YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

Energy Technology Data Exchange (ETDEWEB)

Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: gsaral@cfa.harvard.edu [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

2015-11-01

We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

VLBA Changes Picture of Famous Star-Forming Region

Science.gov (United States)

2007-10-01

Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

Regional medicine use in the Rhine basin and its implication on water quality

Science.gov (United States)

Hut, R. W.; Houtman, C. J.; van de Giesen, N. C.; de Jong, S. A. P.

2012-04-01

Do Germans use more painkillers than the French? Pharmaceuticals used in our Western society form an important group of contaminants found in the river Rhine. As this river is the drinking water source for millions of Europeans, methods to investigate relations between drug use and their penetration in the watercycle are of great importance. An analysis is presented relating medicine residue in the river Rhine to the number of people living in its watershed. An extensive measuring campaign was carried out, sampling river Rhine at 42 locations from its source to the start of its delta (Dutch-German border). The samples were analyzed for 40 common pharmaceuticals. Using discharge data, digital elevation models and demographic data from Eurostat, the relation between total load of drug residue and population was analyzed. Results show regional differences in drug use as well as implications for (down)stream water quality concerning contamination with pharmaceuticals.

The trans-regional implications of the China-Pakistan Economic Corridor and the One Belt and One Road Initiative

Directory of Open Access Journals (Sweden)

Khan Samra Sarfraz

2018-04-01

Full Text Available The paper is an analytical examination of the geo-political implications of the China-Pakistan Economic Corridor and the One Belt and One Road Initiative. The paper examines the probable implications of the two mega projects for the regional, as well as, trans-regional actors. The paper debates on the likelihood for the creation of a new kind of relationship among China, Pakistan and Russia. It is also discussed how the prospects of reduced western influence in the region, in the backdrop of CPEC and the B&R Initiative, may result in the escalation of Russian and Chinese dominance on regional and trans-regional affairs.

Policy implications with regard to controllable forms of natural background radiation

International Nuclear Information System (INIS)

Heijningen, R.J.J. van; Bartels, J.H.M.; Ackers, J.G.; Hogeweg, B.; Rijn, H.T.U. de; Walle, F.B. de

1988-04-01

The RENA (Regulable forms of Natural Background radiation) has started in order to broaden the technical-scientific insights in the domain of the natural background radiation and to continue the SAWORA-study. With regard to the policy implications it has appeared to be desirable to define more detailed the environment-protectional economical and governmental aspects and to consider their mutual relationships in order to prepare a coherent programme which is directed at policy actions to be undertaken as well as at the supporting study needed. (author). 34 refs.; 3 figs.; 11 tabs

Quantum histories and their implications

International Nuclear Information System (INIS)

Kent, A.

2000-01-01

Classical mechanics and standard Copenhagen quantum mechanics respect subspace implications. For example, if a particle is confined in a particular region R of space, then in these theories we can deduce that it is confined in regions containing R. However, subspace implications are generally violated by versions of quantum theory that assign probabilities to histories, such as the consistent histories approach. I define here a new criterion, ordered consistency, which refines the criterion of consistency and has the property that inferences made by ordered consistent sets do not violate subspace relations. This raises the question: do the operators defining our observations form an ordered consistent history? If so, ordered consistency defines a version of quantum theory with greater predictive power than the consistent histories formalism. If not, and our observations are defined by a non-ordered consistent quantum history, then subspace implications are not generally valid. (orig.)

Implications of greenhouse gas emission mitigation scenarios for the main Asian regions

NARCIS (Netherlands)

van Ruijven, B.J.|info:eu-repo/dai/nl/304834521; van Vuuren, D.P.|info:eu-repo/dai/nl/11522016X; van Vliet, J.; Mendoza Beltran, A.; Deetman, S.; den Elzen, M.G.J.

2012-01-01

In order to limit global mean temperature increase, long-term greenhouse gas emissions need to be reduced. This paper discusses the implications of greenhouse gas emission reductions for major Asian regions (China, India, Indonesia, South-East Asia, Japan and Korea) based on results from the IMAGE

Energy requirements of consumption: Urban form, climatic and socio-economic factors, rebounds and their policy implications

International Nuclear Information System (INIS)

Wiedenhofer, Dominik; Lenzen, Manfred; Steinberger, Julia K.

2013-01-01

Household consumption requires energy to be used at all stages of the economic process, thereby directly and indirectly leading to environmental impacts across the entire production chain. The levels, structure and determinants of energy requirements of household consumption therefore constitute an important avenue of research. Incorporating the full upstream requirements into the analysis helps to avoid simplistic conclusions which would actually only imply shifts between consumption categories without taking the economy wide effects into account. This paper presents the investigation of the direct and indirect primary energy requirements of Australian households, contrasting urban, suburban and rural consumption patterns as well as inter- and intra-regional levels of inequality in energy requirements. Furthermore the spatial and socio-economic drivers of energy consumption for different categories of energy requirements are identified and quantified. Conclusions regarding the relationships between energy requirements, household characteristics, urban form and urbanization processes are drawn and the respective policy implications are explored. - Highlights: • We statistically analyze the energy requirements of consumption in Australia. • Contrasting urban/suburban/rural consumption patterns and spatial inequality. • Energy requirements are influenced by urban form, income and demographics. • Urban households require less direct energy, but their total consumption is higher. • Significant rebound effects can be expected when direct energy use is decreased

New far infrared images of bright, nearby, star-forming regions

Science.gov (United States)

Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

1995-01-01

Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

The distribution of warm gas in the G327.3-0.6 star forming region

NARCIS (Netherlands)

Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

Water Supply Deficiency and Implications for Rural Development in the Niger-Delta Region of Nigeria

Science.gov (United States)

Nkwocha, E. E.

2009-01-01

There is a growing concern about the marginalization of the Niger Delta region of Nigeria in terms of infrastructural and social services provision. This study examined the water supply deficiency and its general implications for rural development within the region. Data and other study characteristics were extracted from 501 subjects drawn from…

Transport of Aerosols: Regional and Global Implications for Climate, Weather, and Air Quality

Science.gov (United States)

Chin, Mian; Diehl, Thomas; Yu, Hongbin; Bian, Huisheng; Remer, Lorraine; Kahn, Ralph

2008-01-01

Long-range transport of atmospheric aerosols can have a significant impact on global climate, regional weather, and local air quality. In this study, we use a global model GOCART together with satellite data and ground-based measurements to assess the emission and transport of pollution, dust, biomass burning, and volcanic aerosols and their implications. In particular, we will show the impact of emissions and long-range transport of aerosols from major pollution and dust source regions to (1) the surface air quality, (2) the atmospheric heating rates, and (3) surface radiation change near the source and downwind regions.

The bright lights of city regions - Assumptions, realities and implications of changing population dynamics: Zooming in on the Gauteng city region

CSIR Research Space (South Africa)

Pieterse, A

2014-09-01

Full Text Available It is well known that the city regions attract migrants from across the country because of their roles as economic engines and job baskets in South Africa. To address urbanisation implications it is imperative to better understand some...

The bright lights of city regions: Assumptions, realities and implications of changing population dynamics: Zooming in on the Gauteng city region

CSIR Research Space (South Africa)

Pieterse, A

2014-10-01

Full Text Available It is well known that the city regions attract migrants from across the country because of their roles as economic engines and job baskets in South Africa. To address urbanisation implications it is imperative to better understand some...

The Location of ICT activities in EU regions. Implications for regional policies

Directory of Open Access Journals (Sweden)

Salvador Barrios

2008-11-01

Full Text Available The location of ICT producing industries does matter for global competitivenessand long-run growth potential. For instance, the differing contribution ofICT to economic growth between the US and the EU is often mentioned as one of themain cause explaining the diverging growth performance of these two areas since themid-1990s. In turn, since the mid-1990s, countries with especially dynamic economicgrowth have tended to be highly specialized in ICT-producing and ICT-using industries,see van Ark and Inkaar (2005. More generally, ICT producing sectors, tendto promote technological change and innovative capability which are seen to be at thecore of economic growth and competitiveness. When considering the EU economy,ICT industries appear to be concentrated in a limited number of regions, see Koski etal. (2002 for empirical evidence. Afirst objective of the present paper is to documentthe location of ICT producing industries in European regions in order to map existingEU clusters as well as to analyze recent changes in these industries using recent dataon employment and firm location, especially in relation to the EU enlargement thathas taken place in May 2004. The location of the ICT-producing sectors is not the endof the story however. A crucial aspect concerns the nature of activities that are beingundertaken in different regions. Importantly, ICT industries do have different characteristicsin terms of human capital, skill requirement, and knowledge content. In particular,because of the positive association between human capital, knowledge andlong-run growth, it is important to analyze to what extent EU regional ICT clustersdiffer in according to these characteristics. The second question addressed in the paperconcerns the nature of ICT activities undertaken in EU regions. Finally, the paperprovides econometric estimates of the location of firms in ICT industries across EUregions. The paper considers more specifically the case of multinationals�

Form factors and QCD in spacelike and timelike region

International Nuclear Information System (INIS)

A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

2000-01-01

The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

Form factors and QCD in spacelike and timelike regions

International Nuclear Information System (INIS)

Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

2000-01-01

We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

Energy Technology Data Exchange (ETDEWEB)

Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: edf@astro.psu.edu [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)

2016-12-20

The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

International Nuclear Information System (INIS)

Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.

2016-01-01

The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

TROUBLING TIMES-THE GFC AND ITS IMPLICATIONS FOR REGIONAL PERFORMANCE. PART TWO: AUSTRALIA

OpenAIRE

Robert J. Stimson

2013-01-01

The Global Financial Crisis (GFC) was a profound exogenous shock which has had profound impacts the performance of national economies and the regions within them. The differential outcomes are vast. In many parts of the world there is evidence of what is being referred to as the ‘two-speed’ economy - or even a ‘multi-speed’ - economy. This has implications for regional economic development theory in which, over the last two to three decades, there has been an increasing emphasis on endogenous...

Dynamical evolution of star-forming regions - II. Basic kinematics

Science.gov (United States)

Parker, Richard J.; Wright, Nicholas J.

2016-04-01

We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

Science.gov (United States)

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

2012-01-01

We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.

2012-01-01

We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

Science.gov (United States)

2011-07-15

... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

Science.gov (United States)

2012-11-14

... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

Observations of star-forming regions with the Midcourse Space Experiment

NARCIS (Netherlands)

Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large

Water in low-mass star-forming regions with Herschel

DEFF Research Database (Denmark)

Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.

2010-01-01

"Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...

HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

Science.gov (United States)

2002-01-01

NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

Energy Technology Data Exchange (ETDEWEB)

Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: natsuko.izumi@nao.ac.jp [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)

2017-10-01

The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

Implications of expected climate change in the Mediterranean Region

Energy Technology Data Exchange (ETDEWEB)

Jeftic, L. [United Nations Environment Programme, Athens (Greece). Mediterranean Coordinating Unit

1993-09-01

A Task Team was established in 1987 with the objective of preparing a Mediterranean regional overview of the implications of climate change for coastal, terrestrial and aquatic ecosystems, as well as for socio-economic structures and activities. The paper presents a summary of the results of the first phase (1987-1989) of the work of the Task Team. Assuming a temperature rise of 1.5{degree}C by the year 2025, land degradation would increase, water resources decline, agricultural production would decline, and terrestrial and aquatic ecosystems could be damaged. Impacts of climatic change when combined with the greater impacts of non-climatic factors (e.g. population increases, development plans) would increase the probability of catastrophic events and hasten their occurrence. Case studies on six sites are to be finalised by the end of 1992. Despite the high quality of the Task Team`s study the impact of its work on national authorities and international bodies was below expectation. A specific regional scenario on climate change in the Mediterranean Basin due to global warming was developed following the Task Team`s recommendation. A summary of the approach and results is presented. 25 refs., 2 figs.

GABBR1 has a HERV-W LTR in its regulatory region – a possible implication for schizophrenia

Directory of Open Access Journals (Sweden)

Hegyi Hedi

2013-02-01

Full Text Available Abstract Schizophrenia is a complex disease with uncertain aetiology. We suggest GABBR1, GABA receptor B1 implicated in schizophrenia based on a HERV-W LTR in the regulatory region of GABBR1. Our hypothesis is supported by: (i GABBR1 is in the 6p22 genomic region most often implicated in schizophrenia; (ii microarray studies found that only presynaptic pathway-related genes, including GABA receptors, have altered expression in schizophrenic patients and (iii it explains how HERV-W elements, expressed in schizophrenia, play a role in the disease: by altering the expression of GABBR1 via a long terminal repeat that is also a regulatory element to GABBR1. Reviewers This paper was reviewed by Sandor Pongor and Martijn Huynen.

Competition for petroleum exploration capital in the Asia-Pacific region - implications for New Zealand and Australia

International Nuclear Information System (INIS)

Miller, A.

1995-01-01

This paper examines the future energy production and demand profiles for the Asia Pacific region and the global allocation of exploration capital made by major international petroleum companies. The implications of these factors for future government petroleum exploration policies within the region are considered, in particular the Australian and New Zealand situations, together with likely effects of such measures on the ability of exploration and production companies to raise capital. (Author)

Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

DEFF Research Database (Denmark)

Grunfelder, Julien; Nielsen, Thomas Alexander Sick

2012-01-01

is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

The Structure of the Nearby Giant Star-Forming Region 30 Doradus

Science.gov (United States)

Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

2007-08-01

The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

How do salt withdrawal minibasins form? Insights from forward modelling, and implications for hydrocarbon migration

Science.gov (United States)

Peel, Frank J.

2014-09-01

Existing models for the initiation of salt withdrawal minibasins focus on the role of triggers that exist within the minibasin, either stratigraphic (e.g. differential deposition) or tectonic (extension, translation or contraction). Existing studies tend to focus on complex settings, such as continental margins, which contain many different potential triggering mechanisms. It can be difficult in these settings to identify which process is responsible for minibasin initiation, or the influence of individual factors on their subsequent development. Salt withdrawal minibasins also exist in simpler settings, without any obvious intrinsic trigger; the region of the North German Basin used by Trusheim (1960) in the classic definition of salt withdrawal geometries was of this nature. There is no overall basal or surface slope, no major lateral movement, and there is no depositional heterogeneity. Previously recognized trigger processes for minibasin initiation do not apply in this benign setting, suggesting that other, potentially more fundamental, influences may be at work. A simple forward-modelling approach shows how, in the absence of any other mechanism, a new minibasin can develop as the consequence of salt movement driven by its neighbour, and families of withdrawal minibasins can propagate across a region from a single seed point. This new mechanism may explain how some minibasins appear to initiate before the sediment density has exceeded that of the underlying salt. The forward modelling also indicates that some minibasins begin to invert to form turtle anticlines before the underlying salt has been evacuated, so that the timing of turtle formation may not be diagnostic of weld formation. This mechanism may also give rise to salt-cored turtles that have a lens of salt trapped beneath their cores. These new findings have implications for hydrocarbon migration and trapping.

Stratigraphy of the Descartes region /Apollo 16/ - Implications for the origin of samples

Science.gov (United States)

Head, J. W.

1974-01-01

Analysis of terrain in the Apollo 16 Descartes landing region shows a series of features that form a stratigraphic sequence which dominates the history and petrogenesis at the site. An ancient 150-km diam crater centered on the Apollo 16 site is one of the earliest recognizable major structures. Nectaris ejecta was concentrated in a regional low at the base of the back slope of the Nectaris basin to form the Descartes Mountains. Subsequently, a 60-km diam crater formed in the Descartes Mountains centered about 25 km to the west of the site. This crater dominates the geology and petrogenetic history of the site. Stone and Smoky Mountains represent the degraded terraced crater walls, and the dark matrix breccias and metaclastic rocks derived from North and South Ray craters represent floor fallback breccias from this cratering event. The interpretation is developed that the stratigraphy of the Cayley and Descartes, and thus the historical record of the Apollo 16 region, documents the complex interaction of deposits and morphology of local and regional impact cratering events. Large local 60- to 150-km diam craters have had a dramatic and previously unrecognized effect on the history and petrology of the Apollo 16 site.

H2O masers in star-forming regions

International Nuclear Information System (INIS)

Downes, D.

1985-01-01

Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)

Mesozoic and Cenozoic structural geology of the CP Hills, Nevada Test Site, Nye County, Nevada; and regional implications

Energy Technology Data Exchange (ETDEWEB)

Caskey, S. John [Univ. of Nevada, Reno, NV (United States)

1991-08-01

Detailed mapping and structural analysis of upper Proterozoic and Paleozoic rocks in the CP Hills of the Nevada Test Site, together with analysis of published maps and cross sections and a reconnaissance of regional structural relations indicate that the CP thrust of Barnes and Poole (1968) actually comprises two separate, oppositely verging Mesozoic thrust systems: (1) the west-vergent CP thrust which is well exposed in the CP Hills and at Mine Mountain, and (2) the east-vergent Belted Range thrust located northwest of Yucca Flat. West-vergence of the CP thrust is indicated by large scale west-vergent recumbent folds in both its hangingwall and footwall and by the fact that the CP thrust ramps up section through hangingwall strata toward the northwest. Regional structural relations indicate that the CP thrust forms part of a narrow sigmoidal belt of west-vergent folding and thrusting traceable for over 180 km along strike. The Belted Range thrust represents earlier Mesozoic deformation that was probably related to the Last Chance thrust system in southeastern California, as suggested by earlier workers. A pre-Tertiary reconstruction of the Cordilleran fold and thrust belt in the region between the NTS and the Las Vegas Range bears a close resemblance to other regions of the Cordillera and has important implications for the development of hinterland-vergent deformation as well as for the probable magnitude of Tertiary extension north of Las Vegas Valley. Subsequent to Mesozoic deformation, the CP Hills were disrupted by at least two episodes of Tertiary extensional deformation: (1) an earlier episode represented by pre-middle Miocene low-angle normal faults, and (2) a later, post-11 Ma episode of high-angle normal faulting. Both episodes of extension were related to regional deformation, the latter of which has resulted in the present basin and range topography of the NTS region.

Mesozoic and Cenozoic structural geology of the CP Hills, Nevada Test Site, Nye County, Nevada; and regional implications

International Nuclear Information System (INIS)

Caskey, S.J.

1991-08-01

Detailed mapping and structural analysis of upper Proterozoic and Paleozoic rocks in the CP Hills of the Nevada Test Site, together with analysis of published maps and cross sections and a reconnaissance of regional structural relations indicate that the CP thrust of Barnes and Poole (1968) actually comprises two separate, oppositely verging Mesozoic thrust systems: (1) the west-vergent CP thrust which is well exposed in the CP Hills and at Mine Mountain, and (2) the east-vergent Belted Range thrust located northwest of Yucca Flat. West-vergence of the CP thrust is indicated by large scale west-vergent recumbent folds in both its hangingwall and footwall and by the fact that the CP thrust ramps up section through hangingwall strata toward the northwest. Regional structural relations indicate that the CP thrust forms part of a narrow sigmoidal belt of west-vergent folding and thrusting traceable for over 180 km along strike. The Belted Range thrust represents earlier Mesozoic deformation that was probably related to the Last Chance thrust system in southeastern California, as suggested by earlier workers. A pre-Tertiary reconstruction of the Cordilleran fold and thrust belt in the region between the NTS and the Las Vegas Range bears a close resemblance to other regions of the Cordillera and has important implications for the development of hinterland-vergent deformation as well as for the probable magnitude of Tertiary extension north of Las Vegas Valley. Subsequent to Mesozoic deformation, the CP Hills were disrupted by at least two episodes of Tertiary extensional deformation: (1) an earlier episode represented by pre-middle Miocene low-angle normal faults, and (2) a later, post-11 Ma episode of high-angle normal faulting. Both episodes of extension were related to regional deformation, the latter of which has resulted in the present basin and range topography of the NTS region

Water in Star-forming Regions with Herschel (WISH): recent results and trends

Science.gov (United States)

van Dishoeck, E. F.

2012-03-01

Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at http://www.strw.leidenuniv.nl/WISH, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.

2010-01-01

We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

Problems of regional innovation strategy forming

Directory of Open Access Journals (Sweden)

I. M. Golova

2010-09-01

Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

DEFF Research Database (Denmark)

O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine

2013-01-01

of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...

Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenic forms of Burkitt lymphoma

Energy Technology Data Exchange (ETDEWEB)

Neri, A.; Barriga, F.; Knowles, D.M.; Magrath, I.T.; Dalla-Favera, R.

1988-04-01

The authors show that endemic (eBL), sporadic (sBL), and acquired immunodeficiency syndrome-associated (AIDS-BL) forms of Burkitt lymphoma (BL) carrying t(8; 14) chromosomal translocations display different breakpoints within the immunoglobulin heavy-chain locus (IGH) on chromosome 14. In sBL (7 out of 11) and AIDS-BL (5 out of 6), the breakpoints occurred within or near the IGH ..mu.. switch (S/sub mu/) region on chromosome 14 and within the c-myc locus (MYC) on chromosome 8. In most eBL (13 out of 16) the breakpoints were mapped within or 5' to the IGH joining J/sub H/ region on chromosome 14 and outside the MYC locus on chromosome 8. Cloning and sequencing of the (8; 14) chromosomal junctions from two eBL cell lines and one eBL biopsy sample show that the recombination do not involve IGH-specific recombination signals on chromosome 14 or homologous sequences on chromosome 8, suggesting that these events are not likely to be mediated by the same mechanisms or enzymes as in IGH rearrangements. In general, these data have implications for the timing of occurrence of chromosomal translocations during B-cell differentiation in different BL types.

Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

The comparison of physical properties derived from gas and dust in a massive star-forming region

Energy Technology Data Exchange (ETDEWEB)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

2014-05-10

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

The comparison of physical properties derived from gas and dust in a massive star-forming region

International Nuclear Information System (INIS)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

2014-01-01

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

Challenges from variation across regions in cost effectiveness analysis in multi-regional clinical trials

Directory of Open Access Journals (Sweden)

Yunbo Chu

2016-10-01

Full Text Available Economic evaluation in the form of cost-effectiveness analysis has become a popular means to inform decisions in healthcare. With multi-regional clinical trials in a global development program becoming a new venue for drug efficacy testing in recent decades, questions in methods for cost-effectiveness analysis in the multi-regional clinical trials setting also emerge. This paper addresses some challenges from variation across regions in cost effectiveness analysis in multi-regional clinical trials. Several discussion points are raised for further attention and a multi-regional clinical trial example is presented to illustrate the implications in industrial application. A general message is delivered to call for a depth discussion by all stakeholders to reach an agreement on a good practice in cost-effectiveness analysis in the multi-regional clinical trials. Meanwhile, we recommend an additional consideration of cost-effectiveness analysis results based on the clinical evidence from a certain homogeneous population as sensitivity or scenario analysis upon data availability.

Shear viscosity of glass-forming melts in the liquid-glass transition region

International Nuclear Information System (INIS)

Sanditov, D. S.

2010-01-01

A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

The clean development mechanism (CDM) an international perspective and implications for the LAC region

International Nuclear Information System (INIS)

2004-08-01

This paper addresses activity a) an analysis of international CDM experiences and its potential contribution to the LAC region. The paper begins with a section describing the basic principles of the CDM and retrieves the lessons learned from the first two years of the CDM operation. This is followed by a more detailed review in section 2 of the on-going baseline and monitoring methodology approval process. In section 3, the development value of the CDM is explored. Section 4 describes the current CDM markets, while section 5 reviews the response of host countries to the CDM outside the LAC region. Section 6 describes the various capacity building programs established by Annex 1 countries to support the CDM. In each of the first 6 sections, implications for the LAC region are identified. Section 7 brings these conclusions together into a concise summary. (The author)

Implications of the New Regional Trade Agreements for the World Trading System

Directory of Open Access Journals (Sweden)

Agnes Ghibuțiu

2017-04-01

Full Text Available The year 2013 witnessed an outstanding rise in the pace and scale of negotiations on regional trade agreements (RTAs. While RTAs are not a new phenomenon, current negotiations involve multiple parties and/or major trading countries that have a significant combined economic weight, i.e. mega-RTAs. This paper looks at the recent surge in trade regionalism and addresses some of the key issues related to the potential impact of mega-RTAs upon the world trading system and global trade patterns. It examines the peculiarities of the new mega-RTAs and the factors underlying their proliferation, and discusses the main concerns raised by their foreseeable impact on excluded countries and the wider trading system. The paper finds that, if successfully concluded, mega-RTAs are likely to have far-reaching implications for the world trading regime, affecting its transparency and coherence. Nevertheless, the adverse effects could be cushioned through a revival of trading nations’ interest in the multilateral Doha Round talks.

Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

Directory of Open Access Journals (Sweden)

Jahanbakhsh Pairanj

2011-09-01

Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region?

Science.gov (United States)

Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac

2018-01-01

To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

Science.gov (United States)

Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

2016-04-01

The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

Troubling Times-The GFC and its Implications for Regional Performance. Part One: The United States And Europe

OpenAIRE

Robert J. Stimson

2012-01-01

The Global Financial Crisis (GFC) was a profound exogenous shock which has had profound impacts the performance of national economies and the regions within them. The differential outcomes are vast. In many parts of the world there is evidence of what is being referred to as the ‘two-speed’ economy - or even a ‘multi-speed’ - economy. This has implications for regional economic development theory in which, over the last two to three decades, there has been an increasing emphasis on endogenous...

77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

Science.gov (United States)

2012-08-08

... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions

OpenAIRE

Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

2012-01-01

We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

Science.gov (United States)

2013-04-02

... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

MANAGEMENT OF THE INTERNAL LABOR MARKET (BASING ON CASES OF THE SVERDLOVSK REGION CITY-FORMING ENTERPRISES

Directory of Open Access Journals (Sweden)

S.V. Orekhova

2008-12-01

Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.

Molecular line study of massive star-forming regions from the Red MSX Source survey

Science.gov (United States)

Yu, Naiping; Wang, Jun-Jie

2014-05-01

In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

Holocene sediment distribution on the inner continental shelf of northeastern South Carolina: implications for the regional sediment budget and long-term shoreline response

Science.gov (United States)

Denny, Jane F.; Schwab, William C.; Baldwin, Wayne E.; Barnhardt, Walter A.; Gayes, Paul T.; Morton, R.A.; Warner, John C.; Driscoll, Neal W.; Voulgaris, George

2013-01-01

High-resolution geophysical and sediment sampling surveys were conducted offshore of the Grand Strand, South Carolina to define the shallow geologic framework of the inner shelf. Results are used to identify and map Holocene sediment deposits, infer sediment transport pathways, and discuss implications for the regional coastal sediment budget. The thickest deposits of Holocene sediment observed on the inner shelf form shoal complexes composed of moderately sorted fine sand, which are primarily located offshore of modern tidal inlets. These shoal deposits contain ~67 M m3 of sediment, approximately 96% of Holocene sediment stored on the inner shelf. Due to the lack of any significant modern fluvial input of sand to the region, the Holocene deposits are likely derived from reworking of relict Pleistocene and older inner-shelf deposits during the Holocene marine transgression. The Holocene sediments are concentrated in the southern part of the study area, due to a combination of ancestral drainage patterns, a regional shift in sediment supply from the northeast to the southwest in the late Pleistocene, and proximity to modern inlet systems. Where sediment is limited, only small, low relief ridges have formed and Pleistocene and older deposits are exposed on the seafloor. The low-relief ridges are likely the result of a thin, mobile veneer of sediment being transported across an irregular, erosional surface formed during the last transgression. Sediment textural trends and seafloor morphology indicate a long-term net transport of sediment to the southwest. This is supported by oceanographic studies that suggest the long-term sediment transport direction is controlled by the frequency and intensity of storms that pass through the region, where low pressure systems yield net along-shore flow to the southwest and a weak onshore component. Current sediment budget estimates for the Grand Strand yield a deficit for the region. Volume calculations of Holocene deposits on the

Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

Science.gov (United States)

Povich, Matthew Samuel; Binder, Breanna Arlene

2018-01-01

We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

Forming Spirals From Shadows

Science.gov (United States)

Kohler, Susanna

2016-07-01

What causes the large-scale spiral structures found in some protoplanetary disks? Most models assume theyre created by newly-forming planets, but a new study suggests that planets might have nothing to do with it.Perturbations from Planets?In some transition disks protoplanetary disks with gaps in their inner regions weve directly imaged large-scale spiral arms. Many theories currently attribute the formation of these structures to young planets: either the direct perturbations of a planet embedded in the disk cause the spirals, or theyre indirectly caused by the orbit of a planetary body outside of the arms.Another example of spiral arms detected in a protoplanetary disk, MWC 758. [NASA/ESA/ESO/M. Benisty et al.]But what if you could get spirals without any planets? A team of scientists led by Matas Montesinos (University of Chile) have recently published a study in which they examine what happens to a shadowed protoplanetary disk.Casting Shadows with WarpsIn the teams setup, they envision a protoplanetary disk that is warped: the inner region is slightly tilted relative to the outer region. As the central star casts light out over its protoplanetary disk, this disk warping would cause some regions of the disk to be shaded in a way that isnt axially symmetric with potentially interesting implications.Montesinos and collaborators ran 2D hydrodynamics simulations to determine what happens to the motion of particles within the disk when they pass in and out of the shadowed regions. Since the shadowed regions are significantly colder than the illuminated disk, the pressure in these regions is much lower. Particles are therefore accelerated and decelerated as they pass through these regions, and the lack of axial symmetry causes spiral density waves to form in the disk as a result.Initial profile for the stellar heating rate per unit area for one of the authors simulations. The regions shadowed as a result of the disk warp subtend 0.5 radians each (shown on the left

Functional modulation of cardiac form through regionally confined cell shape changes.

Directory of Open Access Journals (Sweden)

Heidi J Auman

2007-03-01

Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

Economic efficiency and cost implications of habitat conservation: An example in the context of the Edwards Aquifer region

Science.gov (United States)

Gillig, Dhazn; McCarl, Bruce A.; Jones, Lonnie L.; Boadu, Frederick

2004-04-01

Groundwater management in the Edwards Aquifer in Texas is in the process of moving away from a traditional right of capture economic regime toward a more environmentally sensitive scheme designed to preserve endangered species habitats. This study explores economic and environmental implications of proposed groundwater management and water development strategies under a proposed regional Habitat Conservation Plan. Results show that enhancing the habitat by augmenting water flow costs $109-1427 per acre-foot and that regional water development would be accelerated by the more extreme possibilities under the Habitat Conservation Plan. The findings also indicate that a water market would improve regional welfare and lower water development but worsen environmental attributes.

THE SCHMIDT-KENNICUTT LAW OF MATCHED-AGE STAR-FORMING REGIONS; Paα OBSERVATIONS OF THE EARLY-PHASE INTERACTING GALAXY TAFFY I

International Nuclear Information System (INIS)

Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.

2012-01-01

In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

Topology of genetic associations between regional gray matter volume and intellectual ability: Evidence for a high capacity network.

Science.gov (United States)

Bohlken, Marc M; Brouwer, Rachel M; Mandl, René C W; Hedman, Anna M; van den Heuvel, Martijn P; van Haren, Neeltje E M; Kahn, René S; Hulshoff Pol, Hilleke E

2016-01-01

Intelligence is associated with a network of distributed gray matter areas including the frontal and parietal higher association cortices and primary processing areas of the temporal and occipital lobes. Efficient information transfer between gray matter regions implicated in intelligence is thought to be critical for this trait to emerge. Genetic factors implicated in intelligence and gray matter may promote a high capacity for information transfer. Whether these genetic factors act globally or on local gray matter areas separately is not known. Brain maps of phenotypic and genetic associations between gray matter volume and intelligence were made using structural equation modeling of 3T MRI T1-weighted scans acquired in 167 adult twins of the newly acquired U-TWIN cohort. Subsequently, structural connectivity analyses (DTI) were performed to test the hypothesis that gray matter regions associated with intellectual ability form a densely connected core. Gray matter regions associated with intellectual ability were situated in the right prefrontal, bilateral temporal, bilateral parietal, right occipital and subcortical regions. Regions implicated in intelligence had high structural connectivity density compared to 10,000 reference networks (p=0.031). The genetic association with intelligence was for 39% explained by a genetic source unique to these regions (independent of total brain volume), this source specifically implicated the right supramarginal gyrus. Using a twin design, we show that intelligence is genetically represented in a spatially distributed and densely connected network of gray matter regions providing a high capacity infrastructure. Although genes for intelligence have overlap with those for total brain volume, we present evidence that there are genes for intelligence that act specifically on the subset of brain areas that form an efficient brain network. Copyright © 2015 Elsevier Inc. All rights reserved.

Implications of greenhouse gas emission mitigation scenarios for the main Asian regions

International Nuclear Information System (INIS)

Ruijven, Bas J. van; Vuuren, Detlef P. van; Vliet, Jasper van; Mendoza Beltran, Angelica; Deetman, Sebastiaan; Elzen, Michel G.J. den

2012-01-01

In order to limit global mean temperature increase, long-term greenhouse gas emissions need to be reduced. This paper discusses the implications of greenhouse gas emission reductions for major Asian regions (China, India, Indonesia, South-East Asia, Japan and Korea) based on results from the IMAGE modelling framework. Energy use in regions and economic sectors is affected differently by ambitious climate policies. We find that the potential for emission reduction varies widely between regions. With respect to technology choices in the power sector, we find major application of CO 2 storage in Indonesia and India, whereas Korea and India apply more solar and wind. Projections for Japan include a (debatable) large share of nuclear power. China and, India, and South-East Asia, show a diverse technology choice in the power sector. For the industry sector, we find that the recent rapid growth in China limits the potential for emission reduction in the next decades, assuming that recently built coal-based industry facilities are in use for the next decades. For the residential sector, the model results show that fewer households switch from traditional fuels to modern fuels in GHG mitigation scenarios. With respect to co-benefits, we find lower imports of fossil energy in mitigation scenarios and a clear reduction of air pollutant emissions. - Highlights: ► The potential for emission reduction varies widely between regions. ► Some regions have attractive CO 2 storage capacity; others have low-cost solar/wind potential. ► The recent rapid growth of Chinese industry may limit emission reduction potential for decades. ► Fewer households switch from traditional fuels to modern fuels in mitigation scenarios. ► Mitigation scenarios show less fossil energy import and reduction of air pollutant emission.

Complex organic molecules toward low-mass and high-mass star forming regions

Science.gov (United States)

Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.

2016-12-01

One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

OpenAIRE

Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

2014-01-01

We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

Water in massive star-forming regions with Herschel Space Observatory

Science.gov (United States)

Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.

2011-05-01

High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

International Nuclear Information System (INIS)

Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.

1989-01-01

The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

Regional Competitiveness and Its Implications for Development

OpenAIRE

Daryono Soebagyo; Triyono Triyono; Yuli Tri Cahyono

2015-01-01

This study was conducted to identify regional competitiveness in some areas of Central Java. Regional competitiveness became one of the issues in regional development policy since the enactment of local autonomy.Measurement of regional competitiveness has been mostly done through ranking as a benchmark the competitiveness of the region. Mapping regional competitiveness in Indonesia has been made to all counties and cities, which shows the competitiveness ranking of each region. Competitivenes...

COMPETITION AS A FORM OF ORGANIZING CULTURAL ACTIVITIES OF THE KRASNOYARSK REGION POPULATION IN THE 1960-1980S

Directory of Open Access Journals (Sweden)

Ekaterina Ivanovna Lobyneva

2014-08-01

Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

Building form and environmental performance: archetypes, analysis and an arid climate

Energy Technology Data Exchange (ETDEWEB)

Ratti, C.; Raydan, D.; Steemers, K. [Department of Architecture, The Martin Centre for Architectural and Urban Studies, University of Cambridge, Cambridge (United Kingdom)

2002-07-01

Leslie Martin and others at Cambridge University addressed the question 'What building forms make the best use of land?' in a number of influential papers published in the late 1960s. They selected six simplified urban arrays based on archetypal building forms. Then they analysed and compared the archetypes in terms of built potential and day lighting criteria, eventually reaching the conclusion that courtyards perform best. Their results, which inspired a generation of designers, are briefly reviewed here and reassessed in environmental terms using innovative computer analysis techniques. Furthermore, the implications of their question, which to date has not addressed the link with climate, are explored using a case study in a hot-arid region. (author)

Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace

OpenAIRE

Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte

2006-01-01

This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

Energy Technology Data Exchange (ETDEWEB)

Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)

2013-09-20

We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

Directory of Open Access Journals (Sweden)

Tatyana O. Boiko

2012-03-01

Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

«Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

Directory of Open Access Journals (Sweden)

Anishenko Anatoly

2012-01-01

Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

Preferential Pathway for Glycine Formation in Star-Forming Regions

Science.gov (United States)

Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

Regional to global changes in drought and implications for future changes under global warming

Science.gov (United States)

Sheffield, J.; Wood, E. F.; Kam, J.

2012-12-01

Drought can have large impacts on multiple sectors, including agriculture, water resources, ecosystems, transport, industry and tourism. In extreme cases, regional drought can lead to food insecurity and famine, and in intensive agricultural regions, extend to global economic impacts in a connected world. Recent droughts globally have been severe and costly but whether they are becoming more frequent and severe, and the attribution of this, is a key question. Observational evidence at large scales, such as satellite remote sensing are often subject to short-term records and inhomogeneities, and ground based data are sparse in many regions. Reliance on model output is also subject to error and simplifications in the model physics that can, for example, amplify the impact of global warming on drought. This presentation will show the observational and model evidence for changes in drought, with a focus on the interplay between precipitation and atmospheric evaporative demand and its impact on the terrestrial water cycle and drought. We discuss the fidelity of climate models to reproduce our best estimates of drought variability and its drivers historically, and the implications of this on uncertainties in future projections of drought from CMIP5 models, and how this has changed since CMIP3.

The unexpectedly large proportion of high-mass star-forming cores in a Galactic mini-starburst

Science.gov (United States)

Motte, F.; Nony, T.; Louvet, F.; Marsh, K. A.; Bontemps, S.; Whitworth, A. P.; Men'shchikov, A.; Nguyáën Luong, Q.; Csengeri, T.; Maury, A. J.; Gusdorf, A.; Chapillon, E.; Könyves, V.; Schilke, P.; Duarte-Cabral, A.; Didelon, P.; Gaudel, M.

2018-04-01

Understanding the processes that determine the stellar initial mass function (IMF) is a critical unsolved problem, with profound implications for many areas of astrophysics1. In molecular clouds, stars are formed in cores—gas condensations sufficiently dense that gravitational collapse converts a large fraction of their mass into a star or small clutch of stars. In nearby star-formation regions, the core mass function (CMF) is strikingly similar to the IMF, suggesting that the shape of the IMF may simply be inherited from the CMF2-5. Here, we present 1.3 mm observations, obtained with the Atacama Large Millimeter/submillimeter Array telescope, of the active star-formation region W43-MM1, which may be more representative of the Galactic-arm regions where most stars form6,7. The unprecedented resolution of these observations reveals a statistically robust CMF at high masses, with a slope that is markedly shallower than the IMF. This seriously challenges our understanding of the origin of the IMF.

The unexpectedly large proportion of high-mass star-forming cores in a Galactic mini-starburst

Science.gov (United States)

Motte, F.; Nony, T.; Louvet, F.; Marsh, K. A.; Bontemps, S.; Whitworth, A. P.; Men'shchikov, A.; Nguyen Luong, Q.; Csengeri, T.; Maury, A. J.; Gusdorf, A.; Chapillon, E.; Könyves, V.; Schilke, P.; Duarte-Cabral, A.; Didelon, P.; Gaudel, M.

2018-06-01

Understanding the processes that determine the stellar initial mass function (IMF) is a critical unsolved problem, with profound implications for many areas of astrophysics1. In molecular clouds, stars are formed in cores—gas condensations sufficiently dense that gravitational collapse converts a large fraction of their mass into a star or small clutch of stars. In nearby star-formation regions, the core mass function (CMF) is strikingly similar to the IMF, suggesting that the shape of the IMF may simply be inherited from the CMF2-5. Here, we present 1.3 mm observations, obtained with the Atacama Large Millimeter/submillimeter Array telescope, of the active star-formation region W43-MM1, which may be more representative of the Galactic-arm regions where most stars form6,7. The unprecedented resolution of these observations reveals a statistically robust CMF at high masses, with a slope that is markedly shallower than the IMF. This seriously challenges our understanding of the origin of the IMF.

Dispersion-theoretical analysis of the nucleon electromagnetic form factors

Energy Technology Data Exchange (ETDEWEB)

Belushkin, M.

2007-09-29

The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the {pi}{pi}, K anti K and the {rho}{pi} continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

Dispersion-theoretical analysis of the nucleon electromagnetic form factors

International Nuclear Information System (INIS)

Belushkin, M.

2007-01-01

The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the ππ, K anti K and the ρπ continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

Distributional pattern of benthic foraminiferal morpho-groups in the shelf region off Mangalore: Environmental implications

Digital Repository Service at National Institute of Oceanography (India)

Khare, N.; Sinha, R.; Rai, A.K.; Nigam, R.

, the population was further placed into two broad morpho-groups namely, angular-asymmetrical and rounded-symmetrical. The surficial distribution of these groups revealed that angular-asymmetrical forms are abundant in relatively deeper region whereas rounded...

CHEMICAL SEGREGATION TOWARD MASSIVE HOT CORES: THE AFGL2591 STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail: ijimenez-serra@cfa.harvard.edu, E-mail: qzhang@cfa.harvard.edu, E-mail: sv@star.ucl.ac.uk, E-mail: jmartin@cab.inta-csic.es, E-mail: wdewit@eso.org [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)

2012-07-01

We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

International Nuclear Information System (INIS)

De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

2000-01-01

Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

International Nuclear Information System (INIS)

Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.

1990-01-01

New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs

X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

Energy Technology Data Exchange (ETDEWEB)

Montes, V. A.; Hofner, P.; Anderson, C.; Rosero, V. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States)

2015-08-15

We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-ray sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.

Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

Science.gov (United States)

Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

2017-09-01

Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

Symbolic Form in the Pedagogical Implications of Sociolinguistics

Science.gov (United States)

Tolic, Mirela

2011-01-01

The author with the help of analysis of symbolic forms and sociolinguistics explains the transformation of "homo communicans in conscious homo symbolicum." He points out the importance of etymological analysis Cassierer's philosophy of symbolic forms and its effects in the modern understanding of sociolinguistics. It is necessary their…

Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

International Nuclear Information System (INIS)

Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping

2017-01-01

We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

Geodynamic models assist in determining the South Loyalty Basin's slab location and its implications for regional topography

Science.gov (United States)

Clark, Stuart R.

2010-05-01

In the Western Pacific, two competing kinematic reconstructions exist: one with wholly westward subduction of the Pacific plate at what is now the Tonga-Kermadec trench and one combining a degree of eastward subduction under what has been termed the New Caledonia trench. New seismological observations indicate that eastward subduction could explain the existence of a fast anomaly, the hyothesised South Loyalty Basin slab, below the 660km transition zone distinct from the fast anomaly aligned with the Tonga-Kermadec slab. A plate reconstruction dated from the suggested initiation of New Caledonia subduction in the Eocene has been developed. This reconstruction is then used to predict the thermal history of the region and together provide kinematic and thermal boundary conditions for a regional mantle convection model. The model-predicted location of the South Loyalty Basin slab's location will be presented along with the location's dependence on the mantle rheological parameters and the hotspot reference frame. The implications for the topography of the region will also be discussed.

Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

DEFF Research Database (Denmark)

Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne

2015-01-01

displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

International Nuclear Information System (INIS)

Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.

2009-05-01

In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

International Nuclear Information System (INIS)

Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.

1990-01-01

The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

Biophysical characterization of the olfactomedin domain of myocilin, an extracellular matrix protein implicated in inherited forms of glaucoma.

Directory of Open Access Journals (Sweden)

Susan D Orwig

Full Text Available Myocilin is an eye protein found in the trabecular extracellular matrix (TEM, within the anatomic region that controls fluid flow. Variants of myocilin, localized to its olfactomedin (OLF domain, have been linked to inherited forms of glaucoma, a disease associated with elevated intraocular pressure. OLF domains have also been implicated in psychiatric diseases and cancers by their involvement in signaling, neuronal growth, and development. However, molecular characterization of OLFs has been hampered by challenges in recombinant expression, a hurdle we have recently overcome for the myocilin OLF domain (myoc-OLF. Here, we report the first detailed solution biophysical characterization of myoc-OLF to gain insight into its structure and function. Myoc-OLF is stable in the presence of glycosaminoglycans, as well as in a wide pH range in buffers with functional groups reminiscent of such glycosaminoglycans. Circular dichroism (CD reveals significant β-sheet and β-turn secondary structure. Unexpectedly, the CD signature is reminiscent of α-chymotrypsin as well as another ocular protein family, the βγ-crystallins. At neutral pH, intrinsic tryptophan fluorescence and CD melts indicate a highly cooperative transition with a melting temperature of ∼55 °C. Limited proteolysis combined with mass spectrometry reveals that the compact core structural domain of OLF consists of approximately residues 238-461, which retains the single disulfide bond and is as stable as the full myoc-OLF construct. The data presented here inform new testable hypotheses for interactions with specific TEM components, and will assist in design of therapeutic agents for myocilin glaucoma.

Herschel/HIFI observations of high-J CO lines in the NGC 1333 low-mass star-forming region

DEFF Research Database (Denmark)

Yildiz, U. A.; van Dishoeck, E. F.; Kristensen, L. E.

2010-01-01

Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally-resolved......Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally....... Their intensities require a jump in the CO abundance at an evaporation temperature around 25 K, thus providing new direct evidence for a CO ice evaporation zone around low-mass protostars. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia...... and with important participation from NASA.Appendices and acknowledgements (pages 5 to 7) are only available in electronic form at http://www.aanda.org...

Long-term Variability of H2CO Masers in Star-forming Regions

Science.gov (United States)

Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

2017-10-01

We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

Science.gov (United States)

Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

2011-01-01

The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

Economic growth, regional disparities and energy demand in China

International Nuclear Information System (INIS)

Sheng, Yu; Shi, Xunpeng; Zhang, Dandan

2014-01-01

Using the panel data of 27 provinces between 1978 and 2008, we employed a instrumental regression technique to examine the relationship between economic growth, energy demand/production and the related policies in China. The empirical results show that forming a cross-province integrated energy market will in general reduce the response of equilibrium user costs of energy products to their local demand and production, through cross-regional energy transfer (including both energy trade and cross-regional reallocation). In particular, reducing transportation costs and improving marketization level are identified as two important policy instruments to enhance the role of energy market integration. The findings support the argument for a more competitive cross-province energy transfer policies and calls for more developed energy connectivity and associate institutional arrangements within China. These policy implications may also be extended to the East Asia Summit region where energy market integration is being actively promoted. - Highlights: • Development driving energy demand has different impacts on energy prices than others. • EMI will reduce the response of equilibrium energy prices to local demand and production. • Reducing transportation costs and improving marketization level enhance the role of EMI. • More market competition and better physical and institutional connectivity are better. • Policy implications to China may be extended to the East Asia Summit region

Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

Energy Technology Data Exchange (ETDEWEB)

Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: juarez@ice.cat [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)

2017-07-20

We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

The financial and accounting implications of the privatization of the regional electricity companies in the UK

International Nuclear Information System (INIS)

Thomson, L.

1993-01-01

This paper reviews some of the financial and accounting implications of the privatization of the electricity distribution and supply sector in England and Wales, specifically the transformation of the Electricity Area Boards into the 12 Regional Electricity Companies (RECs). It considers the factors influencing the setting of post-privatization price control factors; the capital restructuring of the RECs; the valuation placed by the Secretary of State for Energy on each company at flotation, and market reaction to this as shown in subsequent changes in share price; and changes in the information provided in the RECs' accounts over the privatization period. (Author)

Unraveling the nexus between water and food security in Latin America and the Caribbean: regional and global implications

Science.gov (United States)

Willaarts, Barbara; Garrido, Alberto; Soriano, Barbara; De Stefano, Lucia; López Gunn, Elena; Aldaya, Maite; Martínez-Santos, Pedro; Llamas, Ramon

2014-05-01

Latin American and the Caribbean (LAC) is a water and land abundant region, and plays a key role in meeting global food and water security. During the last decade, LAC has experience a rapid socio-economic growth, largely sustained by its competitive advantage in the production and exports of agricultural and mining products and by the high commodity prices in the global market. This study seeks to quantify the contribution of LAC's agriculture to global food and water security, i.e. virtual water trade, and evaluate the environmental and societal implications for regional development. Results show that between 2000 and 2011, LAC has increase its agricultural production 27%, and it now accounts for nearly 18% of the global agricultural market. As a result, the agricultural water footprint (WF) of LAC was augmented 65%; and yet, nearly 19% to 44% of the actual agricultural WF - depending on the countries - is virtual water exported to third countries. In fact, almost 50% of the increase in global virtual water trade during the last decade, corresponds to LAC. Such global contribution has significant implications for regional water and food security. From an environmental perspective, crop expansion (mostly rain-fed) resulted in the deforestation of nearly 1 million km2, turning this region into the second most important deforestation hotspots worldwide. This land clearing is having large impacts of ecosystem services, e.g. carbon sequestration, water quality or biodiversity conservation. From a socio-economic perspective, increasing agricultural production has improved regional food security indicators, although one every seven children is still stunted in LAC and nearly 10% of the population remains undernourished. Dietary shifts and socio-cultural factors also lag behind the growing problem of malnutrition in the region, i.e. overweight and obesity. Improvements of water access and sanitation, have had a positive impact on food security indicators, especially

Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

International Nuclear Information System (INIS)

Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan

2009-01-01

According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

Emissions reduction and economic implications of renewable energy market penetration of power generation for residential consumption in the MENA region

International Nuclear Information System (INIS)

El Fadel, M.; Rachid, G.; El-Samra, R.; Bou Boutros, G.; Hashisho, J.

2013-01-01

This paper examines the implications of renewable energy (RE) deployment in power generation for residential consumption in the Middle East and North Africa (MENA) region under various RE penetration targets. A comparative assessment revealed a great heterogeneity among countries with Turkey dominating as the highest emitter. At the sub-regional level, the Middle East sub-region contributes more than double the GHG emissions estimated for the Gulf and North Africa sub-regions with all sub-regions achieving reductions in the range of 6–38% depending on the RE target penetration and promising up to 54% savings on investment excluding positive externalities associated with the offset of greenhouse gas (GHG) emissions savings. - Highlights: ► Heterogeneity in GHG emissions in MENA region with Turkey contributing the most. ► Average regional GHG tCO 2 e/capita of 0.42 decreases to 0.17 with RE penetration. ► GHG emissions regional reduction reaches 8–36% depending on RE target penetration. ► Return on investment in RE promises up to 54% savings excluding positive externalities. ► Carbon credits offer economic incentives rendering RE investment more attractive.

The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

Directory of Open Access Journals (Sweden)

Oleynik Olga Stepanovna

2014-12-01

Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

NATO advanced research workshop on implications of climate change and disasters on military activities: building resiliency and mitigating vulnerability in the Balkan Region

CERN Document Server

Veeravalli, Swathi

2017-01-01

This volume provides preliminary recommendations on ways to educate and develop experience-based expertise among disaster response, security and other professionals from diverse backgrounds, whose current and future interests relate to crisis management. The book takes a multidisciplinary approach to improving regional security cooperation and to addressing the complex issues of climate change and disasters on military activities. The main aims of this proceedings volume are: -to provide an Education and Individual Training Activity Common Core Curriculum, whose main purpose is to support increased awareness of the implications of Climate Change; -to identify broad issues on climate change and disasters, particularly those with the highest importance and relevance to regional security. The Crisis Management and Disaster Response Centre of Excellence (CMDR COE) conducted an Advanced Research Workshop “Climate Change Implications on Military Activities in the Balkans Region” between 05-07 July, 2016. The ev...

New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

Science.gov (United States)

van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

2018-02-01

Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

Regional variability among nonlinear chlorophyll-phosphorus relationships in lakes

Science.gov (United States)

Filstrup, Christopher T.; Wagner, Tyler; Soranno, Patricia A.; Stanley, Emily H.; Stow, Craig A.; Webster, Katherine E.; Downing, John A.

2014-01-01

The relationship between chlorophyll a (Chl a) and total phosphorus (TP) is a fundamental relationship in lakes that reflects multiple aspects of ecosystem function and is also used in the regulation and management of inland waters. The exact form of this relationship has substantial implications on its meaning and its use. We assembled a spatially extensive data set to examine whether nonlinear models are a better fit for Chl a—TP relationships than traditional log-linear models, whether there were regional differences in the form of the relationships, and, if so, which regional factors were related to these differences. We analyzed a data set from 2105 temperate lakes across 35 ecoregions by fitting and comparing two different nonlinear models and one log-linear model. The two nonlinear models fit the data better than the log-linear model. In addition, the parameters for the best-fitting model varied among regions: the maximum and lower Chl aasymptotes were positively and negatively related to percent regional pasture land use, respectively, and the rate at which chlorophyll increased with TP was negatively related to percent regional wetland cover. Lakes in regions with more pasture fields had higher maximum chlorophyll concentrations at high TP concentrations but lower minimum chlorophyll concentrations at low TP concentrations. Lakes in regions with less wetland cover showed a steeper Chl a—TP relationship than wetland-rich regions. Interpretation of Chl a—TP relationships depends on regional differences, and theory and management based on a monolithic relationship may be inaccurate.

Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function

Science.gov (United States)

Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.

1990-01-01

Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

HIGH-VELOCITY LINE FORMING REGIONS IN THE TYPE Ia SUPERNOVA 2009ig

International Nuclear Information System (INIS)

Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng

2013-01-01

We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

Implications of a classification of forms of cooperative purchasing

NARCIS (Netherlands)

Schotanus, Fredo; Telgen, Jan; Wynstra, J.Y.F.; Dittrich, K.; Jaspers, F.P.H.

2005-01-01

Our main objective is to classify different forms of cooperative purchasing, i.e. purchasing groups. Based on a literature review, empirical findings, and new institutional economics we employ a classification: the highway matrix. In this matrix we distinguish five forms of cooperative purchasing

Becoming a bwana and burley tobacco in the Central Region of Malawi

DEFF Research Database (Denmark)

Prowse, Martin

2009-01-01

Smallholders now grow most of Malawi’s main export crop – burley tobacco. Based on nineteen months’ fieldwork in the Central Region, this article offers a sociological interpretation of why some smallholder growers spend a proportion of burley income on conspicuous consumption in rural towns...... and trading centres. This practice can be seen as a form of inculcated behaviour whereby smallholders reproduce elements of one model of success in this region: that of the Malawian tobacco bwana (boss/master). The article discusses implications from this form of potlatch behaviour by describing...... the contrasting fortunes of two non-farm rural enterprises, examining data on how tobacco production and ‘cooling off’ is viewed by wives, and comparing the crop preferences of husbands and wives. It concludes by suggesting that the concept of conspicuous consumption may provide an alternative prism through which...

Becoming a bwana and burley tobacco in the Central Region of Malawi

DEFF Research Database (Denmark)

Prowse, Martin

2009-01-01

Smallholders now grow most of Malawi’s main export crop – burley tobacco. Based on nineteen months’ fieldwork in the Central Region, this article offers a sociological interpretation of why some smallholder growers spend a proportion of burley income on conspicuous consumption in rural towns...... and trading centres. This practice can be seen as a form of inculcated behaviour whereby smallholders reproduce elements of one model of success in this region: that of the Malawian tobacco bwana (boss/master). The article discusses implications from this form of potlatch behaviour by describing...... the contrasting fortunes of two non-farm rural enterprises, examining data on how tobacco production and ‘cooling off’ is viewed by wives, and comparing the crop preferences of husbands and wives. It concludes by suggesting that the concept of conspicuous consumption may provide an alternative prism...

Anthropogenic activities and coastal environmental quality: a regional quantitative analysis in southeast China with management implications.

Science.gov (United States)

Chen, Kai; Liu, Yan; Huang, Dongren; Ke, Hongwei; Chen, Huorong; Zhang, Songbin; Yang, Shengyun; Cai, Minggang

2018-02-01

Regional analysis of environmental issues has always been a hot topic in the field of sustainable development. Because the different levels of economic growth, urbanization, resource endowments, etc. in different regions generate apparently different ecological responses, a better description and comparison across different regions will provide more valuable implications for ecological improvement and policymaking. In this study, seven typical bays in southeast China that are a rapid developing area were selected to quantitatively analyze the relationship between socioeconomic development and coastal environmental quality. Based on the water quality data from 2007 to 2015, the multivariate statistical method was applied to analyze the potential environmental risks and to classify the seven bays based on their environmental quality status. The possible variation trends of environmental indices were predicted based on the cross-regional panel data by Environmental Kuznets Curve. The results showed that there were significant regional differences among the seven bays, especially Quanzhou, Xiamen, and Luoyuan Bays, suffered from severer artificial disturbances than other bays, despite their different development patterns. Socioeconomic development level was significantly associated with some water quality indices (pH, DIN, PO 4 -P); the association was roughly positive: the areas with higher GDP per capita have some worse water quality indices. In addition, the decreasing trend of pH values and the increasing trend of nutrient concentration in the seven bays will continue in the foreseeable future. In consideration of the variation trends, the limiting nutrient strategy should be implemented to mitigate the deterioration of the coastal environments.

Young Stellar Objects in the Massive Star-forming Regions W51 and W43

Energy Technology Data Exchange (ETDEWEB)

Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

2017-04-20

We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

Energy Technology Data Exchange (ETDEWEB)

Xiaohui Zhan

2009-12-01

A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

The energy implications of Chinese regional disparities

International Nuclear Information System (INIS)

Huang Yuanxi; Todd, Daniel

2010-01-01

Chinese regional disparities are readily apparent, with well-being seen the highest at the coast and declining steadily inland. Their mitigation will clearly be hostage to improvement in economic development, since the unevenness of that development created them in the first place. Integral to development is structural change, and the key to effecting that change is improved energy efficiency. Indeed, this paper explores energy usage and regional development from 1952 to the present, establishing that they both conform to an inverted-U pattern. Eastern China, the leader in industrialization, has moved beyond the apogee of the curve, but Central and Western China have failed to follow suit, being held back by poor industrial structures and adverse patterns of energy consumption. Remedying this laggardly performance preoccupies China's Government, for rendering the country energy-efficient and containing regional disparities, both rest on pushing the Central and Western regions down the curve in the wake of the prosperous coast.

Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

CERN Document Server

Hartquist, T W

2006-01-01

John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

AN INFRARED/X-RAY SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.

2009-01-01

We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.

VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

Energy Technology Data Exchange (ETDEWEB)

Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: asarma@depaul.edu [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)

2013-04-10

We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

International Nuclear Information System (INIS)

Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.

2013-01-01

We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

Science.gov (United States)

Giroux, Mark; Smith, B.; Struck, C.

2011-05-01

Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

Greenhouse gas emissions from cities and regions: International implications revealed by Hong Kong

International Nuclear Information System (INIS)

Harris, Paul G.; Chow, Alice S.Y.; Symons, Jonathan

2012-01-01

The diversity of greenhouse gas (GHG) accounting methodologies currently utilized by cities around the world make meaningful comparisons of their emissions almost impossible. Consequently, the 2010 United Nations International Standard for Determining Greenhouse Gas Emissions for Cities promotes a “harmonized protocol for quantifying the GHG emissions attributable to cities and local regions.” The UN's common standard has important implications for comparison, benchmarking and policy assessment related to energy policies. This paper uses Hong Kong as a case study to illustrate these implications. Hong Kong's per capita contribution to GHG emissions are among the highest in the world, yet the local government's official statistics indicate emissions that are far below those reported by most affluent economies. This discrepancy arises from a reporting methodology that does not require inclusion of GHG emissions linked to consumption of imported goods or emissions from aviation and shipping. The Hong Kong case reveals that current inventories do not provide sufficient information to guide policymaking related to energy and climate change. They also do not provide adequate information for comparing policies of cities internationally. Alternative emissions-reporting standards that focus more on pollution from consumption will create avenues for more effective climate-related policies. - Highlights: ► Flawed GHG inventory methodologies can lead cities to adopt misguided policies. ► Diverse GHG inventory methodologies make meaningful comparisons among cities difficult. ► A Hong Kong case study highlights that GHG inventories can misrepresent cities' climate impacts. ► City inventories often exclude GHG emissions linked to imports, aviation and shipping. ► The International Standard for Determining GHG Emissions for Cities can assist climate policy.

A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

Directory of Open Access Journals (Sweden)

Barrado y Navascués D.

2011-07-01

Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

International Nuclear Information System (INIS)

Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

2013-01-01

We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

An Evolutionary Approach to Regional Systems of Innovation

DEFF Research Database (Denmark)

Gunnarsson, Jan Sture Gunnar; Wallin, Torsten

This article examines how the birth and the development of regional systems of innovation are connected with economic selection and points to implications for regional-level policies. The research questions are explored using an evolutionary model, which emphasises geographical spaces and product......This article examines how the birth and the development of regional systems of innovation are connected with economic selection and points to implications for regional-level policies. The research questions are explored using an evolutionary model, which emphasises geographical spaces...

An evolutionary approach to regional systems of innovation

DEFF Research Database (Denmark)

Gunnarsson, Jan Sture Gunnar; Wallin, Torsten

2011-01-01

This article examines how the birth and the development of regional systems of innovation are connected with economic selection and points to implications for regional-level policies. The research questions are explored using an evolutionary model, which emphasises geographical spaces and product......This article examines how the birth and the development of regional systems of innovation are connected with economic selection and points to implications for regional-level policies. The research questions are explored using an evolutionary model, which emphasises geographical spaces...

Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region.

Science.gov (United States)

Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J

2017-01-01

The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

International Nuclear Information System (INIS)

Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

2009-01-01

Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

A Study of THT Cold Cores Population in the Star-Forming Region in Serpens

Science.gov (United States)

Fiorellino, Eleonora

2017-11-01

The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

CHEMICAL EVOLUTION IN HIGH-MASS STAR-FORMING REGIONS: RESULTS FROM THE MALT90 SURVEY

Energy Technology Data Exchange (ETDEWEB)

Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail: shoq@bu.edu, E-mail: jackson@bu.edu, E-mail: patricio@bu.edu, E-mail: claysmit@bu.edu, E-mail: jonathan.b.foster@yale.edu, E-mail: aguzmanf@cfa.harvard.edu, E-mail: scott@bu.edu, E-mail: rathborne@csiro.au, E-mail: tv3h@virginia.edu, E-mail: aiv3f@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

2013-11-10

The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.

Millimetre wavelength methanol masers survey towards massive star forming regions

Science.gov (United States)

Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

2007-03-01

We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

Science.gov (United States)

Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

2018-05-01

Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

NARCIS (Netherlands)

Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.

2010-01-01

We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

DISK EVOLUTION IN THE THREE NEARBY STAR-FORMING REGIONS OF TAURUS, CHAMAELEON, AND OPHIUCHUS

International Nuclear Information System (INIS)

Furlan, E.; Watson, Dan M.; McClure, M. K.

2009-01-01

We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

Perturbative corrections to B → D form factors in QCD

Science.gov (United States)

Wang, Yu-Ming; Wei, Yan-Bing; Shen, Yue-Long; Lü, Cai-Dian

2017-06-01

We compute perturbative QCD corrections to B → D form factors at leading power in Λ/ m b , at large hadronic recoil, from the light-cone sum rules (LCSR) with B-meson distribution amplitudes in HQET. QCD factorization for the vacuum-to- B-meson correlation function with an interpolating current for the D-meson is demonstrated explicitly at one loop with the power counting scheme {m}_c˜ O(√{Λ {m}_b}) . The jet functions encoding information of the hard-collinear dynamics in the above-mentioned correlation function are complicated by the appearance of an additional hard-collinear scale m c , compared to the counterparts entering the factorization formula of the vacuum-to- B-meson correction function for the construction of B → π from factors. Inspecting the next-to-leading-logarithmic sum rules for the form factors of B → Dℓν indicates that perturbative corrections to the hard-collinear functions are more profound than that for the hard functions, with the default theory inputs, in the physical kinematic region. We further compute the subleading power correction induced by the three-particle quark-gluon distribution amplitudes of the B-meson at tree level employing the background gluon field approach. The LCSR predictions for the semileptonic B → Dℓν form factors are then extrapolated to the entire kinematic region with the z-series parametrization. Phenomenological implications of our determinations for the form factors f BD +,0 ( q 2) are explored by investigating the (differential) branching fractions and the R( D) ratio of B → Dℓν and by determining the CKM matrix element |V cb | from the total decay rate of B → Dμν μ .

Water Resources Implications of Cellulosic Biofuel Production at a Regional Scale

Science.gov (United States)

Christopher, S. F.; Schoenholtz, S. H.; Nettles, J. E.

2011-12-01

Recent increases in oil prices, a strong national interest in greater energy independence, and a concern for the role of fossil fuels in global climate change, have led to a dramatic expansion in use of alternative renewable energy sources in the U.S. The U.S. government has mandated production of 36 billion gallons of renewable fuels by 2022, of which 16 billion gallons are required to be cellulosic biofuels. Production of cellulosic biomass offers a promising alternative to corn-based systems because large-scale production of corn-based ethanol often requires irrigation and is associated with increased erosion, excess sediment export, and enhanced leaching of nitrogen and phosphorus. Although cultivation of switchgrass using standard agricultural practices is one option being considered for production of cellulosic biomass, intercropping cellulosic biofuel crops within managed forests could provide feedstock without primary land use change or the water quality impacts associated with annual crops. Catchlight Energy LLC is examining the feasibility and sustainability of intercropping switchgrass in loblolly pine plantations in the southeastern U.S. Ongoing research is determining efficient operational techniques and information needed to evaluate effects of these practices on water resources in small watershed-scale (~25 ha) studies. Three sets of four to five sub-watersheds are fully instrumented and currently collecting calibration data in North Carolina, Alabama, and Mississippi. These watershed studies will provide detailed information to understand processes and guide management decisions. However, environmental implications of cellulosic systems need to be examined at a regional scale. We used the Soil Water Assessment Tool (SWAT), a physically-based hydrologic model, to examine water quantity effects of various land use change scenarios ranging from switchgrass intercropping a small percentage of managed pine forest land to conversion of all managed

Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey

Science.gov (United States)

Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

2018-06-01

We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

Forms of Decentralisation and Their Implications for Education.

Science.gov (United States)

Lauglo, Jon

1995-01-01

Describes alternatives to bureaucratic centralism in the administration of national education systems. Discusses forms of decentralization based on political rationales (liberalism, federalism, populist localism, participatory democracy) and those concerned with quality or efficiency (pedagogic professionalism, management by objectives,…

TRIGONOMETRIC PARALLAXES OF MASSIVE STAR-FORMING REGIONS. II. CEP A AND NGC 7538

International Nuclear Information System (INIS)

Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.

2009-01-01

We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

Potential Vorticity Evolution in the Co-orbital Region of Embedded Protoplanets

International Nuclear Information System (INIS)

Koller, J.

2004-01-01

This thesis presents two-dimensional hydrodynamic disk simulations with embedded protoplanets, emphasizing the non-linear dynamics in the co-orbital region. In particular, it demonstrates how a protoplanetary disk responds to embedded low mass planets at the inviscid limit. Since the potential vorticity (PV) flow is not conserved, due to the spiral shocks and possibly boundary layer effects emanating from the planet, the PV profile develops inflection points which eventually render the flow unstable. Vortices are produced in association with the potential vorticity minima. Born in the separatrix region, these vortices experience close encounters with the planet, consequently exerting strong torques on the planet. The existence of these vortices, if confirmed, have important implications on planetary migration rates. The formation of vortices is discussed in more detail and a key parameter is found which depends solely on planet mass and sound speed. With this key parameter, one can predict the disk evolution, PV growth rates, and threshold conditions for forming vortices in the co-orbital region. An analytical estimate for the change of PV due to shocks is compared to the actual change in PV in the hydrodynamic simulations. They match well except in the inner region where vortices form. In addition, extensive resolution tests were carried out but uncertainties remain about the physics of this particular region

Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

Directory of Open Access Journals (Sweden)

Darya-Anna Alekseevna Kaibiyainen

2015-03-01

Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

The Depletion of Water During Dispersal of Planet-forming Disk Regions

Science.gov (United States)

Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.

2017-01-01

We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

Highly restricted deletion of the SNORD116 region is implicated in Prader-Willi Syndrome.

Science.gov (United States)

Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

2015-02-01

The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader-Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS.

Rising global burden of breast cancer: the case of sub-Saharan Africa (with emphasis on Nigeria) and implications for regional development: a review.

Science.gov (United States)

Azubuike, Samuel O; Muirhead, Colin; Hayes, Louise; McNally, Richard

2018-03-22

Despite mortality from breast cancer in Africa being higher than in high income countries, breast cancer has not been extensively studied in the region. The aim of this paper was to highlight the rising burden of breast cancer with an emphasis on sub-Saharan Africa as well as trends, characteristics, controversies and their implications for regional development. A review of published studies and documents was conducted in Medline, Scopus, Pubmed and Google using combinations of key words-breast neoplasm, breast cancer, cancer, incidence, mortality, Africa, Nigeria. Graphical and frequency analyses were carried out on some of the incidence and mortality figures retrieved from published papers and the GLOBOCAN website. Globally, about 25% and 15% of all new cancer cases and cancer deaths respectively among females were due to breast cancer. Africa currently had the highest age-standardized breast cancer mortality rate globally, with the highest incidence rates being recorded within the sub-Saharan African sub-region. Incidence trends such as inherently aggressive tumour and younger age profile had been subject to controversies. Certain factors such as westernized diet, urbanization and possibly increasing awareness had been implicated, though their specific contributions were yet to be fully established. Unless urgent action is taken, breast cancer will compound sub-Saharan Africa's disease burden, increase poverty and gender inequality as well as reverse the current global gains against maternal and neonatal mortality.

Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

Science.gov (United States)

Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

2013-04-11

Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

Extreme Variables in Star Forming Regions

Science.gov (United States)

Contreras Peña, Carlos Eduardo

2015-01-01

in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: johan.lindberg@nasa.gov [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)

2017-01-20

We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

SEQUENTIAL STAR FORMATION IN RCW 34: A SPECTROSCOPIC CENSUS OF THE STELLAR CONTENT OF HIGH-MASS STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.

2010-01-01

In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

Trigonometric parallaxes of star forming regions in the Scutum spiral arm

International Nuclear Information System (INIS)

Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.

2014-01-01

We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

The implications of cross-regional differences for the design of In-vehicle Information Systems: a comparison of Australian and Chinese drivers.

Science.gov (United States)

Young, Kristie L; Rudin-Brown, Christina M; Lenné, Michael G; Williamson, Amy R

2012-05-01

The increasing global distribution of automobiles necessitates that the design of In-vehicle Information Systems (IVIS) is appropriate for the regions to which they are being exported. Differences between regions such as culture, environment and traffic context can influence the needs, usability and acceptance of IVIS. This paper describes two studies aimed at identifying regional differences in IVIS design needs and preferences across drivers from Australia and China to determine the impact of any differences on IVIS design. Using a questionnaire and interaction clinics, the influence of cultural values and driving patterns on drivers' preferences for, and comprehension of, surface- and interaction-level aspects of IVIS interfaces was explored. Similarities and differences were found between the two regional groups in terms of preferences for IVIS input control types and labels and in the comprehension of IVIS functions. Specifically, Chinese drivers preferred symbols and Chinese characters over English words and were less successful (compared to Australians) at comprehending English abbreviations, particularly for complex IVIS functions. Implications in terms of the current trend to introduce Western-styled interfaces into other regions with little or no adaptation are discussed. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

International Nuclear Information System (INIS)

Kim, Kyungsik

2011-01-01

We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

Maritime Violence : Implications to Malaysia

OpenAIRE

Zubir, Nurulizwan Ahmad

2012-01-01

Abstract Maritime Piracy has been a serious threat to the international community especially in the SoutheastAsia region. This threat has caused tremendous implications towards the world economy, environment,political stability of the nations involved because 45% of the shipping company passes through theSoutheast Asia. The worrying fact is that these attacks were committed by terrorists as well as traditionalmaritime pirates. This paper examines on the implications of maritime crime in M...

Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

NARCIS (Netherlands)

van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with

Functional relationship between skull form and feeding mechanics in Sphenodon, and implications for diapsid skull development.

Directory of Open Access Journals (Sweden)

Neil Curtis

Full Text Available The vertebrate skull evolved to protect the brain and sense organs, but with the appearance of jaws and associated forces there was a remarkable structural diversification. This suggests that the evolution of skull form may be linked to these forces, but an important area of debate is whether bone in the skull is minimised with respect to these forces, or whether skulls are mechanically "over-designed" and constrained by phylogeny and development. Mechanical analysis of diapsid reptile skulls could shed light on this longstanding debate. Compared to those of mammals, the skulls of many extant and extinct diapsids comprise an open framework of fenestrae (window-like openings separated by bony struts (e.g., lizards, tuatara, dinosaurs and crocodiles, a cranial form thought to be strongly linked to feeding forces. We investigated this link by utilising the powerful engineering approach of multibody dynamics analysis to predict the physiological forces acting on the skull of the diapsid reptile Sphenodon. We then ran a series of structural finite element analyses to assess the correlation between bone strain and skull form. With comprehensive loading we found that the distribution of peak von Mises strains was particularly uniform throughout the skull, although specific regions were dominated by tensile strains while others were dominated by compressive strains. Our analyses suggest that the frame-like skulls of diapsid reptiles are probably optimally formed (mechanically ideal: sufficient strength with the minimal amount of bone with respect to functional forces; they are efficient in terms of having minimal bone volume, minimal weight, and also minimal energy demands in maintenance.

Functional Relationship between Skull Form and Feeding Mechanics in Sphenodon, and Implications for Diapsid Skull Development

Science.gov (United States)

Curtis, Neil; Jones, Marc E. H.; Shi, Junfen; O'Higgins, Paul; Evans, Susan E.; Fagan, Michael J.

2011-01-01

The vertebrate skull evolved to protect the brain and sense organs, but with the appearance of jaws and associated forces there was a remarkable structural diversification. This suggests that the evolution of skull form may be linked to these forces, but an important area of debate is whether bone in the skull is minimised with respect to these forces, or whether skulls are mechanically “over-designed” and constrained by phylogeny and development. Mechanical analysis of diapsid reptile skulls could shed light on this longstanding debate. Compared to those of mammals, the skulls of many extant and extinct diapsids comprise an open framework of fenestrae (window-like openings) separated by bony struts (e.g., lizards, tuatara, dinosaurs and crocodiles), a cranial form thought to be strongly linked to feeding forces. We investigated this link by utilising the powerful engineering approach of multibody dynamics analysis to predict the physiological forces acting on the skull of the diapsid reptile Sphenodon. We then ran a series of structural finite element analyses to assess the correlation between bone strain and skull form. With comprehensive loading we found that the distribution of peak von Mises strains was particularly uniform throughout the skull, although specific regions were dominated by tensile strains while others were dominated by compressive strains. Our analyses suggest that the frame-like skulls of diapsid reptiles are probably optimally formed (mechanically ideal: sufficient strength with the minimal amount of bone) with respect to functional forces; they are efficient in terms of having minimal bone volume, minimal weight, and also minimal energy demands in maintenance. PMID:22216358

Preliminary results from the ESA STSE project on SST diurnal variability, its regional extent and implications in atmospheric modelling (SSTDV:R.EX.–IM.A.M.)

DEFF Research Database (Denmark)

Karagali, Ioanna; Hasager, Charlotte Bay; Høyer, Jacob L.

2013-01-01

This study presents some preliminary results of the ESA Support To Science Element (STSE) funded project on the Diurnal Variability of the Sea Surface Temperature, regarding its Regional Extend and Implications in Atmospheric Modelling (SSTDV:R.EX.–IM.A.M.). Comparisons of SEVIRI SST with AATSR...

Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

International Nuclear Information System (INIS)

Kobushkin, A.P.; Syamtomov, A.I.

1994-01-01

Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

OpenAIRE

Kato, J; Ito, K; Nakamura, A; Watanabe, H

1989-01-01

Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

Travel and urban form in the Greater Copenhagen region

DEFF Research Database (Denmark)

Nielsen, Thomas Alexander Sick

of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

Directory of Open Access Journals (Sweden)

Marzena RUSZKOWSKA

2017-11-01

Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

The Regional Dimension

DEFF Research Database (Denmark)

Eskjær, Mikkel Fugl

2013-01-01

is largely dependent on regional media systems, yet the role this regional dimension plays has been largely overlooked. This article presents a comparative study of climate-change coverage in three geo-cultural regions, The Middle East, Scandinavia, and North America, and explores the link between global......Global perspectives and national approaches have dominated studies of climate-change communication, reflecting the global nature of climate change as well as the traditional research focus on national media systems. In the absence of a global public sphere, however, transnational issue attention...... climate-change communication and regional media systems. It finds that regional variations in climate-change communication carry important communicative implications concerning perceptions of climate change's relevance and urgency...

Understanding culture in territorial management and its implications for spatial planning. The case of floodplain management in urbanised delta regions in the Netherlands and Thailand

Directory of Open Access Journals (Sweden)

Suwanna Rongwiriyaphanich

2014-08-01

Full Text Available Previous experiences have shown that the implementation of planning policy does not always lead to the originally intended territorial management outcomes. This issue
is particularly crucial when policy ideas, institutions, models and programmes are transferred into places with different cultural settings without adaptations (Knieling and Othengrafen 2009b; Sanyal 2005. These unexpected consequences in planning practice and management outcomes have brought a significant amount of attention to the importance and roles of culture on shaping decision-making in territorial management process and determining transferability of a policy (Friedmann 2005a, 2005b; de Jong and Mamadouh 2002; Sanyal 2005; Ostrom 2005a; Knieling and Othengrafen 2009b. However, conceptual frameworks that seek to understand the roles of culture and its implications for spatial planning are still rather limited. This study presents and applies an integrative conceptual framework which is used
to explain how culture, planning policy and territorial management outcomes are interrelated, and what the implications are for spatial planning. The framework integrates relevant theories and ideas from anthropology, organisational management and political sciences to understand influences of culture on spatial planning. The integrative framework suggests a way of characterising territorial management in the form of ideal types. This helps simplify cultures regarding territorial management to make them comparable. It enables an analysis of ‘cultures’ that includes a broader scope of culture than existing frameworks that focus primarily on ‘planning cultures’ expressed in forms of planning systems, organisations and instruments. This broader scope includes also the implicit expressions of culture in informal forms, such as ideas, customs and social behaviours shared by involved actors in the management of a given territory. The framework also offers two analytical perspectives

Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

Science.gov (United States)

Kulesa, Craig A.

Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

Highly restricted deletion of the SNORD116 region is implicated in Prader–Willi Syndrome

Science.gov (United States)

Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

2015-01-01

The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader–Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS. PMID:24916642

Study, Talk, and Action. A Report of a National Conference on Regionalism and Regionalization in American Postsecondary Education.

Science.gov (United States)

Martorana, S. V., Ed.; Nespoli, Lawrence A., Ed.

This report of a National Conference on Regionalism and Regionalization in American Postsecondary Education contains an overview and summary of the final project report, a keynote address, four papers on the implications of regionalism, some reactor comments, an essay on leadership, and four descriptive accounts of operational regionalization…

Regional migratory osteoporosis: a review illustrated by five cases

International Nuclear Information System (INIS)

Toms, A.P.; Marshall, T.J.; Becker, E.; Donell, S.T.; Lobo-Mueller, E.M.; Barker, T.

2005-01-01

Regional migratory osteoporosis is an uncommon self-limiting disease characterized by an arthralgia which migrates between the weight-bearing joints of the lower limb. The radiological features of the disease obtained by conventional radiography, CT, MRI and radionuclide scintigraphy are illustrated by means of five case reports. These range from the most common presentation of sequential, proximal to distal spread in the lower limb to the rare intra-articular form, and disease involving the axial skeleton is also recognized. Clinical and radiographical features often overlap with those of diseases such as transient osteoporosis of the hip and transient bone marrow oedema syndrome, which is reflected in confusing terminology. Histological sampling is usually unnecessary; the radiological features are characteristic and the histological findings are not specific. Regional migratory osteoporosis is associated with systemic osteoporosis. This association is probably under-recognized, and has implications for the pathophysiology of the disease and for treatment

Ventral aspect of the visual form pathway is not critical for the perception of biological motion

Science.gov (United States)

Gilaie-Dotan, Sharon; Saygin, Ayse Pinar; Lorenzi, Lauren J.; Rees, Geraint; Behrmann, Marlene

2015-01-01

Identifying the movements of those around us is fundamental for many daily activities, such as recognizing actions, detecting predators, and interacting with others socially. A key question concerns the neurobiological substrates underlying biological motion perception. Although the ventral “form” visual cortex is standardly activated by biologically moving stimuli, whether these activations are functionally critical for biological motion perception or are epiphenomenal remains unknown. To address this question, we examined whether focal damage to regions of the ventral visual cortex, resulting in significant deficits in form perception, adversely affects biological motion perception. Six patients with damage to the ventral cortex were tested with sensitive point-light display paradigms. All patients were able to recognize unmasked point-light displays and their perceptual thresholds were not significantly different from those of three different control groups, one of which comprised brain-damaged patients with spared ventral cortex (n > 50). Importantly, these six patients performed significantly better than patients with damage to regions critical for biological motion perception. To assess the necessary contribution of different regions in the ventral pathway to biological motion perception, we complement the behavioral findings with a fine-grained comparison between the lesion location and extent, and the cortical regions standardly implicated in biological motion processing. This analysis revealed that the ventral aspects of the form pathway (e.g., fusiform regions, ventral extrastriate body area) are not critical for biological motion perception. We hypothesize that the role of these ventral regions is to provide enhanced multiview/posture representations of the moving person rather than to represent biological motion perception per se. PMID:25583504

Further assessment of seismic hazard/risk in the Bushveld Complex platinum mines and the implication for regional and local support design.

CSIR Research Space (South Africa)

Brink, AVZ

2002-03-01

Full Text Available Final Project Report Further assessment of seismic hazard/risk in the Bushveld Complex platinum mines and the implication for regional and local support design. A.v.Z Brink, M.K.C. Roberts, S.M Spottiswoode Research Agency: CSIR: Division of Mining... on the VCR. An industry workshop on local support requirements in areas of higher seismic risk resulted in the specification of support requirements. A maximum design parameter for yielding support in terms of the ground motion velocity is 1 m...

Regional and international implications of the Iranian nuclear crisis

International Nuclear Information System (INIS)

Reveillard, Ch.

2006-01-01

Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

Beneath it all: bedrock geology of the Catskill Mountains and implications of its weathering.

Science.gov (United States)

Ver Straeten, Charles A

2013-09-01

The Devonian-age bedrock of the Catskill Mountains has been the focus of many studies. This paper reviews the character and composition of the rocks of the Catskills, and examines weathering (rock decay) processes and their implications in the Catskills. Rocks of the Catskills and closest foothills consist of siliciclastic rocks (sandstones, mudrocks, conglomerates) with minimal, locally dispersed carbonate rocks. The former are dominated by quartz, metamorphic and sedimentary rock fragments, and clay minerals. Other minor sediment components include cements, authigenic and heavy minerals, and fossil organic matter. Physical, chemical, and biological weathering of the Catskill bedrock since uplift of the Appalachian region, combined with glaciation, have dissected a plateau of nearly horizontally layered rocks into a series of ridges, valleys, and peaks. The varied weathering processes, in conjunction with many factors (natural and anthropogenic), fragment the rocks, forming sediment and releasing various elements and compounds. These may have positive, neutral, or negative implications for the region's soils, waters, ecology, and human usage. A new generation of studies and analyses of the Catskill bedrock is needed to help answer a broad set of questions and problems across various fields of interest. © 2013 New York Academy of Sciences.

[Regional health and autonomy conferences (CRSAs): the implications for medical democracy at a regional level].

Science.gov (United States)

Devictor, Bernadette

2010-01-01

The HPST law seeks to reorganize the governance of healthcare at a regional level and to maintain the existence of regional health conferences, now known as regional health and autonomy conferences (CRSAs). The purpose of this article is to examine the new duties attributed to the CRSAs and to consider the various issues raised by their practice. The article also provides an analysis of the preconditions required for the successful implementation of medical democracy at a regional level, ie.: the involvement of the CRSAs in the assessment of regional healthcare policies, the mobilization of funds, the composition of the CRSAs (including the full range of healthcare areas), the importance of providing adequate support for territorial conferences, and the elaboration of a communicative space for fostering exchanges between CRSAs.

Balancing regional industrial development: analysis on regional disparity of China's industrial emissions and policy implications

DEFF Research Database (Denmark)

Liang, Hanwei; Dong, Liang; Luo, Xiao

2016-01-01

Efficient industrial emissions mitigation strategy is critical for China's national action on climate change and sustainable development, considering its rapid industrialization. Regional disparity brings difficulties and uncertainties to policy implementation in China. Therefore, an investigation...... development, and highlight not only disparity, but also inequity exists. It is concluded that, there is a larger unequal distribution of GDP per unit of air pollutants and CO2 emission between eastern and western regions, reveals that less developed western and central regions suffer from the emission leakage...... on the regional features of industrial emissions is critical to better decision makings. While to date, related studies have been rather few. This paper applies a spatial analysis on regional features of China's industrial emissions (SO2, NOx and PM2.5 and CO2 emission) in 31 provinces. Spatial autocorrelation...

The HNC/HCN ratio in star-forming regions

International Nuclear Information System (INIS)

Graninger, Dawn M.; Öberg, Karin I.; Herbst, Eric; Vasyunin, Anton I.

2014-01-01

HNC and HCN, typically used as dense gas tracers in molecular clouds, are a pair of isomers that have great potential as a temperature probe because of temperature dependent, isomer-specific formation and destruction pathways. Previous observations of the HNC/HCN abundance ratio show that the ratio decreases with increasing temperature, something that standard astrochemical models cannot reproduce. We have undertaken a detailed parameter study on which environmental characteristics and chemical reactions affect the HNC/HCN ratio and can thus contribute to the observed dependence. Using existing gas and gas-grain models updated with new reactions and reaction barriers, we find that in static models the H + HNC gas-phase reaction regulates the HNC/HCN ratio under all conditions, except for very early times. We quantitatively constrain the combinations of H abundance and H + HNC reaction barrier that can explain the observed HNC/HCN temperature dependence and discuss the implications in light of new quantum chemical calculations. In warm-up models, gas-grain chemistry contributes significantly to the predicted HNC/HCN ratio and understanding the dynamics of star formation is therefore key to model the HNC/HCN system.

Assessing Climate Vulnerabilities of Food Distribution Center Sites in Greater Boston and Their Regional Implications: Climate Adaptation Planning in Practice

Science.gov (United States)

Teferra, A.; Watson, C.; Douglas, E. M.

2016-12-01

The Metro Boston region, an area whose civic leaders have been at the forefront of climate resilience initiatives in recent years, is finalizing a flood vulnerability assessment of food distribution center sites located north of Boston, with the support of the University of Massachusetts Boston and the American Geophysical Union's Thriving Earth Exchange program. The community-scientist collaboration emerged because of the need for more local analyses of the area to inform climate resiliency policy and planning actions for the region. A significant amount of the metro region's food supply passes through two major distribution centers in the cities of Everett and Chelsea, just north of the Mystic River. The Metropolitan Area Planning Council (MAPC), on behalf of the Metro Boston Climate Preparedness Taskforce, is working with Chris Watson and Ellen Douglas of UMass Boston to build on existing analyses of the region's food system and climate vulnerabilities and to develop a report identifying flood risk exposure to the sites. The analysis brings in dynamic modeling techniques that incorporate storm surge and sea level rise projections under different climate scenarios, and aims to align methodologies with those of other regional analyses, such as Climate Ready Boston and the City of Cambridge's Vulnerability Assessment. The study is helping to inform MAPC's and the Metro Boston Climate Preparedness Taskforce's understanding of this critical food distribution infrastructure, illustrate the larger regional implications of climate impacts on food distribution in the Greater Boston area, and guide the development of site-specific strategies for addressing identified vulnerabilities.

The Military Coup and its Implications for the Thai Economy

DEFF Research Database (Denmark)

Schmidt, Johannes Dragsbæk

The paper analyses the regional and international implications of the Thai military coup in September 2006. Focus is furthermore  attached to the economic consequences and the geo-political and geo-economic aspects related to the coup.......The paper analyses the regional and international implications of the Thai military coup in September 2006. Focus is furthermore  attached to the economic consequences and the geo-political and geo-economic aspects related to the coup....

YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

Energy Technology Data Exchange (ETDEWEB)

Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

2014-12-01

The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

CONDITION OF DECENTRALIZATION AND ORGANIZATIONAL LEGAL FORMS OF SUSTAINABLE DEVELOPMENT OF REGIONS OF UKRAINE IN THE CONTEXT OF THE GLOBAL EXPERIENCE

Directory of Open Access Journals (Sweden)

Nadiia Kulchytska

2016-06-01

Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

New forms of contractual relationships and the implications for occupational safety and health

NARCIS (Netherlands)

Goudswaard, A.; André, J.C.; Ekstedt, E.

2002-01-01

Changes in the world of work can give rise to new risk areas or change the way that occupational safety and health needs to be managed. This has implications for workplaces themselves and also for the occupational safety and health system. For this reason the 'changing world of work' has been a

Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

International Nuclear Information System (INIS)

Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

2015-01-01

Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey.

Science.gov (United States)

Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A

2014-10-01

Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

Escape of ionizing radiation from star-forming regions in Young galaxies

DEFF Research Database (Denmark)

Razoumov, A; Sommer-Larsen, Jesper

2006-01-01

Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

Can Trade Help Overcome Economic Crisis? Implications for Northeast Asia Creating Regional FTA between Korea, China, and Japan and Mega FTAs such as RCEP and TPP

Directory of Open Access Journals (Sweden)

Sang-Chul Park

2017-08-01

Full Text Available Globalization processes have formed a triad of economic and trade systems in terms of GDP and trade volume. These are the European Union (EU, North America Free Trade Association (NAFTA, and Northeast Asia, the major actors in the global economic system and trade since 1990s. However, the global financial crisis in 2008 created a new global economic order and governance that consisted of existing global economic power such as the G7 as well as new emerging economic powers, such as G20 and BRICS. Under such rapidly changing global economic conditions, global trade has contributed to rapid economic growth in the world in the last half-century. Regarding FTAs, the European Union (EU is the frontrunner and has developed the most advanced system for regional economic integration. The EU’s single market provides several implications for Northeast Asian countries trying to build their own regional bilateral and multilateral FTAs and participate in different mega-FTAs such as RCEP and TPP. As a result, their economic interests are rather divided deeply and related to political and security issues in the context of Northeast Asia. Therefore, it is more difficult for Northeast Asian countries to economically integrate in a way that is comparable with the EU. This paper addresses a regional FTA between South Korea, China, and Japan that could be a starting point for their formal economic integration and create a reliable platform to strengthen their trade, boosting further economic growth. It also asks which of the three nations’ economic interests are served by participating in mega FTAs such as RCEP and TPP. Finally, it analyses the best scenario for participating in the multilateral FTA and mega FTAs for each nation.

Forty-year (1971-2010) semiquantitative observations of visibility-cloud-precipitation in Korea and its implication for aerosol effects on regional climate.

Science.gov (United States)

Lee, Hyo-Jung; Kang, Jeong-Eon; Kim, Cheol-Hee

2015-07-01

Forty-year (1971-2010) observations of cloud cover and types have been analyzed, and implications on the effects of aerosol-cloud feedback were explored. Cloud cover and types have been observed over Korea on the basis of visible (human-eye) attributes without any change in official observing instructions. Visibility has been used as an ongoing proxy measure of aerosol concentrations, and observed meteorological variables such as sunshine duration and precipitation have been employed to analyze aerosol causes and implications for urban and regional climate. The analysis revealed persistent decade-long patterns in Korea: steadily reduced visibility (-0.37 km/yr), consistently decreasing sunshine duration (-0.06 %/hr), and declining occurrence of light precipitation. Spatial distributions of sunshine duration and visibility exhibited more localized variations in the early period (1971-1990), and tended to be more uniform throughout Korea over more recent years (1991-2010), implying the recent regional-scale impact of cloud change over northeast Asia. Cloud analysis results showed that the five most common types were stratocumulus (Sc), cirrus (Ci), altostratus (As), stratus (St), and nimbostratus (Ns), with occurrences of 33%, 17%, 17%, 9%, and 8%, respectively. Occurrence of rarely precipitating or nonprecipitating low-level Sc clouds showed an increasing (+0.34%/yr), but no (or only minor) effects of aerosols on heavy precipitation such as cumulus cloud types were found. Cloud cover in the range of 6/10 to 8/10 units has increased by 31.5±6.5%, and occurrences of both cloud-free (~2/10 units) and overcast (~8/10 units) conditions have decreased. Aerosol-cloud-precipitations interaction is highly nonlinear due to feedback mechanisms. One reason for our poor understanding of the aerosol-cloud feedback study is the variety of cloud types with their complicated responses to variations of the aerosol. Our study on the response of precipitation-cloud to long

Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

Directory of Open Access Journals (Sweden)

Bolychev Oleg

2013-12-01

Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

Directory of Open Access Journals (Sweden)

Bolychev Oleg

2013-11-01

Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

Seismotectonic Implications Of Clustered Regional GPS Velocities In The San Francisco Bay Region, California

Science.gov (United States)

Graymer, R. W.; Simpson, R.

2012-12-01

We have used a hierarchical agglomerative clustering algorithm with Euclidean distance and centroid linkage, applied to continuous GPS observations for the Bay region available from the U.S. Geological Survey website. This analysis reveals 4 robust, spatially coherent clusters that coincide with 4 first-order structural blocks separated by 3 major fault systems: San Andreas (SA), Southern/Central Calaveras-Hayward-Rodgers Creek-Maacama (HAY), and Northern Calaveras-Concord-Green Valley-Berryessa-Bartlett Springs (NCAL). Because observations seaward of the San Gregorio (SG) fault are few in number, the cluster to the west of SA may actually contain 2 major structural blocks not adequately resolved: the Pacific plate to the west of the northern SA and a Peninsula block between the Peninsula SA and the SG fault. The average inter-block velocities are 11, 10, and 9 mm/yr across SA, HAY, and NCAL respectively. There appears to be a significant component of fault-normal compression across NCAL, whereas SA and HAY faults appear to be, on regional average, purely strike-slip. The velocities for the Sierra Nevada - Great Valley (SNGV) block to the west of NCAL are impressive in their similarity. The cluster of these velocities in a velocity plot forms a tighter grouping compared with the groupings for the other cluster blocks, suggesting a more rigid behavior for this block than the others. We note that for 4 clusters, none of the 3 cluster boundaries illuminate geologic structures other than north-northwest trending dominantly strike-slip faults, so plate motion is not accommodated by large-scale fault-parallel compression or extension in the region or by significant plastic deformation , at least over the time span of the GPS observations. Complexities of interseismic deformation of the upper crust do not allow simple application of inter-block velocities as long-term slip rates on bounding faults. However, 2D dislocation models using inter-block velocities and typical

Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

Directory of Open Access Journals (Sweden)

Ke WEI

2018-04-01

Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization

Climate change in the four corners and adjacent regions: Implications for environmental restoration and land-use planning

Energy Technology Data Exchange (ETDEWEB)

Waugh, W.J. [ed.

1995-09-01

This document contains the workshop proceedings on Climate Change in the Four Corners and Adjacent Regions: Implications for Environmental Restoration and Land-Use Planning which took place September 12-14, 1994 in Grand Junction, Colorado. The workshop addressed three ways we can use paleoenvironmental data to gain a better understanding of climate change and its effects. (1) To serve as a retrospective baseline for interpreting past and projecting future climate-induced environmental change, (2) To differentiate the influences of climate and humans on past environmental change, and (3) To improve ecosystem management and restoration practices in the future. The papers presented at this workshop contained information on the following subjects: Paleoclimatic data from the Pleistocene and Holocene epochs, climate change and past cultures, and ecological resources and environmental restoration. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

Economic and policy implications of pandemic influenza.

Energy Technology Data Exchange (ETDEWEB)

Smith, Braeton J.; Starks, Shirley J.; Loose, Verne W.; Brown, Theresa Jean; Warren, Drake E.; Vargas, Vanessa N.

2010-03-01

Pandemic influenza has become a serious global health concern; in response, governments around the world have allocated increasing funds to containment of public health threats from this disease. Pandemic influenza is also recognized to have serious economic implications, causing illness and absence that reduces worker productivity and economic output and, through mortality, robs nations of their most valuable assets - human resources. This paper reports two studies that investigate both the short- and long-term economic implications of a pandemic flu outbreak. Policy makers can use the growing number of economic impact estimates to decide how much to spend to combat the pandemic influenza outbreaks. Experts recognize that pandemic influenza has serious global economic implications. The illness causes absenteeism, reduced worker productivity, and therefore reduced economic output. This, combined with the associated mortality rate, robs nations of valuable human resources. Policy makers can use economic impact estimates to decide how much to spend to combat the pandemic influenza outbreaks. In this paper economists examine two studies which investigate both the short- and long-term economic implications of a pandemic influenza outbreak. Resulting policy implications are also discussed. The research uses the Regional Economic Modeling, Inc. (REMI) Policy Insight + Model. This model provides a dynamic, regional, North America Industrial Classification System (NAICS) industry-structured framework for forecasting. It is supported by a population dynamics model that is well-adapted to investigating macro-economic implications of pandemic influenza, including possible demand side effects. The studies reported in this paper exercise all of these capabilities.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

From quarks and gluons to baryon form factors.

Science.gov (United States)

Eichmann, Gernot

2012-04-01

I briefly summarize recent results for nucleon and [Formula: see text] electromagnetic, axial and transition form factors in the Dyson-Schwinger approach. The calculation of the current diagrams from the quark-gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects.

Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

Energy Technology Data Exchange (ETDEWEB)

Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)

2014-06-01

A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

A novel form of the membrane protein CD147 that contains an extra Ig-like domain and interacts homophilically

Directory of Open Access Journals (Sweden)

Brown Marion H

2003-11-01

Full Text Available Abstract Background CD147 is a broadly distributed integral membrane glycoprotein with two Ig-like domains implicated in a wide range of functions. It is associated at the cell surface with the monocarboxylate transporters MCT1 and 4 but interactions of the extracellular region have not been characterised. Results We report the characterisation of a form of CD147 with an additional membrane-distal Ig-like domain. In contrast to the two domain form, this three domain form of CD147 interacts homophilically. Surface plasmon resonance analysis using recombinant proteins showed that the interaction was of low affinity (KD ~ 40 μM and this is typical of many interactions between membrane proteins. cDNA for the 3 domain form are rare but have been identified in human and mouse retina. Conclusion The finding that the three domain form of CD147 has an extracellular ligand, that is it interacts homophilically, suggests this interaction may be important in aligning lactate transporters in the retina where lactate is an important metabolite.

A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

International Nuclear Information System (INIS)

Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.

2014-01-01

We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

Energy Technology Data Exchange (ETDEWEB)

Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: todorovk@phys.ethz.ch [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

2014-06-10

We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

Transformation of the Zagreb urban region

Directory of Open Access Journals (Sweden)

Milan Ilić

2004-01-01

Full Text Available Several aspects of the transformation of theZagreb urban region are considered in this work: change in the regionćssize and form, socio-economic transformation, functional transformation andphysiognomic or morphological transformation. It was established that theregionćs form has changed: it is moving from the classic star-like form,characteristic of the early developmental phase of the urban region, to acircular form. The region has experienced evolution in the developmentalsense and reached a phase of absolute decentralization. The process oftransformation in the region is continuing at full pace, while onlyperipheral, mainly small and poorly linked settlements with an unfavorabledemographic balance and processes are lagging behind.

Characterization of phyllosilicates observed in the central Mawrth Vallis region, Mars, their potential formational processes, and implications for past climate

Science.gov (United States)

McKeown, N.K.; Bishop, J.L.; Noe Dobrea, E.Z.; Ehlmann, B.L.; Parente, M.; Mustard, J.F.; Murchie, S.L.; Swayze, G.A.; Bibring, J.-P.; Silver, E.A.

2009-01-01

Mawrth Vallis contains one of the largest exposures of phyllosilicates on Mars. Nontronite, montmorillonite, kaolinite, and hydrated silica have been identified throughout the region using data from the Compact Reconnaissance Imaging Spectrometer for Mars (CRISM). In addition, saponite has been identified in one observation within a crater. These individual minerals are identified and distinguished by features at 1.38-1.42, ???1.91, and 2.17-2.41 ??m. There are two main phyllosilicate units in the Mawrth Vallis region. The lowermost unit is nontronite bearing, unconformably overlain by an Al-phyllosilicate unit containing montmorillonite plus hydrated silica, with a thin layer of kaolinite plus hydrated silica at the top of the unit. These two units are draped by a spectrally unremarkable capping unit. Smectites generally form in neutral to alkaline environments, while kaolinite and hydrated silica typically form in slightly acidic conditions; thus, the observed phyllosilicates may reflect a change in aqueous chemistry. Spectra retrieved near the boundary between the nontronite and Al-phyllosilicate units exhibit a strong positive slope from 1 to 2 ??m, likely from a ferrous component within the rock. This ferrous component indicates either rapid deposition in an oxidizing environment or reducing conditions. Formation of each of the phyllosilicate minerals identified requires liquid water, thus indicating a regional wet period in the Noachian when these units formed. The two main phyllosilicate units may be extensive layers of altered volcanic ash. Other potential formational processes include sediment deposition into a marine or lacustrine basin or pedogenesis. Copyright 2009 by the American Geophysical Union.

Con-forming bodies: the interplay of machines and bodies and the implications of agency in medical imaging.

Science.gov (United States)

Wood, Lisa A

2016-06-01

Attending to the material discursive constructions of the patient body within cone beam computed tomography (CBCT) imaging in radiotherapy treatments, in this paper I describe how bodies and machines co-create images. Using an analytical framework inspired by Science and Technology Studies and Feminist Technoscience, I describe the interplay between machines and bodies and the implications of materialities and agency. I argue that patients' bodies play a part in producing scans within acceptable limits of machines as set out through organisational arrangements. In doing so I argue that bodies are fabricated into the order of work prescribed and embedded within and around the CBCT system, becoming, not only the subject of resulting images, but part of that image. The scan is not therefore a representation of a passive subject (a body) but co-produced by the work of practitioners and patients who actively control (and contort) and discipline their body according to protocols and instructions and the CBCT system. In this way I suggest they are 'con-forming' the CBCT image. A Virtual Abstract of this paper can be found at: https://youtu.be/qysCcBGuNSM. © 2015 Foundation for the Sociology of Health & Illness.

Radiation damage in natural materials: implications for radioactive waste forms

International Nuclear Information System (INIS)

Ewing, R.C.

1981-01-01

The long-term effect of radiation damage on waste forms, either crystalline or glass, is a factor in the evaluation of the integrity of waste disposal mediums. Natural analogs, such as metamict minerals, provide one approach for the evaluaton of radiation damage effects that might be observed in crystalline waste forms, such as supercalcine or synroc. Metamict minerals are a special class of amorphous materials which were initially crystalline. Although the mechanism for the loss of crystallinity in these minerals (mostly actinide-containing oxides and silicates) is not clearly understood, damage caused by alpha particles and recoil nuclei is critical to the metamictization process. The study of metamict minerals allows the evaluation of long-term radiation damage effects, particularly changes in physical and chemical properties such as microfracturing, hydrothermal alteration, and solubility. In addition, structures susceptible to metamictization share some common properties: (1) complex compositions; (2) some degree of covalent bonding, instead of being ionic close-packed MO/sub x/ structures; and (3) channels or interstitial voids which may accommodate displaced atoms or absorbed water. On the basis of these empirical criteria, minerals such as pollucite, sodalite, nepheline and leucite warrant careful scrutiny as potential waste form phases. Phases with the monazite or fluorite structures are excellent candidates

Electromagnetic form factors of hadrons

International Nuclear Information System (INIS)

Zidell, V.S.

1976-01-01

A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

Surface compositions in the Aristarchus Region: Implications for regional stratigraphy

Science.gov (United States)

Hawke, H. R.; Lucey, P. G.; Mccord, T. B.; Pieters, C. M.; Head, J. W.

1984-01-01

Near infrared reflectance spectra for the Aristachus region, obtained using the 2.2m UH telescope at the Mauna Kea Observatory, were reduced and analyzed. The spectra obtained for the central peak, southern floor, southwestern wall, eastern wall, and northwestern wall of Aristachus crater exhibit shallow continuum slopes, relatively strong feldspar bands, pyroxene bands stronger than those typically seen in the spectra of fresh higland features, and pyroxene band centers near l micrometer suggesting the dominance of Ca rich clinopyroxene. The spectrum of the south rim of Aristachus is quite distinct from those of other crater units. The position of Aristrchus on the plateau/mare boundary raises questions concerning compositional variations in crater ejects deposits.

Measuring the Complexity of Urban Form and Design

OpenAIRE

Boeing, Geoff

2017-01-01

Complex systems have become a popular lens for conceptualizing cities, and complexity has substantial implications for urban performance and resilience. This paper develops a typology of methods and measures for assessing the complexity of the built form at the scale of urban design. It extends quantitative methods from urban planning, network science, ecosystems studies, fractal geometry, and information theory to the physical urban form and the analysis of qualitative human experience. Metr...

Democratic cultural policy : democratic forms and policy consequences

OpenAIRE

Gray, Clive

2012-01-01

The forms that are adopted to give practical meaning to democracy are assessed to identify what their implications are for the production of public policies in general and cultural policies in particular. A comparison of direct, representative, democratic elitist and deliberative versions of democracy identifies clear differences between them in terms of policy form and democratic practice. Further elaboration of these differences and their consequences are identified as areas for further res...

Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

Energy Technology Data Exchange (ETDEWEB)

Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

2017-04-20

We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

A consistent and verifiable macroscopic model for the dissolution of liquid CO2 in water under hydrate forming conditions

International Nuclear Information System (INIS)

Radhakrishnan, R.; Demurov, A.; Trout, B.L.; Herzog, H.

2003-01-01

Direct injection of liquid CO 2 into the ocean has been proposed as one method to reduce the emission levels of CO 2 into the atmosphere. When liquid CO 2 is injected (normally as droplets) at ocean depths >500 m, a solid interfacial region between the CO 2 and the water is observed to form. This region consists of hydrate clathrates and hinders the rate of dissolution of CO 2 . It is, therefore, expected to have a significant impact on the injection of liquid CO 2 into the ocean. Up until now, no consistent and predictive model for the shrinking of droplets of CO 2 under hydrate forming conditions has been proposed. This is because all models proposed to date have had too many unknowns. By computing rates of the physical and chemical processes in hydrates via molecular dynamics simulations, we have been able to determine independently some of these unknowns. We then propose the most reasonable model and use it to make independent predictions of the rates of mass transfer and thickness of the hydrate region. These predictions are compared to measurements, and implications to the rates of shrinkage of CO 2 droplets under varying flow conditions are discussed. (author)

The Roots and Implications of East Asian Regionalism

National Research Council Canada - National Science Library

Miller, John

2004-01-01

Regionalism in East Asia is driven by historical patterns of cooperation, the common challenge of the West, the century-long quest for an Asian identity, and growing economic interdependence and integration...

Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

CERN Multimedia

2002-01-01

The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

Intercontinental Transport of Aerosols: Implication for Regional Air Quality

Science.gov (United States)

Chin, Mian; Diehl, Thomas; Ginoux, Paul

2006-01-01

Aerosol particles, also known as PM2.5 (particle diameter less than 2.5 microns) and PM10 (particle diameter less than 10 microns), is one of the key atmospheric components that determine ambient air quality. Current US air quality standards for PM10 (particles with diameter air pollution problems, aerosols can be transported on a hemispheric or global scale. In this study, we use the Goddard Chemistry Aerosol Radiation and Transport (GOCART) model to quantify contributions of long-range transport vs. local/regional pollution sources and from natural vs. anthropogenic sources to PM concentrations different regions. In particular, we estimate the hemispheric impact of anthropogenic sulfate aerosols and dust from major source areas on other regions in the world. The GOCART model results are compared with satellite remote sensing and ground-based network measurements of aerosol optical depth and concentrations.

Discovery of jarosite within the Mawrth Vallis region of Mars: Implications for the geologic history of the region

Science.gov (United States)

Farrand, W. H.; Glotch, T.D.; Rice, J. W.; Hurowitz, J.A.; Swayze, G.A.

2009-01-01

Analysis of visible to near infrared reflectance data from the MRO CRISM hyperspectral imager has revealed the presence of an ovoid-shaped landform, approximately 3 by 5 km in size, within the layered terrains surrounding the Mawrth Vallis outflow channel. This feature has spectral absorption features consistent with the presence of the ferric sulfate mineral jarosite, specifically a K-bearing jarosite (KFe3(SO4)2(OH)6). Terrestrial jarosite is formed through the oxidation of iron sulfides in acidic environments or from basaltic precursor minerals with the addition of sulfur. Previously identified phyllosilicates in the Mawrth Vallis layered terrains include a basal sequence of layers containing Fe-Mg smectites and an upper set of layers of hydrated silica and aluminous phyllosilicates. In terms of its fine scale morphology revealed by MRO HiRISE imagery, the jarosite-bearing unit has fracture patterns very similar to that observed in Fe-Mg smectite-bearing layers, but unlike that observed in the Al-bearing phyllosilicate unit. The ovoid-shaped landform is situated in an east-west bowl-shaped depression superposed on a north sloping surface. Spectra of the ovoid-shaped jarosite-bearing landform also display an anomalously high 600 nm shoulder, which may be consistent with the presence of goethite and a 1.92 ??m absorption which could indicate the presence of ferrihydrite. Goethite, jarosite, and ferrihydrite can be co-precipitated and/or form through transformation of schwertmannite, both processes generally occurring under low pH conditions (pH 2-4). To date, this location appears to be unique in the Mawrth Vallis region and could represent precipitation of jarosite in acidic, sulfur-rich ponded water during the waning stages of drying. ?? 2009 Elsevier Inc. All rights reserved.

Discovery of jarosite within the Mawrth Vallis region of Mars: Implications for the geologic history of the region

Science.gov (United States)

Farrand, William H.; Glotch, Timothy D.; Rice, James W.; Hurowitz, Joel A.; Swayze, Gregg A.

2009-12-01

Analysis of visible to near infrared reflectance data from the MRO CRISM hyperspectral imager has revealed the presence of an ovoid-shaped landform, approximately 3 by 5 km in size, within the layered terrains surrounding the Mawrth Vallis outflow channel. This feature has spectral absorption features consistent with the presence of the ferric sulfate mineral jarosite, specifically a K-bearing jarosite (KFe 3(SO 4) 2(OH) 6). Terrestrial jarosite is formed through the oxidation of iron sulfides in acidic environments or from basaltic precursor minerals with the addition of sulfur. Previously identified phyllosilicates in the Mawrth Vallis layered terrains include a basal sequence of layers containing Fe-Mg smectites and an upper set of layers of hydrated silica and aluminous phyllosilicates. In terms of its fine scale morphology revealed by MRO HiRISE imagery, the jarosite-bearing unit has fracture patterns very similar to that observed in Fe-Mg smectite-bearing layers, but unlike that observed in the Al-bearing phyllosilicate unit. The ovoid-shaped landform is situated in an east-west bowl-shaped depression superposed on a north sloping surface. Spectra of the ovoid-shaped jarosite-bearing landform also display an anomalously high 600 nm shoulder, which may be consistent with the presence of goethite and a 1.92 μm absorption which could indicate the presence of ferrihydrite. Goethite, jarosite, and ferrihydrite can be co-precipitated and/or form through transformation of schwertmannite, both processes generally occurring under low pH conditions (pH 2-4). To date, this location appears to be unique in the Mawrth Vallis region and could represent precipitation of jarosite in acidic, sulfur-rich ponded water during the waning stages of drying.

Article, component, and method of forming an article

Science.gov (United States)

Lacy, Benjamin Paul; Itzel, Gary Michael; Kottilingam, Srikanth Chandrudu; Dutta, Sandip; Schick, David Edward

2018-05-22

An article and method of forming an article are provided. The article includes a body portion separating an inner region and an outer region, an aperture in the body portion, the aperture fluidly connecting the inner region to the outer region, and a conduit extending from an outer surface of the body portion at the aperture and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The method includes providing a body portion separating an inner region and an outer region, providing an aperture in the body portion, and forming a conduit over the aperture, the conduit extending from an outer surface of the body portion and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The article is arranged and disposed for insertion within a hot gas path component.

Meaning-focused vs Form-focused L2 Instruction: Implications for ...

African Journals Online (AJOL)

KATEVG

focus-on-meaning approach to English language instruction) compare with ... L2 use. Proponents of this view are concerned with the question of how this conversion ... processing, it may draw learners' attention to "notice" the form of the target ...

X-ray crystal structure of the N-terminal region of Moloney murine leukemia virus integrase and its implications for viral DNA recognition: N-Terminal Region of M-MuLV Integrase

Energy Technology Data Exchange (ETDEWEB)

Guan, Rongjin [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Aiyer, Sriram [Department of Pharmacology, Robert Wood Johnson Medical School, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Cote, Marie L. [Department of Biochemistry, Robert Wood Johnson Medical School, UMDNJ, Piscataway New Jersey 08854; Xiao, Rong [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Jiang, Mei [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Acton, Thomas B. [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Roth, Monica J. [Department of Pharmacology, Robert Wood Johnson Medical School, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Montelione, Gaetano T. [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Biochemistry, Robert Wood Johnson Medical School, UMDNJ, Piscataway New Jersey 08854

2017-02-03

The retroviral integrase (IN) carries out the integration of a dsDNA copy of the viral genome into the host DNA, an essential step for viral replication. All IN proteins have three general domains, the N-terminal domain (NTD), the catalytic core domain, and the C-terminal domain. The NTD includes an HHCC zinc finger-like motif, which is conserved in all retroviral IN proteins. Two crystal structures of Moloney murine leukemia virus (M-MuLV) IN N-terminal region (NTR) constructs that both include an N-terminal extension domain (NED, residues 1–44) and an HHCC zinc-finger NTD (residues 45–105), in two crystal forms are reported. The structures of IN NTR constructs encoding residues 1–105 (NTR1–105) and 8–105 (NTR8–105) were determined at 2.7 and 2.15 Å resolution, respectively and belong to different space groups. While both crystal forms have similar protomer structures, NTR1–105 packs as a dimer and NTR8–105 packs as a tetramer in the asymmetric unit. The structure of the NED consists of three anti-parallel β-strands and an α-helix, similar to the NED of prototype foamy virus (PFV) IN. These three β-strands form an extended β-sheet with another β-strand in the HHCC Zn2+ binding domain, which is a unique structural feature for the M-MuLV IN. The HHCC Zn2+ binding domain structure is similar to that in HIV and PFV INs, with variations within the loop regions. Differences between the PFV and MLV IN NEDs localize at regions identified to interact with the PFV LTR and are compared with established biochemical and virological data for M-MuLV. Proteins 2017; 85:647–656.

State fragility and its regional implications for peace and stability

DEFF Research Database (Denmark)

Mandrup, Thomas

of the Cold war left a security void, and the fragility, and in some instances collapse, of the state structures resulted in new state formations and new conflicts, both intra- and inter-state in nature. However, conflicts and security challenges in East Africa are due to amongst other things porous borders......, fragile states and bad governance regional in nature, and cannot be solved by the individual states alone. Regional institutions have been in a weak position dealing with these challenges, and attempts have been to strengthen the capacity of these regional institutions. This paper investigates...

High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q²

Energy Technology Data Exchange (ETDEWEB)

Zhan, Xiaohui [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

2010-01-01

Experiment E08-007 measured the proton elastic form factor ratio μ_pG_E/G_M in the range of Q² = 0.3-0.7(GeV/c)² by recoil polarimetry. Data were taken in 2008 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 1.2 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The recoil proton was detected in the left HRS in coincidence with the elasticly scattered electrons tagged by the BigBite spectrometer. The proton polarization was measured by the focal plane polarimeter (FPP). In this low Q² region, previous measurement from Jefferson Lab Hall A (LEDEX) along with various fits and calculations indicate substantial deviations of the ratio from unity. For this new measurement, the proposed statistical uncertainty (< 1%) was achieved. These new results are a few percent lower than expected from previous world data and fits, which indicate a smaller G_Ep at this region. Beyond the intrinsic interest in nucleon structure, the new results also have implications in determining the proton Zemach radius and the strangeness form factors from parity violation experiments.

Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

DEFF Research Database (Denmark)

Larsen, Peter Wilgaard

2017-01-01

The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

Direct Measurement of Dust Attenuation in z approx. 1.5 Star-Forming Galaxies from 3D-HST: Implications for Dust Geometry and Star Formation Rates

Science.gov (United States)

Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B; Conroy, Charlie; Schreiber, Natascha M. Foerster; Franx, Marijn; Fumagalli, Mattia; Lundren, Britt; Momcheva, Ivelina; Nelson, Erica J.;

MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: carrasco@mpifr-bonn.mpg.de [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)

2012-02-10

We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

International Nuclear Information System (INIS)

Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.

2012-01-01

We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

International Nuclear Information System (INIS)

Gyulbudaghian, A.L.; May, J.

2008-01-01

An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

Atomic hydrogen in the Orion star-forming region

International Nuclear Information System (INIS)

Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.

1989-01-01

A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

Current algebra constraints on K13 form factors

International Nuclear Information System (INIS)

Simmons, L.D.

1975-01-01

New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences

Direct ATP photolabeling of Escherichia coli recA proteins: identification of regions required for ATP binding

International Nuclear Information System (INIS)

Banks, G.R.; Sedgwick, S.G.

1986-01-01

When the Escherichia coli RecA protein is UV irradiated in the presence of [alpha- 32 P]ATP, a labeled protein--ATP adduct is formed. All the experimental evidence indicates that, in forming such an adduct, the ATP becomes specifically immobilized in the catalytically relevant ATP binding site. The adduct can also be identified after irradiation of E. coli cell lysates in a similar manner. This direct ATP photolabeling of RecA proteins has been used to identify regions of the polypeptide chain involved in the binding of ATP. The photolabeling of a RecA protein that lacks wild-type carboxy-terminal amino acids is not detectable. A RecA protein in which the amino-terminal sequence NH2-Ala-Ile-Asp-Glu-Asn- is replaced by NH2-Thr-Met-Ile-Thr-Asn-Ser-Ser-Ser- is only about 5% as efficiently photolabeled as the wild-type protein. Both of these RecA protein constructions, however, contain all the elements previously implicated, directly or indirectly, in the binding of ATP. ATP-photolabeled RecA protein has also been chemically cleaved at specific amino acids in order to identify regions of the polypeptide chain to which the nucleotide becomes covalently photolinked. The evidence is consistent with a region comprising amino acids 116-170. Thus, this work and that of others suggest that several disparate regions of the unfolded polypeptide chain may combine to form the ATP binding site upon protein folding or may influence binding through long-range effects

Regional planning without means - search for regional leadership

DEFF Research Database (Denmark)

Groth, Niels Boje; Fertner, Christian

and stakeholders, not least due to its polycentric urban structure with several medium-sized towns. Besides the regional authority and the regions 22 municipalities, sub-regional collaboration is gaining momentum. Furthermore, different fora, councils and associations are engaging in regional issues. However......, collaboration is often focused on specific sectors or sub-regions, while the joint development of the region is left behind. The regional authority has changed its focus from planning to the provision of knowledge, suitable to kick-off joint action with regional stakeholders, while municipalities keep focus...... on their own territories, eventually in the context of one of the new sub-regional collaborations. Based on an empirical analysis of the regional interplay in Southern Denmark and results from the ESPON ReSSI project, we go through these new settings of regional collaboration in the search for new forms...

Regional implications of heat flow of the Snake River Plain, Northwestern United States

Science.gov (United States)

Blackwell, D. D.

1989-08-01

The Snake River Plain is a major topographic feature of the Northwestern United States. It marks the track of an upper mantle and crustal melting event that propagated across the area from southwest to northeast at a velocity of about 3.5 cm/yr. The melting event has the same energetics as a large oceanic hotspot or plume and so the area is the continental analog of an oceanic hotspot track such as the Hawaiian Island-Emperor Seamount chain. Thus, the unique features of the area reflect the response of a continental lithosphere to a very energetic hotspot. The crust is extensively modified by basalt magma emplacement into the crust and by the resulting massive rhyolite volcanism from melted crustal material, presently occurring at Yellowstone National Park. The volcanism is associated with little crustal extension. Heat flow values are high along the margins of the Eastern and Western Snake River Plains and there is abundant evidence for low-grade geothermal resources associated with regional groundwater systems. The regional heat flow pattern in the Western Snake River Plains reflects the influence of crustal-scale thermal refraction associated with the large sedimentary basin that has formed there. Heat flow values in shallow holes in the Eastern Snake River Plains are low due to the Snake River Plains aquifer, an extensive basalt aquifer where water flow rates approach 1 km/yr. Below the aquifer, conductive heat flow values are about 100 mW m -2. Deep holes in the region suggest a systematic eastward increase in heat flow in the Snake River Plains from about 75-90 mW m -2 to 90-110 mW m -2. Temperatures in the upper crust do not behave similarly because the thermal conductivity of the Plio-Pleistocene sedimentary rocks in the west is lower than that in the volcanic rocks characteristic of the Eastern Snake River Plains. Extremely high heat loss values (averaging 2500 mW m -2) and upper crustal temperatures are characteristic of the Yellowstone caldera.

Greenhouse Gas Implications of Peri-Urban Land Use Change in a Developed City under Four Future Climate Scenarios

Directory of Open Access Journals (Sweden)

Alison Rothwell

2016-12-01

Full Text Available Present decisions about urbanization of peri-urban (PU areas may contribute to the capacity of cities to mitigate future climate change. Comprehensive mitigative responses to PU development should require integration of urban form and food production to realise potential trade-offs. Despite this, few studies examine greenhouse gas (GHG implications of future urban development combined with impacts on PU food production. In this paper, four future scenarios, at 2050 and 2100 time horizons, were developed to evaluate the potential GHG emissions implications of feeding and housing a growing urban population in Sydney, Australia. The scenarios were thematically downscaled from the four relative concentration pathways. Central to the scenarios were differences in population, technology, energy, housing form, transportation, temperature, food production and land use change (LUC. A life cycle assessment approach was used within the scenarios to evaluate differences in GHG impacts. Differences in GHG emissions between scenarios at the 2100 time horizon, per area of PU land transformed, approximated 0.7 Mt CO2-e per year. Per additional resident this equated to 0.7 to 6.1 t CO2-e per year. Indirect LUC has the potential to be significant. Interventions such as carbon capture and storage technology, renewables and urban form markedly reduced emissions. However, incorporating cross-sectoral energy saving measures within urban planning at the regional scale requires a paradigmatic shift.

STAR-FORMING OR STARBURSTING? THE ULTRAVIOLET CONUNDRUM

International Nuclear Information System (INIS)

Boquien, M.; Calzetti, D.; Hong, S.; Kennicutt, R.; Dale, D.; Engelbracht, C.; Portouw, J.; Gordon, K. D.; Lee, J. C.

2009-01-01

Compared to starburst galaxies, normal star-forming galaxies have been shown to display a much larger dispersion of the dust attenuation at fixed reddening through studies of the IRX-β diagram (the IR/UV ratio 'IRX' versus the UV color 'β'). To investigate the causes of this larger dispersion and attempt to isolate second parameters, we have used GALEX UV, ground-based optical, and Spitzer infrared imaging of eight nearby galaxies, and examined the properties of individual UV and 24 μm selected star-forming regions. We concentrated on star-forming regions, in order to isolate simpler star formation histories than those that characterize whole galaxies. We find that (1) the dispersion is not correlated with the mean age of the stellar populations; (2) a range of dust geometries and dust extinction curves are the most likely causes for the observed dispersion in the IRX-β diagram, (3) together with some potential dilution of the most recent star-forming population by older unrelated bursts, at least in the case of star-forming regions within galaxies; and (4) we also recover some general characteristics of the regions, including a tight positive correlation between the amount of dust attenuation and the metal content. Although generalizing our results to whole galaxies may not be immediate, the possibility of a range of dust extinction laws and geometries should be accounted for in the latter systems as well.

Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

Science.gov (United States)

Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

2018-03-01

We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

Science.gov (United States)

Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

2013-01-01

Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

Radio continuum interferometry of dark clouds: A search for newly formed HII regions

International Nuclear Information System (INIS)

Gilmore, W.S.

1978-01-01

A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

International Nuclear Information System (INIS)

Quenzer, A.

1977-01-01

The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

DEFF Research Database (Denmark)

Coutens, Audrey; Vastel, C.; Hincelin, U.

2014-01-01

Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

International Nuclear Information System (INIS)

Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel

2015-01-01

In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions

A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)

2015-02-01

In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

Asymptotics of Heavy-Meson Form Factors

CERN Document Server

Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias

1997-01-01

Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

Directory of Open Access Journals (Sweden)

Mahesh Anantha Narayanan

2014-01-01

Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.

Hadronic Form Factors in Asymptotically Free Field Theories

Science.gov (United States)

Gross, D. J.; Treiman, S. B.

1974-01-01

The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

Energy price increases, economic rents, and industrial structure in a small regional economy

Energy Technology Data Exchange (ETDEWEB)

Norrie, K.H.; Percy, M.B.

1982-01-01

The authors model the relationship between natural-resource revenues and regional economic diversification in the context of a general-equilibrium model of a small, open, natural-resource-based regional economy. The model is then used to stimulate the implications of various province-building strategies, and to draw policy implications from this. They find that the efforts to diversify the economy using the fiscal capacity of the region will, in general, impose real welfare losses on the residents of the province, although certain groups, such as land owners, are already better off.

On the Implications of Knowledge Bases for Regional Innovation Policies in Germany

Directory of Open Access Journals (Sweden)

Hassink Robert

2014-12-01

Full Text Available Regional innovation policies have been criticised for being too standardised, one-size-fits-all and place-neutral in character. Embedded in these debates, this paper has two aims: first, to analyse whether industries with different knowledge bases in regions in Germany have different needs for regional innovation policies, and secondly, to investigate whether knowledge bases can contribute to the fine-tuning of regional innovation policies in particular and to a modern, tailor-made, place-based regional innovation policy in general. It concludes that although needs differ due to differences in knowledge bases, those bases are useful only to a limited extent in fine-tuning regional innovation policies

Regional GDP Convergence in the European Regions in the light of the Economic Recession

DEFF Research Database (Denmark)

Sørensen, Nils Karl; Cornett, Andreas P.

2014-01-01

This article investigates the implications of the slowdown of the European economies since 2007 on the process of GDP convergence at the regional NUTS 2 level. We use a nominal data set on GPD per capita divided into the periods 1995-2006 and 2007-2010. Using the notion of β-convergence we find...

THE ECONOMY AND ENERGY OF THE BLACK SEA REGION

Directory of Open Access Journals (Sweden)

Maria-Floriana Popescu

2014-12-01

Full Text Available The Black Sea region has proved to be an emerging hub for Europe’s security and has experienced several changes and a great development at the beginning of the twenty-first century. This process is currently carried out, and has important implications for European security in a broader definition of the term - to achieve traditional military security, but also tackling other challenges at the address soft security issues, such as organized crime. Located at the crossroads of three regions of paramount importance - Europe, Middle East and Central Asia – the Black Sea region is a major transit area for energy and at the same time, an important source of asymmetric risks and outbreaks of conflicts. Therefore, analysing this region from an economical point of view, but not forgetting the energy security implications for this area, represents the main focus of this article, along with underlining the importance of various actors in the region and their actions’ impact on the future development of the Black Sea territory and surroundings.

The Location of ICT activities in EU regions. Implications for regional policies

Directory of Open Access Journals (Sweden)

Salvador Barrios

2008-01-01

estimaciones econométricas sobre la localización de las empresas en la industria de las TIC a través de las regiones de la UE. El trabajo considera específicamente el caso de la localización de las multinacionales. Los resultados de los determinantes de la localización de las empresas parece diferir ampliamente dependiendo del sector de las TIC considerado, como del tipo de empresa considerada. A partir de estos resultados se deriva un número de implicaciones de política.

Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

Science.gov (United States)

Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

2014-10-01

Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

Dispersive analysis of the pion transition form factor

Science.gov (United States)

Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

2014-11-01

We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

Influence Of Competence Cultural Organization And Job Satisfaction Of Career Development And Implications On The Performance Of EmployeesSurvey On State-Owned Enterprises Soes In The Region Of Cirebon

Directory of Open Access Journals (Sweden)

Zuki Kurniawan

2017-12-01

Full Text Available The purpose of this study is describing and analyzing the influence of competence organizational culture and career development for job satisfaction and its implications on the performance of employees. The purpose of this study is determining the effect of competence organizational culture and career development for satisfaction and its implications for employee performance improvement of SOEs in the region of Cirebon either partially or simultaneously. The method used is descriptive verification with the type of survey sampling using simple random sampling technique. The object of the study is conducting on employees of State Owned Enterprises SOEs Cirebon region with the sample of 240 respondents from the population of 605. The data analysis is descriptive analysis and verification using the Structural Equation Model SEM with the program Linear Structural Relationship LISREL 8.80. The results showed that partial and simultaneous job satisfaction career development competency and organizational culture affect the performance. Competencies organizational culture career development and job satisfaction simultaneously positive and significant effect on employee performance. However the partial organizational culture is not significant to affect the performance of employee. The greatest good for job satisfaction on employee performance and career development is variable. Managerial implications based on the analysis of research need to improve performance through job satisfaction in any aspect expectations are met while the priority in improving job satisfaction and employee performance should give priority to the aspects of career development assessment further premises employee competence skills and later human aspects of organizational culture with aspect results orientation.

Formation of 3D cholesterol crystals from 2D nucleation sites in lipid bilayer membranes: implications for atherosclerosis.

Science.gov (United States)

Varsano, Neta; Fargion, Iael; Wolf, Sharon G; Leiserowitz, Leslie; Addadi, Lia

2015-02-04

Atherosclerosis is the major precursor of cardiovascular disease. The formation of cholesterol crystals in atherosclerotic plaques is associated with the onset of acute pathology. The cholesterol crystals induce physical injury in the plaque core, promoting cell apoptosis and triggering an increased inflammatory response. Herein we address the question of how cholesterol crystal formation occurs in atherosclerosis. We demonstrate that three-dimensional (3D) cholesterol crystals can undergo directed nucleation from bilayer membranes containing two-dimensional (2D) cholesterol crystalline domains. We studied crystal formation on supported lipid bilayers loaded with exogenous cholesterol and labeled using a monoclonal antibody that specifically recognizes ordered cholesterol arrays. Our findings show that 3D crystals are formed exclusively on the bilayer regions where there are segregated 2D cholesterol crystalline domains and that they form on the domains. This study has potentially significant implications for our understanding of the crucial step in the mechanism by which atherosclerotic lesions form.

YOUNG STELLAR OBJECTS IN THE LARGE MAGELLANIC CLOUD STAR-FORMING REGION N206

International Nuclear Information System (INIS)

Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.

2010-01-01

We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.

Proton electromagnetic form factors: present status and future perspectives at PANDA

Directory of Open Access Journals (Sweden)

Tomasi-Gustafsson E.

2015-01-01

Full Text Available Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt. Measurements of the reaction p̅ + p → e+ + e− by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold, through the reaction p̅ + p → e+ + e− + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

Satirical drama, political corruption and development implications for ...

African Journals Online (AJOL)

Satirical drama, political corruption and development implications for Nigeria: a reflection on Ola Rotimi's Our husband has gone mad again. ... The corrupt tendencies of this select few, which come in various forms, have ... from 32 Countries:.

Forms of educational support for students with disabilities or educational needs in the Universidad National de Costa Rica, and implications for their professional training

Directory of Open Access Journals (Sweden)

Angélica Fontana Hernández

2017-09-01

Full Text Available This article presents the forms of educational support for students with disabilities or educational needs in the university environment, and their implications for these students’ professional training, according to results obtained through the FIDA Proyecto Percepciones y realidades en la atención de las necesidades educativas: propuesta de desarrollo profesional y su implementación en la Universidad Nacional (código 0524-10 del año 2012 al 2015. [Project Perceptions and realities in addressing educational needs: professional development proposal, and its implementation in the Universidad Nacional (code 0524-10 between 2012 and 2015[. One hundred and ninety-one students participated in this study (76 men and 115 women, who were enrolled in different careers in several UNA Sites (Central, Brunca, and Chorotega, as well as 427 staff members (181 men, and 246 women. The methodology uses a qualitative approach; 15 workshops and 65 individual interviews were conducted with students to gather their observations. It was found that only some of the students receive individual assistance (during and outside classes, and occasionally tutoring (in English, Mathematics and Chemistry by academic staff of the institution in the Central Site. For instance, more time is provided for them to take exams, during which they receive individual instructions; this is also done when they prepare research projects. One finding that stands out is that most students of UNA Regional Sites stated that their opinion is not taken into consideration by academic staff when determining and implementing adjustments in methodology or for evaluating the courses they receive. On the other hand, in the Central Site, most members of the group of students with disabilities talk with academic staff about defining at least types of adjustment or educational assistance.

Urban form and heat consumption, a comparative study in Copenhagen districts

DEFF Research Database (Denmark)

Mohammadi Dehcheshme, Mostafa; Jensen, Jesper Ole

Since urban form and land use patterns significantly influence the cities energy needs, the study linkage of energy consumption and urban form is an interdisciplinary issue and one the current central topics of urban planners in recent years. Our concern in this paper, therefore, is to address...... the implications of urban development and form in terms of its impact on energy consumption in ten districts of Copenhagen city. As comparative study, this paper is trying to respond the question: How does urban form impact the heat consumption in households in Copenhagen districts? To respond this question, two...

Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

International Nuclear Information System (INIS)

Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

1995-01-01

A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

Territory and Sustainable Tourism Development: a Space-Time Analysis on European Regions

Directory of Open Access Journals (Sweden)

João Romão

2017-07-01

Full Text Available In the long run, tourism competitiveness depends on the sustainable use of territorial assets: the differentiation of destinations depends on the integration of cultural and natural resources into the tourism supply, but also on their preservation over time. The link between competitiveness and sustainability is the staring point for our analysis of the relationships between regional tourism competitiveness, the dynamics of tourism demand and investment and the existence of natural resources and cultural assets in European regions, by using advanced spatial econometric techniques. Despite the close relationship between tourism activities and the characteristics of the territory, the application of methods of spatial analysis methods in tourism studies is still scarce and the results of this work clearly show their potential for this field of research. Among the main findings of this paper, it was observed that natural resources do not have the expected positive impacts on regional tourism competitiveness and that European regions with more abundant natural resources are often developing unsustainable forms of mass tourism, with low value added and scarce benefits for the host communities. The existence of spatial correlation effects suggests that positive spillovers arising from tourism dynamics in neighbourhood regions prevail over potential negative effects related to the competition between destinations. Policy and managerial implications of these results are discussed and further research questions are suggested.

Regional and non-regional cults of affliction in Western Zambia

NARCIS (Netherlands)

Binsbergen, W.M.J.; Werbner, R.P.

1977-01-01

A generic relation holds between two types of cult of affliction in formerly Barotseland. Cults of one type, the non-regional, form a substratum out of which cults of the other type, the regional, may spring forth under certain conditions, and into which they submerge again under different

Air pollution and health implications of regional electricity transfer at generational centre and design of compensation mechanism

Science.gov (United States)

Relhan, Nemika

India's electricity generation is primarily from coal. As a result of interconnection of grid and establishment of pithead power plants, there has been increased electricity transfer from one region to the other. This results in imbalance of pollution loads between the communities located in generation vis-a-vis consumption region. There may be some states, which are major power generation centres and hence are facing excessive environmental degradation. On the other hand, electricity importing regions are reaping the benefits without paying proper charges for it because present tariff structure does not include the full externalities in it. The present study investigates the distributional implications in terms of air pollution loads between the electricity generation and consumption regions at the state level. It identifies the major electricity importing and exporting states in India. Next, as a case study, it estimates the health damage as a result of air pollution from thermal power plants (TPPs) located in a critically polluted region that is one of the major generator and exporter of electricity. The methodology used to estimate the health damage is based on impact pathway approach. In this method, air pollution modelling has been performed in order to estimate the gridded Particulate Matter (PM) concentration at various receptor locations in the study domain. The air quality modeling exercise helps to quantify the air pollution concentration in each grid and also apportion the contribution of power plants to the total concentration. The health impacts as a result of PM have been estimated in terms of number of mortality and morbidity cases using Concentration Response Function (CRF's) available in the literature. Mortality has been converted into Years of Life Lost (YOLL) using life expectancy table and age wise death distribution. Morbidity has been estimated in terms of number of cases with respect to various health end points. To convert this health

Implications of climate change in the ROPME region: an overview

Energy Technology Data Exchange (ETDEWEB)

Hassan, M.E.; Gerges, M.A.

1994-12-31

The Regional Organization for the Protection of the Marine Environment (ROPME) region is divided into three areas: SA-I, the northern part of the Arabian Sea bounded by the south coast of the Sultanate of Oman, the mouth of the Gulf of Oman and the southern coast of the Islamic Republic of Iran; SA-II, the Gulf of Oman; and SA-III named as the Persian or Arabian Gulf. SA-I is the prime representative of the monsoonal weather system, which produces strong summertime upwelling resulting in rich fisheries that disappear in the winter. SA-II shows transition between the monsoonal system and the desert belt climate of SA-III. Its shallowness mean that the annual range of water temperature is the greatest for any water body freely connected to the world ocean. This restricts the ecosystems that can survive. It also enhances the effect of sea level rise on the tidal pattern. Because the SA-III region is the world`s major oil and gas extraction area, resulting land subsidence can produce an apparent sea level rise of the same order of magnitude as that postulated from expected climate change. Observed sea level rise could be twice the global rate. The shallowness of the area means that the change of tidal pattern resulting from the change of depth will be very dramatic. To help combat climate change it is recommended that: a high quality dense tide recording network be set up and connected to a land subsidence recording network; a regional central data collecting and data processing centre be identified in the region; an active participation in international relevant programs such as TOGA and GOOS by ROPME Member States be maintained; and environmental non-Governmental Organizationsshould be encouraged to publicise these issues.

REGIONAL BLACK SEA ARCHITECTURE AND CONSEQUENCES FOR THE REGIONAL COOPERATION FRAMEWORK

Directory of Open Access Journals (Sweden)

Alina Homorozean

2010-12-01

Full Text Available Sometimes considered an asset, other times a liability, the Black Sea started recently to be regarded as a region. However, the Black Sea Region lacks a common vision, often due to the complicated and often inefficient nexus of regional cooperation initiatives. Following the logic of finding regional solutions for regional problems, this paper aims to assess existing institutional and regional initiatives, reflecting on the implications for the success of Black Sea regionalism in creating patterns of sustained and sustainable development and a high degree of actors' involvement.This paper concentrates on two complementary research questions: What is the regional order in the BSR and what does it imply for its future? What is the current contribution of the most significant cooperation initiatives and what are the consequences for regional institutionalism? For the purpose of this paper, I draw on best-practices from other two regions: the Northern Dimension and South- East Asia. Through a comparative perspective, I suggest an analysis of the most important initiatives: BSEC, CDC, Black Sea Synergy, Eastern Partnership, Baku Initiative and the BSF. This paper argues that a possible strategic solution for successful policy development lies in the creation of an integrated regional cooperation package, functioning on the principles of multi-speed and multi-dimensional cooperation in several policy fields, in a context in which the BSR seems to be caught between two paradigms: a European and a Russian-oriented one.

Dynamic positional fate map of the primary heart-forming region.

Science.gov (United States)

Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J

2009-08-15

Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

Evaluation of the ability of commercial wine yeasts to form biofilms (mats) and adhere to plastic: implications for the microbiota of the winery environment.

Science.gov (United States)

Tek, Ee Lin; Sundstrom, Joanna F; Gardner, Jennifer M; Oliver, Stephen G; Jiranek, Vladimir

2018-02-01

Commercially available active dried wine yeasts are regularly used by winemakers worldwide to achieve reliable fermentations and obtain quality wine. This practice has led to increased evidence of traces of commercial wine yeast in the vineyard, winery and uninoculated musts. The mechanism(s) that enables commercial wine yeast to persist in the winery environment and the influence to native microbial communities on this persistence is poorly understood. This study has investigated the ability of commercial wine yeasts to form biofilms and adhere to plastic. The results indicate that the biofilms formed by commercial yeasts consist of cells with a combination of different lifestyles (replicative and non-replicative) and growth modes including invasive growth, bud elongation, sporulation and a mat sectoring-like phenotype. Invasive growth was greatly enhanced on grape pulp regardless of strain, while adhesion on plastic varied between strains. The findings suggest a possible mechanism that allows commercial yeast to colonise and survive in the winery environment, which may have implications for the indigenous microbiota profile as well as the population profile in uninoculated fermentations if their dissemination is not controlled. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Honeybee colony marketing and its implications for queen rearing ...

African Journals Online (AJOL)

Honeybee colony marketing and its implications for queen rearing and beekeeping development in Werieleke ... Thus, colony marketing is an important venture in Werieleke district of Tigray region. ... EMAIL FULL TEXT EMAIL FULL TEXT

Child Rearing Practices in Nigeria: Implications for Mental Health ...

African Journals Online (AJOL)

Child Rearing Practices in Nigeria: Implications for Mental Health. ... over time are important, especially as this region is undergoing rapid transformation. ... Through policy and aggressive health education, traditional child rearing practices in ...

Genetic architecture of HIV-1 genes circulating in north India & their functional implications.

Science.gov (United States)

Neogi, Ujjwal; Sood, Vikas; Ronsard, Larence; Singh, Jyotsna; Lata, Sneh; Ramachandran, V G; Das, S; Wanchu, Ajay; Banerjea, Akhil C

2011-12-01

This review presents data on genetic and functional analysis of some of the HIV-1 genes derived from HIV-1 infected individuals from north India (Delhi, Punjab and Chandigarh). We found evidence of novel B/C recombinants in HIV-1 LTR region showing relatedness to China/Myanmar with 3 copies of Nfκb sites; B/C/D mosaic genomes for HIV-1 Vpr and novel B/C Tat. We reported appearance of a complex recombinant form CRF_02AG of HIV-1 envelope sequences which is predominantly found in Central/Western Africa. Also one Indian HIV-1 envelope subtype C sequence suggested exclusive CXCR4 co-receptor usage. This extensive recombination, which is observed in about 10 per cent HIV-1 infected individuals in the Vpr genes, resulted in remarkably altered functions when compared with prototype subtype B Vpr. The Vpu C was found to be more potent in causing apoptosis when compared with Vpu B when analyzed for subG1 DNA content. The functional implications of these changes as well as in other genes of HIV-1 are discussed in detail with possible implications for subtype-specific pathogenesis highlighted.

Managerialism and higher education governance: Implications for ...

African Journals Online (AJOL)

This article identifies some of the implications of corporate forms of higher education governance for the management of South African universities. It explores corporate higher educational governance with reference to institutional autonomy incorporating academic freedom. It is the contention of this article that the primary ...

Invited review: climate change impacts in polar regions: lessons from Antarctic moss bank archives.

Science.gov (United States)

Royles, Jessica; Griffiths, Howard

2015-03-01

Mosses are the dominant plants in polar and boreal regions, areas which are experiencing rapid impacts of regional warming. Long-term monitoring programmes provide some records of the rate of recent climate change, but moss peat banks contain an unrivalled temporal record of past climate change on terrestrial plant Antarctic systems. We summarise the current understanding of climatic proxies and determinants of moss growth for contrasting continental and maritime Antarctic regions, as informed by 13C and 18O signals in organic material. Rates of moss accumulation are more than three times higher in the maritime Antarctic than continental Antarctica with growing season length being a critical determinant of growth rate, and high carbon isotope discrimination values reflecting optimal hydration conditions. Correlation plots of 13C and 18O values show that species (Chorisodontium aciphyllum / Polytrichum strictum) and growth form (hummock / bank) are the major determinants of measured isotope ratios. The interplay between moss growth form, photosynthetic physiology, water status and isotope composition are compared with developments of secondary proxies, such as chlorophyll fluorescence. These approaches provide a framework to consider the potential impact of climate change on terrestrial Antarctic habitats as well as having implications for future studies of temperate, boreal and Arctic peatlands. There are many urgent ecological and environmental problems in the Arctic related to mosses in a changing climate, but the geographical ranges of species and life-forms are difficult to track individually. Our goal was to translate what we have learned from the more simple systems in Antarctica, for application to Arctic habitats. © 2014 John Wiley & Sons Ltd.

Diode having trenches in a semiconductor region

Energy Technology Data Exchange (ETDEWEB)

Palacios, Tomas Apostol; Lu, Bin; Matioli, Elison de Nazareth

2016-03-22

An electrode structure is described in which conductive regions are recessed into a semiconductor region. Trenches may be formed in a semiconductor region, such that conductive regions can be formed in the trenches. The electrode structure may be used in semiconductor devices such as field effect transistors or diodes. Nitride-based power semiconductor devices are described including such an electrode structure, which can reduce leakage current and otherwise improve performance.

Corporate social responsibility in regional and international entrepreneurship

NARCIS (Netherlands)

Fakhrutdinov, A. (Artyom)

2016-01-01

http://dx.doi.org/10.14261/postit/EF4989E2-2F5F-4E6B-B91D7CFEBE91755D In 2015 and 2016, Saxion University of Applied Sciences organized the 2nd and 3rd edition of the Regional Innovation and Entrepreneurship Conference (RIEC). This paper is debating the regional implications of Corporate Social

Regional differences in entrepreneurial perceptions and implications for the Romanian competitiveness policy

Directory of Open Access Journals (Sweden)

Nicolae Mariana

2016-04-01

Full Text Available Understanding entrepreneurship as being spatially rooted transforms it in a regional and national competitiveness factor. Despite the increasing importance of the territorial dimension in supporting economic growth at policy and declarative levels, in practice, in Romania, the territorial structure and spatial organization of the economy contributes little to the national value added. In this context, we study regional differences in entrepreneurial initiative and perception and their possible impact on the national competitiveness strategy. We use primary data collected in three Romanian regions (Centre, North-East, Bucureşti-Ilfov and conduct a statistical analysis of the data. The results indicate different comparative regional profiles. The regional differences in the intentions, motivations, barriers and limitation for entrepreneurship confirm the theoretical view that personal motivations of becoming an entrepreneur are determined by environmental conditions. We conclude that the regional differences should be taken into account in the elaboration of the competitiveness policy, corroborated with the results of other similar studies.

17 CFR 259.0-1 - Availability of forms.

Science.gov (United States)

2010-04-01

... may inspect the forms at this address and at the Commission's regional and district offices. (See... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Availability of forms. 259.0-1 Section 259.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS...

Contemporary Trans-regional Cooperation between Europe and Asia in a Changing World

Directory of Open Access Journals (Sweden)

Beginda Pakpahan

2010-11-01

Full Text Available This article is concerned with contemporary trans-regional cooperation between Europe and Asia in a changing world. It examines the emerging economic relationship between the EU and Asia and possible challenges and implications facing both regions. It argues that Europe - Asia economic and commercial ties are likely in the future to result in unbalanced economic development between both these regions; in short, future agreements are likely to disproportionately favour Europe. Therefore, the economic and commercial ties between these two regions should aim to develop the least advanced countries in Asia. The article argues that ASEM can be empowered as a common flexible framework for bilateral and inter-regional trade initiatives between both regions; it can be empowered to manage and monitor these trade initiatives and their social implications for vulnerable ASEM countries. The main objective of this article is to contribute a clearer understanding of the current EU - Asia relationship in the context of ASEM.

Implications of Climate Change for Rural Tourism in the Nordic Region

NARCIS (Netherlands)

Nicholls, S.; Amelung, B.

2015-01-01

In many rural regions, including those of the Nordic region, a former dependence on primary activities such as fishing, forestry, mining and/or agriculture has been superseded in recent decades by increasing involvement in the tourism sector. The purpose of this paper is to explore the potential

Implications of Hegel's Theories of Language on Second Language Teaching

Science.gov (United States)

Wu, Manfred

2016-01-01

This article explores the implications of Hegel's theories of language on second language (L2) teaching. Three among the various concepts in Hegel's theories of language are selected. They are the crucial role of intersubjectivity; the primacy of the spoken over the written form; and the importance of the training of form or grammar. Applying…

Intrusive images in psychological disorders: characteristics, neural mechanisms, and treatment implications.

Science.gov (United States)

Brewin, Chris R; Gregory, James D; Lipton, Michelle; Burgess, Neil

2010-01-01

Involuntary images and visual memories are prominent in many types of psychopathology. Patients with posttraumatic stress disorder, other anxiety disorders, depression, eating disorders, and psychosis frequently report repeated visual intrusions corresponding to a small number of real or imaginary events, usually extremely vivid, detailed, and with highly distressing content. Both memory and imagery appear to rely on common networks involving medial prefrontal regions, posterior regions in the medial and lateral parietal cortices, the lateral temporal cortex, and the medial temporal lobe. Evidence from cognitive psychology and neuroscience implies distinct neural bases to abstract, flexible, contextualized representations (C-reps) and to inflexible, sensory-bound representations (S-reps). We revise our previous dual representation theory of posttraumatic stress disorder to place it within a neural systems model of healthy memory and imagery. The revised model is used to explain how the different types of distressing visual intrusions associated with clinical disorders arise, in terms of the need for correct interaction between the neural systems supporting S-reps and C-reps via visuospatial working memory. Finally, we discuss the treatment implications of the new model and relate it to existing forms of psychological therapy.

Producing custom regional climate data sets for impact assessment with xarray

Science.gov (United States)

Simcock, J. G.; Delgado, M.; Greenstone, M.; Hsiang, S. M.; Kopp, R. E.; Carleton, T.; Hultgren, A.; Jina, A.; Nath, I.; Rising, J. A.; Rode, A.; Yuan, J.; Chong, T.; Dobbels, G.; Hussain, A.; Song, Y.; Wang, J.; Mohan, S.; Larsen, K.; Houser, T.

2017-12-01

Research in the field of climate impact assessment and valuation frequently requires the pairing of economic observations with historical or projected weather variables. Impact assessments with large geographic scope or spatially aggregated data frequently require climate variables to be prepared for use with administrative/political regions, economic districts such as utility service areas, physical regions such as watersheds, or other larger, non-gridded shapes. Approaches to preparing such data in the literature vary from methods developed out of convenience to more complex measures intended to account for spatial heterogeneity. But more sophisticated methods are difficult to implement, from both a theoretical and a technical standpoint. We present a new python package designed to assist researchers in the preparation of historical and projected climate data for arbitrary spatial definitions. Users specify transformations by providing (a) sets of regions in the form of shapefiles, (b) gridded data to be transformed, and, optionally, (c) gridded weights to use in the transformation. By default, aggregation to regions is conducted such that the resulting regional data draws from each grid cell according to the cell's share of total region area. However, researchers can provide alternative weighting schemes, such that the regional data is weighted by, for example, the population or planted agricultural area within each cell. An advantage of this method is that it enables easy preparation of nonlinear transformations of the climate data before aggregation to regions, allowing aggregated variables to more accurately capture the spatial heterogeneity within a region in the transformed data. At this session, we will allow attendees to view transformed climate projections, examining the effect of various weighting schemes and nonlinear transformations on aggregate regional values, highlighting the implications for climate impact assessment work.

Measurement of weak meson form factors in spacelike regions

CERN Document Server

Brene, N

1973-01-01

With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

Federal Tax Implications of Charitable Gift Annuities

Science.gov (United States)

Teitell, Conrad

1975-01-01

Surveys the federal tax implications of "immediate" charitable gift annuities (annuity payments beginning within one year of transfer) and "deferred payment" charitable gift annuities (beginning at a specified date), both of which enable individuals to make a charitable gift, retain a form of life income, and achieve federal…

Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey

Science.gov (United States)

Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.

2015-05-01

Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

Water deuteration in star-forming regions: Contribution of Herschel/HIFI spectroscopic data

International Nuclear Information System (INIS)

Coutens, Audrey

2012-01-01

cloud. The HDO/H_2O ratios as well as the D_2O/HDO ratios determined in IRAS 16293-2422 enable to constrain the conditions of water formation in this kind of objects and in particular suggest that water would be formed before the gravitational collapse of the cloud. This study was then extended to other solar-type protostars NGC1333 IRAS4A and NGC1333 IRAS4B, for which I estimated the abundances of deuterated water and noticed that an extended absorbing layer also surrounds these sources. The high HDO/H_2O ratios determined in IRAS 16293-2422 suggest that mechanisms are required between the Class 0 stage and the comets formation to decrease these isotopic ratios. It is however necessary to study a larger sample of protostars to know if this trend is observed in most of the sources. The HDO abundances obtained in NGC1333 IRAS4A and NGC1333 IRAS4B will consequently be useful to estimate their HDO/H_2O ratios. Finally, I also studied deuterated water in protostellar objects more massive and more luminous than solar-type protostars and show here the case of the ultra-compact HII region G34.26+0.15. (author) [fr

Rural Policy and the New Regional Economics: Implications for Rural America.

Science.gov (United States)

Quigley, John M.

This paper discusses gross economic and demographic trends in rural and urban America during the past 30 years, the kinds of competitive advantages enjoyed by urban and rural regions, and insights offered by the new regional economics concerning exploitation of those advantages. The importance of agriculture has declined in rural areas, while that…

Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

Energy Technology Data Exchange (ETDEWEB)

Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: rbeaton@virginia.edu [Department of Physics, New York University, New York, NY 10003 (United States)

2014-08-01

We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

International Nuclear Information System (INIS)

Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael

2014-01-01

We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

TADPOL: A 1.3 mm SURVEY OF DUST POLARIZATION IN STAR-FORMING CORES AND REGIONS

International Nuclear Information System (INIS)

Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran

2014-01-01

We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article

Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars

Science.gov (United States)

Hargitai, H. I.; Gulick, V. C.; Glines, N. H.

2017-09-01

The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

Cisplatin carbonato complexes. Implications for uptake, antitumor properties, and toxicity.

Science.gov (United States)

Centerwall, Corey R; Goodisman, Jerry; Kerwood, Deborah J; Dabrowiak, James C

2005-09-21

The reaction of aquated cisplatin with carbonate which is present in culture media and blood is described. The first formed complex is a monochloro monocarbonato species, which upon continued exposure to carbonate slowly forms a biscarbonato complex. The formation of carbonato species under conditions that simulate therapy may have important implications for uptake, antitumor properties, and toxicity of cisplatin.

17 CFR 209.0-1 - Availability of forms.

Science.gov (United States)

2010-04-01

... may inspect the forms at this address and at the Commission's regional offices. (See § 200.11 of this... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Availability of forms. 209.0-1 Section 209.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED...

Heat flow study of the Emeishan large igneous province region: Implications for the geodynamics of the Emeishan mantle plume

Science.gov (United States)

Jiang, Qiang; Qiu, Nansheng; Zhu, Chuanqing

2018-01-01

The Emeishan large igneous province (ELIP) is widely considered to be a consequence of a mantle plume. The supporting evidence includes rapid emplacement, voluminous flood basalt eruptions, and high mantle potential temperature estimates. Several studies have suggested that there was surface uplift prior to the eruption of the Emeishan flood basalts. Additionally, the plume's lateral extent is hard to constrain and has been variously estimated to be 800-1400 km in diameter. In this study, we analyzed present-day heat flow data and reconstructed the Permian paleo-heat flow using vitrinite reflectance and zircon (U-Th)/He thermochronology data in the ELIP region and discussed implications for the geodynamics of the Emeishan mantle plume. The present-day heat flow is higher in the inner and intermediate zones than in the outer zone, with a decrease of average heat flow from 76 mW/m2 to 51 mW/m2. Thermal history modeling results show that an abnormal high paleo-heat flow of 90-110 mW/m2 was caused by the Emeishan mantle plume activity. Based on the present-day heat flow data, we can calculate that there is lithospheric thinning in the central ELIP region, which may be due to the destruction of the lithosphere by mantle plume upwelling and magmatic underplating. The Permian paleo-heat flow anomaly implies that there was a temperature anomaly in the mantle. The ascending high-temperature mantle plume and the thinned lithosphere may have induced the large-scale uplift in the ELIP region. According to the range of the surface heat flow anomaly, it can be estimated that the diameter of the flattened head of the Emeishan mantle plume could have reached 1600-1800 km. Our research provides new insights into the geodynamics of the Emeishan mantle plume through study of heat flow.

Comparative Genomics of Methanopyrus sp. SNP6 and KOL6 Revealing Genomic Regions of Plasticity Implicated in Extremely Thermophilic Profiles

Directory of Open Access Journals (Sweden)

Zhiliang Yu

2017-07-01

Full Text Available Methanopyrus spp. are usually isolated from harsh niches, such as high osmotic pressure and extreme temperature. However, the molecular mechanisms for their environmental adaption are poorly understood. Archaeal species is commonly considered as primitive organism. The evolutional placement of archaea is a fundamental and intriguing scientific question. We sequenced the genomes of Methanopyrus strains SNP6 and KOL6 isolated from the Atlantic and Iceland, respectively. Comparative genomic analysis revealed genetic diversity and instability implicated in niche adaption, including a number of transporter- and integrase/transposase-related genes. Pan-genome analysis also defined the gene pool of Methanopyrus spp., in addition of ~120-Kb genomic region of plasticity impacting cognate genomic architecture. We believe that Methanopyrus genomics could facilitate efficient investigation/recognition of archaeal phylogenetic diverse patterns, as well as improve understanding of biological roles and significance of these versatile microbes.

Non-robust dynamic inferences from macroeconometric models: Bifurcation stratification of confidence regions

Science.gov (United States)

Barnett, William A.; Duzhak, Evgeniya Aleksandrovna

2008-06-01

Grandmont [J.M. Grandmont, On endogenous competitive business cycles, Econometrica 53 (1985) 995-1045] found that the parameter space of the most classical dynamic models is stratified into an infinite number of subsets supporting an infinite number of different kinds of dynamics, from monotonic stability at one extreme to chaos at the other extreme, and with many forms of multiperiodic dynamics in between. The econometric implications of Grandmont’s findings are particularly important, if bifurcation boundaries cross the confidence regions surrounding parameter estimates in policy-relevant models. Stratification of a confidence region into bifurcated subsets seriously damages robustness of dynamical inferences. Recently, interest in policy in some circles has moved to New-Keynesian models. As a result, in this paper we explore bifurcation within the class of New-Keynesian models. We develop the econometric theory needed to locate bifurcation boundaries in log-linearized New-Keynesian models with Taylor policy rules or inflation-targeting policy rules. Central results needed in this research are our theorems on the existence and location of Hopf bifurcation boundaries in each of the cases that we consider.

Regional and international implications of the Iranian nuclear crisis; Les implications regionales et internationales de la crise nucleaire iranienne

Energy Technology Data Exchange (ETDEWEB)

Reveillard, Ch

2006-07-15

Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

International Nuclear Information System (INIS)

Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus

2015-01-01

We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively

SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: daemgen@astro.utoronto.ca [Department of Astronomy, Stockholm University, Stockholm (Sweden)

2015-02-01

We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

Implications for Gender Relations of Summons-Response and Address Forms in Dagbanli

Directory of Open Access Journals (Sweden)

Salifu, Nantogma Alhassan

2014-02-01

Full Text Available This paper examines the structure and function of the summons and response in Dagbanli as well as address forms in the husband-wife relation. The Dagbanli language imposes different response forms on males and females and asymmetrical address terms between husband and wife. Drawing from my knowledge of the language as a native speaker and from observed practices of other speakers as well as from insights of key informants, I apply theories of sociolinguistics and pragmatics to analyze these simple conversational acts and I argue that they do not only reflect the sex differences of speakers but embed a larger gender ideology of unequal social relations between males and females in the Dagomba society.

Form CMS-2728 data versus erythropoietin claims data: implications for quality of care studies.

Science.gov (United States)

Beaubrun, Anne C; Kanda, Eiichiro; Bond, T Christopher; McClellan, William M

2013-01-01

Medical Evidence Report Form CMS-2728 data is frequently used to study US dialysis patients, but the validity of these data have been called into question. We compared predialysis erythropoietin use as recorded on Form CMS-2728 with claims data as part of an assessment of quality of care among hemodialysis patients. Medicare claims were linked to Form CMS-2728 data for 18,870 patients. Dialysis patients, 67 years old or older, who started dialysis from 1 June 2005 to 31 May 2007 were eligible. Logistic and multivariate regressions were used to compare the use of either Form CMS-2728 or the corresponding claims data to predict mortality and the probability of meeting target hemoglobin levels. The sensitivity, specificity, and kappa coefficient for the predialysis erythropoietin indicator were 58.0%, 78.4%, and 0.36, respectively. Patients with a predialysis erythropoietin claim were less likely to die compared with patients without a claim (odds ratio = 0.80 and 95% confidence interval = 0.74-0.87), but there was no relationship observed between predialysis care and death using only Form CMS-2728 predictors. At the facility level, a predialysis erythropoietin claim was associated with a 0.085 increase in the rate of meeting target hemoglobin levels compared with patients without a claim (p = 0.041), but no statistically significant relationship was observed when using the Form CMS-2728 indicators. The agreement between Form CMS-2728 and claims data is poor and discordant results are observed when comparing the use of these data sources to predict health outcomes. Facilities with higher agreement between the two data sources may provide greater quality of care.

Problems forming innovative-technological image of russian regions

Directory of Open Access Journals (Sweden)

Irina Markovna Golova

2012-06-01

Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.

2014-01-01

The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

Energy Technology Data Exchange (ETDEWEB)

Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: jybarra@astro.unam.mx [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)

2014-10-20

The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.

MODEL EVALUATION OF THE SPATIAL DEVELOPMENT OF THE REGION THROUGH THE DEVELOPMENT OF REGIONAL ECONOMIC CLUSTERS

Directory of Open Access Journals (Sweden)

Чингис Дашидалаевич Дашицыренов

2013-12-01

Full Text Available The article describes a model of evaluation of effectiveness of spatial development of a region. Main approaches and criteria to assess effectiveness of socio-economic development of a region based on use of regional economic cluster are identified.The author believes that clusterization allows to eliminate or localize mentioned above restrictions which are characteristic of specific activity of entities. Effect in this case can be measured by increase in productivity obtained from cluster’s resources use  in regard to specific form of enterprises’ existence.The article also focused on definition of idea of synergic effect and the model of effectiveness of clusters. Cluster integration’s essence is considered – it is pointed out that a new structure is formed, which has emergent characteristics.Thus, main approach to spatial socio-economic development of a region proposed by the author is diversification of organizational and economic forms into regional economic clusters.Proposed by the author model allows to assess effectiveness of clusterization for spatial socio-economic development of any region. DOI: http://dx.doi.org/10.12731/2218-7405-2013-10-14

Towards integrated crisis support of regional emergency networks.

Science.gov (United States)

Caro, D H

1999-01-01

Emergency and crisis management pose multidimensional information systems challenges for communities across North America. In the quest to reduce mortality and morbidity risks and to increase the level of crisis preparedness, regional emergency management networks have evolved. Integrated Crisis Support Systems (ICSS) are enabling information technologies that assist emergency managers by enhancing the ability to strategically manage and control these regional emergency networks efficiently and effectively. This article underscores the ICCS development, control and leadership issues and their promising implications for regional emergency management networks.

Extension Implications of Skill Gaps among Cassava Farmers in the ...

African Journals Online (AJOL)

Extension Implications of Skill Gaps among Cassava Farmers in the Niger Delta Region of Nigeria. ... PROMOTING ACCESS TO AFRICAN RESEARCH ... Skill gap analysis indicated 16 areas including packaging of cassava products with ...

Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

Directory of Open Access Journals (Sweden)

Elena Leonidovna Andreeva

2017-09-01

Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

Alternative Forms of the Rey Auditory Verbal Learning Test: A Review

Directory of Open Access Journals (Sweden)

Keith A. Hawkins

2004-01-01

Full Text Available Practice effects in memory testing complicate the interpretation of score changes over repeated testings, particularly in clinical applications. Consequently, several alternative forms of the Auditory Verbal Learning Test (AVLT have been developed. Studies of these typically indicate that the forms examined are equivalent. However, the implication that the forms in the literature are interchangeable must be tempered by several caveats. Few studies of equivalence have been undertaken; most are restricted to the comparison of single pairs of forms, and the pairings vary across studies. These limitations are exacerbated by the minimal overlapping across studies in variables reported, or in the analyses of equivalence undertaken. The data generated by these studies are nonetheless valuable, as significant practice effects result from serial use of the same form. The available data on alternative AVLT forms are summarized, and recommendations regarding form development and the determination of form equivalence are offered.

Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

Science.gov (United States)

Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

2017-11-01

We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

Regional hydrological impacts of climate change: implications for water management in India

Directory of Open Access Journals (Sweden)

A. Mondal

2015-04-01

Full Text Available Climate change is most likely to introduce an additional stress to already stressed water systems in developing countries. Climate change is inherently linked with the hydrological cycle and is expected to cause significant alterations in regional water resources systems necessitating measures for adaptation and mitigation. Increasing temperatures, for example, are likely to change precipitation patterns resulting in alterations of regional water availability, evapotranspirative water demand of crops and vegetation, extremes of floods and droughts, and water quality. A comprehensive assessment of regional hydrological impacts of climate change is thus necessary. Global climate model simulations provide future projections of the climate system taking into consideration changes in external forcings, such as atmospheric carbon-dioxide and aerosols, especially those resulting from anthropogenic emissions. However, such simulations are typically run at a coarse scale, and are not equipped to reproduce regional hydrological processes. This paper summarizes recent research on the assessment of climate change impacts on regional hydrology, addressing the scale and physical processes mismatch issues. Particular attention is given to changes in water availability, irrigation demands and water quality. This paper also includes description of the methodologies developed to address uncertainties in the projections resulting from incomplete knowledge about future evolution of the human-induced emissions and from using multiple climate models. Approaches for investigating possible causes of historically observed changes in regional hydrological variables are also discussed. Illustrations of all the above-mentioned methods are provided for Indian regions with a view to specifically aiding water management in India.

Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

Energy Technology Data Exchange (ETDEWEB)

Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

2017-11-01

Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

Current correlators and form factors in the resonance region

Energy Technology Data Exchange (ETDEWEB)

Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

2009-01-15

Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

"Mature Regionalism" and the Genesis of "Functional Projects": "Educational Regionalism" in Small (and Micro-States)

Science.gov (United States)

Jules, Tavis D.

2017-01-01

This article advances that the movement towards "deeper" Caribbean integration has generated a shift from "immature" regionalism to a "mature" form of regionalism. Thus, mature regionalism, a new governance mechanism, in regulating the institutional and legal framework of Caribbean Single Market and Economy is…

Source data supported high resolution carbon emissions inventory for urban areas of the Beijing-Tianjin-Hebei region: Spatial patterns, decomposition and policy implications.

Science.gov (United States)

Cai, Bofeng; Li, Wanxin; Dhakal, Shobhakar; Wang, Jianghao

2018-01-15

This paper developed internationally compatible methods for delineating boundaries of urban areas in China. By integrating emission source data with existing official statistics as well as using rescaling methodology of data mapping for 1 km grid, the authors constructed high resolution emission gridded data in Beijing-Tianjin-Hebei (Jing-Jin-Ji) region in China for 2012. Comparisons between urban and non-urban areas of carbon emissions from industry, agriculture, household and transport exhibited regional disparities as well as sectoral differences. Except for the Hebei province, per capita total direct carbon emissions from urban extents in Beijing and Tianjin were both lower than provincial averages, indicating the climate benefit of urbanization, comparable to results from developed countries. Urban extents in the Hebei province were mainly industrial centers while those in Beijing and Tianjin were more service oriented. Further decomposition analysis revealed population to be a common major driver for increased carbon emissions but climate implications of urban design, economic productivity of land use, and carbon intensity of GDP were both cluster- and sector-specific. This study disapproves the one-size-fits-all solution for carbon mitigation but calls for down-scaled analysis of carbon emissions and formulation of localized carbon reduction strategies in the Jing-Jin-Ji as well as other regions in China. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pion form factor

Energy Technology Data Exchange (ETDEWEB)

Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

1994-04-01

It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

An assessment of the Pacific Regional Cancer Coalition: outcomes and implications of a regional coalition internal and external assessment.

Science.gov (United States)

Sy, Angela U; Heckert, Karen A; Buenconsejo-Lum, Lee; Hedson, Johnny; Tamang, Suresh; Palafox, Neal

2011-11-01

The Pacific Regional Cancer Coalition (PRCC) provides regional leadership in the U.S. Affiliated Pacific Islands (USAPI) to implement the Regional Comprehensive Control Plan: 2007-2012, and to evaluate its coalition and partnerships. The Pacific Center of Excellence in the Elimination of Disparities (CEED), aims to reduce cancer disparities and conducts evaluation activities relevant to cancer prevention and control in the USAPI. The PRCC Self (internal) and Partner (external) Assessments were conducted to assess coalition functioning, regional and national partnerships, sustainability, and the role of regionalism for integrating all chronic disease prevention and control in the Pacific. Self-administered questionnaires and key informant telephone interviews with PRCC members (N=20), and representatives from regional and national partner organizations were administered (N=26). Validated multi item measures using 5-point scales on coalition and partnership characteristics were used. Chronbach's alphas and averages for the measures were computed. Internal coalition measures: satisfaction (4.2, SD=0.48) communication (4.0, SD=0.56), respect (4.0, SD=0.60) were rated more highly than external partnership measures: resource sharing (3.5, SD=0.74), regionalism (3.9, SD=0.47), use of findings (3.9, SD=0.50). The PRCC specifically identified its level of "collaboration" with external partners including Pacific CEED. External partners identified its partnership with the PRCC in the "coalition" stage. PRCC members and external partners are satisfied with their partnerships. All groups should continue to focus on building collaboration with partners to reflect a truly regional approach to sustain the commitment, the coalitions and the programming to reduce cancer in the USAPI. PRCC and partners should also work together to integrate all chronic disease prevention and control efforts in the Pacific.

Downscaling a global climate model to simulate climate change over the US and the implication on regional and urban air quality

Directory of Open Access Journals (Sweden)

M. Trail

2013-09-01

Full Text Available Climate change can exacerbate future regional air pollution events by making conditions more favorable to form high levels of ozone. In this study, we use spectral nudging with the Weather Research and Forecasting (WRF model to downscale NASA earth system GISS modelE2 results during the years 2006 to 2010 and 2048 to 2052 over the contiguous United States in order to compare the resulting meteorological fields from the air quality perspective during the four seasons of five-year historic and future climatological periods. GISS results are used as initial and boundary conditions by the WRF regional climate model (RCM to produce hourly meteorological fields. The downscaling technique and choice of physics parameterizations used are evaluated by comparing them with in situ observations. This study investigates changes of similar regional climate conditions down to a 12 km by 12 km resolution, as well as the effect of evolving climate conditions on the air quality at major US cities. The high-resolution simulations produce somewhat different results than the coarse-resolution simulations in some regions. Also, through the analysis of the meteorological variables that most strongly influence air quality, we find consistent changes in regional climate that would enhance ozone levels in four regions of the US during fall (western US, Texas, northeastern, and southeastern US, one region during summer (Texas, and one region where changes potentially would lead to better air quality during spring (Northeast. Changes in regional climate that would enhance ozone levels are increased temperatures and stagnation along with decreased precipitation and ventilation. We also find that daily peak temperatures tend to increase in most major cities in the US, which would increase the risk of health problems associated with heat stress. Future work will address a more comprehensive assessment of emissions and chemistry involved in the formation and removal of air

Validation of the Short Form of the Academic Procrastination Scale.

Science.gov (United States)

Yockey, Ronald D

2016-02-01

The factor structure, internal consistency reliability, and convergent validity of the five-item Academic Procrastination Scale-Short Form was investigated on an ethnically diverse sample of college students. The results provided support for the Academic Procrastination Scale-Short Form as a unidimensional measure of academic procrastination, which possessed good internal consistency reliability in this sample of 282 students. The scale also demonstrated good convergent validity, with moderate to large correlations with both the Procrastination Assessment Scale-Students and the Tuckman Procrastination Scale. Implications of the results are discussed and recommendations for future work provided.

Demographic trends in the Lodz region and their implications for seniors 50+

OpenAIRE

Jolanta Woźnica; Andrzej Tokarski

2014-01-01

The situation on the labor market in the Lodz region will change much in the short term , among other things as a result of unfavorable demographic trends, associated with a decrease in population, and also due to a lowering of labor resources. Decreasing labor resources may in the future adversely affect both the balance between the regional labor market by inducing a state of labor shortages and limit the opportunities for development of the region. Simultaneously, due to declining bi...

Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

Science.gov (United States)

Banabic, D.; Vos, M.; Paraianu, L.; Jurco, P.

2007-05-01

The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy.

Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

International Nuclear Information System (INIS)

Banabic, D.; Paraianu, L.; Vos, M.; Jurco, P.

2007-01-01

The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy

The Effects of Anthropogenic Heat Release on Urban Meteorology and Implication for Haze Pollution in the Beijing-Tianjin-Hebei Region

Directory of Open Access Journals (Sweden)

Ruiting Liu

2016-01-01

Full Text Available In this study, the effect of anthropogenic heat release (AHR on meteorological variables and atmospheric diffusion capability and implication for haze pollution in the Beijing-Tianjin-Hebei region in January 2013 were investigated by using Weather Research and Forecasting (WRF model with an urban canopy model (UCM and an AHR scheme. The comparison with observation demonstrated the WRF/UCM model taking AHR into account apparently improved meteorological prediction, especially for surface air temperature at 2 m (T2. The model also exhibited a better performance for planetary boundary layer (PBL height. This study revealed that AHR from cities exerted a significant impact on meteorology by generally increasing surface air temperature and wind speed, decreasing relative humidity, and elevating PBL height and near surface turbulent kinetic energy (TKE, which could consequently reduce surface pollutant concentration and mitigate haze pollution by enhancing atmospheric instability and turbulent mixing and reducing aerosol hygroscopic growth.

Direct Measurements of Dust Attenuation in z ~ 1.5 Star-forming Galaxies from 3D-HST: Implications for Dust Geometry and Star Formation Rates

Science.gov (United States)

Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B.; Conroy, Charlie; Förster Schreiber, Natascha M.; Franx, Marijn; Fumagalli, Mattia; Lundgren, Britt; Momcheva, Ivelina; Nelson, Erica J.; Skelton, Rosalind E.; van Dokkum, Pieter G.; Whitaker, Katherine E.; Wuyts, Stijn

2014-06-01

The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust around star-forming regions (A V, H II ) and the integrated dust content (A V, star). We select a sample of 163 galaxies between 1.36 =5 and measure Balmer decrements from stacked spectra to calculate A V, H II . First, we stack spectra in bins of A V, star, and find that A V, H II = 1.86 A V, star, with a significance of σ = 1.7. Our result is consistent with the two-component dust model, in which galaxies contain both diffuse and stellar birth cloud dust. Next, we stack spectra in bins of specific star formation rate (log SSFR), star formation rate (log SFR), and stellar mass (log M *). We find that on average A V, H II increases with SFR and mass, but decreases with increasing SSFR. Interestingly, the data hint that the amount of extra attenuation decreases with increasing SSFR. This trend is expected from the two-component model, as the extra attenuation will increase once older stars outside the star-forming regions become more dominant in the galaxy spectrum. Finally, using Balmer decrements we derive dust-corrected Hα SFRs, and find that stellar population modeling produces incorrect SFRs if rapidly declining star formation histories are included in the explored parameter space.

Multi Scale Models for Flexure Deformation in Sheet Metal Forming

Directory of Open Access Journals (Sweden)

Di Pasquale Edmondo

2016-01-01

Full Text Available This paper presents the application of multi scale techniques to the simulation of sheet metal forming using the one-step method. When a blank flows over the die radius, it undergoes a complex cycle of bending and unbending. First, we describe an original model for the prediction of residual plastic deformation and stresses in the blank section. This model, working on a scale about one hundred times smaller than the element size, has been implemented in SIMEX, one-step sheet metal forming simulation code. The utilisation of this multi-scale modeling technique improves greatly the accuracy of the solution. Finally, we discuss the implications of this analysis on the prediction of springback in metal forming.

MODERN FORMS OF PARTNERSHIP IN BUSINESS

OpenAIRE

Markova V. D.; Trapeznikov I. S.

2016-01-01

The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining comp...

Regionalisation in Serbia: Between centralism and regionalism

Directory of Open Access Journals (Sweden)

Tripković Milan B.

2003-01-01

Full Text Available This paper is one of the results of the empirical research of the problem of regionalisation and multiculturality on the territory of Vojvodina. Only the part of gathered data, which concerns the regionalisation of Serbia and the status of Vojvodina, is used. Claiming that a regional state is not only a special form of the complex organization of state authorities, but also a special form of the whole social life, the author tries to define clear and reliable criteria of "good" or "desirable" regionalisation, which would avoid extreme centralism and extreme regionalism. Following the statistical territorial units, according to the standards of the European Union (NUTS the author recommends the a regional structure, understood as a special form of division of authorities: Serbia as a state or federal unit (NUTS 1 Vojvodina and Kosovo and Metohija as provinces (NUTS 2, regions (NUTS 3 sub-regions (NUTS 4 and municipalities (NUTS 5. In this context, it is suggested that the future Constitution of the Republic of Serbia should define only provinces and municipalities (NUTS 2 and NUTS 5, while for the forming of regions and sub-regions (NUTS 3 and NUTS 4 only the procedure and principles should be given - the rest would be left to spontaneous initiative of potential regional or sub-regional units. Two undesirable things would be avoided: A regionalisation imposed from "above", which could be understood as uncovered centralism, and a regionalism from "bellow" which tries to hide separatism under the mask of regionalisation and which leads not to better functioning and faster development of Serbia, but to disintegration.

Innovation and inter-firm linkages : new implications for policy

NARCIS (Netherlands)

Nooteboom, B

This article discusses the implications for competition, innovation and learning of different forms of inter-firm linkage, ways to govern them, different 'generic systems' of innovation, and government policy. It employs a transformed theory of transactions that can deal with innovation and

Decreased regional cerebral glucose metabolism in the prefrontal regions in adults' with internet game addiction

International Nuclear Information System (INIS)

Park, Hyun Soo; Bang, Soong Ae; Yoon, Eun Jin; Cho, Sang Soo; Kim, Sang Hee; Kim, Yu Kyeong; Kim, Sang Eun

2007-01-01

Internet Game Addiction (IGA) is known to be associated with poor decision-making and diminished impulse control; however, the underlying neural substrates of IGA have not been identified. To investigate the neural substrates of IGA, we compared regional cerebral glucose metabolism between adults with and without IGA, primarily in the prefrontal brain regions, which have been implicated in inhibitory control. We studied 10 right-handed participants (5 controls: male, 23.8±0.75 y, 5 IGAs: male, 22.6±2.42 y) with FDG PET. A standardized questionnaire was used to assess the severity of IGA. Before scanning, all subjects carried out a computerized version of the Iowa Gambling Task (IGT) and the Balloon Analogue Risk Task (BART), as measures of behavioral inhibitory control. Statistical Parametric Mapping 2 (SPM2) was used to analyze differences in regional brain glucose metabolism between adults with and without IGA. Consistent with our predictions, compared to controls, significant reductions in FDG uptake in individuals with IGA were found in the bilateral orbitofrontal gyrus (BA 11, 47), bilateral inferior frontal gyrus (BA 44, 48), cingulate cortex (BA 24), and bilateral supplementary motor area (SMA) (BA 6); whereas increases were found in the bilateral hippocampus. Correlation analyses within the IGA group further showed that the level of glucose metabolism in the right orbitofrontal gyrus was marginally positively correlated with task scores in BART. Our results showed that IGA is associated with reduced glucose metabolism in the prefrontal regions involved in inhibitory control. This finding highlights dysfunctional inhibitory brain systems in individuals with IGA and offers implications for the development for therapeutic paradigms for IGA

Conformal symmetry and pion form factor: Soft and hard contributions

International Nuclear Information System (INIS)

Choi, Ho-Meoyng; Ji, Chueng-Ryong

2006-01-01

We discuss a constraint of conformal symmetry in the analysis of the pion form factor. The usual power-law behavior of the form factor obtained in the perturbative QCD analysis can also be attained by taking negligible quark masses in the nonperturbative quark model analysis, confirming the recent AdS/CFT correspondence. We analyze the transition from soft to hard contributions in the pion form factor considering a momentum-dependent dynamical quark mass from an appreciable constituent quark mass at low momentum region to a negligible current quark mass at high momentum region. We find a correlation between the shape of nonperturbative quark distribution amplitude and the amount of soft and hard contributions to the pion form factor

MARITIME VIOLENCE : IMPLICATIONS TO MALAYSIA

Directory of Open Access Journals (Sweden)

Nurulizwan Ahmad Zubir

2014-04-01

Full Text Available Abstract Maritime Piracy has been a serious threat to the international community especially in the SoutheastAsia region. This threat has caused tremendous implications towards the world economy, environment,political stability of the nations involved because 45% of the shipping company passes through theSoutheast Asia. The worrying fact is that these attacks were committed by terrorists as well as traditionalmaritime pirates. This paper examines on the implications of maritime crime in Malaysia and discusseswhether the definition of piracy under the International Law could be applied to these attacks. Thispaper concludes that cooperation between the region’s states and the enhancement of a good securitysystem of one state are needed to combat maritime violence. Thus it is imperative that the internationallaw need to be changed in order to enhance the meaning of piracy and also to include sea terrorism. Key words: piracy, maritime, terrorist

Agricultural transformations, livelihoods and rural-city connections. Policy implications for regional development

NARCIS (Netherlands)

Steel, G.|info:eu-repo/dai/nl/304349828; van Lindert, P.H.C.M.|info:eu-repo/dai/nl/069299382; Fold, Niels; Mynborg, Tobias

2016-01-01

This report analyses agricultural transformations, livelihoods and rural-city connections in Sub-Saharan Africa with the aim to identify key policy areas for regional development. The report draws on the results from comparative empirical studies in various dynamic rural regions characterized by

Dispersive analysis of the pion transition form factor

Energy Technology Data Exchange (ETDEWEB)

Hoferichter, M. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, ExtreMe Matter Institute EMMI, Darmstadt (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics, Bern (Switzerland); Kubis, B.; Niecknig, F.; Schneider, S.P. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany); Leupold, S. [Uppsala Universitet, Institutionen foer fysik och astronomi, Box 516, Uppsala (Sweden)

2014-11-15

We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the e{sup +}e{sup -} → 3π cross section, generalizing previous studies on ω, φ → 3π decays and γπ → ππ scattering, and verify our result by comparing to e{sup +}e{sup -} → π{sup 0}γ data. We perform the analytic continuation to the space-like region, predicting the poorlyconstrained space-like transition form factor below 1 GeV, and extract the slope of the form factor at vanishing momentum transfer a{sub π} = (30.7 ± 0.6) x 10{sup -3}. We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon. (orig.)

76 FR 76612 - Amendments to OMB Control Numbers and Certain Forms

Science.gov (United States)

2011-12-08

... Valuation. Part 1210--Forms and Reports. Part 1218--Collection of Monies and Provision for Geothermal.... Part 1206--Product Valuation We are revising part 1206, subpart H. In Sec. 1206.356(a)(2), we are... not apply to private property. A takings implication assessment is not required. 6. Federalism (E.O...

Air cargo in the Mid-America Freight Coalition region.

Science.gov (United States)

2012-08-01

This report contains a contextual review of air cargo transportation in the 10-state Mid-America Freight Coalition (MAFC) region including the industrys recent history, security implications, and integration within the greater MAFC economy. The re...

Regional Landslide Hazard Assessment Considering Potential Climate Change

Science.gov (United States)

Almeida, S.; Holcombe, E.; Pianosi, F.; Wagener, T.

2016-12-01

Landslides have many negative economic and societal impacts, including the potential for significant loss of life and damage to infrastructure. These risks are likely to be exacerbated in the future by a combination of climatic and socio-economic factors. Climate change, for example, is expected to increase the occurrence of rainfall-triggered landslides, because a warmer atmosphere tends to produce more high intensity rainfall events. Prediction of future changes in rainfall, however, is subject to high levels of uncertainty, making it challenging for decision-makers to identify the areas and populations that are most vulnerable to landslide hazards. In this study, we demonstrate how a physically-based model - the Combined Hydrology and Stability Model (CHASM) - can be used together with Global Sensitivity Analysis (GSA) to explore the underlying factors controlling the spatial distribution of landslide risks across a regional landscape, while also accounting for deep uncertainty around potential future rainfall triggers. We demonstrate how GSA can be used to analyse CHASM which in turn represents the spatial variability of hillslope characteristics in the study region, while accounting for other uncertainties. Results are presented in the form of landslide hazard maps, utilising high-resolution digital elevation datasets for a case study in St Lucia in the Caribbean. Our findings about spatial landslide hazard drivers have important implications for data collection approaches and for long-term decision-making about land management practices.

Glucokinase MODY and implications for treatment goals of common forms of diabetes.

Science.gov (United States)

Ajjan, Ramzi A; Owen, Katharine R

2014-12-01

Treatment goals in diabetes concentrate on reducing the risk of vascular complications, largely through setting targets for glycated haemoglobin (HbA1c). These targets are based on epidemiological studies of complication development, but so far have not adequately addressed the adverse effects associated with lowering HbA1c towards the normal range. Glucokinase (GCK) mutations cause a monogenic form of hyperglycaemia (GCK-MODY) characterised by fasting hyperglycaemia with low postprandial glucose excursions and a marginally elevated HbA1c. Minimal levels of vascular complications (comparable with nondiabetic individuals) are observed in GCK-MODY, leading to the hypothesis that GCK-MODY may represent a useful paradigm for assessing treatment goals in all forms of diabetes. In this review, we discuss the evidence behind this concept, suggest ways of translating this hypothesis into clinical practice and address some of the caveats of such an approach.

Measurement of the Charged Pion Electromagnetic Form Factor

International Nuclear Information System (INIS)

J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

2001-01-01

Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data

Medial prefrontal cortex subserves diverse forms of self-reflection.

Science.gov (United States)

Jenkins, Adrianna C; Mitchell, Jason P

2011-01-01

The ability to think about oneself--to self--reflect--is one of the defining features of the human mind. Recent research has suggested that this ability may be subserved by a particular brain region: the medial prefrontal cortex (MPFC). However, although humans can contemplate a variety of different aspects of themselves, including their stable personality traits, current feelings, and physical attributes, no research has directly examined the extent to which these different forms of self-reflection are subserved by common mechanisms. To address this question, participants were scanned using functional magnetic resonance imaging (fMRI) while making judgments about their own personality traits, current mental states, and physical attributes as well as those of another person. Whereas some brain regions responded preferentially during only one form of self-reflection, a robust region of MPFC was engaged preferentially during self-reflection across all three types of judgment. These results suggest that--although dissociable--diverse forms of self-referential thought draw on a shared cognitive process subserved by MPFC.

Regionalization and political dynamics of Brazilian health federalism.

Science.gov (United States)

Dourado, Daniel de Araujo; Elias, Paulo Eduardo Mangeon

2011-02-01

The implications from the Brazilian federal structure on the regionalization of health actions and services in the National Unified Health System (SUS) were analyzed, considering that the regional health planning in Brazil takes place within the context of intergovernmental relations as an expression of cooperative federalism in health. The analysis was based on a historical approach to Brazilian health federalism, recognizing two development periods, decentralization and regionalization. Regional health planning of SUS was explored in light of the theoretical framework of federalism. It is concluded that relative centralization of the process is needed in intergovernmental committees to actualize federal coordination and that it is essential to consider formalizing opportunities for dissent, both in regional management boards and in the intergovernmental committees, so that the consensus decision-making can be accomplished in healthcare regionalization.

A novel form of postcranial skeletal pneumaticity in a sauropod dinosaur: Implications for the paleobiology of Rebbachisauridae

Directory of Open Access Journals (Sweden)

Lucio M. Ibiricu

2017-06-01

Full Text Available In dinosaurs and other archosaurs, the presence of foramina connected with internal chambers in axial and appendicular bones is regarded as a robust indicator of postcranial skeletal pneumaticity (PSP. Here we analyze PSP and its paleobiological implications in rebbachisaurid diplodocoid sauropod dinosaurs based primarily on the dorsal vertebrae of Katepensaurus goicoecheai, a rebbachisaurid from the Cenomanian–Turonian (Upper Cretaceous Bajo Barreal Formation of Patagonia, Argentina. We document a complex of interconnected pneumatic foramina and internal chambers within the dorsal vertebral transverse processes of Katepensaurus. Collectively, these structures constitute a form of PSP that has not previously been observed in sauropods, though it is closely comparable to morphologies seen in selected birds and non-avian theropods. Parts of the skeletons of Katepensaurus and other rebbachisaurid taxa such as Amazonsaurus maranhensis and Tataouinea hannibalis exhibit an elevated degree of pneumaticity relative to the conditions in many other sauropods. We interpret this extensive PSP as an adaptation for lowering the density of the skeleton, and tentatively propose that this reduced skeletal density may also have decreased the muscle energy required to move the body and the heat generated in so doing. Given that several rebbachisaurids inhabited tropical to subtropical paleolatitudes during the extreme warmth of the mid-Cretaceous, increased PSP may have better enabled these sauropods to cope with extraordinarily high temperatures. Extensive skeletal pneumaticity may have been an important innovation in Rebbachisauridae, and perhaps also in saltasaurine titanosaurs, which evolved an even greater degree of PSP. This may in turn have contributed to the evolutionary success of rebbachisaurids, which were the only diplodocoids to survive into the Late Cretaceous.

Geographical baselines of sustainable planning of the regional development of Zasavje region

Directory of Open Access Journals (Sweden)

Dušan Plut

2002-12-01

Full Text Available Geographical baselines of planning the regional development and interventions into the geographical environment derive from the premises of the concept of permanent adjusting the anthropogenic changes in the landscape to specific capacities and limitations of landscape-forming components. In the landscape-degraded region of Zasavje the improvement of environmental quality (curative measures and regional economic progress within the scope of carrying capacities and space (preventative measures are the primary, developmentaly-environmentally devised goal of developmental strategy.

Role of regional planning organizations in transportation planning across boundaries

Science.gov (United States)

2014-06-11

The Volpe Center conducted research for the Federal Highway Administration Office of Planning that explores the implications of Regional Planning Organizations (RPO) engaging in transportation planning partnerships and projects of megaregions signifi...

The Star Formation in Radio Survey: Jansky Very Large Array 33 GHz Observations of Nearby Galaxy Nuclei and Extranuclear Star-forming Regions

Science.gov (United States)

Murphy, E. J.; Dong, D.; Momjian, E.; Linden, S.; Kennicutt, R. C., Jr.; Meier, D. S.; Schinnerer, E.; Turner, J. L.

2018-02-01

We present 33 GHz imaging for 112 pointings toward galaxy nuclei and extranuclear star-forming regions at ≈2″ resolution using the Karl G. Jansky Very Large Array (VLA) as part of the Star Formation in Radio Survey. A comparison with 33 GHz Robert C. Byrd Green Bank Telescope single-dish observations indicates that the interferometric VLA observations recover 78% ± 4% of the total flux density over 25″ regions (≈kpc scales) among all fields. On these scales, the emission being resolved out is most likely diffuse non-thermal synchrotron emission. Consequently, on the ≈30–300 pc scales sampled by our VLA observations, the bulk of the 33 GHz emission is recovered and primarily powered by free–free emission from discrete H II regions, making it an excellent tracer of massive star formation. Of the 225 discrete regions used for aperture photometry, 162 are extranuclear (i.e., having galactocentric radii r G ≥ 250 pc) and detected at >3σ significance at 33 GHz and in Hα. Assuming a typical 33 GHz thermal fraction of 90%, the ratio of optically-thin 33 GHz to uncorrected Hα star formation rates indicates a median extinction value on ≈30–300 pc scales of A Hα ≈ 1.26 ± 0.09 mag, with an associated median absolute deviation of 0.87 mag. We find that 10% of these sources are “highly embedded” (i.e., A Hα ≳ 3.3 mag), suggesting that on average, H II regions remain embedded for ≲1 Myr. Finally, we find the median 33 GHz continuum-to-Hα line flux ratio to be statistically larger within r G < 250 pc relative to the outer disk regions by a factor of 1.82 ± 0.39, while the ratio of 33 GHz to 24 μm flux densities is lower by a factor of 0.45 ± 0.08, which may suggest increased extinction in the central regions.

U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization?

Science.gov (United States)

Bustamante, Arturo Vargas

2016-01-01

For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. PMID:27694684

An Entropy Approach to Regional Differences in Carbon Dioxide Emissions: Implications for Ethanol Usage

Directory of Open Access Journals (Sweden)

Dong Hee Suh

2018-01-01

Full Text Available The growth of the U.S. economy has been accompanied with a significant rise in carbon dioxide (CO2 emissions. As CO2 emissions are dependent on regional climatic conditions and energy-related activities in states, this study examines the extent to which the distribution of CO2 emissions vary across nine climatically consistent regions in the U.S. The results obtained from the entropy approach reveal that the inequalities of CO2 emissions vary across the regions. While the total inequality of CO2 emissions is determined by the between-region and the average within-region inequalities, the between-region inequality begins to dominate the average within-region inequalities around 1980s; the emission inequalities between regions increase, but those within each region decrease. Given that ethanol usage is relevant to energy-related CO2 emissions, this study also evaluates the impact of ethanol usage on the changes in the emission inequalities. The results show that an increase in the ratio of ethanol to fossil fuels is associated closely with the reductions in the inequalities of CO2 emissions.

The 1950-1998 warm ENSO events and regional implications to ...

African Journals Online (AJOL)

1998 seasonal El Niño/Southern Oscillation (ENSO) is investigated in 502 rivers gauged in 9 countries of the Southern African region. We found some evidence of possible links between available surface water resources in terms of mean annual ...

THE FINANCIAL MANAGEMENT AND REGIONAL DEVELOPMENT

Directory of Open Access Journals (Sweden)

Brindusa Tudose

2015-07-01

Full Text Available The main objective of the study is to examine the role that financial management plays in ensuring regional development. This is because the crisis, economic globalisation, the increasing external growth of companies and the institutionalisation of the autonomy of local communities have fuelled the interest in identifying alternatives to local and thereby regional development. The targeted operational objectives were: to define the preliminary coordinates of regional development; to identify the role of private and public financial management in supporting regional development; and to present the financing framework of the Siret-Prut-Nistru Euroregion. The main financial levers with a direct impact on regional economic development there are: tax incentives; using EU financing programmes; leverage based on ownership of buildings and land; business incubators, etc. The study suggests that financial management (both public and private plays an important role in the development of the Euroregion, with wide-ranging present (in the post-crisis as well as future implications.

Decreased regional cerebral glucose metabolism in the prefrontal regions in adults' with internet game addiction

Energy Technology Data Exchange (ETDEWEB)

Park, Hyun Soo; Bang, Soong Ae; Yoon, Eun Jin; Cho, Sang Soo; Kim, Sang Hee; Kim, Yu Kyeong; Kim, Sang Eun [Seoul National Univ. College of Medicine, Seoul (Korea, Republic of)

2007-07-01

Internet Game Addiction (IGA) is known to be associated with poor decision-making and diminished impulse control; however, the underlying neural substrates of IGA have not been identified. To investigate the neural substrates of IGA, we compared regional cerebral glucose metabolism between adults with and without IGA, primarily in the prefrontal brain regions, which have been implicated in inhibitory control. We studied 10 right-handed participants (5 controls: male, 23.8{+-}0.75 y, 5 IGAs: male, 22.6{+-}2.42 y) with FDG PET. A standardized questionnaire was used to assess the severity of IGA. Before scanning, all subjects carried out a computerized version of the Iowa Gambling Task (IGT) and the Balloon Analogue Risk Task (BART), as measures of behavioral inhibitory control. Statistical Parametric Mapping 2 (SPM2) was used to analyze differences in regional brain glucose metabolism between adults with and without IGA. Consistent with our predictions, compared to controls, significant reductions in FDG uptake in individuals with IGA were found in the bilateral orbitofrontal gyrus (BA 11, 47), bilateral inferior frontal gyrus (BA 44, 48), cingulate cortex (BA 24), and bilateral supplementary motor area (SMA) (BA 6); whereas increases were found in the bilateral hippocampus. Correlation analyses within the IGA group further showed that the level of glucose metabolism in the right orbitofrontal gyrus was marginally positively correlated with task scores in BART. Our results showed that IGA is associated with reduced glucose metabolism in the prefrontal regions involved in inhibitory control. This finding highlights dysfunctional inhibitory brain systems in individuals with IGA and offers implications for the development for therapeutic paradigms for IGA.

Rumor, gossip and blame: implications for HIV/AIDS prevention in the South African lowveld.

Science.gov (United States)

Stadler, Jonathan

2003-08-01

The HIV/AIDS epidemic provides fertile breeding ground for theories of the origin of HIV/AIDS, its mode of transmission, and the allocation of blame. Drawing on ethnographic research in the Bushbuckridge region of the South African lowveld, this article examines the articulation of AIDS through gossip and rumor. These oral forms create moral readings of behavior and shape folk discourses of AIDS that resist dominant epidemiological explanations. Significantly, constructions of AIDS are not uniform. Although elders claim AIDS as traditional and curable, younger men and women support theories of AIDS as a modern, foreign disease. Witchcraft beliefs are popular in explaining why certain people die and not others. At times, rumor may escalate into a moral panic. The implications of these findings for social responses to the AIDS epidemic and HIV/AIDS prevention are explored.

Direct measurements of dust attenuation in z ∼ 1.5 star-forming galaxies from 3D-HST: Implications for dust geometry and star formation rates

International Nuclear Information System (INIS)

Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B.; Conroy, Charlie; Schreiber, Natascha M. Förster; Wuyts, Stijn; Franx, Marijn; Fumagalli, Mattia; Lundgren, Britt; Momcheva, Ivelina; Nelson, Erica J.; Van Dokkum, Pieter G.; Skelton, Rosalind E.; Whitaker, Katherine E.

2014-01-01

The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust around star-forming regions (A V, H II ) and the integrated dust content (A V, star ). We select a sample of 163 galaxies between 1.36 ≤ z ≤ 1.5 with Hα signal-to-noise ratio ≥5 and measure Balmer decrements from stacked spectra to calculate A V, H II . First, we stack spectra in bins of A V, star , and find that A V, H II = 1.86 A V, star , with a significance of σ = 1.7. Our result is consistent with the two-component dust model, in which galaxies contain both diffuse and stellar birth cloud dust. Next, we stack spectra in bins of specific star formation rate (log SSFR), star formation rate (log SFR), and stellar mass (log M * ). We find that on average A V, H II increases with SFR and mass, but decreases with increasing SSFR. Interestingly, the data hint that the amount of extra attenuation decreases with increasing SSFR. This trend is expected from the two-component model, as the extra attenuation will increase once older stars outside the star-forming regions become more dominant in the galaxy spectrum. Finally, using Balmer decrements we derive dust-corrected Hα SFRs, and find that stellar population modeling produces incorrect SFRs if rapidly declining star formation histories are included in the explored parameter space.

Recent Studies of Nucleon Electromagnetic Form Factors

International Nuclear Information System (INIS)

Gilad, Shalev

2010-01-01

The electromagnetic form factors of nucleons are fundamental quantities in nucleon structure. As such, they have been studied extensively both theoretically and experimentally. Significant progress has been made with new measurements at Jlab, MAMI and MIT-Bates, with emphases on expanding the momentum-transfer range and on higher precision. In this paper, we describe the status of this field and present new results from measurements at both low and high momentum transfers. We also compare the experimental data to model predictions, and mention possible implications of the new results to other fields.

Identification and therapeutic potential of a vitronectin binding region of meningococcal msf.

Science.gov (United States)

Hill, Darryl J; Griffiths, Natalie J; Borodina, Elena; Andreae, Clio A; Sessions, Richard B; Virji, Mumtaz

2015-01-01

The human pathogen Neisseria meningitides (Nm) attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf), a trimeric autotransporter, binds to the activated form of vitronectin (aVn) to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen.

China–Myanmar Energy Cooperation and Its Regional Implications

Directory of Open Access Journals (Sweden)

Hong Zhao

2011-01-01

Full Text Available Although Myanmar is among the world’s oldest oil-producing countries, Chinese oil and gas companies did not start their oil and gas exploration projects there until recently. The most recent and significant China–Myanmar energy cooperation project is the oil and gas pipelines which got started in 2009. This paper will discuss the reasons and driving forces for this pipeline project and its broader objectives, and testify whether pipelines can deepen regional economic integration and strengthen bilateral relations. This paper concludes by saying that China might use the China–Myanmar pipeline construction as an opportunity to play a more constructive role in Myanmar’s domestic reforms, thus improving its image in Southeast Asia and strengthening its relations with Myanmar.

On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security

Science.gov (United States)

Filimonova, L. A.; Skvortsova, N. K.

2017-11-01

The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

New Technology and Changing Organisational Forms: Implications for Managerial Control and Skills.

Science.gov (United States)

Grimshaw, Damian; Cooke, Fang-Lee; Grugulis, Irena; Vincent, Steve

2002-01-01

Case studies of client relations in a call center and an information technology company's partnership with a government agency examined how new technology affects organizational structures and managerial control. Evidence suggests that new structures arise in tandem with technological changes and technology's use as a form of control differs in…

Land use, macroalgae, and a tumor-forming disease in marine turtles.

Directory of Open Access Journals (Sweden)

Kyle S Van Houtan

Full Text Available Wildlife diseases are an increasing concern for endangered species conservation, but their occurrence, causes, and human influences are often unknown. We analyzed 3,939 records of stranded Hawaiian green sea turtles (Chelonia mydas over 28 years to understand fibropapillomatosis, a tumor-forming disease linked to a herpesvirus. Turtle size is a consistent risk factor and size-standardized models revealed considerable spatial and temporal variability. The disease peaked in some areas in the 1990s, in some regions rates remained constant, and elsewhere rates increased. Land use, onshore of where the turtles feed, may play a role. Elevated disease rates were clustered in watersheds with high nitrogen-footprints; an index of natural and anthropogenic factors that affect coastal eutrophication. Further analysis shows strong epidemiological links between disease rates, nitrogen-footprints, and invasive macroalgae and points to foraging ecology. These turtles now forage on invasive macroalgae, which can dominate nutrient rich waters and sequester environmental N in the amino acid arginine. Arginine is known to regulate immune activity, promote herpesviruses, and contribute to tumor formation. Our results have implications for understanding diseases in aquatic organisms, eutrophication, herpesviruses, and tumor formation.

Social theory and the region: from the Regional Planning Association of America to the restructuring of sociospatial theory, with policy implications

OpenAIRE

R Banai

1993-01-01

In this paper an argument is developed in support of the relevance of social theory for the region. Characterized by bridging across conceptual and methodological divides, by the increasing prominence of the role of space, context, and human agency, social theory exhibits an affinity with the regional development theory of the Regional Planning Association of America (RPAA) in the 1920s. This paper provides a brief account of the RPAA's approach to regional synthesis. The author alms to build...

the implications of non- authentic questions in galatians

African Journals Online (AJOL)

tegies in the form of non-authentic questions in Paul's letters may thus be scru- tinised, and their ... A similar approach will be followed in this paper by ... and to describe their implications in order to better understand their function .... They are not addressed to the receiver, and can be primarily rational or emotional.

Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

Energy Technology Data Exchange (ETDEWEB)

Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)

2014-03-10

Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

Analysis of policy implications and challenges of the Cuban health assistance program related to human resources for health in the Pacific

Directory of Open Access Journals (Sweden)

Asante Augustine D

2012-05-01

Full Text Available Abstract Background Cuba has extended its medical cooperation to Pacific Island Countries (PICs by supplying doctors to boost service delivery and offering scholarships for Pacific Islanders to study medicine in Cuba. Given the small populations of PICs, the Cuban engagement could prove particularly significant for health systems development in the region. This paper reviews the magnitude and form of Cuban medical cooperation in the Pacific and analyses its implications for health policy, human resource capacity and overall development assistance for health in the region. Methods We reviewed both published and grey literature on health workforce in the Pacific including health workforce plans and human resource policy documents. Further information was gathered through discussions with key stakeholders involved in health workforce development in the region. Results Cuba formalised its relationship with PICs in September 2008 following the first Cuba-Pacific Islands ministerial meeting. Some 33 Cuban health personnel work in Pacific Island Countries and 177 Pacific island students are studying medicine in Cuba in 2010 with the most extensive engagement in Kiribati, the Solomon Islands, Tuvalu and Vanuatu. The cost of the Cuban medical cooperation to PICs comes in the form of countries providing benefits and paying allowances to in-country Cuban health workers and return airfares for their students in Cuba. This has been seen by some PICs as a cheaper alternative to training doctors in other countries. Conclusions The Cuban engagement with PICs, while smaller than engagement with other countries, presents several opportunities and challenges for health system strengthening in the region. In particular, it allows PICs to increase their health workforce numbers at relatively low cost and extends delivery of health services to remote areas. A key challenge is that with the potential increase in the number of medical doctors, once the local students

The Tarantula Nebula as a template for extragalactic star forming regions from VLT/MUSE and HST/STIS

Science.gov (United States)

Crowther, Paul A.; Caballero-Nieves, Saida M.; Castro, Norberto; Evans, Christopher J.

2017-11-01

We present VLT/MUSE observations of NGC 2070, the dominant ionizing nebula of 30 Doradus in the LMC, plus HST/STIS spectroscopy of its central star cluster R136. Integral Field Spectroscopy (MUSE) and pseudo IFS (STIS) together provides a complete census of all massive stars within the central 30×30 parsec2 of the Tarantula. We discuss the integrated far-UV spectrum of R136, of particular interest for UV studies of young extragalactic star clusters. Strong He iiλ1640 emission at very early ages (1-2 Myr) from very massive stars cannot be reproduced by current population synthesis models, even those incorporating binary evolution and very massive stars. A nebular analysis of the integrated MUSE dataset implies an age of ~4.5 Myr for NGC 2070. Wolf-Rayet features provide alternative age diagnostics, with the primary contribution to the integrated Wolf-Rayet bumps arising from R140 rather than the more numerous H-rich WN stars in R136. Caution should be used when interpreting spatially extended observations of extragalactic star-forming regions.

Competitive implications of cross-border banking

OpenAIRE

Claessens, Stijn

2006-01-01

This paper reviews the recent literature on cross-border banking, with a focus on policy implications. Cross-border banking has increased sharply in recent decades, particularly in the form of entry, and has affected the development of financial systems, access to financial services, and stability. Reviewing the empirical literature, the author finds much, although not uniform, evidence that cross-border banking supports the development of an efficient and stable financial system that offers ...

A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

Energy Technology Data Exchange (ETDEWEB)

Esplin, T. L.; Luhman, K. L., E-mail: taran.esplin@psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States)

2017-10-01

We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K{sub s}, which should have masses as low as ∼4–5 M {sub Jup} according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M{sub Jup}).

Citizenship and the Forms of Political Support: A Case-Study of the Croatian Adriatic Regions

Directory of Open Access Journals (Sweden)

Zoran Radman

2010-01-01

Full Text Available The article is dealing with the issue of political support in Croatia, related to the issues of trust and legitimacy towards authority and institutions, as the elements of the political system. Previous research conducted in Croatia evidences a relatively low level of trust in the political authorities and institutions. In this paper we go by Easton’s dimensions of political support: authority support, support to institutions, support to democracy and support to community. All these forms of political support represent the subjective orientations of citizens towards the units of the political system. On the other hand, orientation and relationship of citizens towards the units of the political systems poses the question of citizenship. The paper is exploring the relation of subjective orientations of citizens towards the political systems units and different dimensions of political support in the specific context of Adriatic regions of Croatia, on the basis of the established models of citizenship developed by various authors. The results point out that the level of support rises as we go from the lower, specific types of support (support to authorities and support to institutions towards higher, diffuse modes of support (support to community. In the background of the political support, especially “support to democracy”, there are performances of the political system. In other words, political support is more instrumentally then intrinsically founded.

A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

International Nuclear Information System (INIS)

Esplin, T. L.; Luhman, K. L.

2017-01-01

We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K s , which should have masses as low as ∼4–5 M Jup according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M Jup ).

Where should MMS look for the electron and ion diffusion regions?

Science.gov (United States)

Lapenta, G.; Goldman, M. V.; Newman, D. L.; Olshevsky, V.

2015-12-01

Our message is that if we think of reconnection with the usual cartoon, the MMS mission should follow the advice of Indiana Jones: X never marks the spot. Based on 3D fully kinetic simulations started with a well defined x-line, we observe that reconnection transitions towards a more chaotic regime. Two fronts develop downstream of the x-line where the outflow meets the pre-existing plasma. In the fronts an instability develops caused by the local gradients of the density. The consequence is the break up of the fronts in a fashion similar to the classical fluid Rayleigh-Taylor instability with the formation of "fingers" of plasma and embedded magnetic fields. These fingers interact and produce secondary reconnection sites. We present several different diagnostics that prove the existence of these secondary reconnection sites. Each site is surrounded by its own electron diffusion region.At the fronts the ions are generally not magnetized and considerable ion slippage is present. The discovery we present is that electrons are also slipping, forming localized diffusion regions near secondary reconnection sites [1].The consequence of this discovery is twofold. First, the instability in the fronts has strong energetic implications. We observe that the energy transfer locally is very strong, an order of magnitude stronger than in the "X" line. However, this energy transfer is of both signs as it is natural for a wavy rippling with regions of magnetic to kinetic and regions of kinetic to magnetic energy conversion.Second, and most important for this session, is that MMS should not limit the search for electron diffusion regions to the location marked with X in all reconnection cartoons. Our simulations predict more numerous and perhaps more easily measurable electron diffusion regions in the fronts. [1] Lapenta, G et al., Nature Physics 11, 690-695 (2015)

Siberian Regional Identity in the Context of Historical Consciousness (Content Analysis of Tomsk Regional Media

Directory of Open Access Journals (Sweden)

A V Bocharov

2011-12-01

Full Text Available The article presents a model to study the Siberian regional identity in the context of historical consciousness, as well as the results of its practical application in the content analysis of the publications by the Tomsk regional media. On the basis of the content analysis procedures the author demonstrates how, through historical memory, the regional identity is formed and manifested in the regional media in various spheres of society.

A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

Energy Technology Data Exchange (ETDEWEB)

Kang, Sung-Ju; Choi, Minho; Kang, Miju [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 34055 (Korea, Republic of); Kerton, C. R., E-mail: sjkang@kasi.re.kr, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

2017-08-10

We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential products of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.

A trans-national monarch butterfly population model and implications for regional conservation priorities

Science.gov (United States)

Oberhauser, Karen; Wiederholt, Ruscena; Diffendorfer, James E.; Semmens, Darius J.; Ries, Leslie; Thogmartin, Wayne E.; Lopez-Hoffman, Laura; Semmens, Brice

2017-01-01

1. The monarch has undergone considerable population declines over the past decade, and the governments of Mexico, Canada, and the United States have agreed to work together to conserve the species.2. Given limited resources, understanding where to focus conservation action is key for widespread species like monarchs. To support planning for continental-scale monarch habitat restoration, we address the question of where restoration efforts are likely to have the largest impacts on monarch butterfly (Danaus plexippus Linn.) population growth rates.3. We present a spatially explicit demographic model simulating the multi-generational annual cycle of the eastern monarch population, and use the model to examine management scenarios, some of which focus on particular regions of North America.4. Improving the monarch habitat in the north central or southern parts of the monarch range yields a slightly greater increase in the population growth rate than restoration in other regions. However, combining restoration efforts across multiple regions yields population growth rates above 1 with smaller simulated improvements in habitat per region than single-region strategies.5. Synthesis and applications: These findings suggest that conservation investment in projects across the full monarch range will be more effective than focusing on one or a few regions, and will require international cooperation across many land use categories.

Implications of material selection on the design of packaging machinery.

Science.gov (United States)

Merritt, J P

2009-01-01

Material selection has significant implications on the design and cost of horizontal-form-fill-seal packaging machinery. To avoid excessive costs, machine redesigns and project delays, material selection must be reconciled early in the project and revisited throughout the construction of the machine.

The role of personality in the transmission of cultural forms an example of the bearer of regional traditions in central Moravia (the ethnographic area of Haná

Directory of Open Access Journals (Sweden)

Válka Miroslav

2017-01-01

Full Text Available The ethnographic area of Haná in Central Moravia (Czech Republic has been among distinctive ethnographic regions since the 16th century. Even though traditional regional forms had gradually disappeared as a consequence of the modernization of village life, these returned alongside new functions in terms of national consciousness from the late 19th century. It was the intelligentsia, mainly teachers, priests, physicians and artists, who contributed to the spread of these forms. The personalities´ activities did not stop even in the 20th century. The teacher Marie Pachtová (born 1932 is an example of one such person (in study by Miroslav Válka. She not only led a children´s folklore ensemble, moderated programmes aimed at presentation of folklore, and worked as a lector, but she also tries to involve older folk traditions of Haná in the present cultural calendar of the town where she lives. Among other things, she was instrumental in the preservation of the production of Easter eggs from Haná which are decorated with stuck-on straw. She paid similar attention to the ceremonial pastries. With the focus of this example, it is possible to prove the transformations of regional culture´s expression into the contemporary social life as well as the mechanism of the creation of a new tradition.

The Implication of Agricultural Expansion on the Groundwater Flow Regime of Saq Aquifer in Al Qassim Region, Saudi Arabia

Science.gov (United States)

Alharbi, T.; Mansour Helmy, B. M.

2017-12-01

Al-Qassim Region in Saudi Arabia is characterized by expanding agricultural activities. Most agricultural fields are irrigated by groundwater, mainly from the Saq aquifer. Excessive water extraction from this aquifer and arid climatic conditions negatively alter the quality and quantity of the groundwater. In this study, detailed hydrological and hydrogeological investigations were carried out to characterize spatially the potential groundwater recharge zones, deal with the estimation of groundwater balance of the Saq aquifer in the study area and to assess the safe yield of the aquifer. Accordingly, the implication of agricultural expansion on groundwater flow regime of Saq aquifer and its relation with safe yield and groundwater recharge was evaluated. The water-budget was calculated and the main water Inputs and outputs were measured. Change detections of agricultural areas in the region for years, 1983, 1995 and 2005 were conducted using Landsat Satellite images and results were compared to water levels for same years. There are two potential recharge zones for Saq aquifer in the area, both are structurally controlled. The first zone is the outlet of wadi Ar Risha basin in south-eastern corner of the study area. The second is the western water divide of wadi Turfiya basin in the North west. Results of the study also indicated that 96.4 % of the total abstraction is consumed for agriculture supply. The present abstractions exceed both recharge and safe yield of the aquifer system, thus the aquifer is overexploited and mined. The average decrease in groundwater storage during the year 1983-2005 was estimated to be 33.4 Mm3, representing an average yearly decline of 1.98 m of the water table.

Regulations of irrigation on regional climate in the Heihe watershed, China, and its implications to water budget

Science.gov (United States)

Zhang, X.

2015-12-01

In the arid area, such as the Heihe watershed in Northwest China, agriculture is heavily dependent on the irrigation. Irrigation suggests human-induced hydro process, which modifies the local climate and water budget. In this study, we simulated the irrigation-induced changes in surface energy/moisture budgets and modifications on regional climate, using the WRF-NoahMP modle with an irrigation scheme. The irrigation scheme was implemented following the roles that soil moisture is assigned a saturated value once the mean soil moisture of all root layers is lower than 70% of fileld capacity. Across the growth season refering from May to September, the simulated mean irrigation amount of the 1181 cropland gridcells is ~900 mm, wihch is close to the field measurments of around 1000 mm. Such an irrigation largely modified the surface energy budget. Due to irrigation, the surface net solar radiation increased by ~76.7 MJ (~11 Wm-2) accouting for ~2.3%, surface latent and senbile heat flux increased by 97.7 Wm-2 and decreased by ~79.7 Wm-2 respectively; and local daily mean surface air temperature was thereby cooling by ~1.1°C. Corresponding to the surface energy changes, wind and circulation were also modified and regional water budget is therefore regulated. The total rainfall in the irrigation area increased due to more moisture from surface. However, the increased rainfall is only ~6.5mm (accounting for ~5% of background rainfall) which is much less than the increased evaporation of ~521.5mm from surface. The ~515mm of water accounting for 57% of total irrigation was transported outward by wind. The other ~385 mm accounting for 43% of total irrigation was transformed to be runoff and soil water. These results suggest that in the Heihe watershed irrigation largely modify local energy budget and cooling surface. This study also implicate that the existing irrigation may waste a large number of water. It is thereby valuable to develope effective irrigation scheme to

Transient osteoporosis of pregnancy: A case report and review of anesthetic implications

Directory of Open Access Journals (Sweden)

Victor Eduardo Anillo Lombana

2013-01-01

We reviewed the anesthetic implications of this rare disease, particularly the use of a regional technique that removes the restrictive effect of the hip pain, and therefore increases the risk of a fracture.

Floodplain inundation response to climate, valley form, and flow regulation on a gravel-bed river in a Mediterranean-climate region

Science.gov (United States)

Cienciala, P.; Pasternack, G. B.

2017-04-01

Floodplain inundation regime defines hydrological connectivity between river channel and floodplain and thus strongly controls structure and function of these highly diverse and productive ecosystems. We combined an extensive LiDAR data set on topography and vegetation, long-term hydrological records, as well as the outputs of hydrological and two-dimensional hydraulic models to examine how floodplain inundation regimes in a dynamic, regulated, gravel-cobble river in a Mediterranean-climate region are controlled by reach-scale valley morphology, hydroclimatic conditions, and flow regulation. Estimated relative differences in the extent, duration, and cumulative duration of inundation events were often as large as an order of magnitude and generally greatest for large and long duration events. The relative impact of flow regulation was greatest under dry hydroclimatic conditions. Although the effects of hydroclimate and flow impairment are larger than that of valley floor topography, the latter controls sensitivity of floodplain hydroperiod to flow regime changes and should not be ignored. These quantitative estimates of the relative importance of factors that control floodplain processes in Mediterranean, semiarid rivers contributes to better understanding of hydrology and geomorphology of this important class of channels. We also discuss implications of our findings for processes that shape floodplain habitat for riparian vegetation and salmonid fish, especially in the context of ecological restoration.

Measurement of the pion form factor in the time-like region for q2 values between 0.1 (GeV/c)2 and 0.18 (GeV/c)2

International Nuclear Information System (INIS)

Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.

1984-01-01

The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)

Implicative Algebras

African Journals Online (AJOL)

Tadesse

In this paper we introduce the concept of implicative algebras which is an equivalent definition of lattice implication algebra of Xu (1993) and further we prove that it is a regular Autometrized. Algebra. Further we remark that the binary operation → on lattice implicative algebra can never be associative. Key words: Implicative ...

Urban form and energy use for transport. A Nordic experience

Energy Technology Data Exchange (ETDEWEB)

Naess, P

1995-02-10

The main research problem addressed in this thesis is the possible influence of several urban form variables on the amount of transportation, on the modal split between different means of transport, and on energy use for transportation. This problem is elucidated through five empirical investigations covering different geographic levels in a Nordic context, from individual employees and households to commuting regions. A main feature of the study is the combination of socioeconomic and urban form variables in empirical investigations, employing techniques of multivariate analysis. The investigations of residential areas and job sites have been based on travel surveys, while the investigations where the units of analysis are towns or regions have been based on fuel sales. The socioeconomic data have been collected from official statistics and from questionnaires. It is found that urban form variables exert important influences on transportation energy use. Urban density affects energy use for transportation. A central location of residences as well as workplaces is favourable with respect to energy conservation on an intra-urban scale, but not in a wider geographical context, where decentralization into several dense, relatively self-contained local communities distributed over the region is the most energy-saving pattern of regional development. Urban form characteristics favourable for minimizing transport energy requirements also seem favourable for energy conservation in buildings. 160 refs., 39 figs., 46 tabs.

Regulated necrosis and its implications in toxicology.

Science.gov (United States)

Aki, Toshihiko; Funakoshi, Takeshi; Uemura, Koichi

2015-07-03

Recent research developments have revealed that caspase-dependent apoptosis is not the sole form of regulated cell death. Caspase-independent, but genetically regulated, forms of cell death include pyroptosis, necroptosis, parthanatos, and the recently discovered ferroptosis and autosis. Importantly, regulated necrosis can be modulated by small molecule inhibitors/activators, confirming the cell autonomous mechanism of these forms of cell death. The success of small molecule-mediated manipulation of regulated necrosis has produced great changes in the field of cell death research, and has also brought about significant changes in the fields of pharmacology as well as toxicology. In this review, we intend to summarize the modes of regulated cell death other than apoptosis, and discuss their implications in toxicology. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The role of natural E-region plasma turbulence in the enhanced absorption of HF radio waves in the auroral ionosphere:Implications for RF heating of the auroral electrojet

Directory of Open Access Journals (Sweden)

T. R. Robinson

1994-03-01

Full Text Available Physical processes which affect the absorption of radio waves passing through the auroral E-region when Farley-Buneman irregularities are present are examined. In particular, the question of whether or not it is legitimate to include the anomalous wave-enhanced collision frequency, which has been used successfully to account for the heating effects of Farley-Buneman waves in the auroral E-region, in the usual expression for the radio-wave absorption coefficient is addressed. Effects also considered are those due to wave coupling between electromagnetic waves and high-frequency electrostatic waves in the presence of Farley-Buneman irregularities. The implications for radio-wave heating of the auroral electrojet of these processes are also discussed. In particular, a new theoretical model for calculating the effects of high-power radio-wave heating on the electron temperature in an electrojet containing Farley-Buneman turbulence is presented.

The role of natural E-region plasma turbulence in the enhanced absorption of HF radio waves in the auroral ionosphere:Implications for RF heating of the auroral electrojet

Directory of Open Access Journals (Sweden)

T. R. Robinson

Full Text Available Physical processes which affect the absorption of radio waves passing through the auroral E-region when Farley-Buneman irregularities are present are examined. In particular, the question of whether or not it is legitimate to include the anomalous wave-enhanced collision frequency, which has been used successfully to account for the heating effects of Farley-Buneman waves in the auroral E-region, in the usual expression for the radio-wave absorption coefficient is addressed. Effects also considered are those due to wave coupling between electromagnetic waves and high-frequency electrostatic waves in the presence of Farley-Buneman irregularities. The implications for radio-wave heating of the auroral electrojet of these processes are also discussed. In particular, a new theoretical model for calculating the effects of high-power radio-wave heating on the electron temperature in an electrojet containing Farley-Buneman turbulence is presented.

Single-Spin Polarization Effects and the Determination of Timelike Proton Form Factors

Energy Technology Data Exchange (ETDEWEB)

Brodsky, S

2003-10-24

We show that measurements of the proton's polarization in e{sup +}e{sup -} {yields} p{bar p} strongly discriminate between analytic forms of models which fit the proton form factors in the spacelike region. In particular, the single-spin asymmetry normal to the scattering plane measures the relative phase difference between the timelike G{sub E} and G{sub M} form factors. The expected proton polarization in the timelike region is large, of order of several tens of percent.

Geographic variation in nasal cavity form among three human groups from the Japanese Archipelago: Ecogeographic and functional implications.

Science.gov (United States)

Fukase, Hitoshi; Ito, Tsuyoshi; Ishida, Hajime

2016-05-01

Geographic variation in human nasal form has often been interpreted as a climatic adaptation, owing to the nasal air-conditioning function. The aim of this study was to further address morphofunctional issues of the nasal cavity, using three human groups from subarctic, temperate, and subtropical regions of the Japanese Archipelago: prehistoric Okhotsk, early-modern Honshu and Okinawa groups. Using three-dimensional coordinates of craniometric landmarks surrounding the nasal cavity, we compared linear measurements regarding nasal cavity form among the three groups and also conducted 3D geometric morphometrics. Both linear measurements and morphometric analyses corroborate the previously reported covariation pattern of nasal cavity shape with climate, where humans from a cold/dry climate tend to possess a relatively tall, narrow, and deep nasal cavity compared with those from a warm/humid environment. The northern Okhotsk group had overall larger cranial airways, which may be attributable to their large facial skeleton. However, the ratio of nasal/bimaxillary breadth was significantly lower in the Okhotsk group, indicating that maxillary size does not necessarily constrain the nasal breadth. In addition, despite the presence of obvious geographic clines in anterior nasal shape, posterior choanal shape lacked the north-south geographic cline. This suggests a certain level of morphofunctional independence between the anterior and posterior nasal openings. The observed geographic variations must, however, be partly considered as a reflection of different ancestral traits and population histories of the three groups. Nevertheless, the results indicate that intergroup variations in nasal cavity morphology can be largely explained by climatic conditions. Am. J. Hum. Biol. 28:343-351, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

Science.gov (United States)

Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

2012-01-01

The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

Regional landslide hazard assessment in a deep uncertain future

Science.gov (United States)

Almeida, Susana; Holcombe, Liz; Pianosi, Francesca; Wagener, Thorsten

2017-04-01

Landslides have many negative economic and societal impacts, including the potential for significant loss of life and damage to infrastructure. These risks are likely to be exacerbated in the future by a combination of climatic and socio-economic factors. Climate change, for example, is expected to increase the occurrence of rainfall-triggered landslides, because a warmer atmosphere tends to produce more high intensity rainfall events. Prediction of future changes in rainfall, however, is subject to high levels of uncertainty, making it challenging for decision-makers to identify the areas and populations that are most vulnerable to landslide hazards. In this study, we demonstrate how a physically-based model - the Combined Hydrology and Stability Model (CHASM) - can be used together with Global Sensitivity Analysis (GSA) to explore the underlying factors controlling the spatial distribution of landslide risks across a regional landscape, while also accounting for deep uncertainty around future rainfall conditions. We demonstrate how GSA can used to analyse CHASM which in turn represents the spatial variability of hillslope characteristics in the study region, while accounting for other uncertainties. Results are presented in the form of landslide hazard maps, utilising high-resolution digital elevation datasets for a case study in St Lucia in the Caribbean. Our findings about spatial landslide hazard drivers have important implications for data collection approaches and for long-term decision-making about land management practices.

Tourism Diversification and Its Implications for Smart Specialisation

Directory of Open Access Journals (Sweden)

Adi Weidenfeld

2018-01-01

Full Text Available The complex nature of tourism, its strong inter-sectoral relationships and regional dimension challenge innovation. The advent of smart specialisation, which focuses on regional diversification across sectors, offers considerable and hitherto largely unrealized potential for developing innovative tourism policies within this new agenda. This paper addresses the understudied concept of tourism diversification and its unrealized relevance to smart specialisation, which has emerged as a mainstream logic underpinning EU Cohesion Policy reforms and has diffused into other OECD countries. It provides a theoretical framework for studying product, market, sectoral and regional diversification as well as related variety in tourism. Some policy implications for realizing tourism diversification and for the potential role of tourism in smart specialisation strategies in particular are suggested.

{sup 13}C-METHYL FORMATE: OBSERVATIONS OF A SAMPLE OF HIGH-MASS STAR-FORMING REGIONS INCLUDING ORION-KL AND SPECTROSCOPIC CHARACTERIZATION

Energy Technology Data Exchange (ETDEWEB)

Favre, Cécile; Bergin, Edwin A.; Crockett, Nathan R.; Neill, Justin L. [Department of Astronomy, University of Michigan, 500 Church Street, Ann Arbor, MI 48109 (United States); Carvajal, Miguel [Dpto. Física Aplicada, Unidad Asociada CSIC, Facultad de Ciencias Experimentales, Universidad de Huelva, E-21071 Huelva (Spain); Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Brouillet, Nathalie; Despois, Didier; Baudry, Alain [Univ. Bordeaux, LAB, UMR 5804, F-33270, Floirac (France); Kleiner, Isabelle [Laboratoire Interuniversitaire des Systèmes Atmosphériques (LISA), CNRS, UMR 7583, Université de Paris-Est et Paris Diderot, 61, Av. du Général de Gaulle, F-94010 Créteil Cedex (France); Margulès, Laurent; Huet, Thérèse R.; Demaison, Jean, E-mail: cfavre@umich.edu, E-mail: miguel.carvajal@dfa.uhu.es [Laboratoire de Physique des Lasers, Atomes et Molécules, UMR CNRS 8523, Université Lille I, F-59655 Villeneuve d' Ascq Cedex (France)

2015-01-01

We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH{sub 3}, and its isotopologues H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the {sup 13}C-methyl formate isotopologue HCOO{sup 13}CH{sub 3} toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection of the {sup 13}C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the {sup 12}C/{sup 13}C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the {sup 13}C-methyl formate isotopologues, commensurate with the average {sup 12}C/{sup 13}C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the {sup 12}C/{sup 13}C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3} species. New spectroscopic data for both isotopomers H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time.

Regional analyses of labor markets and demography: a model based Norwegian example.

Science.gov (United States)

Stambol, L S; Stolen, N M; Avitsland, T

1998-01-01

The authors discuss the regional REGARD model, developed by Statistics Norway to analyze the regional implications of macroeconomic development of employment, labor force, and unemployment. "In building the model, empirical analyses of regional producer behavior in manufacturing industries have been performed, and the relation between labor market development and regional migration has been investigated. Apart from providing a short description of the REGARD model, this article demonstrates the functioning of the model, and presents some results of an application." excerpt

THE MARKETING ROLE IN IMPROVING THE COMPETITIVENESS OF THE REGION

Directory of Open Access Journals (Sweden)

Yuliia Shapoval

2017-09-01

Full Text Available The research objective is the sight of theoretical aspects formulation and prediction of competitiveness of regions within the framework of modern marketing positions. The evolution, programs, strategies, and factors of marketing are analysed, which affects the attractiveness of the regions. Methodology. In the study process, a combination of the following methods is used: generalization and scientific abstraction to specify the key definitions and categories, monographic method – for presenting the opinion of scientists regarding the directions of application of marketing tools in the process of managing the competitiveness of regions, comparative analysis – to detect features of application programs and marketing strategies. Results. It is considered that regional marketing is a mechanism that provides a methodology and tools for ensuring the competitiveness of the territory. It allows determining the marketing type of territorial management, which is formed not from the wishes of the authorities (for example, in search for funds for the implementation of certain projects, but from the study of the needs of consumers (entrepreneurs, local residents, investors, tourists, which the territory has the opportunity to satisfy; analyse the market opportunities and determine the competitive advantages of the territory, as well as influence the sustainable economic growth. It is determined that the competitiveness of the region is defined as a potential opportunity to win in a competition between territories for the benefits that satisfy needs and are distributed among the population and business entities that identify themselves with the region, as well as visitors who have certain intentions in this region. In fact, we are talking about the choice of priorities, in which this territory has competitive advantages, the raise of which can lead to heightening living standards, which is an indicator of the competitiveness of the region. The practical

Premonsoon Aerosol Characterization and Radiative Effects Over the Indo-Gangetic Plains: Implications for Regional Climate Warming

Science.gov (United States)

Gautam, Ritesh; Hsu, N. Christina; Lau, K.-M.

2010-01-01

The Himalayas have a profound effect on the South Asian climate and the regional hydrological cycle, as it forms a barrier for the strong monsoon winds and serves as an elevated heat source, thus controlling the onset and distribution of precipitation during the Indian summer monsoon. Recent studies have suggested that radiative heating by absorbing aerosols, such as dust and black carbon over the Indo-Gangetic Plains (IGP) and slopes of the Himalayas, may significantly accelerate the seasonal warming of the Hindu Kush-Himalayas-Tibetan Plateau (HKHT) and influence the subsequent evolution of the summer monsoon. This paper presents a detailed characterization of aerosols over the IGP and their radiative effects during the premonsoon season (April-May-June) when dust transport constitutes the bulk of the regional aerosol loading, using ground radiometric and spaceborne observations. During the dust-laden period, there is a strong response of surface shortwave flux to aerosol absorption indicated by the diurnally averaged forcing efficiency of -70 W/sq m per unit optical depth. The simulated aerosol single-scattering albedo, constrained by surface flux and aerosol measurements, is estimated to be 0.89+/- 0.01 (at approx.550 nm) with diurnal mean surface and top-of-atmosphere forcing values ranging from -11 to -79.8 W/sq m and +1.4 to +12 W/sq m, respectively, for the premonsoon period. The model-simulated solar heating rate profile peaks in the lower troposphere with enhanced heating penetrating into the middle troposphere (5-6 km), caused by vertically extended aerosols over the IGP with peak altitude of approx.5 km as indicated by spaceborne Cloud-Aerosol Lidar with Orthogonal Polarization observations. On a long-term climate scale, our analysis, on the basis of microwave satellite measurements of tropospheric temperatures from 1979 to 2007, indicates accelerated annual mean warming rates found over the Himalayan-Hindu Kush region (0.21 C/decade+/-0.08 C

Rising prevalence of back pain in Austria: considering regional disparities.

Science.gov (United States)

Großschädl, Franziska; Stolz, Erwin; Mayerl, Hannes; Rásky, Éva; Freidl, Wolfgang; Stronegger, Willibald J

2016-01-01

Back pain is the most common form of musculoskeletal conditions and leads to high health care costs. Information about geographic variations in highly prevalent diseases/disorders represents important implications for public health planning to face structural challenges. The present study aims to investigate regional trends in the prevalence of back pain and the role of obesity and social inequalities among Austrian adults. A secondary data analysis based on five nationally representative cross-sectional surveys (1973-2007) was carried out (N = 178,818). Back pain was measured as self-reported presence. Obesity (BMI ≥ 30 kg/m²) was adjusted for self-report bias. For the regional analyses, Austria was divided into Western, Central and Eastern Austria. A relative index of inequality (RII) was computed to quantify the extent of social inequality. A continuous rise in back pain prevalence was observed in the three regions and among all investigated subgroups. In 2007 the age-standardised prevalence was similar in Central (36.9 %), Western (35.2 %) and Eastern Austria (34.3 %). The absolute change in back pain prevalence was highest among obese subjects in Central Austria (women: + 29.8 %, men: + 32.5 %). RIIs were unstable during the study period and in 2007 highest in Eastern Austria. Variation and trends in back pain are not attributable to geographic variation in Austria: an assumed East-West gradient in Austria has not been confirmed. Nevertheless our study confirms that back pain dramatically increased in all Austrian regions and investigated subgroups. This worrying trend should be further monitored and public health interventions should be implemented increasingly, especially among obese women and men.

Robustness Regions for Dichotomous Decisions.

Science.gov (United States)

Vijn, Pieter; Molenaar, Ivo W.

1981-01-01

In the case of dichotomous decisions, the total set of all assumptions/specifications for which the decision would have been the same is the robustness region. Inspection of this (data-dependent) region is a form of sensitivity analysis which may lead to improved decision making. (Author/BW)

Scientific Collaboration Along the Trinational Frontier of Brazil-Bolivia-Peru: Implications for Regional Land-Use in the MAP Region of Southwestern Amazonia

Science.gov (United States)

Brown, I.

2002-12-01

High-speed road systems are connecting southwestern Amazonia (~1.5 million km2) to Pacific and Atlantic ports as well as providing greater access to Brazilian, Bolivian and Peruvian urban markets. Coupled with this increased accessibility are ambitious governmental plans to expand production of timber, non-timber forest products, and beef, all of which are likely to modify human migrations in the region. The heart of southwestern Amazonia lies in the trinational frontier region of Madre de Dios Department/Peru, eastern Acre State/Brazil and Pando Department/Bolivia (MAP region: ~200,000 km2, ~500,000 inhabitants). The MAP region composes a global hot spot of terrestrial biodiversity and has become an axis of integration for the three countries. Faced with rapid change in socioeconomic trends, regional environmental scientists and professionals have promoted collaborative projects to analyze land use trends and their forcing functions and to supply these results to local and regional societies. In addition, they have begun to develop a regional scientific community that bridges different nationalities and specialties. The projects are both international - as they involve three countries - and local/regional as they involve institutions that are within a radius of 300 km of the border. In the past two years, LBA-sponsored activities have helped bring over 100 professionals together in the region in five MAP-oriented workshops. The research results are now influencing public policy and are being incorporated into the regional school systems with the objective of maximizing the benefits and minimizing the adverse impacts of the changing socio-economic trends on land-use and development in the MAP region.

Substitutions in conserved regions preceding and within the linker affect activity and flexibility of tRNase ZL, the long form of tRNase Z.

Directory of Open Access Journals (Sweden)

Makenzie Saoura

Full Text Available The enzyme tRNase Z, a member of the metallo-β-lactamase family, endonucleolytically removes 3' trailers from precursor tRNAs, preparing them for CCA addition and aminoacylation. The short form of tRNase Z, tRNase ZS, functions as a homodimer and is found in all prokaryotes and some eukaryotes. The long form, tRNase ZL, related to tRNase ZS through tandem duplication and found only in eukaryotes, possesses ~2,000-fold greater catalytic efficiency than tRNase ZS. tRNase ZL consists of related but diverged amino and carboxy domains connected by a flexible linker (also referred to as a flexible tether and functions as a monomer. The amino domain retains the flexible arm responsible for substrate recognition and binding while the carboxy domain retains the active site. The linker region was explored by Ala-scanning through two conserved regions of D. melanogaster tRNase Z: NdomTprox, located at the carboxy end of the amino domain proximal to the linker, and Tflex, a flexible site in the linker. Periodic substitutions in a hydrophobic patch (F329 and L332 at the carboxy end of NdomTprox show 2,700 and 670-fold impairment relative to wild type, respectively, accompanied by reduced linker flexibility at N-T inside the Ndom- linker boundary. The Ala substitution for N378 in the Tflex region has 10-fold higher catalytic efficiency than wild type and locally decreased flexibility, while the Ala substitution at R382 reduces catalytic efficiency ~50-fold. These changes in pre-tRNA processing kinetics and protein flexibility are interpreted in light of a recent crystal structure for S. cerevisiae tRNase Z, suggesting transmission of local changes in hydrophobicity into the skeleton of the amino domain.

Mantle refertilization and magmatism in old orogenic regions: The role of late-orogenic pyroxenites

Science.gov (United States)

France, Lydéric; Chazot, Gilles; Kornprobst, Jacques; Dallai, Luigi; Vannucci, Riccardo; Grégoire, Michel; Bertrand, Hervé; Boivin, Pierre

2015-09-01

Pyroxenites and garnet pyroxenites are mantle heterogeneities characterized by a lower solidus temperature than the enclosing peridotites; it follows that they are preferentially involved during magma genesis. Constraining their origin, composition, and the interactions they underwent during their subsequent evolution is therefore essential to discuss the sources of magmatism in a given area. Pyroxenites could represent either recycling of crustal rocks in mantle domains or mantle originated rocks (formed either by olivine consuming melt-rock reactions or by crystal fractionation). Petrological and geochemical (major and trace elements, Sr-Nd and O isotopes) features of xenoliths from various occurrences (French Massif-Central, Jordan, Morocco and Cameroon) show that these samples represent cumulates crystallized during melt percolation at mantle conditions. They formed in mantle domains at pressures of 1-2 GPa during post-collisional magmatism (possibly Hercynian for the French Massif-Central, and Panafrican for Morocco, Jordan and Cameroon). The thermal re-equilibration of lithospheric domains, typical of the late orogenic exhumation stages, is also recorded by the samples. Most of the samples display a metasomatic overprint that may be either inherited or likely linked to the recent volcanic activity that occurred in the investigated regions. The crystallization of pyroxenites during late orogenic events has implications for the subsequent evolution of the mantle domains. The presence of large amounts of mantle pyroxenites in old orogenic regions indeed imparts peculiar physical and chemical characteristics to these domains. Among others, the global solidus temperature of the whole lithospheric domain will be lowered; in turn, this implies that old orogenic regions are refertilized zones where magmatic activity would be enhanced.

Intern Perceptions of Dialect and Regionalism

Science.gov (United States)

O'Hara, Hunter

2005-01-01

Interns at The University of Tampa investigate how perceptions of dialect and regionalism may impact the learning environment and more precisely, the learner. Regionalism is defined as a belief that one's region of origin is a primary determinant of the quality of one's standards of living, social forms, customary beliefs, levels of…

Regionally-varying and regionally-uniform electricity pricing policies compared across four usage categories

International Nuclear Information System (INIS)

Cho, Seong-Hoon; Kim, Taeyoung; Kim, Hyun Jae; Park, Kihyun; Roberts, Roland K.

2015-01-01

The objective of our research is to predict how electricity demand varies spatially between status quo regionally-uniform electricity pricing and hypothetical regionally-varying electricity pricing across usage categories. We summarize the empirical results of a case study of electricity demand in South Korea with three key findings and their related implications. First, the price elasticities of electricity demand differ across usage categories. Specifically, electricity demands for manufacturing and retail uses are price inelastic and close to unit elastic, respectively, while those for agricultural and residential uses are not statistically significant. This information is important in designing energy policy, because higher electricity prices could reduce electricity demands for manufacturing and retail uses, resulting in slower growth in those sectors. Second, spatial spillovers in electricity demand vary across uses. Understanding the spatial structure of electricity demand provides useful information to energy policy makers for anticipating changes in demand across regions via regionally-varying electricity pricing for different uses. Third, simulation results suggest that spatial variations among electricity demands by usage category under a regionally-varying electricity-pricing policy differ from those under a regionally-uniform electricity-pricing policy. Differences in spatial changes between the policies provide information for developing a realistic regionally-varying electricity-pricing policy according to usage category. - Highlights: • We compare regionally-varying and regionally-uniform electricity pricing policies. • We summarize empirical results of a case study of electricity demand in South Korea. • We confirm that spatial spillovers in electricity demands vary across different uses. • We find positive spatial spillovers in the manufacturing and residential sectors. • Our methods help policy makers evaluate regionally-varying pricing

THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

International Nuclear Information System (INIS)

Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

2012-01-01

Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

Phylogenetic and functional implications of the ear region anatomy of Glossotherium robustum (Xenarthra, Mylodontidae) from the Late Pleistocene of Argentina

Science.gov (United States)

Boscaini, Alberto; Iurino, Dawid A.; Billet, Guillaume; Hautier, Lionel; Sardella, Raffaele; Tirao, German; Gaudin, Timothy J.; Pujos, François

2018-04-01

Several detailed studies of the external morphology of the ear region in extinct sloths have been published in the past few decades, and this anatomical region has proved extremely helpful in elucidating the phylogenetic relationships among the members of this mammalian clade. Few studies of the inner ear anatomy in these peculiar animals were conducted historically, but these are increasing in number in recent years, in both the extinct and extant representatives, due to wider access to CT-scanning facilities, which allow non-destructive access to internal morphologies. In the present study, we analyze the extinct ground sloth Glossotherium robustum and provide a description of the external features of the ear region and the endocranial side of the petrosal bone, coupled with the first data on the anatomy of the bony labyrinth. Some features observable in the ear region of G. robustum (e.g., the shape and size of the entotympanic bone and the morphology of the posteromedial surface of the petrosal) are highly variable, both intraspecifically and intraindividually. The form of the bony labyrinth of G. robustum is also described, providing the first data from this anatomical region for the family Mylodontidae. The anatomy of the bony labyrinth of the genus Glossotherium is here compared at the level of the superorder Xenarthra, including all available extant and extinct representatives, using geometric morphometric methods. In light of the new data, we discuss the evolution of inner ear anatomy in the xenarthran clade, and most particularly in sloths, considering the influence of phylogeny, allometry, and physiology on the shape of this highly informative region of the skull. These analyses show that the inner ear of Glossotherium more closely resembles that of the extant anteaters, and to a lesser extent those of the giant ground sloth Megatherium and euphractine armadillos, than those of the extant sloths Bradypus and Choloepus, further demonstrating the striking

The regional approach and regional studies method in the process of geography teaching

Science.gov (United States)

Dermendzhieva, Stela; Doikov, Martin

2017-03-01

We define the regional approach as a manner of relations among the global trends of development of the "Society-man-nature" system and the local differentiating level of knowledge. Conditionally, interactions interlace under the influence of the character of Geography as a science, education, approaches, goals and teaching methods. Global, national and local development differentiates in three concentric circles at the level of knowledge. It is determined as a conception of modern, complex and effective mechanism for young people, through which knowledge develops in regional historical and cultural perspective; self-consciousness for socio-economic and cultural integration is formed as a part of the. historical-geographical image of the native land. This way an attitude to the. native land is formed as a connecting construct between patriotism to the motherland and the same in global aspect. The possibility for integration and cooperation of the educative geographical content with all the local historical-geographical, regional, profession orientating, artistic, municipal and district institutions, is outlined. Contemporary geographical education appears to be a powerful and indispensable mechanism for organization of human sciences, while the regional approach and the application of the regional studies method stimulate and motivate the development and realization of optimal capacities for direct connection with the local structures and environments.

Turbine component casting core with high resolution region

Science.gov (United States)

Kamel, Ahmed; Merrill, Gary B.

2014-08-26

A hollow turbine engine component with complex internal features can include a first region and a second, high resolution region. The first region can be defined by a first ceramic core piece formed by any conventional process, such as by injection molding or transfer molding. The second region can be defined by a second ceramic core piece formed separately by a method effective to produce high resolution features, such as tomo lithographic molding. The first core piece and the second core piece can be joined by interlocking engagement that once subjected to an intermediate thermal heat treatment process thermally deform to form a three dimensional interlocking joint between the first and second core pieces by allowing thermal creep to irreversibly interlock the first and second core pieces together such that the joint becomes physically locked together providing joint stability through thermal processing.

Molecular Diagnostics of the Interstellar Medium and Star Forming Regions

Science.gov (United States)

Hartquist, T. W.; Dalgarno, A.

1996-03-01

Selected examples of the use of observationally inferred molecular level populations and chemical compositions in the diagnosis of interstellar sources and processes important in them (and in other diffuse astrophysical sources) are given. The sources considered include the interclump medium of a giant molecular cloud, dark cores which are the progenitors of star formation, material responding to recent star formation and which may form further stars, and stellar ejecta (including those of supernovae) about to merge with the interstellar medium. The measurement of the microwave background, mixing of material between different nuclear burning zones in evolved stars and turbulent boundary layers (which are present in and influence the structures and evolution of all diffuse astrophysical sources) are treated.

Acid Rain in Niger Delta Region: Implication on Water Resources ...

African Journals Online (AJOL)

This research focused on the effect of acid rain on the water quality of the Niger Delta region of Nigeria. Three hundred water samples were collected: 100 water samples from rain, 100 from open wells and 100 from rivers. The water samples were analysed using the paired t-test and multiple correlation analysis to ascertain ...

Northeast Asia regional energy infrastructure proposals

International Nuclear Information System (INIS)

Hippel, David von; Gulidov, Ruslan; Kalashnikov, Victor; Hayes, Peter

2011-01-01

Economic growth in the countries of Northeast Asia has spurred a massive increase in the need for energy, especially oil, gas, coal, and electricity. Although the region, taken as a whole, possesses financial, technical, labor, and natural resources sufficient to address much of the region's needs now and into the future, no one country has all of those attributes. As a result, over the past two decades, there has been significant interest in regional proposals that would allow sharing of resources, including infrastructure to develop and transport energy resources from the Russian Far East to South Korea, China, and Japan, and cooperation on energy-efficiency, renewable energy, and the nuclear fuel cycle as well. In this article we review some of these proposals, identify some of the factors that could contribute to the success or failure of infrastructure proposals, and explore some of the implications and ramifications of energy cooperation activities for energy security in the region.

Regional Influences on Chinese Medicine Education: Comparing Australia and Hong Kong

Science.gov (United States)

Chung, Vincent C. H.; Zhang, Anthony L.; Adams, Jon

2016-01-01

High quality education programs are essential for preparing the next generation of Chinese medicine (CM) practitioners. Currently, training in CM occurs within differing health and education policy contexts. There has been little analysis of the factors influencing the form and status of CM education in different regions. Such a task is important for understanding how CM is evolving internationally and predicting future workforce characteristics. This paper compares the status of CM education in Australia and Hong Kong across a range of dimensions: historical and current positions in the national higher education system, regulatory context and relationship to the health system, and public and professional legitimacy. The analysis highlights the different ways in which CM education is developing in these settings, with Hong Kong providing somewhat greater access to clinical training opportunities for CM students. However, common trends and challenges shape CM education in both regions, including marginalisation from mainstream health professions, a small but established presence in universities, and an emphasis on biomedical research. Three factors stand out as significant for the evolution of CM education in Australia and Hong Kong and may have international implications: continuing biomedical dominance, increased competition between universities, and strengthened links with mainland China. PMID:27379170

Regional Influences on Chinese Medicine Education: Comparing Australia and Hong Kong

Directory of Open Access Journals (Sweden)

Caragh Brosnan

2016-01-01

Full Text Available High quality education programs are essential for preparing the next generation of Chinese medicine (CM practitioners. Currently, training in CM occurs within differing health and education policy contexts. There has been little analysis of the factors influencing the form and status of CM education in different regions. Such a task is important for understanding how CM is evolving internationally and predicting future workforce characteristics. This paper compares the status of CM education in Australia and Hong Kong across a range of dimensions: historical and current positions in the national higher education system, regulatory context and relationship to the health system, and public and professional legitimacy. The analysis highlights the different ways in which CM education is developing in these settings, with Hong Kong providing somewhat greater access to clinical training opportunities for CM students. However, common trends and challenges shape CM education in both regions, including marginalisation from mainstream health professions, a small but established presence in universities, and an emphasis on biomedical research. Three factors stand out as significant for the evolution of CM education in Australia and Hong Kong and may have international implications: continuing biomedical dominance, increased competition between universities, and strengthened links with mainland China.

Glacial Fluctuation in the Source Region of the Yangtze River

International Nuclear Information System (INIS)

Shengyi, Gao; Qingsong, Fan; Xi, Cao; Li, Ma

2014-01-01

Glaciers in the source region of the Yangtze River are not only water resources but also important energy and environmental resources. Glacial fluctuation is an important component of the study of changes in the natural environment, including climate change. We investigated the glaciers in the source region of the Yangtze River, and analyzed the fluctuations using multi-temporal remote sensing data. The trend in glacial fluctuation and the factors that influence it were determined. The results have implications for water resource management and environmental conservation in the Yangtze River region

Determinants of health disparities between Italian regions

Directory of Open Access Journals (Sweden)

Giannoni Margherita

2010-06-01

Full Text Available Abstract Background Among European countries, Italy is one of the countries where regional health disparities contribute substantially to socioeconomic health disparities. In this paper, we report on regional differences in self-reported poor health and explore possible determinants at the individual and regional levels in Italy. Methods We use data from the "Indagine Multiscopo sulle Famiglie", a survey of aspects of everyday life in the Italian population, to estimate multilevel logistic regressions that model poor self-reported health as a function of individual and regional socioeconomic factors. Next we use the causal step approach to test if living conditions, healthcare characteristics, social isolation, and health behaviors at the regional level mediate the relationship between regional socioeconomic factors and self-rated health. Results We find that residents living in regions with more poverty, more unemployment, and more income inequality are more likely to report poor health and that poor living conditions and private share of healthcare expenditures at the regional level mediate socioeconomic disparities in self-rated health among Italian regions. Conclusion The implications are that regional contexts matter and that regional policies in Italy have the potential to reduce health disparities by implementing interventions aimed at improving living conditions and access to quality healthcare.

Identification and therapeutic potential of a vitronectin binding region of meningococcal msf.

Directory of Open Access Journals (Sweden)

Darryl J Hill

Full Text Available The human pathogen Neisseria meningitides (Nm attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf, a trimeric autotransporter, binds to the activated form of vitronectin (aVn to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen.

Newborns health in the Danube Region

DEFF Research Database (Denmark)

Andersen, Zorana J; Sram, Radim J; Ščasný, Milan

2016-01-01

risks, and knowledge gaps in the Danube Region, based on publicly available databases, registers, and literature, as a rationale and incentive for a new integrated project. The review also proposes the concept for the project aiming to characterize in utero exposures to multiple environmental factors....... Estimating the burden of environmental exposures on early-life health is a growing research area in Europe which has major public health implications, but the data from the Danube Region are largely missing. AIM: This review presents an inventory of current environmental challenges, related early-life health...... and estimate their effect on early-life health, evaluate economic impact, as well as identify interventions with a potential to harness social norms to reduce emissions, exposures and health risks in the Danube Region. METHODS: Experts in environmental epidemiology, human biomonitoring and social science...

Regions, Regionalisme, Regionalisation. Clarifications conceptuelles et terminologiques

Directory of Open Access Journals (Sweden)

Dinu Balan

2013-07-01

Full Text Available This study points out the proteiphorme dimension of the three terms-concepts used in the actually political and juridical-administrative vocabulary, in relation with the transformations produced both in the European and national areas, in connection with the phenomenology of regionalization and its adjoining process. Our analysis is focused upon the terminological aspects and underlines both the signification and the practical implications of these concepts, in an interdisciplinary interpretation frame. We underline the importance of these terms in the European construction process. If they are difficult to prove an obvious relation between the regional politics of the European Union and the development of a regional tendency in Europe, they can say that the two phenomena cross and interfere themselves. The European integration and the regional tendency are not contradictory phenomena, but they join in the ample process concerning the new statute of the national state in a broader Europe. The regionalization and the regionalism don't only limit themselves at the regional politics of the bureaucracy from Brussels, so the process connected with the development of the regions involve very many factories.

STAR FORMATION IN SELF-GRAVITATING DISKS IN ACTIVE GALACTIC NUCLEI. II. EPISODIC FORMATION OF BROAD-LINE REGIONS

International Nuclear Information System (INIS)

WangJianmin; Du Pu; Ge Junqiang; Hu Chen; Baldwin, Jack A.; Ferland, Gary J.

2012-01-01

compose the high-ionization line regions whereas the metal-poor clouds are in low-ionization line (LIL) regions. Since metal-rich clouds are optically thin, they will be blown away by radiation pressure, forming the observed outflows. The outflowing clouds could set up a metallicity correlation between the BLRs and narrow-line regions. The LIL regions are episodic due to the mass cycle of clouds with the CAS in response to continuous injection by the SF disk, giving rise to different types of AGNs. Based on Sloan Digital Sky Survey quasar spectra, we identify a spectral sequence in light of emission-line equivalent width from phase I to IV. A key phase in the episodic appearance of the BLRs is bright type II AGNs with no or only weak BLRs, contrary to the popular picture in which the absence of a BLR is due to a low accretion rate. We discuss observational implications and tests of the theoretical predictions of this model.

Modeling the Spray Forming of H13 Steel Tooling

Science.gov (United States)

Lin, Yaojun; McHugh, Kevin M.; Zhou, Yizhang; Lavernia, Enrique J.

2007-07-01

On the basis of a numerical model, the temperature and liquid fraction of spray-formed H13 tool steel are calculated as a function of time. Results show that a preheated substrate at the appropriate temperature can lead to very low porosity by increasing the liquid fraction in the deposited steel. The calculated cooling rate can lead to a microstructure consisting of martensite, lower bainite, retained austenite, and proeutectoid carbides in as-spray-formed material. In the temperature range between the solidus and liquidus temperatures, the calculated temperature of the spray-formed material increases with increasing substrate preheat temperature, resulting in a very low porosity by increasing the liquid fraction of the deposited steel. In the temperature region where austenite decomposition occurs, the substrate preheat temperature has a negligible influence on the cooling rate of the spray-formed material. On the basis of the calculated results, it is possible to generate sufficient liquid fraction during spray forming by using a high growth rate of the deposit without preheating the substrate, and the growth rate of the deposit has almost no influence on the cooling rate in the temperature region of austenite decomposition.

SPATIAL DIFFERENTIATION OF THE REGIONS OF UKRAINE CONCERNING THE KNOWLEDGE ECONOMY

Directory of Open Access Journals (Sweden)

Lesia Dmytryshyn

2017-11-01

Full Text Available The purpose of the research is a set of theoretical and methodological, methodical and applied provisions concerning the analysis of economic development built on knowledge (KE in the regions of Ukraine and also the determination of their integral estimation of KE development level. Methodology. The research methodology is based on a systematic approach, within which analysed KAM methodology (Knowledge Assessment Methodology developed by the World Bank, identified key groups of indicators, such as the general condition of regional economies, economic stimulus and the characteristics of the institutional system, innovation, R&D sector and informational infrastructure. Considered the key factors that determine the position of knowledge in the regional development, namely: the business community, the scientific environment and the system of self-government, which forms regional policy in the light of specific conditions of areas. The possibility of this methodology’s application in the regional aspect is determined. For the research are chosen all regions of Ukraine. Exceptions are temporarily occupied territory. Accordingly, histograms of each of the key indicators’ groups are built that help to determine the level of development of a particular region. Results. Established that the symbiosis of innovative potential with the unique economic mechanisms is the catalysts that enhance the development of the regional knowledge economy. This analysis helps to see social and economic differences between the regions of Ukraine. Determined that the characteristic feature is an inadequate level of funding of science, which causes the slowdown of innovation activity in the regions because of links imbalance between industry and research industry sector. In most cases, the regions occupied similar positions in different groups of indicators. This allows us to conclude that the development of the knowledge economy components in the region is balanced

Community Psychology, Diversity, and the Many Forms of Culture

Science.gov (United States)

Tebes, Jacob Kraemer

2010-01-01

Comments on the original article, "Many forms of culture," by A. B. Cohen. Cohen argued that psychology must broaden its conceptualization of culture to consider its many forms, such as religion, socioeconomic status, and region. The current author could not agree more with Cohen's proposed conceptualization of culture and its potential impact on…

Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

Science.gov (United States)

Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

2010-01-01

Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

Variation of nuclear radii in the drip line regions

CERN Document Server

Beiner, M; Mas, D

1976-01-01

The authors are concerned with predictions of the energy density method with respect to the nuclear sizes (RMS radii). It is known that the commonly accepted A/sup 1/3/-type laws are only approximative and deviations are expected to grow significantly as one goes away from the beta -stability region. Particular attention is paid to the variation of nuclear radii in the drip line regions. Implications of the resulting large total Coulomb energy variations between neighbouring nuclei will be emphasized.

Regional Legal Assistance

Directory of Open Access Journals (Sweden)

Abdul Fatah

2015-06-01

Full Text Available Legal aid policy in the area carried out on several considerations including: Implementation of the authority given to the legal aid act, granting the guarantee and protection of access to justice and equality before the law in the area, equitable distribution of justice and increase public awareness and understanding of the law, and legal implications that accompanied the emergence of the right to legal counsel without pay and the right to choose the legal settlement. How To Cite Fatah, A. (2015. Regional Legal Assistance. Rechtsidee, 2(1, 1-10. doi:http://dx.doi.org/10.21070/jihr.v2i1.7

Process and structures for fabrication of solar cells with laser ablation steps to form contact holes

Science.gov (United States)

Harley, Gabriel; Smith, David D; Dennis, Tim; Waldhauer, Ann; Kim, Taeseok; Cousins, Peter John

2013-11-19

Contact holes of solar cells are formed by laser ablation to accomodate various solar cell designs. Use of a laser to form the contact holes is facilitated by replacing films formed on the diffusion regions with a film that has substantially uniform thickness. Contact holes may be formed to deep diffusion regions to increase the laser ablation process margins. The laser configuration may be tailored to form contact holes through dielectric films of varying thickness.

Innovation Geography and Regional Growth in European Union

Directory of Open Access Journals (Sweden)

George M. Korres

2011-06-01

Full Text Available There is a huge literature regarding the main determinants and sources of economic growth. Most of the recent work emphasizes on the role of knowledge and innovation activities typically produced by a specific sector of the economy, and on analyzing the implications and the importance for economic growth. Moreover, the socioeconomic and public policies aim to distinguish the determining factors of growth to enhance the regional cohesion and the convergence process. Much of the recent work on regional growth can be viewed as refining the basic economic insights of economic geography. This article attempts to analyze the European systems of innovation and the effects of European technological policy to regional growth.

Ocean Data Interoperability Platform (ODIP): using regional data systems for global ocean research

Science.gov (United States)

Schaap, D.; Thijsse, P.; Glaves, H.

2017-12-01

Ocean acidification, loss of coral reefs, sustainable exploitation of the marine environment are just a few of the challenges researchers around the world are currently attempting to understand and address. However, studies of these ecosystem level challenges are impossible unless researchers can discover and re-use the large volumes of interoperable multidisciplinary data that are currently only accessible through regional and global data systems that serve discreet, and often discipline specific, user communities. The plethora of marine data systems currently in existence are also using different standards, technologies and best practices making re-use of the data problematic for those engaged in interdisciplinary marine research. The Ocean Data Interoperability Platform (ODIP) is responding to this growing demand for discoverable, accessible and reusable data by establishing the foundations for a common global framework for marine data management. But creation of such an infrastructure is a major undertaking, and one that needs to be achieved in part by establishing different levels of interoperability across existing regional and global marine e-infrastructures. Workshops organised by ODIP II facilitate dialogue between selected regional and global marine data systems in an effort to identify potential solutions that integrate these marine e-infrastructures. The outcomes of these discussions have formed the basis for a number of prototype development tasks that aim to demonstrate effective sharing of data across multiple data systems, and allow users to access data from more than one system through a single access point. The ODIP II project is currently developing four prototype solutions that are establishing interoperability between selected regional marine data management infrastructures in Europe, the USA, Canada and Australia, and with the global POGO, IODE Ocean Data Portal (ODP) and GEOSS systems. The potential impact of implementing these solutions for

Specific protein supplementation using soya, casein or whey differentially affects regional gut growth and luminal growth factor bioactivity in rats; implications for the treatment of gut injury and stimulating repair.

Science.gov (United States)

Marchbank, Tania; Mandir, Nikki; Calnan, Denis; Goodlad, Robert A; Podas, Theo; Playford, Raymond J

2018-01-24

Modulation of regional growth within specific segments of the bowel may have clinical value for several gastrointestinal conditions. We therefore examined the effects of different dietary protein sources on regional gut growth and luminal growth factor bioactivity as potential therapies. Rats were fed for 14 days on isonitrogenous and isocaloric diets comprising elemental diet (ED) alone (which is known to cause gut atrophy), ED supplemented with casein or whey or a soya protein-rich feed. Effects on regional gut growth and intraluminal growth factor activity were then determined. Despite calorie intake being similar in all groups, soya rich feed caused 20% extra total body weight gain. Stomach weight was highest on soya and casein diets. Soya enhanced diet caused greatest increase in small intestinal weight and preserved luminal growth factor activity at levels sufficient to increase proliferation in vitro. Regional small intestinal proliferation was highest in proximal segment in ED fed animals whereas distal small intestine proliferation was greater in soya fed animals. Colonic weight and proliferation throughout the colon was higher in animals receiving soya or whey supplemented feeds. We conclude that specific protein supplementation with either soya, casein or whey may be beneficial to rest or increase growth in different regions of the bowel through mechanisms that include differentially affecting luminal growth factor bioactivity. These results have implications for targeting specific regions of the bowel for conditions such as Crohn's disease and chemotherapy.

Speciated OVOC and VOC emission inventories and their implications for reactivity-based ozone control strategy in the Pearl River Delta region, China.

Science.gov (United States)

Ou, Jiamin; Zheng, Junyu; Li, Rongrong; Huang, Xiaobo; Zhong, Zhuangmin; Zhong, Liuju; Lin, Hui

2015-10-15

The increasing ground-ozone (O3) levels, accompanied by decreasing SO2, NO2, PM10 and PM2.5 concentrations benefited from air pollution control measures implemented in recent years, initiated a serious challenge to control Volatile Organic Compound (VOC) emissions in the Pearl River Delta (PRD) region, China. Speciated VOC emission inventory is fundamental for estimating Ozone Formation Potentials (OFPs) to identify key reactive VOC species and sources in order to formulate efficient O3 control strategies. With the use of the latest bulk VOC emission inventory and local source profiles, this study developed the PRD regional speciated Oxygenated Volatile Organic Compound (OVOC) and VOC emission inventories to identify the key emission-based and OFP-based VOC sources and species. Results showed that: (1) Methyl alcohol, acetone and ethyl acetate were the major constituents in the OVOC emissions from industrial solvents, household solvents, architectural paints and biogenic sources; (2) from the emission-based perspective, aromatics, alkanes, OVOCs and alkenes made up 39.2%, 28.2%, 15.9% and 10.9% of anthropogenic VOCs; (3) from the OFP-based perspective, aromatics and alkenes become predominant with contributions of 59.4% and 25.8% respectively; (4) ethene, m/p-xylene, toluene, 1,2,4-trimethyl benzene and other 24 high OFP-contributing species were the key reactive species that contributed to 52% of anthropogenic emissions and up to 80% of OFPs; and (5) industrial solvents, industrial process, gasoline vehicles and motorcycles were major emission sources of these key reactive species. Policy implications for O3 control strategy were discussed. The OFP cap was proposed to regulate VOC control policies in the PRD region due to its flexibility in reducing the overall OFP of VOC emission sources in practice. Copyright © 2015 Elsevier B.V. All rights reserved.

The emerging international constitutional order: the implications of hierarchy in international law for the coherence and legitimacy of international decision-making

Directory of Open Access Journals (Sweden)

E de Wet

2007-11-01

Full Text Available The article examines the contours and implications of the emerging international constitutional order. The "constitutional" nature of this order relates to the fact that it contains certain fundamental substantive and structural norms that form a supreme legal framework for the exercise of public power. The substantive elements primarily include the value system of the international legal order, meaning norms of positive law with a strong ethical underpinning (notably human rights norms that have acquired a special hierarchical standing vis-à-vis other international norms through state practice. The structural elements refer to the subjects of the international legal order that collectively constitute the international community (polity, as well as the mechanisms for enforcement of the international value system. This vision of an international constitutional model is inspired by the intensification in the shift of public decision-making away from the nation state towards international actors of a regional (for example EU or functional (for example WTO, UN nature, and its eroding impact on the notion of a “total” constitutional order, where the fundamental substantive and structural norms that form the supreme legal framework for the exercise of public power are concentrated in the nation state. It is also inspired by the belief that such a supreme legal framework is only possible in a system where different national, regional and functional legal orders complement each other in order to form an international constitutional order.

Rise of China in the Caribbean: Impacts for Regional Security

Science.gov (United States)

2013-12-13

Prima facie , more demonstrative of a policy is to retain primacy in the region while engaging the interests and cooperation of Caribbean states. In...and diplomatic cooperation with Caribbean nations. The prima facie implications are therefore, without evidence to the contrary, that these

Radiative transfer modelling of W33A MM1: 3-D structure and dynamics of a complex massive star forming region

Science.gov (United States)

Izquierdo, Andrés F.; Galván-Madrid, Roberto; Maud, Luke T.; Hoare, Melvin G.; Johnston, Katharine G.; Keto, Eric R.; Zhang, Qizhou; de Wit, Willem-Jan

2018-05-01

We present a composite model and radiative transfer simulations of the massive star forming core W33A MM1. The model was tailored to reproduce the complex features observed with ALMA at ≈0.2 arcsec resolution in CH3CN and dust emission. The MM1 core is fragmented into six compact sources coexisting within ˜1000 au. In our models, three of these compact sources are better represented as disc-envelope systems around a central (proto)star, two as envelopes with a central object, and one as a pure envelope. The model of the most prominent object (Main) contains the most massive (proto)star (M⋆ ≈ 7 M⊙) and disc+envelope (Mgas ≈ 0.4 M⊙), and is the most luminous (LMain ˜ 104 L⊙). The model discs are small (a few hundred au) for all sources. The composite model shows that the elongated spiral-like feature converging to the MM1 core can be convincingly interpreted as a filamentary accretion flow that feeds the rising stellar system. The kinematics of this filament is reproduced by a parabolic trajectory with focus at the center of mass of the region. Radial collapse and fragmentation within this filament, as well as smaller filamentary flows between pairs of sources are proposed to exist. Our modelling supports an interpretation where what was once considered as a single massive star with a ˜103 au disc and envelope, is instead a forming stellar association which appears to be virialized and to form several low-mass stars per high-mass object.

Evaluating the MBTI® Form M in a South African context

Directory of Open Access Journals (Sweden)

Casper J.J. van Zyl

2012-09-01

Research purpose: To investigate the reliability, validity and differential item functioning of the MBTI® Form M across groups in South Africa using Classical Test Theory (CTT and Item Response Theory (IRT methods. Motivation for the study: To add to the continual research and improvement of the MBTI® Form M through the investigation of its psychometric properties across groups in South Africa. Research design, approach and method: This study falls within the quantitative research paradigm. Classical test theory methods and Rasch analysis were used to evaluate the functioning of the MBTI Form M across gender and ethnic groups. A cross-sectional study was completed consisting of 10 705 South African respondents. Main findings: Excellent reliability was found for the instrument across groups in the sample. Good evidence for construct validity was found using exploratory factor analysis and confirmatory factor analysis. Some evidence for uniform bias was found across ethnic and gender groups and a few items reflected non-uniform DIF across gender groups only. The effect of uniform and non-uniform DIF did not appear to have major practical implications for the interpretation of the scales. Practical/managerial implications: The results provided evidence that supports the psychometric validity of the MBTI instrument in the South African context. Contribution/value-add: This study is the largest study to date regarding the psychometric functioning of the MBTI instrument in South Africa. It contributes to the evolution of the instrument in line with the legislative requirements concerning the use of psychometric tests in South Africa.

Far-infrared to Millimeter Data of Protoplanetary Disks: Dust Growth in the Taurus, Ophiuchus, and Chamaeleon I Star-forming Regions

Energy Technology Data Exchange (ETDEWEB)

Ribas, Álvaro; Espaillat, Catherine C.; Macías, Enrique [Department of Astronomy, Boston University, Boston, MA 02215 (United States); Bouy, Hervé [Laboratoire d’Astrophysique de Bordeaux, Univ. Bordeaux, CNRS, F-33615 Pessac (France); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Calvet, Nuria [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Naylor, David A.; Van der Wiel, Matthijs H. D. [Institute for Space Imaging Science, Department of Physics and Astronomy, University of Lethbridge (Canada); Riviere-Marichalar, Pablo, E-mail: aribas@bu.edu [Instituto de Ciencia de Materiales de Madrid (CSIC). Calle Sor Juana Inés de la Cruz 3, E-28049 Cantoblanco, Madrid (Spain)

2017-11-01

Far-infrared and (sub)millimeter fluxes can be used to study dust in protoplanetary disks, the building blocks of planets. Here, we combine observations from the Herschel Space Observatory with ancillary data of 284 protoplanetary disks in the Taurus, Chamaeleon I, and Ophiuchus star-forming regions, covering from the optical to mm/cm wavelengths. We analyze their spectral indices as a function of wavelength and determine their (sub)millimeter slopes when possible. Most disks display observational evidence of grain growth, in agreement with previous studies. No correlation is found between other tracers of disk evolution and the millimeter spectral indices. A simple disk model is used to fit these sources, and we derive posterior distributions for the optical depth at 1.3 mm and 10 au, the disk temperature at this same radius, and the dust opacity spectral index β . We find the fluxes at 70 μ m to correlate strongly with disk temperatures at 10 au, as derived from these simple models. We find tentative evidence for spectral indices in Chamaeleon I being steeper than those of disks in Taurus/Ophiuchus, although more millimeter observations are needed to confirm this trend and identify its possible origin. Additionally, we determine the median spectral energy distribution of each region and find them to be similar across the entire wavelength range studied, possibly due to the large scatter in disk properties and morphologies.

A model of characteristic earthquakes and its implications for regional seismicity

DEFF Research Database (Denmark)

López-Ruiz, R.; Vázquez-Prada, M.; Pacheco, A.F.

2004-01-01

Regional seismicity (i.e. that averaged over large enough areas over long enough periods of time) has a size-frequency relationship, the Gutenberg-Richter law, which differs from that found for some seismic faults, the Characteristic Earthquake relationship. But all seismicity comes in the end from...... active faults, so the question arises of how one seismicity pattern could emerge from the other. The recently introduced Minimalist Model of Vázquez-Prada et al. of characteristic earthquakes provides a simple representation of the seismicity originating from a single fault. Here, we show...... that a Characteristic Earthquake relationship together with a fractal distribution of fault lengths can accurately describe the total seismicity produced in a region. The resulting earthquake catalogue accounts for the addition of both all the characteristic and all the non-characteristic events triggered in the faults...

Machine implications for detectors and physics

International Nuclear Information System (INIS)

Tauchi, Toshiaki

2001-01-01

Future linear colliders are very different at many aspects because of low repetition rate (5∼200 Hz) and high accelerating gradient (22∼150 MeV/m). For high luminosity, the beam sizes must be squeezed in extremely small region at interaction point (IP). We briefly describe new phenomena at the IP, i.e. beamstrahlung process, creations of e + e - pairs and minijets. We also report machine implications related to the energy spread, beamstrahlung, bunch-train structure, beam polarizations and backgrounds for detectors and physics

Central Asia: Regional Developments and Implications for U.S. Interests

Science.gov (United States)

2012-09-19

the Trilateral Cooperation at the Former Semipalatinsk Test Site , March 26, 2012. 13 U.S. Senate, Committee on Foreign Relations, Subcommittee on...former Semipalatinsk Test Site in East Kazakhstan Region.127 Kazakhstan and Uzbekistan hosted major chemical and biological warfare (CBW) facilities...Uzbekistan’s Nukus chemical weapons research facility. CTR aid also was used to eliminate active anthrax spores at a former CBW test site on an island in

Constructivism: Its Theoretical Underpinnings, Variations, and Implications for Classroom Instruction

Science.gov (United States)

Yilmaz, Kaya

2008-01-01

This article provides an overview of constructivism and its implications for classroom practices. To that end, it first describes the basic features of constructivism along with its major forms or variations. It then elucidates the constructivist view of knowledge, learning, teaching, and the relationship among these constructs. More specifically,…

The US ballistic missile defence policy in the Baltic and Nordic regions

Directory of Open Access Journals (Sweden)

Konyshev Valery

2016-03-01

Full Text Available This article examines the implications of the deployment of the US ballistic missile defense (BMD system in the Baltic and Nordic regions. These implications are to be considered to ensure Russia’s military security. Using the structural-functional method, the authors analyse the internal structure of the US BMD in Europe, stages of its implementation, and its influence on the military equilibrium in the region. Being similar to other regional missile defence systems of the Pentagon, BMD in Europe increases the offensive capabilities of the US armed forces and its allies and in doing so, it stops performing a purely defensive mission declared by Washington. It is stressed that the deployment of mobile sea- and land-based BMD elements in the Baltic Sea region and Nordic countries will inevitably destabilize the strategic situation and may lead to a new round of arms race in the region. The efficacy of BMD in Europe is evaluated from the perspective of military technology. The system’s potential threats to Russia’s military security and its armed forces are assessed. The article considers measures to enhance national security that could be taken by Russia provided the US plans to deploy BMD in Europe are fully implemented.

DECONVOLUTION OF IMAGES FROM BLAST 2005: INSIGHT INTO THE K3-50 AND IC 5146 STAR-FORMING REGIONS

International Nuclear Information System (INIS)

Roy, Arabindo; Netterfield, Calvin B.; Ade, Peter A. R.; Griffin, Matthew; Hargrave, Peter C.; Mauskopf, Philip; Bock, James J.; Brunt, Christopher M.; Chapin, Edward L.; Gibb, Andrew G.; Halpern, Mark; Marsden, Gaelen; Devlin, Mark J.; Dicker, Simon R.; Klein, Jeff; France, Kevin; Gundersen, Joshua O.; Hughes, David H.; Martin, Peter G.; Olmi, Luca

2011-01-01

We present an implementation of the iterative flux-conserving Lucy-Richardson (L-R) deconvolution method of image restoration for maps produced by the Balloon-borne Large Aperture Submillimeter Telescope (BLAST). Compared to the direct Fourier transform method of deconvolution, the L-R operation restores images with better-controlled background noise and increases source detectability. Intermediate iterated images are useful for studying extended diffuse structures, while the later iterations truly enhance point sources to near the designed diffraction limit of the telescope. The L-R method of deconvolution is efficient in resolving compact sources in crowded regions while simultaneously conserving their respective flux densities. We have analyzed its performance and convergence extensively through simulations and cross-correlations of the deconvolved images with available high-resolution maps. We present new science results from two BLAST surveys, in the Galactic regions K3-50 and IC 5146, further demonstrating the benefits of performing this deconvolution. We have resolved three clumps within a radius of 4.'5 inside the star-forming molecular cloud containing K3-50. Combining the well-resolved dust emission map with available multi-wavelength data, we have constrained the spectral energy distributions (SEDs) of five clumps to obtain masses (M), bolometric luminosities (L), and dust temperatures (T). The L-M diagram has been used as a diagnostic tool to estimate the evolutionary stages of the clumps. There are close relationships between dust continuum emission and both 21 cm radio continuum and 12 CO molecular line emission. The restored extended large-scale structures in the Northern Streamer of IC 5146 have a strong spatial correlation with both SCUBA and high-resolution extinction images. A dust temperature of 12 K has been obtained for the central filament. We report physical properties of ten compact sources, including six associated protostars, by fitting

VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. III. HP TAU/G2 AND THE THREE-DIMENSIONAL STRUCTURE OF TAURUS

International Nuclear Information System (INIS)

Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.

2009-01-01

Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

Solare Cell Roof Tile And Method Of Forming Same

Science.gov (United States)

Hanoka, Jack I.; Real, Markus

1999-11-16

A solar cell roof tile includes a front support layer, a transparent encapsulant layer, a plurality of interconnected solar cells and a backskin layer. The front support layer is formed of light transmitting material and has first and second surfaces. The transparent encapsulant layer is disposed adjacent the second surface of the front support layer. The interconnected solar cells has a first surface disposed adjacent the transparent encapsulant layer. The backskin layer has a first surface disposed adjacent a second surface of the interconnected solar cells, wherein a portion of the backskin layer wraps around and contacts the first surface of the front support layer to form the border region. A portion of the border region has an extended width. The solar cell roof tile may have stand-offs disposed on the extended width border region for providing vertical spacing with respect to an adjacent solar cell roof tile.

Mentalizing regions represent distributed, continuous, and abstract dimensions of others' beliefs.

Science.gov (United States)

Koster-Hale, Jorie; Richardson, Hilary; Velez, Natalia; Asaba, Mika; Young, Liane; Saxe, Rebecca

2017-11-01

The human capacity to reason about others' minds includes making causal inferences about intentions, beliefs, values, and goals. Previous fMRI research has suggested that a network of brain regions, including bilateral temporo-parietal junction (TPJ), superior temporal sulcus (STS), and medial prefrontal-cortex (MPFC), are reliably recruited for mental state reasoning. Here, in two fMRI experiments, we investigate the representational content of these regions. Building on existing computational and neural evidence, we hypothesized that social brain regions contain at least two functionally and spatially distinct components: one that represents information related to others' motivations and values, and another that represents information about others' beliefs and knowledge. Using multi-voxel pattern analysis, we find evidence that motivational versus epistemic features are independently represented by theory of mind (ToM) regions: RTPJ contains information about the justification of the belief, bilateral TPJ represents the modality of the source of knowledge, and VMPFC represents the valence of the resulting emotion. These representations are found only in regions implicated in social cognition and predict behavioral responses at the level of single items. We argue that cortical regions implicated in mental state inference contain complementary, but distinct, representations of epistemic and motivational features of others' beliefs, and that, mirroring the processes observed in sensory systems, social stimuli are represented in distinct and distributed formats across the human brain. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Development and Restructuring of Regional Production/Distribution Networks in East Asia

OpenAIRE

Mitsuyo ANDO

2013-01-01

This paper attempts to investigate the features of development and restructuring patterns of production/distribution networks in East Asia, mainly in machinery sectors, using international trade data at the most disaggregated level, to discuss their resilient nature, and to provide policy implications for the regional production networks and the economic development in the region. Although the negative impacts of the Global Financial Crisis (GFC) in 2008 were initially transmitted through the...

Ellipsoidal prediction regions for multivariate uncertainty characterization

DEFF Research Database (Denmark)

Golestaneh, Faranak; Pinson, Pierre; Azizipanah-Abarghooee, Rasoul

2018-01-01

, for classes of decision-making problems based on robust, interval chance-constrained optimization, necessary inputs take the form of multivariate prediction regions rather than scenarios. The current literature is at very primitive stage of characterizing multivariate prediction regions to be employed...... in these classes of optimization problems. To address this issue, we introduce a new class of multivariate forecasts which form as multivariate ellipsoids for non-Gaussian variables. We propose a data-driven systematic framework to readily generate and evaluate ellipsoidal prediction regions, with predefined...... probability guarantees and minimum conservativeness. A skill score is proposed for quantitative assessment of the quality of prediction ellipsoids. A set of experiments is used to illustrate the discrimination ability of the proposed scoring rule for potential misspecification of ellipsoidal prediction regions...

Implications of transmutation on the defect chemistry in crystalline waste forms

Energy Technology Data Exchange (ETDEWEB)

Uberuaga, B.P., E-mail: blas@lanl.go [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Jiang, C.; Stanek, C.R.; Sickafus, K.E. [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Marks, N.A. [Nanochemistry Research Institute, Curtin University of Technology, P.O. Box U1987, Perth, WA 6845 (Australia); Carter, D.J.; Rohl, A.L. [Nanochemistry Research Institute, Curtin University of Technology, P.O. Box U1987, Perth, WA 6845 (Australia); iVEC, Technology Park, Kensington, WA 6151 (Australia)

2010-10-01

Radioactive decay within the solid state creates chemical environments which are typically incommensurate with the initial host structure. Using a combined theoretical and computational approach, we discuss this 'transmutation problem' in the context of the short-lived fission products Cs-137 and Sr-90. We show how a Kroeger-Vink treatment is insufficient for understanding defects arising from transmutation, and present density functional theory data for chemical evolution within two prototypical hosts, CsCl and SrTiO{sub 3}. While the latter has a strong driving force for phase separation with increasing Zr content, the Cs(Ba)Cl system is surprisingly stable. The sharp difference between these two findings points to the need for better understanding of novel chemistry in nuclear waste forms.

Implications of NRL/ATM solar flare observations on flare theories

International Nuclear Information System (INIS)

Cheng, C.C.; Spicer, D.S.

1975-01-01

During the Skylab mission, many solar flares were observed with the NRL XUV spectroheliogram in the wavelength region from 150 to 650 A. Because of its high spatial resolution (approximately 2ins.) the three-dimensional structures of the flare emission regions characterized by temperatures from 10 4 K to 20 x 10 6 K can be resolved. Thus the spatial relationship between the relatively cool plasma and the hot plasma components of a flare, and the associated magnetic field structure can be inferred. The implications for various flare models are discussed. (Auth.)

Venus - Phoebe Region

Science.gov (United States)

1990-01-01

This Magellan radar image is of part of the Phoebe region of Venus. It is a mosaic of parts of revolutions 146 and 147 acquired in the first radar test on Aug. 16, 1990. The area in the image is located at 291 degrees east longitude, 19 degrees south latitude. The image shows an area 30 kilometers (19.6 miles) wide and 76 km (47 miles) long. On the basis of Pioneer Venus and Arecibo data, it is known that two major rift zones occur in southern Phoebe Regio and that they terminate at about 20 to 25 degrees south latitude, about 2,000 km (1,240 miles) apart. This image is of an area just north of the southern end of the western rift zone. The region is characterized by a complex geologic history involving both volcanism and faulting. Several of the geologic units show distinctive overlapping or cross cutting relationships that permit identification and separation of geologic events and construction of the geologic history of the region. The oldest rocks in this image form the complexly deformed and faulted, radar bright, hilly terrain in the northern half. Faults of a variety of orientations are observed. A narrow fault trough (about one-half to one km (three tenths to six tenths of a mile) wide is seen crossing the bright hills near the lower part in the middle of the image. This is one of the youngest faults in the faulted, hilly unit as it is seen to cut across many other structures. The fault trough in turn appears to be embayed and flooded by the darker plains that appear in the south half of the image. These plains are interpreted to be of volcanic origin. The dark plains may be formed of a complex of overlapping volcanic flows. For example, the somewhat darker region of plains in the lower left (southwest) corner of the image may be a different age series of plains forming volcanic lava flows. Finally, the narrow bright line crossing the image in its lower part is interpreted to be a fault which cross cuts both plains units and is thus the youngest event in

Patient Cross-Border Mobility: New Findings and Implications in Spanish Regions