WorldWideScience

Sample records for forming region implications

  1. Extended high circular polarization in the Orion massive star forming region: implications for the origin of homochirality in the solar system.

    Science.gov (United States)

    Fukue, Tsubasa; Tamura, Motohide; Kandori, Ryo; Kusakabe, Nobuhiko; Hough, James H; Bailey, Jeremy; Whittet, Douglas C B; Lucas, Philip W; Nakajima, Yasushi; Hashimoto, Jun

    2010-06-01

    We present a wide-field (approximately 6' x 6') and deep near-infrared (K(s) band: 2.14 mum) circular polarization image in the Orion nebula, where massive stars and many low-mass stars are forming. Our results reveal that a high circular polarization region is spatially extended (approximately 0.4 pc) around the massive star-forming region, the BN/KL nebula. However, other regions, including the linearly polarized Orion bar, show no significant circular polarization. Most of the low-mass young stars do not show detectable extended structure in either linear or circular polarization, in contrast to the BN/KL nebula. If our solar system formed in a massive star-forming region and was irradiated by net circularly polarized radiation, then enantiomeric excesses could have been induced, through asymmetric photochemistry, in the parent bodies of the meteorites and subsequently delivered to Earth. These could then have played a role in the development of biological homochirality on Earth.

  2. African Regional Integration: Implications for Food Security

    NARCIS (Netherlands)

    Dijk, van M.

    2011-01-01

    This report looks at the African regional trade, regional integration agreements (RIAs) and the implications for food security. An overview is presented on the present state of African regional integration and the determinants of regional trade in agriculture and food commodities. In particular the

  3. Optical polarimetry of star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Gledhill, T M

    1987-01-01

    The polarimetric investigation of nebulosity associated with loss-mass pre-main sequence (PMS) stellar objects is detailed. Three regions of on-going star formation are considered, specifically, the Haro 6-5 and the HL/XZ Tau systems - both associated with dark clouds in the Taurus complex - and the PV Cephei nebulosity near NGC7023. In each region the imaging observations suggest bipolarity in the optical structure of the nebulosity, and the polarimetric data are used to determine the locations of the illuminating sources. Evidence is found for the association of circumstellar discs of obscuration with the PMS objects Haro 6-5A (FS Tau), Haro 6-5B, HL Tau, and PV Cephei. In each case the polarimetric data suggest that the local magnetic field has played an important role in the evolution of the star and the circumstellar material. Examination of the source-region polarization maps suggests that at least one of the objects considered is surrounded by a dust grain-aligning magnetic field with a predominantly toroidal geometry in the plane of the circumstellar disc. Implications for current theories of outflow acceleration and cloud evolution are discussed.

  4. OH outflows in star-forming regions

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Ruiz, A.; Rodriguez, L.F.; Canto, J.; Universidad de Puer; Universidad de Puerto Rico, Rio Piedras; Universidad Nacional Autonoma de Mexico, Mexico City)

    1987-01-01

    The results from a survey for high-velocity OH in molecular outflows in star-forming regions are reported. High-velocity OH was detected in absorption in nine of these regions. When the telescope beam can resolve the outflows, they show similar anisotropic angular distribution as the redshifted and blueshifted CO. The OH transitions are markedly subthermal since for several sources it is found that the radiation that is being absorbed is a background continuum constituted by the cosmic component plus a small Galactic contribution. The absorbing OH appears to trace gas with higher velocities and lower densities than does the CO and, in some cases, provides information on the structure of the outflows at larger distances from the central source. At scales of 0.1 pc, the outflows are elongated in the direction of the steepest density gradient of the ambient cloud, suggesting that the large-scale collimation of the outflow is produced by the density structure of the ambient cloud. 29 references

  5. Problems of regional innovation strategy forming

    Directory of Open Access Journals (Sweden)

    I. M. Golova

    2010-09-01

    Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

  6. Extreme Variables in Star Forming Regions

    Science.gov (United States)

    Contreras Peña, Carlos Eduardo

    2015-01-01

    in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

  7. Forming controlled inset regions by ion implantation and laser bombardment

    International Nuclear Information System (INIS)

    Gibbons, J.F.

    1981-01-01

    A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

  8. Some Implications of Two Forms of the Generalized Uncertainty Principle

    Directory of Open Access Journals (Sweden)

    Mohammed M. Khalil

    2014-01-01

    Full Text Available Various theories of quantum gravity predict the existence of a minimum length scale, which leads to the modification of the standard uncertainty principle to the Generalized Uncertainty Principle (GUP. In this paper, we study two forms of the GUP and calculate their implications on the energy of the harmonic oscillator and the hydrogen atom more accurately than previous studies. In addition, we show how the GUP modifies the Lorentz force law and the time-energy uncertainty principle.

  9. Regional Competitiveness and Its Implications for Development

    OpenAIRE

    Daryono Soebagyo; Triyono Triyono; Yuli Tri Cahyono

    2015-01-01

    This study was conducted to identify regional competitiveness in some areas of Central Java. Regional competitiveness became one of the issues in regional development policy since the enactment of local autonomy.Measurement of regional competitiveness has been mostly done through ranking as a benchmark the competitiveness of the region. Mapping regional competitiveness in Indonesia has been made to all counties and cities, which shows the competitiveness ranking of each region. Competitivenes...

  10. Spatial and kinematic structure of Monoceros star-forming region

    Science.gov (United States)

    Costado, M. T.; Alfaro, E. J.

    2018-05-01

    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  11. Implications of tristability in pattern-forming ecosystems

    Science.gov (United States)

    Zelnik, Yuval R.; Gandhi, Punit; Knobloch, Edgar; Meron, Ehud

    2018-03-01

    Many ecosystems show both self-organized spatial patterns and multistability of possible states. The combination of these two phenomena in different forms has a significant impact on the behavior of ecosystems in changing environments. One notable case is connected to tristability of two distinct uniform states together with patterned states, which has recently been found in model studies of dryland ecosystems. Using a simple model, we determine the extent of tristability in parameter space, explore its effects on the system dynamics, and consider its implications for state transitions or regime shifts. We analyze the bifurcation structure of model solutions that describe uniform states, periodic patterns, and hybrid states between the former two. We map out the parameter space where these states exist, and note how the different states interact with each other. We further focus on two special implications with ecological significance, breakdown of the snaking range and complex fronts. We find that the organization of the hybrid states within a homoclinic snaking structure breaks down as it meets a Maxwell point where simple fronts are stationary. We also discover a new series of complex fronts between the uniform states, each with its own velocity. We conclude with a brief discussion of the significance of these findings for the dynamics of regime shifts and their potential control.

  12. Multimolecular studies of Galactic star-forming regions

    NARCIS (Netherlands)

    Baan, W. A.; Loenen, A. F.; Spaans, M.

    2014-01-01

    Molecular emission-line observations of isolated Galactic star-forming regions are used to model the physical properties of the molecular interstellar medium in these systems. Observed line ratios are compared with the results predicted by models that incorporate gas-phase chemistry and the heating

  13. The energy implications of Chinese regional disparities

    International Nuclear Information System (INIS)

    Huang Yuanxi; Todd, Daniel

    2010-01-01

    Chinese regional disparities are readily apparent, with well-being seen the highest at the coast and declining steadily inland. Their mitigation will clearly be hostage to improvement in economic development, since the unevenness of that development created them in the first place. Integral to development is structural change, and the key to effecting that change is improved energy efficiency. Indeed, this paper explores energy usage and regional development from 1952 to the present, establishing that they both conform to an inverted-U pattern. Eastern China, the leader in industrialization, has moved beyond the apogee of the curve, but Central and Western China have failed to follow suit, being held back by poor industrial structures and adverse patterns of energy consumption. Remedying this laggardly performance preoccupies China's Government, for rendering the country energy-efficient and containing regional disparities, both rest on pushing the Central and Western regions down the curve in the wake of the prosperous coast.

  14. Forming the development program of industrial cooperation in the region

    Directory of Open Access Journals (Sweden)

    Aleksandr Viktorovich Makarov

    2011-09-01

    Full Text Available The paper defines the role of industrial cooperation in the process of ensuring the competitiveness of the Russian economy. Economic nature of this form of long-term cooperation specified subjects and objects of cooperatives, the effects of its introduction is disclosed. Formed concept of the Programme of development of industrial cooperation in the region, taking into account the state gained in building industrial complex and the differentiation of state support measures at various stages of development cooperation. Forecast parameters on implementation of cooperation development in Sverdlovsk region for the period up to 2020 are formed. According to the reported characteristics and conducted author's calculations, based on realistic projections of engineering enterprises of Sverdlovsk region, a four-indicator sectorgram for the performance evaluation of the program for the development of industrial and technological cooperation in the field of engineering is presented. The described approach to the establishment of a development program for the industrial cooperation in the region can monitor the situation, timely adjust regional performance standards and policies in this field

  15. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

    2000-01-01

    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  16. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

    2000-01-01

    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  17. Areas and forms of regional cooperation in multi-structured (matreshka-style) regions (Tyumen region, Russia)

    OpenAIRE

    LARIONOV ANDREY V.

    2015-01-01

    The problem of the administrative, economic and social sustainability of a group consisting of neighboring regions with close ties has no clear solution yet. Should closely-tied regions in the long run form a centralized system of administrative bodies, compress their budgets into one, and construct unified social programs, or not? To answer this question, in the article we describe a case that represents the paramount form of cooperation amongst closely-tied regions. It is the case of the so...

  18. Surface compositions in the Aristarchus Region: Implications for regional stratigraphy

    Science.gov (United States)

    Hawke, H. R.; Lucey, P. G.; Mccord, T. B.; Pieters, C. M.; Head, J. W.

    1984-01-01

    Near infrared reflectance spectra for the Aristachus region, obtained using the 2.2m UH telescope at the Mauna Kea Observatory, were reduced and analyzed. The spectra obtained for the central peak, southern floor, southwestern wall, eastern wall, and northwestern wall of Aristachus crater exhibit shallow continuum slopes, relatively strong feldspar bands, pyroxene bands stronger than those typically seen in the spectra of fresh higland features, and pyroxene band centers near l micrometer suggesting the dominance of Ca rich clinopyroxene. The spectrum of the south rim of Aristachus is quite distinct from those of other crater units. The position of Aristrchus on the plateau/mare boundary raises questions concerning compositional variations in crater ejects deposits.

  19. Dynamical evolution of star-forming regions - II. Basic kinematics

    Science.gov (United States)

    Parker, Richard J.; Wright, Nicholas J.

    2016-04-01

    We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

  20. Academy panel proposes new form of regional institution

    International Nuclear Information System (INIS)

    Kloman, E.H.

    1977-01-01

    A panel of the National Academy of Public Administration has proposed development of a new form of interstate regional institution as an instrument for the siting, licensing, and regulating of nuclear facilities. Noting the danger that the nation's energy supplies may prove inadequate to meet basic needs of the economy despite increasing emphasis on greater use of coal and energy conservation, the panel pointed to the virtual stalemate in the national decision-making process for siting and licensing nuclear plants. A basic cause of the logjam is the growing conflict and overlap between federal and state agencies for authorizing nuclear development. The panel recommended setting up a new form of regional organization to fill an institutional void between federal and state levels of government. The proposed regional organizations would be established through federal legislation preempting to the Federal Government the regulation of siting, licensing, and construction of nuclear facilities. They would have jurisdiction over all matters in the operation of nuclear plants relating to public health and safety including those environmental factors and socio-economic factors covered in the preparation of environmental impact statements

  1. Stellar Feedback in Massive Star-Forming Regions

    Science.gov (United States)

    Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret

    2008-02-01

    Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

  2. VLBA Changes Picture of Famous Star-Forming Region

    Science.gov (United States)

    2007-10-01

    Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

  3. THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.

    2010-01-01

    We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

  4. H2O masers in star-forming regions

    International Nuclear Information System (INIS)

    Downes, D.

    1985-01-01

    Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)

  5. HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

    Science.gov (United States)

    2002-01-01

    NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

  6. Symbolic Form in the Pedagogical Implications of Sociolinguistics

    Science.gov (United States)

    Tolic, Mirela

    2011-01-01

    The author with the help of analysis of symbolic forms and sociolinguistics explains the transformation of "homo communicans in conscious homo symbolicum." He points out the importance of etymological analysis Cassierer's philosophy of symbolic forms and its effects in the modern understanding of sociolinguistics. It is necessary their…

  7. Implications of a classification of forms of cooperative purchasing

    NARCIS (Netherlands)

    Schotanus, Fredo; Telgen, Jan; Wynstra, J.Y.F.; Dittrich, K.; Jaspers, F.P.H.

    2005-01-01

    Our main objective is to classify different forms of cooperative purchasing, i.e. purchasing groups. Based on a literature review, empirical findings, and new institutional economics we employ a classification: the highway matrix. In this matrix we distinguish five forms of cooperative purchasing

  8. Forms of Decentralisation and Their Implications for Education.

    Science.gov (United States)

    Lauglo, Jon

    1995-01-01

    Describes alternatives to bureaucratic centralism in the administration of national education systems. Discusses forms of decentralization based on political rationales (liberalism, federalism, populist localism, participatory democracy) and those concerned with quality or efficiency (pedagogic professionalism, management by objectives,…

  9. Preferential Pathway for Glycine Formation in Star-Forming Regions

    Science.gov (United States)

    Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

    Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

  10. Millimetre wavelength methanol masers survey towards massive star forming regions

    Science.gov (United States)

    Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

    2007-03-01

    We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

  11. Radiation damage in natural materials: implications for radioactive waste forms

    International Nuclear Information System (INIS)

    Ewing, R.C.

    1981-01-01

    The long-term effect of radiation damage on waste forms, either crystalline or glass, is a factor in the evaluation of the integrity of waste disposal mediums. Natural analogs, such as metamict minerals, provide one approach for the evaluaton of radiation damage effects that might be observed in crystalline waste forms, such as supercalcine or synroc. Metamict minerals are a special class of amorphous materials which were initially crystalline. Although the mechanism for the loss of crystallinity in these minerals (mostly actinide-containing oxides and silicates) is not clearly understood, damage caused by alpha particles and recoil nuclei is critical to the metamictization process. The study of metamict minerals allows the evaluation of long-term radiation damage effects, particularly changes in physical and chemical properties such as microfracturing, hydrothermal alteration, and solubility. In addition, structures susceptible to metamictization share some common properties: (1) complex compositions; (2) some degree of covalent bonding, instead of being ionic close-packed MO/sub x/ structures; and (3) channels or interstitial voids which may accommodate displaced atoms or absorbed water. On the basis of these empirical criteria, minerals such as pollucite, sodalite, nepheline and leucite warrant careful scrutiny as potential waste form phases. Phases with the monazite or fluorite structures are excellent candidates

  12. Travel and urban form in the Greater Copenhagen region

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

  13. Gemini Spectroscopic Survey of Young Intermediate-Mass Star-Forming Regions

    Science.gov (United States)

    Lundquist, Michael; Kobulnicky, Henry

    2018-01-01

    The majority of stars form in embedded clusters. Current research into star formation has focused on either high-mass star-forming regions or low-mass star-forming regions. We present the results from a Gemini spectroscopic survey of young intermediate-mass star-forming regions. These are star forming regions selected to produce stars up to but not exceeding 8 solar masses. We obtained spectra of these regions with GNIRS on Gemini North and Flamingos-2 on Gemini South. We also combine this with near-infrared imaging from 2MASS, UKIDSS, and VVV to study the stellar content.

  14. The HNC/HCN ratio in star-forming regions

    International Nuclear Information System (INIS)

    Graninger, Dawn M.; Öberg, Karin I.; Herbst, Eric; Vasyunin, Anton I.

    2014-01-01

    HNC and HCN, typically used as dense gas tracers in molecular clouds, are a pair of isomers that have great potential as a temperature probe because of temperature dependent, isomer-specific formation and destruction pathways. Previous observations of the HNC/HCN abundance ratio show that the ratio decreases with increasing temperature, something that standard astrochemical models cannot reproduce. We have undertaken a detailed parameter study on which environmental characteristics and chemical reactions affect the HNC/HCN ratio and can thus contribute to the observed dependence. Using existing gas and gas-grain models updated with new reactions and reaction barriers, we find that in static models the H + HNC gas-phase reaction regulates the HNC/HCN ratio under all conditions, except for very early times. We quantitatively constrain the combinations of H abundance and H + HNC reaction barrier that can explain the observed HNC/HCN temperature dependence and discuss the implications in light of new quantum chemical calculations. In warm-up models, gas-grain chemistry contributes significantly to the predicted HNC/HCN ratio and understanding the dynamics of star formation is therefore key to model the HNC/HCN system.

  15. Atomic hydrogen in the Orion star-forming region

    International Nuclear Information System (INIS)

    Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.

    1989-01-01

    A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

  16. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N

    1973-01-01

    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  17. Molecular Diagnostics of the Interstellar Medium and Star Forming Regions

    Science.gov (United States)

    Hartquist, T. W.; Dalgarno, A.

    1996-03-01

    Selected examples of the use of observationally inferred molecular level populations and chemical compositions in the diagnosis of interstellar sources and processes important in them (and in other diffuse astrophysical sources) are given. The sources considered include the interclump medium of a giant molecular cloud, dark cores which are the progenitors of star formation, material responding to recent star formation and which may form further stars, and stellar ejecta (including those of supernovae) about to merge with the interstellar medium. The measurement of the microwave background, mixing of material between different nuclear burning zones in evolved stars and turbulent boundary layers (which are present in and influence the structures and evolution of all diffuse astrophysical sources) are treated.

  18. Current correlators and form factors in the resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

    2009-01-15

    Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

  19. Implications of expected climate change in the Mediterranean Region

    Energy Technology Data Exchange (ETDEWEB)

    Jeftic, L. [United Nations Environment Programme, Athens (Greece). Mediterranean Coordinating Unit

    1993-09-01

    A Task Team was established in 1987 with the objective of preparing a Mediterranean regional overview of the implications of climate change for coastal, terrestrial and aquatic ecosystems, as well as for socio-economic structures and activities. The paper presents a summary of the results of the first phase (1987-1989) of the work of the Task Team. Assuming a temperature rise of 1.5{degree}C by the year 2025, land degradation would increase, water resources decline, agricultural production would decline, and terrestrial and aquatic ecosystems could be damaged. Impacts of climatic change when combined with the greater impacts of non-climatic factors (e.g. population increases, development plans) would increase the probability of catastrophic events and hasten their occurrence. Case studies on six sites are to be finalised by the end of 1992. Despite the high quality of the Task Team`s study the impact of its work on national authorities and international bodies was below expectation. A specific regional scenario on climate change in the Mediterranean Basin due to global warming was developed following the Task Team`s recommendation. A summary of the approach and results is presented. 25 refs., 2 figs.

  20. The distribution of warm gas in the G327.3-0.6 star forming region

    NARCIS (Netherlands)

    Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

    Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

  1. Problems forming innovative-technological image of russian regions

    Directory of Open Access Journals (Sweden)

    Irina Markovna Golova

    2012-06-01

    Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

  2. How do salt withdrawal minibasins form? Insights from forward modelling, and implications for hydrocarbon migration

    Science.gov (United States)

    Peel, Frank J.

    2014-09-01

    Existing models for the initiation of salt withdrawal minibasins focus on the role of triggers that exist within the minibasin, either stratigraphic (e.g. differential deposition) or tectonic (extension, translation or contraction). Existing studies tend to focus on complex settings, such as continental margins, which contain many different potential triggering mechanisms. It can be difficult in these settings to identify which process is responsible for minibasin initiation, or the influence of individual factors on their subsequent development. Salt withdrawal minibasins also exist in simpler settings, without any obvious intrinsic trigger; the region of the North German Basin used by Trusheim (1960) in the classic definition of salt withdrawal geometries was of this nature. There is no overall basal or surface slope, no major lateral movement, and there is no depositional heterogeneity. Previously recognized trigger processes for minibasin initiation do not apply in this benign setting, suggesting that other, potentially more fundamental, influences may be at work. A simple forward-modelling approach shows how, in the absence of any other mechanism, a new minibasin can develop as the consequence of salt movement driven by its neighbour, and families of withdrawal minibasins can propagate across a region from a single seed point. This new mechanism may explain how some minibasins appear to initiate before the sediment density has exceeded that of the underlying salt. The forward modelling also indicates that some minibasins begin to invert to form turtle anticlines before the underlying salt has been evacuated, so that the timing of turtle formation may not be diagnostic of weld formation. This mechanism may also give rise to salt-cored turtles that have a lens of salt trapped beneath their cores. These new findings have implications for hydrocarbon migration and trapping.

  3. 77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

    Science.gov (United States)

    2012-11-14

    ... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

  4. 76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

    Science.gov (United States)

    2011-07-15

    ... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

  5. Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region

    Science.gov (United States)

    Bajaj, Ketan; Anbazhagan, P.

    2018-01-01

    Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

  6. Regional social legitimacy of entrepreneurship: Implications for entrepreneurial intention and start-up behaviour

    OpenAIRE

    Kibler, Ewald; Kautonen, Teemu; Fink, Matthias

    2014-01-01

    Regional social legitimacy of entrepreneurship: implications for entrepreneurial intention and start-up behaviour, Regional Studies. A new understanding of the role of regional culture in the emergence of business start-up behaviour is developed. The focal construct is regional social legitimacy: the perception of the desirability and appropriateness of entrepreneurship in a region. The econometric analysis utilizes a combination of bespoke longitudinal survey data from 65 regions in Austria ...

  7. The Location of ICT activities in EU regions. Implications for regional policies

    Directory of Open Access Journals (Sweden)

    Salvador Barrios

    2008-11-01

    Full Text Available The location of ICT producing industries does matter for global competitivenessand long-run growth potential. For instance, the differing contribution ofICT to economic growth between the US and the EU is often mentioned as one of themain cause explaining the diverging growth performance of these two areas since themid-1990s. In turn, since the mid-1990s, countries with especially dynamic economicgrowth have tended to be highly specialized in ICT-producing and ICT-using industries,see van Ark and Inkaar (2005. More generally, ICT producing sectors, tendto promote technological change and innovative capability which are seen to be at thecore of economic growth and competitiveness. When considering the EU economy,ICT industries appear to be concentrated in a limited number of regions, see Koski etal. (2002 for empirical evidence. Afirst objective of the present paper is to documentthe location of ICT producing industries in European regions in order to map existingEU clusters as well as to analyze recent changes in these industries using recent dataon employment and firm location, especially in relation to the EU enlargement thathas taken place in May 2004. The location of the ICT-producing sectors is not the endof the story however. A crucial aspect concerns the nature of activities that are beingundertaken in different regions. Importantly, ICT industries do have different characteristicsin terms of human capital, skill requirement, and knowledge content. In particular,because of the positive association between human capital, knowledge andlong-run growth, it is important to analyze to what extent EU regional ICT clustersdiffer in according to these characteristics. The second question addressed in the paperconcerns the nature of ICT activities undertaken in EU regions. Finally, the paperprovides econometric estimates of the location of firms in ICT industries across EUregions. The paper considers more specifically the case of multinationals

  8. 78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

    Science.gov (United States)

    2013-04-02

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

  9. 77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

    Science.gov (United States)

    2012-08-08

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  10. Regional medicine use in the Rhine basin and its implication on water quality

    Science.gov (United States)

    Hut, R. W.; Houtman, C. J.; van de Giesen, N. C.; de Jong, S. A. P.

    2012-04-01

    Do Germans use more painkillers than the French? Pharmaceuticals used in our Western society form an important group of contaminants found in the river Rhine. As this river is the drinking water source for millions of Europeans, methods to investigate relations between drug use and their penetration in the watercycle are of great importance. An analysis is presented relating medicine residue in the river Rhine to the number of people living in its watershed. An extensive measuring campaign was carried out, sampling river Rhine at 42 locations from its source to the start of its delta (Dutch-German border). The samples were analyzed for 40 common pharmaceuticals. Using discharge data, digital elevation models and demographic data from Eurostat, the relation between total load of drug residue and population was analyzed. Results show regional differences in drug use as well as implications for (down)stream water quality concerning contamination with pharmaceuticals.

  11. Policy implications with regard to controllable forms of natural background radiation

    International Nuclear Information System (INIS)

    Heijningen, R.J.J. van; Bartels, J.H.M.; Ackers, J.G.; Hogeweg, B.; Rijn, H.T.U. de; Walle, F.B. de

    1988-04-01

    The RENA (Regulable forms of Natural Background radiation) has started in order to broaden the technical-scientific insights in the domain of the natural background radiation and to continue the SAWORA-study. With regard to the policy implications it has appeared to be desirable to define more detailed the environment-protectional economical and governmental aspects and to consider their mutual relationships in order to prepare a coherent programme which is directed at policy actions to be undertaken as well as at the supporting study needed. (author). 34 refs.; 3 figs.; 11 tabs

  12. Spondylolysis and spondylolisthesis: prevalence of different forms of instability and clinical implications.

    Science.gov (United States)

    Niggemann, Pascal; Kuchta, Johannes; Beyer, Hans-Konrad; Grosskurth, D; Schulze, Thorsten; Delank, Karl-Stefan

    2011-10-15

    Imaging study with an evaluation of incidences and clinical correlation. To evaluate the incidence of 3 different types of instabilities in patients with spondylolysis or isthmic spondylolisthesis. Clinical findings are correlated with imaging findings, and the imaging findings are analyzed with regard to their clinical implications. Spondylolysis and isthmic spondylolisthesis are common disorders. An unstable slip is the most well-known form of instability, but other forms also exist. However, the incidence of these instabilities and their clinical implications are yet unclear. A total of 140 patients with 141 levels of spondylolysis identified by MRI (magnetic resonance imaging) were included in this study. Using positional MRI, the instability of the slip, an increased angular movement, and movement in the spondylolytic cleft were assessed. On the basis of clinical findings, the patients were classified as presenting with either radicular or nonradicular symptoms. The incidence of the instabilities was recorded and correlated with the incidence of radicular symptoms. Fifteen patients had an unstable slip (anterior instability); 35, an increased angular movement (angular instability); and 34 patients, a movement in the spondylolytic cleft (posterior instability). All forms of instability could be found together. No instability at all was found in 76 patients. Radicular symptoms were found significantly more often in patients with one or more of the described instabilities compared with patients without instability. All 3 described forms of instability are common in spondylolysis or isthmic spondylolisthesis and associated with radicular pain. This finding stresses the value of positional MRI in the evaluation of patients with spondylolysis and isthmic spondylolisthesis, especially if radicular symptoms are present.

  13. State fragility and its regional implications for peace and stability

    DEFF Research Database (Denmark)

    Mandrup, Thomas

    of the Cold war left a security void, and the fragility, and in some instances collapse, of the state structures resulted in new state formations and new conflicts, both intra- and inter-state in nature. However, conflicts and security challenges in East Africa are due to amongst other things porous borders......, fragile states and bad governance regional in nature, and cannot be solved by the individual states alone. Regional institutions have been in a weak position dealing with these challenges, and attempts have been to strengthen the capacity of these regional institutions. This paper investigates...

  14. The Roots and Implications of East Asian Regionalism

    National Research Council Canada - National Science Library

    Miller, John

    2004-01-01

    Regionalism in East Asia is driven by historical patterns of cooperation, the common challenge of the West, the century-long quest for an Asian identity, and growing economic interdependence and integration...

  15. Regional and international implications of the Iranian nuclear crisis

    International Nuclear Information System (INIS)

    Reveillard, Ch.

    2006-01-01

    Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

  16. Intercontinental Transport of Aerosols: Implication for Regional Air Quality

    Science.gov (United States)

    Chin, Mian; Diehl, Thomas; Ginoux, Paul

    2006-01-01

    Aerosol particles, also known as PM2.5 (particle diameter less than 2.5 microns) and PM10 (particle diameter less than 10 microns), is one of the key atmospheric components that determine ambient air quality. Current US air quality standards for PM10 (particles with diameter air pollution problems, aerosols can be transported on a hemispheric or global scale. In this study, we use the Goddard Chemistry Aerosol Radiation and Transport (GOCART) model to quantify contributions of long-range transport vs. local/regional pollution sources and from natural vs. anthropogenic sources to PM concentrations different regions. In particular, we estimate the hemispheric impact of anthropogenic sulfate aerosols and dust from major source areas on other regions in the world. The GOCART model results are compared with satellite remote sensing and ground-based network measurements of aerosol optical depth and concentrations.

  17. Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

    DEFF Research Database (Denmark)

    Grunfelder, Julien; Nielsen, Thomas Alexander Sick

    2012-01-01

    is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

  18. Acid Rain in Niger Delta Region: Implication on Water Resources ...

    African Journals Online (AJOL)

    This research focused on the effect of acid rain on the water quality of the Niger Delta region of Nigeria. Three hundred water samples were collected: 100 water samples from rain, 100 from open wells and 100 from rivers. The water samples were analysed using the paired t-test and multiple correlation analysis to ascertain ...

  19. Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions

    OpenAIRE

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

  20. Implications of climate change in the ROPME region: an overview

    Energy Technology Data Exchange (ETDEWEB)

    Hassan, M.E.; Gerges, M.A.

    1994-12-31

    The Regional Organization for the Protection of the Marine Environment (ROPME) region is divided into three areas: SA-I, the northern part of the Arabian Sea bounded by the south coast of the Sultanate of Oman, the mouth of the Gulf of Oman and the southern coast of the Islamic Republic of Iran; SA-II, the Gulf of Oman; and SA-III named as the Persian or Arabian Gulf. SA-I is the prime representative of the monsoonal weather system, which produces strong summertime upwelling resulting in rich fisheries that disappear in the winter. SA-II shows transition between the monsoonal system and the desert belt climate of SA-III. Its shallowness mean that the annual range of water temperature is the greatest for any water body freely connected to the world ocean. This restricts the ecosystems that can survive. It also enhances the effect of sea level rise on the tidal pattern. Because the SA-III region is the world`s major oil and gas extraction area, resulting land subsidence can produce an apparent sea level rise of the same order of magnitude as that postulated from expected climate change. Observed sea level rise could be twice the global rate. The shallowness of the area means that the change of tidal pattern resulting from the change of depth will be very dramatic. To help combat climate change it is recommended that: a high quality dense tide recording network be set up and connected to a land subsidence recording network; a regional central data collecting and data processing centre be identified in the region; an active participation in international relevant programs such as TOGA and GOOS by ROPME Member States be maintained; and environmental non-Governmental Organizationsshould be encouraged to publicise these issues.

  1. Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace

    OpenAIRE

    Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte

    2006-01-01

    This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

  2. Water Supply Deficiency and Implications for Rural Development in the Niger-Delta Region of Nigeria

    Science.gov (United States)

    Nkwocha, E. E.

    2009-01-01

    There is a growing concern about the marginalization of the Niger Delta region of Nigeria in terms of infrastructural and social services provision. This study examined the water supply deficiency and its general implications for rural development within the region. Data and other study characteristics were extracted from 501 subjects drawn from…

  3. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    Science.gov (United States)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  4. Water in low-mass star-forming regions with Herschel

    DEFF Research Database (Denmark)

    Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.

    2010-01-01

    "Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...

  5. YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: gsaral@cfa.harvard.edu [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2015-11-01

    We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

  6. Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.

    1989-01-01

    The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

  7. Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

    DEFF Research Database (Denmark)

    O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine

    2013-01-01

    of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...

  8. WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  9. United States - Japanese nuclear relations: implications for the pacific region

    International Nuclear Information System (INIS)

    Suttmeier, R.P.

    1980-01-01

    The initiation of a new approach to non-proliferation policy by the United States in 1977 was the most upsetting development in the history of US-Japanese nuclear relations. The policy has seemingly altered Japanese views of its own nuclear future very little, yet it has altered the tone of the nuclear relationship with the United States. Recent Japanese nuclear power developments, both technical and administrative, are outlined and the prospects for the future of the United States-Japanese nuclear relationship and for Pacific regional cooperation assessed. Issues of importance in the relationship include reprocessing - enrichment, plutonium management, spent fuel and waste management and uranium supplies

  10. Energy requirements of consumption: Urban form, climatic and socio-economic factors, rebounds and their policy implications

    International Nuclear Information System (INIS)

    Wiedenhofer, Dominik; Lenzen, Manfred; Steinberger, Julia K.

    2013-01-01

    Household consumption requires energy to be used at all stages of the economic process, thereby directly and indirectly leading to environmental impacts across the entire production chain. The levels, structure and determinants of energy requirements of household consumption therefore constitute an important avenue of research. Incorporating the full upstream requirements into the analysis helps to avoid simplistic conclusions which would actually only imply shifts between consumption categories without taking the economy wide effects into account. This paper presents the investigation of the direct and indirect primary energy requirements of Australian households, contrasting urban, suburban and rural consumption patterns as well as inter- and intra-regional levels of inequality in energy requirements. Furthermore the spatial and socio-economic drivers of energy consumption for different categories of energy requirements are identified and quantified. Conclusions regarding the relationships between energy requirements, household characteristics, urban form and urbanization processes are drawn and the respective policy implications are explored. - Highlights: • We statistically analyze the energy requirements of consumption in Australia. • Contrasting urban/suburban/rural consumption patterns and spatial inequality. • Energy requirements are influenced by urban form, income and demographics. • Urban households require less direct energy, but their total consumption is higher. • Significant rebound effects can be expected when direct energy use is decreased

  11. Orion star-forming region - far-infrared and radio molecular observations

    International Nuclear Information System (INIS)

    Thronson, H.A. Jr.; Harper, D.A.; Bally, J.; Dragovan, M.; Mozurkewich, D.; Yerkes Observatory, Williams Bay, WI; ATandT Bell Labs., Holmdel, NJ; Chicago Uni., IL; E. O. Hulburt Center for Space Research, Washington, DC)

    1986-01-01

    New J = 1-0 CO and far-infrared maps of the Orion star-forming region are presented and discussed. The total infrared luminosity of the Orion star-forming ridge is 250,000 solar luminosities. The material that is emitting strongly at 60 microns is traced and found to be highly centrally concentrated. However, the majority of the extended emission from this region comes from dust that is ultimately heated by the visible Trapezium cluster stars. The luminosity of IRc 2, the most luminous member of the infrared cluster, is estimated to be 40,000-50,000 solar luminosities. A schematic drawing of the Ori MC 1 region is presented. 30 references

  12. Seismotectonic Implications Of Clustered Regional GPS Velocities In The San Francisco Bay Region, California

    Science.gov (United States)

    Graymer, R. W.; Simpson, R.

    2012-12-01

    We have used a hierarchical agglomerative clustering algorithm with Euclidean distance and centroid linkage, applied to continuous GPS observations for the Bay region available from the U.S. Geological Survey website. This analysis reveals 4 robust, spatially coherent clusters that coincide with 4 first-order structural blocks separated by 3 major fault systems: San Andreas (SA), Southern/Central Calaveras-Hayward-Rodgers Creek-Maacama (HAY), and Northern Calaveras-Concord-Green Valley-Berryessa-Bartlett Springs (NCAL). Because observations seaward of the San Gregorio (SG) fault are few in number, the cluster to the west of SA may actually contain 2 major structural blocks not adequately resolved: the Pacific plate to the west of the northern SA and a Peninsula block between the Peninsula SA and the SG fault. The average inter-block velocities are 11, 10, and 9 mm/yr across SA, HAY, and NCAL respectively. There appears to be a significant component of fault-normal compression across NCAL, whereas SA and HAY faults appear to be, on regional average, purely strike-slip. The velocities for the Sierra Nevada - Great Valley (SNGV) block to the west of NCAL are impressive in their similarity. The cluster of these velocities in a velocity plot forms a tighter grouping compared with the groupings for the other cluster blocks, suggesting a more rigid behavior for this block than the others. We note that for 4 clusters, none of the 3 cluster boundaries illuminate geologic structures other than north-northwest trending dominantly strike-slip faults, so plate motion is not accommodated by large-scale fault-parallel compression or extension in the region or by significant plastic deformation , at least over the time span of the GPS observations. Complexities of interseismic deformation of the upper crust do not allow simple application of inter-block velocities as long-term slip rates on bounding faults. However, 2D dislocation models using inter-block velocities and typical

  13. China–Myanmar Energy Cooperation and Its Regional Implications

    Directory of Open Access Journals (Sweden)

    Hong Zhao

    2011-01-01

    Full Text Available Although Myanmar is among the world’s oldest oil-producing countries, Chinese oil and gas companies did not start their oil and gas exploration projects there until recently. The most recent and significant China–Myanmar energy cooperation project is the oil and gas pipelines which got started in 2009. This paper will discuss the reasons and driving forces for this pipeline project and its broader objectives, and testify whether pipelines can deepen regional economic integration and strengthen bilateral relations. This paper concludes by saying that China might use the China–Myanmar pipeline construction as an opportunity to play a more constructive role in Myanmar’s domestic reforms, thus improving its image in Southeast Asia and strengthening its relations with Myanmar.

  14. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

    Science.gov (United States)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

    2018-01-01

    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  15. International labour migration in the Asian-Pacific region: patterns, policies and economic implications.

    Science.gov (United States)

    Athukorala, P

    1993-11-01

    "This paper reviews the literature on international labour migration from and within the Asian-Pacific region. It deals with patterns and characteristics of migration flows, government policies towards labour migration, and economic implications of labour migration for both labour-exporting and importing countries in the region. The indications are that, despite gradual slowing down of labour flows to the western industrial countries and the Middle East, labour migration will continue to be a major economic influence on surplus-labour countries in the region. As an integral part of the growth dynamism in the region, labour migration has now begun to take on a regional dimension, with immense implications for the process of industrial restructuring in high growth economies and the changing pattern of economic interdependence among countries." excerpt

  16. Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: natsuko.izumi@nao.ac.jp [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)

    2017-10-01

    The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

  17. [Regional health and autonomy conferences (CRSAs): the implications for medical democracy at a regional level].

    Science.gov (United States)

    Devictor, Bernadette

    2010-01-01

    The HPST law seeks to reorganize the governance of healthcare at a regional level and to maintain the existence of regional health conferences, now known as regional health and autonomy conferences (CRSAs). The purpose of this article is to examine the new duties attributed to the CRSAs and to consider the various issues raised by their practice. The article also provides an analysis of the preconditions required for the successful implementation of medical democracy at a regional level, ie.: the involvement of the CRSAs in the assessment of regional healthcare policies, the mobilization of funds, the composition of the CRSAs (including the full range of healthcare areas), the importance of providing adequate support for territorial conferences, and the elaboration of a communicative space for fostering exchanges between CRSAs.

  18. Balancing regional industrial development: analysis on regional disparity of China's industrial emissions and policy implications

    DEFF Research Database (Denmark)

    Liang, Hanwei; Dong, Liang; Luo, Xiao

    2016-01-01

    Efficient industrial emissions mitigation strategy is critical for China's national action on climate change and sustainable development, considering its rapid industrialization. Regional disparity brings difficulties and uncertainties to policy implementation in China. Therefore, an investigation...... development, and highlight not only disparity, but also inequity exists. It is concluded that, there is a larger unequal distribution of GDP per unit of air pollutants and CO2 emission between eastern and western regions, reveals that less developed western and central regions suffer from the emission leakage...... on the regional features of industrial emissions is critical to better decision makings. While to date, related studies have been rather few. This paper applies a spatial analysis on regional features of China's industrial emissions (SO2, NOx and PM2.5 and CO2 emission) in 31 provinces. Spatial autocorrelation...

  19. New far infrared images of bright, nearby, star-forming regions

    Science.gov (United States)

    Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

    1995-01-01

    Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

  20. Observations of star-forming regions with the Midcourse Space Experiment

    NARCIS (Netherlands)

    Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

    We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large

  1. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    Energy Technology Data Exchange (ETDEWEB)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: edf@astro.psu.edu [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)

    2016-12-20

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  2. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    International Nuclear Information System (INIS)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.

    2016-01-01

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  3. Functional relationship between skull form and feeding mechanics in Sphenodon, and implications for diapsid skull development.

    Directory of Open Access Journals (Sweden)

    Neil Curtis

    Full Text Available The vertebrate skull evolved to protect the brain and sense organs, but with the appearance of jaws and associated forces there was a remarkable structural diversification. This suggests that the evolution of skull form may be linked to these forces, but an important area of debate is whether bone in the skull is minimised with respect to these forces, or whether skulls are mechanically "over-designed" and constrained by phylogeny and development. Mechanical analysis of diapsid reptile skulls could shed light on this longstanding debate. Compared to those of mammals, the skulls of many extant and extinct diapsids comprise an open framework of fenestrae (window-like openings separated by bony struts (e.g., lizards, tuatara, dinosaurs and crocodiles, a cranial form thought to be strongly linked to feeding forces. We investigated this link by utilising the powerful engineering approach of multibody dynamics analysis to predict the physiological forces acting on the skull of the diapsid reptile Sphenodon. We then ran a series of structural finite element analyses to assess the correlation between bone strain and skull form. With comprehensive loading we found that the distribution of peak von Mises strains was particularly uniform throughout the skull, although specific regions were dominated by tensile strains while others were dominated by compressive strains. Our analyses suggest that the frame-like skulls of diapsid reptiles are probably optimally formed (mechanically ideal: sufficient strength with the minimal amount of bone with respect to functional forces; they are efficient in terms of having minimal bone volume, minimal weight, and also minimal energy demands in maintenance.

  4. Functional Relationship between Skull Form and Feeding Mechanics in Sphenodon, and Implications for Diapsid Skull Development

    Science.gov (United States)

    Curtis, Neil; Jones, Marc E. H.; Shi, Junfen; O'Higgins, Paul; Evans, Susan E.; Fagan, Michael J.

    2011-01-01

    The vertebrate skull evolved to protect the brain and sense organs, but with the appearance of jaws and associated forces there was a remarkable structural diversification. This suggests that the evolution of skull form may be linked to these forces, but an important area of debate is whether bone in the skull is minimised with respect to these forces, or whether skulls are mechanically “over-designed” and constrained by phylogeny and development. Mechanical analysis of diapsid reptile skulls could shed light on this longstanding debate. Compared to those of mammals, the skulls of many extant and extinct diapsids comprise an open framework of fenestrae (window-like openings) separated by bony struts (e.g., lizards, tuatara, dinosaurs and crocodiles), a cranial form thought to be strongly linked to feeding forces. We investigated this link by utilising the powerful engineering approach of multibody dynamics analysis to predict the physiological forces acting on the skull of the diapsid reptile Sphenodon. We then ran a series of structural finite element analyses to assess the correlation between bone strain and skull form. With comprehensive loading we found that the distribution of peak von Mises strains was particularly uniform throughout the skull, although specific regions were dominated by tensile strains while others were dominated by compressive strains. Our analyses suggest that the frame-like skulls of diapsid reptiles are probably optimally formed (mechanically ideal: sufficient strength with the minimal amount of bone) with respect to functional forces; they are efficient in terms of having minimal bone volume, minimal weight, and also minimal energy demands in maintenance. PMID:22216358

  5. Molecular line study of massive star-forming regions from the Red MSX Source survey

    Science.gov (United States)

    Yu, Naiping; Wang, Jun-Jie

    2014-05-01

    In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

  6. Implications of greenhouse gas emission mitigation scenarios for the main Asian regions

    NARCIS (Netherlands)

    van Ruijven, B.J.|info:eu-repo/dai/nl/304834521; van Vuuren, D.P.|info:eu-repo/dai/nl/11522016X; van Vliet, J.; Mendoza Beltran, A.; Deetman, S.; den Elzen, M.G.J.

    2012-01-01

    In order to limit global mean temperature increase, long-term greenhouse gas emissions need to be reduced. This paper discusses the implications of greenhouse gas emission reductions for major Asian regions (China, India, Indonesia, South-East Asia, Japan and Korea) based on results from the IMAGE

  7. Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

    Science.gov (United States)

    Povich, Matthew Samuel; Binder, Breanna Arlene

    2018-01-01

    We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

  8. The Structure of the Nearby Giant Star-Forming Region 30 Doradus

    Science.gov (United States)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

    2007-08-01

    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  9. Transport of Aerosols: Regional and Global Implications for Climate, Weather, and Air Quality

    Science.gov (United States)

    Chin, Mian; Diehl, Thomas; Yu, Hongbin; Bian, Huisheng; Remer, Lorraine; Kahn, Ralph

    2008-01-01

    Long-range transport of atmospheric aerosols can have a significant impact on global climate, regional weather, and local air quality. In this study, we use a global model GOCART together with satellite data and ground-based measurements to assess the emission and transport of pollution, dust, biomass burning, and volcanic aerosols and their implications. In particular, we will show the impact of emissions and long-range transport of aerosols from major pollution and dust source regions to (1) the surface air quality, (2) the atmospheric heating rates, and (3) surface radiation change near the source and downwind regions.

  10. Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

    DEFF Research Database (Denmark)

    Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne

    2015-01-01

    displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

  11. Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

    International Nuclear Information System (INIS)

    Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.

    2009-05-01

    In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

  12. Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

    CERN Document Server

    Hartquist, T W

    2006-01-01

    John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

  13. Complex organic molecules toward low-mass and high-mass star forming regions

    Science.gov (United States)

    Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.

    2016-12-01

    One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

  14. Distributional pattern of benthic foraminiferal morpho-groups in the shelf region off Mangalore: Environmental implications

    Digital Repository Service at National Institute of Oceanography (India)

    Khare, N.; Sinha, R.; Rai, A.K.; Nigam, R.

    , the population was further placed into two broad morpho-groups namely, angular-asymmetrical and rounded-symmetrical. The surficial distribution of these groups revealed that angular-asymmetrical forms are abundant in relatively deeper region whereas rounded...

  15. Water in Star-forming Regions with Herschel (WISH): recent results and trends

    Science.gov (United States)

    van Dishoeck, E. F.

    2012-03-01

    Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at http://www.strw.leidenuniv.nl/WISH, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

  16. The Location of ICT activities in EU regions. Implications for regional policies

    Directory of Open Access Journals (Sweden)

    Salvador Barrios

    2008-01-01

    estimaciones econométricas sobre la localización de las empresas en la industria de las TIC a través de las regiones de la UE. El trabajo considera específicamente el caso de la localización de las multinacionales. Los resultados de los determinantes de la localización de las empresas parece diferir ampliamente dependiendo del sector de las TIC considerado, como del tipo de empresa considerada. A partir de estos resultados se deriva un número de implicaciones de política.

  17. Young Stellar Objects in the Massive Star-forming Regions W51 and W43

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2017-04-20

    We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

  18. Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

    Science.gov (United States)

    Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

    2017-09-01

    Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

  19. AN INFRARED/X-RAY SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.

    2009-01-01

    We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.

  20. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    Energy Technology Data Exchange (ETDEWEB)

    Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: asarma@depaul.edu [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)

    2013-04-10

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  1. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    International Nuclear Information System (INIS)

    Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.

    2013-01-01

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  2. Shear viscosity of glass-forming melts in the liquid-glass transition region

    International Nuclear Information System (INIS)

    Sanditov, D. S.

    2010-01-01

    A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

  3. Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

    International Nuclear Information System (INIS)

    Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.

    1990-01-01

    The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

  4. Functional modulation of cardiac form through regionally confined cell shape changes.

    Directory of Open Access Journals (Sweden)

    Heidi J Auman

    2007-03-01

    Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

  5. Biophysical characterization of the olfactomedin domain of myocilin, an extracellular matrix protein implicated in inherited forms of glaucoma.

    Directory of Open Access Journals (Sweden)

    Susan D Orwig

    Full Text Available Myocilin is an eye protein found in the trabecular extracellular matrix (TEM, within the anatomic region that controls fluid flow. Variants of myocilin, localized to its olfactomedin (OLF domain, have been linked to inherited forms of glaucoma, a disease associated with elevated intraocular pressure. OLF domains have also been implicated in psychiatric diseases and cancers by their involvement in signaling, neuronal growth, and development. However, molecular characterization of OLFs has been hampered by challenges in recombinant expression, a hurdle we have recently overcome for the myocilin OLF domain (myoc-OLF. Here, we report the first detailed solution biophysical characterization of myoc-OLF to gain insight into its structure and function. Myoc-OLF is stable in the presence of glycosaminoglycans, as well as in a wide pH range in buffers with functional groups reminiscent of such glycosaminoglycans. Circular dichroism (CD reveals significant β-sheet and β-turn secondary structure. Unexpectedly, the CD signature is reminiscent of α-chymotrypsin as well as another ocular protein family, the βγ-crystallins. At neutral pH, intrinsic tryptophan fluorescence and CD melts indicate a highly cooperative transition with a melting temperature of ∼55 °C. Limited proteolysis combined with mass spectrometry reveals that the compact core structural domain of OLF consists of approximately residues 238-461, which retains the single disulfide bond and is as stable as the full myoc-OLF construct. The data presented here inform new testable hypotheses for interactions with specific TEM components, and will assist in design of therapeutic agents for myocilin glaucoma.

  6. TROUBLING TIMES-THE GFC AND ITS IMPLICATIONS FOR REGIONAL PERFORMANCE. PART TWO: AUSTRALIA

    OpenAIRE

    Robert J. Stimson

    2013-01-01

    The Global Financial Crisis (GFC) was a profound exogenous shock which has had profound impacts the performance of national economies and the regions within them. The differential outcomes are vast. In many parts of the world there is evidence of what is being referred to as the ‘two-speed’ economy - or even a ‘multi-speed’ - economy. This has implications for regional economic development theory in which, over the last two to three decades, there has been an increasing emphasis on endogenous...

  7. DISK EVOLUTION IN THE THREE NEARBY STAR-FORMING REGIONS OF TAURUS, CHAMAELEON, AND OPHIUCHUS

    International Nuclear Information System (INIS)

    Furlan, E.; Watson, Dan M.; McClure, M. K.

    2009-01-01

    We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

  8. Long-term Variability of H2CO Masers in Star-forming Regions

    Science.gov (United States)

    Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

    2017-10-01

    We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

  9. New forms of contractual relationships and the implications for occupational safety and health

    NARCIS (Netherlands)

    Goudswaard, A.; André, J.C.; Ekstedt, E.

    2002-01-01

    Changes in the world of work can give rise to new risk areas or change the way that occupational safety and health needs to be managed. This has implications for workplaces themselves and also for the occupational safety and health system. For this reason the 'changing world of work' has been a

  10. TRIGONOMETRIC PARALLAXES OF MASSIVE STAR-FORMING REGIONS. II. CEP A AND NGC 7538

    International Nuclear Information System (INIS)

    Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.

    2009-01-01

    We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

  11. Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

    Science.gov (United States)

    Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

    2011-01-01

    The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

  12. Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

    Science.gov (United States)

    Giroux, Mark; Smith, B.; Struck, C.

    2011-05-01

    Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

  13. CHEMICAL EVOLUTION IN HIGH-MASS STAR-FORMING REGIONS: RESULTS FROM THE MALT90 SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail: shoq@bu.edu, E-mail: jackson@bu.edu, E-mail: patricio@bu.edu, E-mail: claysmit@bu.edu, E-mail: jonathan.b.foster@yale.edu, E-mail: aguzmanf@cfa.harvard.edu, E-mail: scott@bu.edu, E-mail: rathborne@csiro.au, E-mail: tv3h@virginia.edu, E-mail: aiv3f@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2013-11-10

    The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.

  14. HIGH-VELOCITY LINE FORMING REGIONS IN THE TYPE Ia SUPERNOVA 2009ig

    International Nuclear Information System (INIS)

    Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng

    2013-01-01

    We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

  15. CHEMICAL SEGREGATION TOWARD MASSIVE HOT CORES: THE AFGL2591 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail: ijimenez-serra@cfa.harvard.edu, E-mail: qzhang@cfa.harvard.edu, E-mail: sv@star.ucl.ac.uk, E-mail: jmartin@cab.inta-csic.es, E-mail: wdewit@eso.org [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)

    2012-07-01

    We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

  16. A Study of THT Cold Cores Population in the Star-Forming Region in Serpens

    Science.gov (United States)

    Fiorellino, Eleonora

    2017-11-01

    The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

  17. Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

    International Nuclear Information System (INIS)

    Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.

    1990-01-01

    New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs

  18. B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

    2013-01-01

    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  19. The trans-regional implications of the China-Pakistan Economic Corridor and the One Belt and One Road Initiative

    Directory of Open Access Journals (Sweden)

    Khan Samra Sarfraz

    2018-04-01

    Full Text Available The paper is an analytical examination of the geo-political implications of the China-Pakistan Economic Corridor and the One Belt and One Road Initiative. The paper examines the probable implications of the two mega projects for the regional, as well as, trans-regional actors. The paper debates on the likelihood for the creation of a new kind of relationship among China, Pakistan and Russia. It is also discussed how the prospects of reduced western influence in the region, in the backdrop of CPEC and the B&R Initiative, may result in the escalation of Russian and Chinese dominance on regional and trans-regional affairs.

  20. The clean development mechanism (CDM) an international perspective and implications for the LAC region

    International Nuclear Information System (INIS)

    2004-08-01

    This paper addresses activity a) an analysis of international CDM experiences and its potential contribution to the LAC region. The paper begins with a section describing the basic principles of the CDM and retrieves the lessons learned from the first two years of the CDM operation. This is followed by a more detailed review in section 2 of the on-going baseline and monitoring methodology approval process. In section 3, the development value of the CDM is explored. Section 4 describes the current CDM markets, while section 5 reviews the response of host countries to the CDM outside the LAC region. Section 6 describes the various capacity building programs established by Annex 1 countries to support the CDM. In each of the first 6 sections, implications for the LAC region are identified. Section 7 brings these conclusions together into a concise summary. (The author)

  1. Escape of ionizing radiation from star-forming regions in Young galaxies

    DEFF Research Database (Denmark)

    Razoumov, A; Sommer-Larsen, Jesper

    2006-01-01

    Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

  2. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    International Nuclear Information System (INIS)

    Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.

    2014-01-01

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  3. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: todorovk@phys.ethz.ch [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2014-06-10

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  4. Water in massive star-forming regions with Herschel Space Observatory

    Science.gov (United States)

    Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.

    2011-05-01

    High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

  5. The Depletion of Water During Dispersal of Planet-forming Disk Regions

    Science.gov (United States)

    Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.

    2017-01-01

    We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

  6. Mesozoic and Cenozoic structural geology of the CP Hills, Nevada Test Site, Nye County, Nevada; and regional implications

    Energy Technology Data Exchange (ETDEWEB)

    Caskey, S. John [Univ. of Nevada, Reno, NV (United States)

    1991-08-01

    Detailed mapping and structural analysis of upper Proterozoic and Paleozoic rocks in the CP Hills of the Nevada Test Site, together with analysis of published maps and cross sections and a reconnaissance of regional structural relations indicate that the CP thrust of Barnes and Poole (1968) actually comprises two separate, oppositely verging Mesozoic thrust systems: (1) the west-vergent CP thrust which is well exposed in the CP Hills and at Mine Mountain, and (2) the east-vergent Belted Range thrust located northwest of Yucca Flat. West-vergence of the CP thrust is indicated by large scale west-vergent recumbent folds in both its hangingwall and footwall and by the fact that the CP thrust ramps up section through hangingwall strata toward the northwest. Regional structural relations indicate that the CP thrust forms part of a narrow sigmoidal belt of west-vergent folding and thrusting traceable for over 180 km along strike. The Belted Range thrust represents earlier Mesozoic deformation that was probably related to the Last Chance thrust system in southeastern California, as suggested by earlier workers. A pre-Tertiary reconstruction of the Cordilleran fold and thrust belt in the region between the NTS and the Las Vegas Range bears a close resemblance to other regions of the Cordillera and has important implications for the development of hinterland-vergent deformation as well as for the probable magnitude of Tertiary extension north of Las Vegas Valley. Subsequent to Mesozoic deformation, the CP Hills were disrupted by at least two episodes of Tertiary extensional deformation: (1) an earlier episode represented by pre-middle Miocene low-angle normal faults, and (2) a later, post-11 Ma episode of high-angle normal faulting. Both episodes of extension were related to regional deformation, the latter of which has resulted in the present basin and range topography of the NTS region.

  7. Mesozoic and Cenozoic structural geology of the CP Hills, Nevada Test Site, Nye County, Nevada; and regional implications

    International Nuclear Information System (INIS)

    Caskey, S.J.

    1991-08-01

    Detailed mapping and structural analysis of upper Proterozoic and Paleozoic rocks in the CP Hills of the Nevada Test Site, together with analysis of published maps and cross sections and a reconnaissance of regional structural relations indicate that the CP thrust of Barnes and Poole (1968) actually comprises two separate, oppositely verging Mesozoic thrust systems: (1) the west-vergent CP thrust which is well exposed in the CP Hills and at Mine Mountain, and (2) the east-vergent Belted Range thrust located northwest of Yucca Flat. West-vergence of the CP thrust is indicated by large scale west-vergent recumbent folds in both its hangingwall and footwall and by the fact that the CP thrust ramps up section through hangingwall strata toward the northwest. Regional structural relations indicate that the CP thrust forms part of a narrow sigmoidal belt of west-vergent folding and thrusting traceable for over 180 km along strike. The Belted Range thrust represents earlier Mesozoic deformation that was probably related to the Last Chance thrust system in southeastern California, as suggested by earlier workers. A pre-Tertiary reconstruction of the Cordilleran fold and thrust belt in the region between the NTS and the Las Vegas Range bears a close resemblance to other regions of the Cordillera and has important implications for the development of hinterland-vergent deformation as well as for the probable magnitude of Tertiary extension north of Las Vegas Valley. Subsequent to Mesozoic deformation, the CP Hills were disrupted by at least two episodes of Tertiary extensional deformation: (1) an earlier episode represented by pre-middle Miocene low-angle normal faults, and (2) a later, post-11 Ma episode of high-angle normal faulting. Both episodes of extension were related to regional deformation, the latter of which has resulted in the present basin and range topography of the NTS region

  8. Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

    International Nuclear Information System (INIS)

    Gyulbudaghian, A.L.; May, J.

    2008-01-01

    An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

  9. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    Energy Technology Data Exchange (ETDEWEB)

    Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)

    2014-03-10

    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  10. The financial and accounting implications of the privatization of the regional electricity companies in the UK

    International Nuclear Information System (INIS)

    Thomson, L.

    1993-01-01

    This paper reviews some of the financial and accounting implications of the privatization of the electricity distribution and supply sector in England and Wales, specifically the transformation of the Electricity Area Boards into the 12 Regional Electricity Companies (RECs). It considers the factors influencing the setting of post-privatization price control factors; the capital restructuring of the RECs; the valuation placed by the Secretary of State for Energy on each company at flotation, and market reaction to this as shown in subsequent changes in share price; and changes in the information provided in the RECs' accounts over the privatization period. (Author)

  11. Citizenship and the Forms of Political Support: A Case-Study of the Croatian Adriatic Regions

    Directory of Open Access Journals (Sweden)

    Zoran Radman

    2010-01-01

    Full Text Available The article is dealing with the issue of political support in Croatia, related to the issues of trust and legitimacy towards authority and institutions, as the elements of the political system. Previous research conducted in Croatia evidences a relatively low level of trust in the political authorities and institutions. In this paper we go by Easton’s dimensions of political support: authority support, support to institutions, support to democracy and support to community. All these forms of political support represent the subjective orientations of citizens towards the units of the political system. On the other hand, orientation and relationship of citizens towards the units of the political systems poses the question of citizenship. The paper is exploring the relation of subjective orientations of citizens towards the political systems units and different dimensions of political support in the specific context of Adriatic regions of Croatia, on the basis of the established models of citizenship developed by various authors. The results point out that the level of support rises as we go from the lower, specific types of support (support to authorities and support to institutions towards higher, diffuse modes of support (support to community. In the background of the political support, especially “support to democracy”, there are performances of the political system. In other words, political support is more instrumentally then intrinsically founded.

  12. Trigonometric parallaxes of star forming regions in the Scutum spiral arm

    International Nuclear Information System (INIS)

    Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.

    2014-01-01

    We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

  13. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

  14. YOUNG STELLAR OBJECTS IN THE LARGE MAGELLANIC CLOUD STAR-FORMING REGION N206

    International Nuclear Information System (INIS)

    Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.

    2010-01-01

    We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.

  15. EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: johan.lindberg@nasa.gov [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)

    2017-01-20

    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

  16. YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

    Energy Technology Data Exchange (ETDEWEB)

    Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

    2014-12-01

    The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

  17. Form CMS-2728 data versus erythropoietin claims data: implications for quality of care studies.

    Science.gov (United States)

    Beaubrun, Anne C; Kanda, Eiichiro; Bond, T Christopher; McClellan, William M

    2013-01-01

    Medical Evidence Report Form CMS-2728 data is frequently used to study US dialysis patients, but the validity of these data have been called into question. We compared predialysis erythropoietin use as recorded on Form CMS-2728 with claims data as part of an assessment of quality of care among hemodialysis patients. Medicare claims were linked to Form CMS-2728 data for 18,870 patients. Dialysis patients, 67 years old or older, who started dialysis from 1 June 2005 to 31 May 2007 were eligible. Logistic and multivariate regressions were used to compare the use of either Form CMS-2728 or the corresponding claims data to predict mortality and the probability of meeting target hemoglobin levels. The sensitivity, specificity, and kappa coefficient for the predialysis erythropoietin indicator were 58.0%, 78.4%, and 0.36, respectively. Patients with a predialysis erythropoietin claim were less likely to die compared with patients without a claim (odds ratio = 0.80 and 95% confidence interval = 0.74-0.87), but there was no relationship observed between predialysis care and death using only Form CMS-2728 predictors. At the facility level, a predialysis erythropoietin claim was associated with a 0.085 increase in the rate of meeting target hemoglobin levels compared with patients without a claim (p = 0.041), but no statistically significant relationship was observed when using the Form CMS-2728 indicators. The agreement between Form CMS-2728 and claims data is poor and discordant results are observed when comparing the use of these data sources to predict health outcomes. Facilities with higher agreement between the two data sources may provide greater quality of care.

  18. Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

    Science.gov (United States)

    Kulesa, Craig A.

    Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

  19. Anthropogenic activities and coastal environmental quality: a regional quantitative analysis in southeast China with management implications.

    Science.gov (United States)

    Chen, Kai; Liu, Yan; Huang, Dongren; Ke, Hongwei; Chen, Huorong; Zhang, Songbin; Yang, Shengyun; Cai, Minggang

    2018-02-01

    Regional analysis of environmental issues has always been a hot topic in the field of sustainable development. Because the different levels of economic growth, urbanization, resource endowments, etc. in different regions generate apparently different ecological responses, a better description and comparison across different regions will provide more valuable implications for ecological improvement and policymaking. In this study, seven typical bays in southeast China that are a rapid developing area were selected to quantitatively analyze the relationship between socioeconomic development and coastal environmental quality. Based on the water quality data from 2007 to 2015, the multivariate statistical method was applied to analyze the potential environmental risks and to classify the seven bays based on their environmental quality status. The possible variation trends of environmental indices were predicted based on the cross-regional panel data by Environmental Kuznets Curve. The results showed that there were significant regional differences among the seven bays, especially Quanzhou, Xiamen, and Luoyuan Bays, suffered from severer artificial disturbances than other bays, despite their different development patterns. Socioeconomic development level was significantly associated with some water quality indices (pH, DIN, PO 4 -P); the association was roughly positive: the areas with higher GDP per capita have some worse water quality indices. In addition, the decreasing trend of pH values and the increasing trend of nutrient concentration in the seven bays will continue in the foreseeable future. In consideration of the variation trends, the limiting nutrient strategy should be implemented to mitigate the deterioration of the coastal environments.

  20. MANAGEMENT OF THE INTERNAL LABOR MARKET (BASING ON CASES OF THE SVERDLOVSK REGION CITY-FORMING ENTERPRISES

    Directory of Open Access Journals (Sweden)

    S.V. Orekhova

    2008-12-01

    Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.

  1. New Technology and Changing Organisational Forms: Implications for Managerial Control and Skills.

    Science.gov (United States)

    Grimshaw, Damian; Cooke, Fang-Lee; Grugulis, Irena; Vincent, Steve

    2002-01-01

    Case studies of client relations in a call center and an information technology company's partnership with a government agency examined how new technology affects organizational structures and managerial control. Evidence suggests that new structures arise in tandem with technological changes and technology's use as a form of control differs in…

  2. Meaning-focused vs Form-focused L2 Instruction: Implications for ...

    African Journals Online (AJOL)

    KATEVG

    focus-on-meaning approach to English language instruction) compare with ... L2 use. Proponents of this view are concerned with the question of how this conversion ... processing, it may draw learners' attention to "notice" the form of the target ...

  3. On the Shortcomings of Our Organisational Forms: With Implications for Educational Change and School Improvement

    Science.gov (United States)

    Waite, Duncan

    2010-01-01

    This article informs school improvement and educational change from a radically different perspective. Building upon work done recently in neural psychology, primatology and ethology, the article examines four common and general types of organisational form: the cell, the silo, the pyramidal, and the network types of organisational structures.…

  4. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus

    2015-01-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively

  5. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: daemgen@astro.utoronto.ca [Department of Astronomy, Stockholm University, Stockholm (Sweden)

    2015-02-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

  6. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: carrasco@mpifr-bonn.mpg.de [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)

    2012-02-10

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  7. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.

    2012-01-01

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  8. Stratigraphy of the Descartes region /Apollo 16/ - Implications for the origin of samples

    Science.gov (United States)

    Head, J. W.

    1974-01-01

    Analysis of terrain in the Apollo 16 Descartes landing region shows a series of features that form a stratigraphic sequence which dominates the history and petrogenesis at the site. An ancient 150-km diam crater centered on the Apollo 16 site is one of the earliest recognizable major structures. Nectaris ejecta was concentrated in a regional low at the base of the back slope of the Nectaris basin to form the Descartes Mountains. Subsequently, a 60-km diam crater formed in the Descartes Mountains centered about 25 km to the west of the site. This crater dominates the geology and petrogenetic history of the site. Stone and Smoky Mountains represent the degraded terraced crater walls, and the dark matrix breccias and metaclastic rocks derived from North and South Ray craters represent floor fallback breccias from this cratering event. The interpretation is developed that the stratigraphy of the Cayley and Descartes, and thus the historical record of the Apollo 16 region, documents the complex interaction of deposits and morphology of local and regional impact cratering events. Large local 60- to 150-km diam craters have had a dramatic and previously unrecognized effect on the history and petrology of the Apollo 16 site.

  9. Water deuteration in star-forming regions: Contribution of Herschel/HIFI spectroscopic data

    International Nuclear Information System (INIS)

    Coutens, Audrey

    2012-01-01

    cloud. The HDO/H_2O ratios as well as the D_2O/HDO ratios determined in IRAS 16293-2422 enable to constrain the conditions of water formation in this kind of objects and in particular suggest that water would be formed before the gravitational collapse of the cloud. This study was then extended to other solar-type protostars NGC1333 IRAS4A and NGC1333 IRAS4B, for which I estimated the abundances of deuterated water and noticed that an extended absorbing layer also surrounds these sources. The high HDO/H_2O ratios determined in IRAS 16293-2422 suggest that mechanisms are required between the Class 0 stage and the comets formation to decrease these isotopic ratios. It is however necessary to study a larger sample of protostars to know if this trend is observed in most of the sources. The HDO abundances obtained in NGC1333 IRAS4A and NGC1333 IRAS4B will consequently be useful to estimate their HDO/H_2O ratios. Finally, I also studied deuterated water in protostellar objects more massive and more luminous than solar-type protostars and show here the case of the ultra-compact HII region G34.26+0.15. (author) [fr

  10. Glucokinase MODY and implications for treatment goals of common forms of diabetes.

    Science.gov (United States)

    Ajjan, Ramzi A; Owen, Katharine R

    2014-12-01

    Treatment goals in diabetes concentrate on reducing the risk of vascular complications, largely through setting targets for glycated haemoglobin (HbA1c). These targets are based on epidemiological studies of complication development, but so far have not adequately addressed the adverse effects associated with lowering HbA1c towards the normal range. Glucokinase (GCK) mutations cause a monogenic form of hyperglycaemia (GCK-MODY) characterised by fasting hyperglycaemia with low postprandial glucose excursions and a marginally elevated HbA1c. Minimal levels of vascular complications (comparable with nondiabetic individuals) are observed in GCK-MODY, leading to the hypothesis that GCK-MODY may represent a useful paradigm for assessing treatment goals in all forms of diabetes. In this review, we discuss the evidence behind this concept, suggest ways of translating this hypothesis into clinical practice and address some of the caveats of such an approach.

  11. Implications for Gender Relations of Summons-Response and Address Forms in Dagbanli

    Directory of Open Access Journals (Sweden)

    Salifu, Nantogma Alhassan

    2014-02-01

    Full Text Available This paper examines the structure and function of the summons and response in Dagbanli as well as address forms in the husband-wife relation. The Dagbanli language imposes different response forms on males and females and asymmetrical address terms between husband and wife. Drawing from my knowledge of the language as a native speaker and from observed practices of other speakers as well as from insights of key informants, I apply theories of sociolinguistics and pragmatics to analyze these simple conversational acts and I argue that they do not only reflect the sex differences of speakers but embed a larger gender ideology of unequal social relations between males and females in the Dagomba society.

  12. The aquatic toxicity and chemical forms of coke plant effluent cyanide -- Implications for discharge limits

    International Nuclear Information System (INIS)

    Garibay, R.; Rupnow, M.; Godwin-Saad, E.; Hall, S.

    1995-01-01

    Cyanide is present in treated cokemaking process waters at concentrations as high as 8.0 mg/L. In assessing options for managing the discharge of a treated effluent, the development and implementation of discharge limits for cyanide became a critical issue. A study was initiated to evaluate possible alternatives to cyanide permit limits at the US Steel Gary Works Facility. The objectives of the study were to: (1) evaluation the forms of cyanide present in coke plant effluent; (2) determine whether these forms of cyanide are toxic to selected aquatic organisms; (3) compare the aquatic toxicity of various chemical forms of cyanide; (4) identify if the receiving water modifies cyanide bioavailability; and (5) confirm, with respect to water quality-based effluent limits, an appropriate analytical method for monitoring cyanide in a coke plant effluent. The results of aquatic toxicity tests and corresponding analytical data are presented. Toxicity tests were conducted with various pure chemical forms of cyanide as well as whole coke plant effluent (generated from a pilot-scale treatment system). Test species included the fathead minnow (Pimephales promelas), rainbow trout (Oncorhynchus mykiss), Ceriodaphnia dubia (C. dubia) and Daphnia magna (D. magna). Analytical measurements for cyanide included total, weak acid dissociable, diffusible cyanide and selected metal species of cyanide. The findings presented by the paper are relevant with respect to the application of cyanide water quality criteria for a coke plant effluent discharge, the translation of these water quality-based effluent limits to permit limits, and methods for compliance monitoring for cyanide

  13. Tool Wear and Life Span Variations in Cold Forming Operations and Their Implications in Microforming

    Directory of Open Access Journals (Sweden)

    Anders E. W. Jarfors

    2016-12-01

    Full Text Available The current paper aims to review tooling life span, failure modes and models in cold microforming processes. As there is nearly no information available on tool-life for microforming the starting point was conventional cold forming. In cold forming common failures are (1 over stressing of the tool; (2 abrasive wear; (3 galling or adhesive wear, and (4 fatigue failure. The large variation in tool life observed in production and how to predict this was reviewed as this is important to the viability of microforming based on that the tooling cost takes a higher portion of the part cost. Anisotropic properties of the tool materials affect tool life span and depend on both the as-received and in-service conditions. It was concluded that preconditioning of the tool surface, and coating are important to control wear and fatigue. Properly managed, the detrimental effects from surface particles can be reduced. Under high stress low-cycle fatigue conditions, fatigue failure form internal microstructures and inclusions are common. To improve abrasive wear resistance larger carbides are commonly the solution which will have a negative impact on tooling life as these tend to be the root cause of fatigue failures. This has significant impact on cold microforming.

  14. Amorphous salts formed from rapid dehydration of multicomponent chloride and ferric sulfate brines: Implications for Mars

    Science.gov (United States)

    Sklute, Elizabeth C.; Rogers, A. Deanne; Gregerson, Jason C.; Jensen, Heidi B.; Reeder, Richard J.; Dyar, M. Darby

    2018-01-01

    Salts with high hydration states have the potential to maintain high levels of relative humidity (RH) in the near subsurface of Mars, even at moderate temperatures. These conditions could promote deliquescence of lower hydrates of ferric sulfate, chlorides, and other salts. Previous work on deliquesced ferric sulfates has shown that when these materials undergo rapid dehydration, such as that which would occur upon exposure to present day Martian surface conditions, an amorphous phase forms. However, the fate of deliquesced halides or mixed ferric sulfate-bearing brines are presently unknown. Here we present results of rapid dehydration experiments on Ca–, Na–, Mg– and Fe–chloride brines and multi-component (Fe2 (SO4)3 ± Ca, Na, Mg, Fe, Cl, HCO3) brines at ∼21°C, and characterize the dehydration products using visible/near-infrared (VNIR) reflectance spectroscopy, mid-infrared attenuated total reflectance spectroscopy, and X-ray diffraction (XRD) analysis. We find that rapid dehydration of many multicomponent brines can form amorphous solids or solids with an amorphous component, and that the presence of other elements affects the persistence of the amorphous phase under RH fluctuations. Of the pure chloride brines, only Fe–chloride formed an amorphous solid. XRD patterns of the multicomponent amorphous salts show changes in position, shape, and magnitude of the characteristic diffuse scattering observed in all amorphous materials that could be used to help constrain the composition of the amorphous salt. Amorphous salts deliquesce at lower RH values compared to their crystalline counterparts, opening up the possibility of their role in potential deliquescence-related geologic phenomena such as recurring slope lineae (RSLs) or soil induration. This work suggests that a wide range of aqueous mixed salt solutions can lead to the formation of amorphous salts and are possible for Mars; detailed studies of the formation mechanisms, stability and

  15. Amorphous salts formed from rapid dehydration of multicomponent chloride and ferric sulfate brines: Implications for Mars

    Science.gov (United States)

    Sklute, Elizabeth C.; Rogers, A. Deanne; Gregerson, Jason C.; Jensen, Heidi B.; Reeder, Richard J.; Dyar, M. Darby

    2018-03-01

    Salts with high hydration states have the potential to maintain high levels of relative humidity (RH) in the near subsurface of Mars, even at moderate temperatures. These conditions could promote deliquescence of lower hydrates of ferric sulfate, chlorides, and other salts. Previous work on deliquesced ferric sulfates has shown that when these materials undergo rapid dehydration, such as that which would occur upon exposure to present day Martian surface conditions, an amorphous phase forms. However, the fate of deliquesced halides or mixed ferric sulfate-bearing brines are presently unknown. Here we present results of rapid dehydration experiments on Ca-, Na-, Mg- and Fe-chloride brines and multicomponent (Fe2(SO4)3 ± Ca, Na, Mg, Fe, Cl, HCO3) brines at ∼21 °C, and characterize the dehydration products using visible/near-infrared (VNIR) reflectance spectroscopy, mid-infrared attenuated total reflectance spectroscopy, and X-ray diffraction (XRD) analysis. We find that rapid dehydration of many multicomponent brines can form amorphous solids or solids with an amorphous component, and that the presence of other elements affects the persistence of the amorphous phase under RH fluctuations. Of the pure chloride brines, only Fe-chloride formed an amorphous solid. XRD patterns of the multicomponent amorphous salts show changes in position, shape, and magnitude of the characteristic diffuse scattering observed in all amorphous materials that could be used to help constrain the composition of the amorphous salt. Amorphous salts deliquesce at lower RH values compared to their crystalline counterparts, opening up the possibility of their role in potential deliquescence-related geologic phenomena such as recurring slope lineae (RSLs) or soil induration. This work suggests that a wide range of aqueous mixed salt solutions can lead to the formation of amorphous salts and are possible for Mars; detailed studies of the formation mechanisms, stability and transformation

  16. Amorphous salts formed from rapid dehydration of multicomponent chloride and ferric sulfate brines: Implications for Mars.

    Science.gov (United States)

    Sklute, Elizabeth C; Rogers, A Deanne; Gregerson, Jason C; Jensen, Heidi B; Reeder, Richard J; Dyar, M Darby

    2018-03-01

    Salts with high hydration states have the potential to maintain high levels of relative humidity (RH) in the near subsurface of Mars, even at moderate temperatures. These conditions could promote deliquescence of lower hydrates of ferric sulfate, chlorides, and other salts. Previous work on deliquesced ferric sulfates has shown that when these materials undergo rapid dehydration, such as that which would occur upon exposure to present day Martian surface conditions, an amorphous phase forms. However, the fate of deliquesced halides or mixed ferric sulfate-bearing brines are presently unknown. Here we present results of rapid dehydration experiments on Ca-, Na-, Mg- and Fe-chloride brines and multi-component (Fe 2 (SO 4 ) 3 ± Ca, Na, Mg, Fe, Cl, HCO 3 ) brines at ∼21°C, and characterize the dehydration products using visible/near-infrared (VNIR) reflectance spectroscopy, mid-infrared attenuated total reflectance spectroscopy, and X-ray diffraction (XRD) analysis. We find that rapid dehydration of many multicomponent brines can form amorphous solids or solids with an amorphous component, and that the presence of other elements affects the persistence of the amorphous phase under RH fluctuations. Of the pure chloride brines, only Fe-chloride formed an amorphous solid. XRD patterns of the multicomponent amorphous salts show changes in position, shape, and magnitude of the characteristic diffuse scattering observed in all amorphous materials that could be used to help constrain the composition of the amorphous salt. Amorphous salts deliquesce at lower RH values compared to their crystalline counterparts, opening up the possibility of their role in potential deliquescence-related geologic phenomena such as recurring slope lineae (RSLs) or soil induration. This work suggests that a wide range of aqueous mixed salt solutions can lead to the formation of amorphous salts and are possible for Mars; detailed studies of the formation mechanisms, stability and transformation

  17. Cross-cultural Differences in Preferred Forms of Address: Implications for Work with African American Adults

    Directory of Open Access Journals (Sweden)

    Wanda Lott Collins

    2004-12-01

    Full Text Available Using an individual’s last name indicates respect and contributes to positive interaction with African American clients and adults of African descent. This paper discusses the importance of using social titles as a proper form of address during, and sometimes after, the initial professional relationship. Two case vignettes will highlight potential difficulties that non-African American practitioners may experience when using first names with African Americans within the professional realm. The vignettes include a scenario for a supervisor and a client.

  18. Implications of transmutation on the defect chemistry in crystalline waste forms

    Energy Technology Data Exchange (ETDEWEB)

    Uberuaga, B.P., E-mail: blas@lanl.go [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Jiang, C.; Stanek, C.R.; Sickafus, K.E. [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Marks, N.A. [Nanochemistry Research Institute, Curtin University of Technology, P.O. Box U1987, Perth, WA 6845 (Australia); Carter, D.J.; Rohl, A.L. [Nanochemistry Research Institute, Curtin University of Technology, P.O. Box U1987, Perth, WA 6845 (Australia); iVEC, Technology Park, Kensington, WA 6151 (Australia)

    2010-10-01

    Radioactive decay within the solid state creates chemical environments which are typically incommensurate with the initial host structure. Using a combined theoretical and computational approach, we discuss this 'transmutation problem' in the context of the short-lived fission products Cs-137 and Sr-90. We show how a Kroeger-Vink treatment is insufficient for understanding defects arising from transmutation, and present density functional theory data for chemical evolution within two prototypical hosts, CsCl and SrTiO{sub 3}. While the latter has a strong driving force for phase separation with increasing Zr content, the Cs(Ba)Cl system is surprisingly stable. The sharp difference between these two findings points to the need for better understanding of novel chemistry in nuclear waste forms.

  19. Implications of greenhouse gas emission mitigation scenarios for the main Asian regions

    International Nuclear Information System (INIS)

    Ruijven, Bas J. van; Vuuren, Detlef P. van; Vliet, Jasper van; Mendoza Beltran, Angelica; Deetman, Sebastiaan; Elzen, Michel G.J. den

    2012-01-01

    In order to limit global mean temperature increase, long-term greenhouse gas emissions need to be reduced. This paper discusses the implications of greenhouse gas emission reductions for major Asian regions (China, India, Indonesia, South-East Asia, Japan and Korea) based on results from the IMAGE modelling framework. Energy use in regions and economic sectors is affected differently by ambitious climate policies. We find that the potential for emission reduction varies widely between regions. With respect to technology choices in the power sector, we find major application of CO 2 storage in Indonesia and India, whereas Korea and India apply more solar and wind. Projections for Japan include a (debatable) large share of nuclear power. China and, India, and South-East Asia, show a diverse technology choice in the power sector. For the industry sector, we find that the recent rapid growth in China limits the potential for emission reduction in the next decades, assuming that recently built coal-based industry facilities are in use for the next decades. For the residential sector, the model results show that fewer households switch from traditional fuels to modern fuels in GHG mitigation scenarios. With respect to co-benefits, we find lower imports of fossil energy in mitigation scenarios and a clear reduction of air pollutant emissions. - Highlights: ► The potential for emission reduction varies widely between regions. ► Some regions have attractive CO 2 storage capacity; others have low-cost solar/wind potential. ► The recent rapid growth of Chinese industry may limit emission reduction potential for decades. ► Fewer households switch from traditional fuels to modern fuels in mitigation scenarios. ► Mitigation scenarios show less fossil energy import and reduction of air pollutant emission.

  20. Regional to global changes in drought and implications for future changes under global warming

    Science.gov (United States)

    Sheffield, J.; Wood, E. F.; Kam, J.

    2012-12-01

    Drought can have large impacts on multiple sectors, including agriculture, water resources, ecosystems, transport, industry and tourism. In extreme cases, regional drought can lead to food insecurity and famine, and in intensive agricultural regions, extend to global economic impacts in a connected world. Recent droughts globally have been severe and costly but whether they are becoming more frequent and severe, and the attribution of this, is a key question. Observational evidence at large scales, such as satellite remote sensing are often subject to short-term records and inhomogeneities, and ground based data are sparse in many regions. Reliance on model output is also subject to error and simplifications in the model physics that can, for example, amplify the impact of global warming on drought. This presentation will show the observational and model evidence for changes in drought, with a focus on the interplay between precipitation and atmospheric evaporative demand and its impact on the terrestrial water cycle and drought. We discuss the fidelity of climate models to reproduce our best estimates of drought variability and its drivers historically, and the implications of this on uncertainties in future projections of drought from CMIP5 models, and how this has changed since CMIP3.

  1. Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

    International Nuclear Information System (INIS)

    Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan

    2009-01-01

    According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

  2. A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Sung-Ju; Choi, Minho; Kang, Miju [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 34055 (Korea, Republic of); Kerton, C. R., E-mail: sjkang@kasi.re.kr, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

    2017-08-10

    We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential products of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.

  3. Radio continuum interferometry of dark clouds: A search for newly formed HII regions

    International Nuclear Information System (INIS)

    Gilmore, W.S.

    1978-01-01

    A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

  4. Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

    International Nuclear Information System (INIS)

    De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

    2000-01-01

    Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

  5. The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

    Directory of Open Access Journals (Sweden)

    Tatyana O. Boiko

    2012-03-01

    Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

  6. Form and function of the human and chimpanzee forefoot: implications for early hominin bipedalism

    Science.gov (United States)

    Fernández, Peter J.; Holowka, Nicholas B.; Demes, Brigitte; Jungers, William L.

    2016-01-01

    During bipedal walking, modern humans dorsiflex their forefoot at the metatarsophalangeal joints (MTPJs) prior to push off, which tightens the plantar soft tissues to convert the foot into a stiff propulsive lever. Particular features of metatarsal head morphology such as “dorsal doming” are thought to facilitate this stiffening mechanism. In contrast, chimpanzees are believed to possess MTPJ morphology that precludes high dorsiflexion excursions during terrestrial locomotion. The morphological affinity of the metatarsal heads has been used to reconstruct locomotor behavior in fossil hominins, but few studies have provided detailed empirical data to validate the assumed link between morphology and function at the MTPJs. Using three-dimensional kinematic and morphometric analyses, we show that humans push off with greater peak dorsiflexion angles at all MTPJs than do chimpanzees during bipedal and quadrupedal walking, with the greatest disparity occurring at MTPJ 1. Among MTPJs 2–5, both species exhibit decreasing peak angles from medial to lateral. This kinematic pattern is mirrored in the morphometric analyses of metatarsal head shape. Analyses of Australopithecus afarensis metatarsals reveal morphology intermediate between humans and chimpanzees, suggesting that this species used different bipedal push-off kinematics than modern humans, perhaps resulting in a less efficient form of bipedalism. PMID:27464580

  7. Implications of defect clusters formed in cascades on free defect generation and microstructural development

    International Nuclear Information System (INIS)

    Wiedersich, H.

    1992-12-01

    A large fraction of the defects produced by irradiation with energetic neutrons or heavy ions originates in cascades. Not only increased recombination of vacancy and interstitial defects but also significant clustering of like defects occur. Both processes reduce the number of point defects available for long range migration. Consequences of defect clustering in cascades will be discussed in a semi-quantitative form with the aid of calculations using a very simplified model: Quasi-steady-state distributions of immobile vacancy and/or interstitial clusters develop which, in turn, can become significant sinks for mobile defects, and, therefore reduce their lifetime. Although cluster sinks will cause segregation and, potentially, precipitation of second phases due to local changes of composition, the finite lifetime of clusters will not lead to lasting, local compositional changes. A transition from highly dense interstitial and vacancy cluster distributions to the void swelling regime occurs when the thermal evaporation of vacancies from small vacancy clusters becomes significant at higher temperatures. Unequal clustering of vacancies and interstitials leads to an imbalance of their fluxes of in the matrix and, hence, to unequal contributions to atom transport by interstitials and by vacancies even in the quasi-steady state approximation

  8. The bright lights of city regions - Assumptions, realities and implications of changing population dynamics: Zooming in on the Gauteng city region

    CSIR Research Space (South Africa)

    Pieterse, A

    2014-09-01

    Full Text Available It is well known that the city regions attract migrants from across the country because of their roles as economic engines and job baskets in South Africa. To address urbanisation implications it is imperative to better understand some...

  9. The bright lights of city regions: Assumptions, realities and implications of changing population dynamics: Zooming in on the Gauteng city region

    CSIR Research Space (South Africa)

    Pieterse, A

    2014-10-01

    Full Text Available It is well known that the city regions attract migrants from across the country because of their roles as economic engines and job baskets in South Africa. To address urbanisation implications it is imperative to better understand some...

  10. Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

    Directory of Open Access Journals (Sweden)

    Marzena RUSZKOWSKA

    2017-11-01

    Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

  11. Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

    Directory of Open Access Journals (Sweden)

    Elena Leonidovna Andreeva

    2017-09-01

    Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

  12. On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security

    Science.gov (United States)

    Filimonova, L. A.; Skvortsova, N. K.

    2017-11-01

    The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

  13. Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function

    Science.gov (United States)

    Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.

    1990-01-01

    Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

  14. Discovery of jarosite within the Mawrth Vallis region of Mars: Implications for the geologic history of the region

    Science.gov (United States)

    Farrand, W. H.; Glotch, T.D.; Rice, J. W.; Hurowitz, J.A.; Swayze, G.A.

    2009-01-01

    Analysis of visible to near infrared reflectance data from the MRO CRISM hyperspectral imager has revealed the presence of an ovoid-shaped landform, approximately 3 by 5 km in size, within the layered terrains surrounding the Mawrth Vallis outflow channel. This feature has spectral absorption features consistent with the presence of the ferric sulfate mineral jarosite, specifically a K-bearing jarosite (KFe3(SO4)2(OH)6). Terrestrial jarosite is formed through the oxidation of iron sulfides in acidic environments or from basaltic precursor minerals with the addition of sulfur. Previously identified phyllosilicates in the Mawrth Vallis layered terrains include a basal sequence of layers containing Fe-Mg smectites and an upper set of layers of hydrated silica and aluminous phyllosilicates. In terms of its fine scale morphology revealed by MRO HiRISE imagery, the jarosite-bearing unit has fracture patterns very similar to that observed in Fe-Mg smectite-bearing layers, but unlike that observed in the Al-bearing phyllosilicate unit. The ovoid-shaped landform is situated in an east-west bowl-shaped depression superposed on a north sloping surface. Spectra of the ovoid-shaped jarosite-bearing landform also display an anomalously high 600 nm shoulder, which may be consistent with the presence of goethite and a 1.92 ??m absorption which could indicate the presence of ferrihydrite. Goethite, jarosite, and ferrihydrite can be co-precipitated and/or form through transformation of schwertmannite, both processes generally occurring under low pH conditions (pH 2-4). To date, this location appears to be unique in the Mawrth Vallis region and could represent precipitation of jarosite in acidic, sulfur-rich ponded water during the waning stages of drying. ?? 2009 Elsevier Inc. All rights reserved.

  15. Discovery of jarosite within the Mawrth Vallis region of Mars: Implications for the geologic history of the region

    Science.gov (United States)

    Farrand, William H.; Glotch, Timothy D.; Rice, James W.; Hurowitz, Joel A.; Swayze, Gregg A.

    2009-12-01

    Analysis of visible to near infrared reflectance data from the MRO CRISM hyperspectral imager has revealed the presence of an ovoid-shaped landform, approximately 3 by 5 km in size, within the layered terrains surrounding the Mawrth Vallis outflow channel. This feature has spectral absorption features consistent with the presence of the ferric sulfate mineral jarosite, specifically a K-bearing jarosite (KFe 3(SO 4) 2(OH) 6). Terrestrial jarosite is formed through the oxidation of iron sulfides in acidic environments or from basaltic precursor minerals with the addition of sulfur. Previously identified phyllosilicates in the Mawrth Vallis layered terrains include a basal sequence of layers containing Fe-Mg smectites and an upper set of layers of hydrated silica and aluminous phyllosilicates. In terms of its fine scale morphology revealed by MRO HiRISE imagery, the jarosite-bearing unit has fracture patterns very similar to that observed in Fe-Mg smectite-bearing layers, but unlike that observed in the Al-bearing phyllosilicate unit. The ovoid-shaped landform is situated in an east-west bowl-shaped depression superposed on a north sloping surface. Spectra of the ovoid-shaped jarosite-bearing landform also display an anomalously high 600 nm shoulder, which may be consistent with the presence of goethite and a 1.92 μm absorption which could indicate the presence of ferrihydrite. Goethite, jarosite, and ferrihydrite can be co-precipitated and/or form through transformation of schwertmannite, both processes generally occurring under low pH conditions (pH 2-4). To date, this location appears to be unique in the Mawrth Vallis region and could represent precipitation of jarosite in acidic, sulfur-rich ponded water during the waning stages of drying.

  16. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

    Science.gov (United States)

    Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

    2013-04-11

    Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

  17. Implications of the New Regional Trade Agreements for the World Trading System

    Directory of Open Access Journals (Sweden)

    Agnes Ghibuțiu

    2017-04-01

    Full Text Available The year 2013 witnessed an outstanding rise in the pace and scale of negotiations on regional trade agreements (RTAs. While RTAs are not a new phenomenon, current negotiations involve multiple parties and/or major trading countries that have a significant combined economic weight, i.e. mega-RTAs. This paper looks at the recent surge in trade regionalism and addresses some of the key issues related to the potential impact of mega-RTAs upon the world trading system and global trade patterns. It examines the peculiarities of the new mega-RTAs and the factors underlying their proliferation, and discusses the main concerns raised by their foreseeable impact on excluded countries and the wider trading system. The paper finds that, if successfully concluded, mega-RTAs are likely to have far-reaching implications for the world trading regime, affecting its transparency and coherence. Nevertheless, the adverse effects could be cushioned through a revival of trading nations’ interest in the multilateral Doha Round talks.

  18. Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

    DEFF Research Database (Denmark)

    Larsen, Peter Wilgaard

    2017-01-01

    The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

  19. Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

    Directory of Open Access Journals (Sweden)

    Jahanbakhsh Pairanj

    2011-09-01

    Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

  20. Changes to urban form and commuting patterns: trends in two Danish city regions

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    2015-01-01

    This paper compares indicators of polycentricity in a monocentric (MUR) and a polycentric urban region (PUR) in Denmark at two points in time (1982 and 2002). It describes how population, jobs and commuting indicators of polycentricity develop and interact over time. Both the MUR and the PUR tend...

  1. Innovative Forms of Regional Structural Policy in Europe: the Role of Dominant Concepts and Knowledge Flows

    NARCIS (Netherlands)

    Lagendijk, A.

    1999-01-01

    The last decade has witnessed a revival of regional structural policy in the Western world. The new style of policy-making which has emerged differs markedly from the top-down distributional models that dominated the post-war period, but is also more pro-active than the hands-off approach of the

  2. Distribution of various forms of Cd, Pb and Cu in the Wadge Bank region (Arabian Sea)

    Digital Repository Service at National Institute of Oceanography (India)

    George, M.D.

    Labile, nonlabile and particulate forms of Cd,Pb and Cu were determined in 29 water samples collected from a depth of 5 m, from the Wadge Bank area. Labile Cd varied from 0.1 to 0.2 mu g.l-1 while nonlabile fraction was in the range 0.1 to 0.3 mu gl...

  3. Greenhouse gas emissions from cities and regions: International implications revealed by Hong Kong

    International Nuclear Information System (INIS)

    Harris, Paul G.; Chow, Alice S.Y.; Symons, Jonathan

    2012-01-01

    The diversity of greenhouse gas (GHG) accounting methodologies currently utilized by cities around the world make meaningful comparisons of their emissions almost impossible. Consequently, the 2010 United Nations International Standard for Determining Greenhouse Gas Emissions for Cities promotes a “harmonized protocol for quantifying the GHG emissions attributable to cities and local regions.” The UN's common standard has important implications for comparison, benchmarking and policy assessment related to energy policies. This paper uses Hong Kong as a case study to illustrate these implications. Hong Kong's per capita contribution to GHG emissions are among the highest in the world, yet the local government's official statistics indicate emissions that are far below those reported by most affluent economies. This discrepancy arises from a reporting methodology that does not require inclusion of GHG emissions linked to consumption of imported goods or emissions from aviation and shipping. The Hong Kong case reveals that current inventories do not provide sufficient information to guide policymaking related to energy and climate change. They also do not provide adequate information for comparing policies of cities internationally. Alternative emissions-reporting standards that focus more on pollution from consumption will create avenues for more effective climate-related policies. - Highlights: ► Flawed GHG inventory methodologies can lead cities to adopt misguided policies. ► Diverse GHG inventory methodologies make meaningful comparisons among cities difficult. ► A Hong Kong case study highlights that GHG inventories can misrepresent cities' climate impacts. ► City inventories often exclude GHG emissions linked to imports, aviation and shipping. ► The International Standard for Determining GHG Emissions for Cities can assist climate policy.

  4. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: jybarra@astro.unam.mx [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)

    2014-10-20

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.

  5. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.

    2014-01-01

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

  6. Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region?

    Science.gov (United States)

    Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac

    2018-01-01

    To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

  7. Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

  8. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  9. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  10. Competition for petroleum exploration capital in the Asia-Pacific region - implications for New Zealand and Australia

    International Nuclear Information System (INIS)

    Miller, A.

    1995-01-01

    This paper examines the future energy production and demand profiles for the Asia Pacific region and the global allocation of exploration capital made by major international petroleum companies. The implications of these factors for future government petroleum exploration policies within the region are considered, in particular the Australian and New Zealand situations, together with likely effects of such measures on the ability of exploration and production companies to raise capital. (Author)

  11. «Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

    Directory of Open Access Journals (Sweden)

    Anishenko Anatoly

    2012-01-01

    Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

  12. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A*

    Science.gov (United States)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.

    2018-05-01

    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  13. Dynamic positional fate map of the primary heart-forming region.

    Science.gov (United States)

    Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J

    2009-08-15

    Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

  14. TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

    OpenAIRE

    Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

  15. Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

    International Nuclear Information System (INIS)

    Kim, Kyungsik

    2011-01-01

    We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

  16. Digitisation Project Planning in the Maribor City Library as a Form of Regional Cross Institutional Cooperation

    Directory of Open Access Journals (Sweden)

    Nina Hriberšek Vuk

    2013-09-01

    Full Text Available EXTENDED ABSTRACT:More and more Slovenian public libraries have been facing the question of selection criteria for digitisation of library materials as well as the issue of financial resources, copyright permission and the promotion of digitised materials. Libraries having long tradition of collecting valuable local history resources are more convinced about the selection criteria. Digitisation is, in spite of being expensive, time consuming and labour intensive, an easy method to enable quick access to library materials, to promote and preserve library collections. The mission of the central regional public library (cofinanced by the Ministry of Culture is not only to coordinate the collection, cataloguing and storage of local history resources but also to coordinate local history digital projects. Due to historical circumstances, the local history resources were first collected by the Maribor University Library. It is only in the recent past that the Maribor City Library has started to systematically collect these materials. Due to this fact, the Maribor City Library does not hold an extensive collection of rare and valuable local history items. It was initially faced with the problem of selection criteria for digitisation. However, it soon succeeded to establish the strategy to promote the local history collections in the region, regardless of their location. Thus the library started to cooperate with different regional institutions and the first partner projects were designed. In the year 2007 the library collaborated with the elementary school at Lovrenc na Pohorju and decided to digitise research papers of ex-pupils of the school. The first part of the project was accomplished in 2007 when 72 research papers were digitised, in the next two years their number was increased as the second part of the project was concluded. The papers were published on the KAMRA portal and the project was promoted at the summer annual meeting at Lovrenc na

  17. Highly restricted deletion of the SNORD116 region is implicated in Prader–Willi Syndrome

    Science.gov (United States)

    Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

    2015-01-01

    The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader–Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS. PMID:24916642

  18. Highly restricted deletion of the SNORD116 region is implicated in Prader-Willi Syndrome.

    Science.gov (United States)

    Bieth, Eric; Eddiry, Sanaa; Gaston, Véronique; Lorenzini, Françoise; Buffet, Alexandre; Conte Auriol, Françoise; Molinas, Catherine; Cailley, Dorothée; Rooryck, Caroline; Arveiler, Benoit; Cavaillé, Jérome; Salles, Jean Pierre; Tauber, Maïthé

    2015-02-01

    The SNORD116 locus lies in the 15q11-13 region of paternally expressed genes implicated in Prader-Willi Syndrome (PWS), a complex disease accompanied by obesity and severe neurobehavioural disturbances. Cases of PWS patients with a deletion encompassing the SNORD116 gene cluster, but preserving the expression of flanking genes, have been described. We report a 23-year-old woman who presented clinical criteria of PWS, including the behavioural and nutritional features, obesity, developmental delay and endocrine dysfunctions with hyperghrelinemia. We found a paternally transmitted highly restricted deletion of the SNORD116 gene cluster, the shortest described to date (118 kb). This deletion was also present in the father. This finding in a human case strongly supports the current hypothesis that lack of the paternal SNORD116 gene cluster has a determinant role in the pathogenesis of PWS. Moreover, targeted analysis of the SNORD116 gene cluster, complementary to SNRPN methylation analysis, should be carried out in subjects with a phenotype suggestive of PWS.

  19. Characterization of Nitride Layers Formed by Nitrogen Ion Implantation into Surface Region of Iron

    International Nuclear Information System (INIS)

    Sudjatmoko; Subki, M. Iyos R.

    2000-01-01

    Ion implantation is a convenient means of modifying the physical and chemical properties of the near-surface region of materials. The nitrogen implantation into pure iron has been performed at room temperature with ion dose of 1.310 17 to 1.310 18 ions/cm 2 and ion energy of 20 to 100 keV. The optimum dose of nitrogen ions implanted into pure iron was around 2.2310 17 ions/cm 2 in order to get the maximum wear resistant. SEM micrographs and EDX show that the nitride layers were found on the surface of substrate. The nitrogen concentration profile was measured using EDX in combination with spot technique, and it can be shown that the depth profile of nitrogen implanted into substrate was nearly Gaussian. (author)

  20. The pion-nucleon form factor in space- and time-like regions

    International Nuclear Information System (INIS)

    Speth, J.; Tegen, R.

    1990-01-01

    We investigate the pion-nucleon vertex function in space- and time-like regions; these vertex functions appear as internal vertices in nucleon-antinucleon annihilations into n pions (n=2, 3, ..., 6). It is emphasised that only relativistic quark models can account for these vertices where one of the baryons/antibaryons is far off-shell with total energy close to zero. Using a novel 4-momentum projection technique we obtain results which generalize the usual (Breit frame) calculation of G πNN (k 2 ) (space-like) thereby removing completely the discrepancy in the Goldberger-Treiman relation. Our relativistic quark model calculation also explains the empirical suppression of antibaryonic contributions to the vertex functions Gsub(πNanti B) and Gsub(πBanti N) which enter in processes like Nanti N→ππ. (orig.)

  1. Regional and international implications of the Iranian nuclear crisis; Les implications regionales et internationales de la crise nucleaire iranienne

    Energy Technology Data Exchange (ETDEWEB)

    Reveillard, Ch

    2006-07-15

    Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

  2. Water Resources Implications of Cellulosic Biofuel Production at a Regional Scale

    Science.gov (United States)

    Christopher, S. F.; Schoenholtz, S. H.; Nettles, J. E.

    2011-12-01

    Recent increases in oil prices, a strong national interest in greater energy independence, and a concern for the role of fossil fuels in global climate change, have led to a dramatic expansion in use of alternative renewable energy sources in the U.S. The U.S. government has mandated production of 36 billion gallons of renewable fuels by 2022, of which 16 billion gallons are required to be cellulosic biofuels. Production of cellulosic biomass offers a promising alternative to corn-based systems because large-scale production of corn-based ethanol often requires irrigation and is associated with increased erosion, excess sediment export, and enhanced leaching of nitrogen and phosphorus. Although cultivation of switchgrass using standard agricultural practices is one option being considered for production of cellulosic biomass, intercropping cellulosic biofuel crops within managed forests could provide feedstock without primary land use change or the water quality impacts associated with annual crops. Catchlight Energy LLC is examining the feasibility and sustainability of intercropping switchgrass in loblolly pine plantations in the southeastern U.S. Ongoing research is determining efficient operational techniques and information needed to evaluate effects of these practices on water resources in small watershed-scale (~25 ha) studies. Three sets of four to five sub-watersheds are fully instrumented and currently collecting calibration data in North Carolina, Alabama, and Mississippi. These watershed studies will provide detailed information to understand processes and guide management decisions. However, environmental implications of cellulosic systems need to be examined at a regional scale. We used the Soil Water Assessment Tool (SWAT), a physically-based hydrologic model, to examine water quantity effects of various land use change scenarios ranging from switchgrass intercropping a small percentage of managed pine forest land to conversion of all managed

  3. The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

    Science.gov (United States)

    Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

    2016-04-01

    The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

  4. COMPETITION AS A FORM OF ORGANIZING CULTURAL ACTIVITIES OF THE KRASNOYARSK REGION POPULATION IN THE 1960-1980S

    Directory of Open Access Journals (Sweden)

    Ekaterina Ivanovna Lobyneva

    2014-08-01

    Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

  5. Con-forming bodies: the interplay of machines and bodies and the implications of agency in medical imaging.

    Science.gov (United States)

    Wood, Lisa A

    2016-06-01

    Attending to the material discursive constructions of the patient body within cone beam computed tomography (CBCT) imaging in radiotherapy treatments, in this paper I describe how bodies and machines co-create images. Using an analytical framework inspired by Science and Technology Studies and Feminist Technoscience, I describe the interplay between machines and bodies and the implications of materialities and agency. I argue that patients' bodies play a part in producing scans within acceptable limits of machines as set out through organisational arrangements. In doing so I argue that bodies are fabricated into the order of work prescribed and embedded within and around the CBCT system, becoming, not only the subject of resulting images, but part of that image. The scan is not therefore a representation of a passive subject (a body) but co-produced by the work of practitioners and patients who actively control (and contort) and discipline their body according to protocols and instructions and the CBCT system. In this way I suggest they are 'con-forming' the CBCT image. A Virtual Abstract of this paper can be found at: https://youtu.be/qysCcBGuNSM. © 2015 Foundation for the Sociology of Health & Illness.

  6. Economic efficiency and cost implications of habitat conservation: An example in the context of the Edwards Aquifer region

    Science.gov (United States)

    Gillig, Dhazn; McCarl, Bruce A.; Jones, Lonnie L.; Boadu, Frederick

    2004-04-01

    Groundwater management in the Edwards Aquifer in Texas is in the process of moving away from a traditional right of capture economic regime toward a more environmentally sensitive scheme designed to preserve endangered species habitats. This study explores economic and environmental implications of proposed groundwater management and water development strategies under a proposed regional Habitat Conservation Plan. Results show that enhancing the habitat by augmenting water flow costs $109-1427 per acre-foot and that regional water development would be accelerated by the more extreme possibilities under the Habitat Conservation Plan. The findings also indicate that a water market would improve regional welfare and lower water development but worsen environmental attributes.

  7. On the origin of phosphorus nitride in star-forming regions

    Science.gov (United States)

    Mininni, C.; Fontani, F.; Rivilla, V. M.; Beltrán, M. T.; Caselli, P.; Vasyunin, A.

    2018-05-01

    We present multitransition observations of phosphorus nitride (PN) towards a sample of nine massive dense cores in different evolutionary stages. Using transitions with different excitation conditions, we have found for the first time that the excitation temperatures of PN are in the range ˜5-30 K. To investigate the main chemical route for the PN formation (surface-chemistry versus gas-phase chemistry), and the dominant desorption mechanism (thermal versus shock), we have compared our results with those obtained from molecules tracing different chemical and physical conditions (SiO, SO, CH3OH, and N2H+). We have found that the PN line profiles are very well correlated with those of SiO and SO in six out of the nine targets, which indicate that PN may be released by sputtering of dust grains due to shocks. This finding is corroborated by a faint but statistically significant positive trend between the PN abundance and those of SiO and SO. However, in three objects the PN lines have no hints of high-velocity wings, which indicates an alternative origin of PN. Overall, our results indicate that the origin of PN is not unique, as it can be formed not only in protostellar shocks, but also in colder and more quiescent gas through alternative pathways.

  8. THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)

    2013-09-20

    We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

  9. Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenic forms of Burkitt lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Neri, A.; Barriga, F.; Knowles, D.M.; Magrath, I.T.; Dalla-Favera, R.

    1988-04-01

    The authors show that endemic (eBL), sporadic (sBL), and acquired immunodeficiency syndrome-associated (AIDS-BL) forms of Burkitt lymphoma (BL) carrying t(8; 14) chromosomal translocations display different breakpoints within the immunoglobulin heavy-chain locus (IGH) on chromosome 14. In sBL (7 out of 11) and AIDS-BL (5 out of 6), the breakpoints occurred within or near the IGH ..mu.. switch (S/sub mu/) region on chromosome 14 and within the c-myc locus (MYC) on chromosome 8. In most eBL (13 out of 16) the breakpoints were mapped within or 5' to the IGH joining J/sub H/ region on chromosome 14 and outside the MYC locus on chromosome 8. Cloning and sequencing of the (8; 14) chromosomal junctions from two eBL cell lines and one eBL biopsy sample show that the recombination do not involve IGH-specific recombination signals on chromosome 14 or homologous sequences on chromosome 8, suggesting that these events are not likely to be mediated by the same mechanisms or enzymes as in IGH rearrangements. In general, these data have implications for the timing of occurrence of chromosomal translocations during B-cell differentiation in different BL types.

  10. New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

    Science.gov (United States)

    van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

    2018-02-01

    Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

  11. Output and substitution elasticities of energy and implications for renewable energy expansion in the ECOWAS region

    International Nuclear Information System (INIS)

    Wesseh, Presley K.; Lin, Boqiang

    2016-01-01

    This study estimates output and substitution elasticities of renewable energy and nonrenewable energy for the Economic Community of West African States (ECOWAS) and discusses implications for expanding the former. The results show that nonrenewable energy promises greater benefits for ECOWAS economic transition, with output elasticities averaging between 0.052–0.579 and −0.055 to 0.223 for nonrenewable energy and renewable energy respectively. Overall estimated technological progress is low (−0.5% to 2.6%); the bulk coming from input efficiency. Substitution elasticities (0.02–0.94) suggest potential for switching towards renewable energy. Notwithstanding, scale, economics and sitting problems inherent in renewable power generation challenge the opportunities for energy substitution. A sustainable policy solution, therefore, appears to be one favoring scaled and efficient electricity generation from fossil energy in the short-run with a gradual switch towards renewable power in the long-run. In general, the applied model provides insights that energy efficiency enhances sustainable growth by propelling technological advancement especially when technical change is scale-biased and factor-augmenting. The study also provides insights that impacts of exogenous shocks to inputs are temporary, and hence, do not jeopardize efforts aimed at scaling output through increased and efficient use of labor, capital and energy; especially nonrenewable energy. - Highlights: • Output and substitution elasticities of energy are estimated for the ECOWAS region. • Nonrenewable energy promises greater opportunities for economic growth. • Technical progress is low and driven mainly by the efficiency of inputs. • Energy efficiency drives technological innovation. • Potential of switching towards renewable energy is high but suffers feasibility gaps.

  12. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    Energy Technology Data Exchange (ETDEWEB)

    Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: juarez@ice.cat [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)

    2017-07-20

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  13. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    International Nuclear Information System (INIS)

    Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping

    2017-01-01

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  14. An assessment of the Pacific Regional Cancer Coalition: outcomes and implications of a regional coalition internal and external assessment.

    Science.gov (United States)

    Sy, Angela U; Heckert, Karen A; Buenconsejo-Lum, Lee; Hedson, Johnny; Tamang, Suresh; Palafox, Neal

    2011-11-01

    The Pacific Regional Cancer Coalition (PRCC) provides regional leadership in the U.S. Affiliated Pacific Islands (USAPI) to implement the Regional Comprehensive Control Plan: 2007-2012, and to evaluate its coalition and partnerships. The Pacific Center of Excellence in the Elimination of Disparities (CEED), aims to reduce cancer disparities and conducts evaluation activities relevant to cancer prevention and control in the USAPI. The PRCC Self (internal) and Partner (external) Assessments were conducted to assess coalition functioning, regional and national partnerships, sustainability, and the role of regionalism for integrating all chronic disease prevention and control in the Pacific. Self-administered questionnaires and key informant telephone interviews with PRCC members (N=20), and representatives from regional and national partner organizations were administered (N=26). Validated multi item measures using 5-point scales on coalition and partnership characteristics were used. Chronbach's alphas and averages for the measures were computed. Internal coalition measures: satisfaction (4.2, SD=0.48) communication (4.0, SD=0.56), respect (4.0, SD=0.60) were rated more highly than external partnership measures: resource sharing (3.5, SD=0.74), regionalism (3.9, SD=0.47), use of findings (3.9, SD=0.50). The PRCC specifically identified its level of "collaboration" with external partners including Pacific CEED. External partners identified its partnership with the PRCC in the "coalition" stage. PRCC members and external partners are satisfied with their partnerships. All groups should continue to focus on building collaboration with partners to reflect a truly regional approach to sustain the commitment, the coalitions and the programming to reduce cancer in the USAPI. PRCC and partners should also work together to integrate all chronic disease prevention and control efforts in the Pacific.

  15. Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

    Science.gov (United States)

    Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

    2013-01-01

    Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

  16. A novel form of postcranial skeletal pneumaticity in a sauropod dinosaur: Implications for the paleobiology of Rebbachisauridae

    Directory of Open Access Journals (Sweden)

    Lucio M. Ibiricu

    2017-06-01

    Full Text Available In dinosaurs and other archosaurs, the presence of foramina connected with internal chambers in axial and appendicular bones is regarded as a robust indicator of postcranial skeletal pneumaticity (PSP. Here we analyze PSP and its paleobiological implications in rebbachisaurid diplodocoid sauropod dinosaurs based primarily on the dorsal vertebrae of Katepensaurus goicoecheai, a rebbachisaurid from the Cenomanian–Turonian (Upper Cretaceous Bajo Barreal Formation of Patagonia, Argentina. We document a complex of interconnected pneumatic foramina and internal chambers within the dorsal vertebral transverse processes of Katepensaurus. Collectively, these structures constitute a form of PSP that has not previously been observed in sauropods, though it is closely comparable to morphologies seen in selected birds and non-avian theropods. Parts of the skeletons of Katepensaurus and other rebbachisaurid taxa such as Amazonsaurus maranhensis and Tataouinea hannibalis exhibit an elevated degree of pneumaticity relative to the conditions in many other sauropods. We interpret this extensive PSP as an adaptation for lowering the density of the skeleton, and tentatively propose that this reduced skeletal density may also have decreased the muscle energy required to move the body and the heat generated in so doing. Given that several rebbachisaurids inhabited tropical to subtropical paleolatitudes during the extreme warmth of the mid-Cretaceous, increased PSP may have better enabled these sauropods to cope with extraordinarily high temperatures. Extensive skeletal pneumaticity may have been an important innovation in Rebbachisauridae, and perhaps also in saltasaurine titanosaurs, which evolved an even greater degree of PSP. This may in turn have contributed to the evolutionary success of rebbachisaurids, which were the only diplodocoids to survive into the Late Cretaceous.

  17. Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey

    Science.gov (United States)

    Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

    2018-06-01

    We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

  18. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  19. GABBR1 has a HERV-W LTR in its regulatory region – a possible implication for schizophrenia

    Directory of Open Access Journals (Sweden)

    Hegyi Hedi

    2013-02-01

    Full Text Available Abstract Schizophrenia is a complex disease with uncertain aetiology. We suggest GABBR1, GABA receptor B1 implicated in schizophrenia based on a HERV-W LTR in the regulatory region of GABBR1. Our hypothesis is supported by: (i GABBR1 is in the 6p22 genomic region most often implicated in schizophrenia; (ii microarray studies found that only presynaptic pathway-related genes, including GABA receptors, have altered expression in schizophrenic patients and (iii it explains how HERV-W elements, expressed in schizophrenia, play a role in the disease: by altering the expression of GABBR1 via a long terminal repeat that is also a regulatory element to GABBR1. Reviewers This paper was reviewed by Sandor Pongor and Martijn Huynen.

  20. Regional implications of heat flow of the Snake River Plain, Northwestern United States

    Science.gov (United States)

    Blackwell, D. D.

    1989-08-01

    The Snake River Plain is a major topographic feature of the Northwestern United States. It marks the track of an upper mantle and crustal melting event that propagated across the area from southwest to northeast at a velocity of about 3.5 cm/yr. The melting event has the same energetics as a large oceanic hotspot or plume and so the area is the continental analog of an oceanic hotspot track such as the Hawaiian Island-Emperor Seamount chain. Thus, the unique features of the area reflect the response of a continental lithosphere to a very energetic hotspot. The crust is extensively modified by basalt magma emplacement into the crust and by the resulting massive rhyolite volcanism from melted crustal material, presently occurring at Yellowstone National Park. The volcanism is associated with little crustal extension. Heat flow values are high along the margins of the Eastern and Western Snake River Plains and there is abundant evidence for low-grade geothermal resources associated with regional groundwater systems. The regional heat flow pattern in the Western Snake River Plains reflects the influence of crustal-scale thermal refraction associated with the large sedimentary basin that has formed there. Heat flow values in shallow holes in the Eastern Snake River Plains are low due to the Snake River Plains aquifer, an extensive basalt aquifer where water flow rates approach 1 km/yr. Below the aquifer, conductive heat flow values are about 100 mW m -2. Deep holes in the region suggest a systematic eastward increase in heat flow in the Snake River Plains from about 75-90 mW m -2 to 90-110 mW m -2. Temperatures in the upper crust do not behave similarly because the thermal conductivity of the Plio-Pleistocene sedimentary rocks in the west is lower than that in the volcanic rocks characteristic of the Eastern Snake River Plains. Extremely high heat loss values (averaging 2500 mW m -2) and upper crustal temperatures are characteristic of the Yellowstone caldera.

  1. Troubling Times-The GFC and its Implications for Regional Performance. Part One: The United States And Europe

    OpenAIRE

    Robert J. Stimson

    2012-01-01

    The Global Financial Crisis (GFC) was a profound exogenous shock which has had profound impacts the performance of national economies and the regions within them. The differential outcomes are vast. In many parts of the world there is evidence of what is being referred to as the ‘two-speed’ economy - or even a ‘multi-speed’ - economy. This has implications for regional economic development theory in which, over the last two to three decades, there has been an increasing emphasis on endogenous...

  2. Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

    2017-04-20

    We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

  3. A proposed cell model for multiple-occurrence regional landslide events: Implications for landslide susceptibility mapping

    Science.gov (United States)

    Crozier, M. J.

    2017-10-01

    Multiple-occurrence regional landslide events (MORLEs) consist of hundreds to thousands of shallow landslides occurring more or less simultaneously within defined areas, ranging from tens to thousands of square kilometres. While MORLEs can be triggered by rainstorms and earthquakes, this paper is confined to those landslide events triggered by rainstorms. Globally, MORLEs occur in a range of geological settings in areas of moderate to steep slopes subject to intense rainstorms. Individual landslides in rainstorm-triggered events are dominantly small, shallow debris and earth flows, and debris and earth slides involving regolith or weathered bedrock. The model used to characterise these events assumes that energy distribution within the event area is represented on the land surface by a cell structure; with maximum energy expenditure within an identifiable core and rapid dissipation concentrically away from the centre. The version of the model presented here has been developed for rainfall-triggered landslide events. It proposes that rainfall intensity can be used to determine different critical landslide response zones within the cell (referred to as core, middle, and periphery zones). These zones are most readily distinguished by two conditions: the proportion of the slope that fails and the particular type of the slope stability factor that assumes dominance in determining specific sites of landslide occurrence. The latter condition means that the power of any slope stability factor to distinguish between stable and unstable sites varies throughout the affected area in accordance with the landslide response zones within the cell; certain factors critical for determining the location of landslide sites in one part of the event area have little influence in other parts of the event area. The implication is that landslide susceptibility maps (and subsequently derived mitigation measures) based on conventional slope stability factors may have only limited validity

  4. Regional distribution of volcaniclastic layer and its implication for segmentation of the Nankai seismogenic zone

    Science.gov (United States)

    Sasaki, T.; Lim, J.; Higashi, M.; Park, J.

    2010-12-01

    The Nankai Trough is known as one of the best-suited convergent plate margins for studying accretionary prism growth as well as subduction zone earthquakes. Along the Nankai accretionary margin off southwest Japan, the Shikoku Basin which formed 26-15 Ma as backarc spreading in the Philippine Sea Plate is being subducted about 4 cm/year to the northwest. The Deep Sea Drilling Project (DSDP) and Ocean Drilling Program (ODP) penetrated the Nankai accretionary prism and the incoming sedimentary section along the Ashizuri and Muroto transects, off Shikoku Island. Also, Integrated Ocean Drilling Program (IODP), which represented just one part of a multi-stage project known as the Nankai Trough Seismogenic Zone Experiment (NanTroSEIZE) has been conducting drilling cruises now. IODP Expedition 322 in 2009, the coring was carried out at two drilling sites on the northern part of the Shikoku Basin in the subducting Philippine Sea plate. One of the major achievements of Expedition 322 is a discovery of late Miocene (10.2-7.6 Ma) tuffaceous and volcaniclastic sandstone layer (Underwood et al., IODP Prel. Rept. 322, 2009) that has not been previously recognized in the Nankai Trough. Based on age and volcanic sand content analysis, these volcaniclastic layers were unique to the Shikoku Basin off Kii Peninsula. The closest source of this volcanic layer was supposed to be the Izu-Bonin arc. Subducted sediments ultimately affect subduction zone geochemistry, thermal structure, and seismogenesis. High porosity of the volcaniclastic sandstone layer suggests the transportation of fluid to the subduction zone, it might affect the initiation and evolution of the decollement zone or plate boundary fault in the Nankai Trough. We interpreted single channel and multichannel seismic reflection profiles that have been acquired in the Nankai Trough margin by Japan Agency for Marine-Earth Science and Technology (JAMSTEC) since the year of 1997. We tried to map the major seismic layers such as

  5. X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    Energy Technology Data Exchange (ETDEWEB)

    Montes, V. A.; Hofner, P.; Anderson, C.; Rosero, V. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States)

    2015-08-15

    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-ray sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.

  6. Geographic variation in nasal cavity form among three human groups from the Japanese Archipelago: Ecogeographic and functional implications.

    Science.gov (United States)

    Fukase, Hitoshi; Ito, Tsuyoshi; Ishida, Hajime

    2016-05-01

    Geographic variation in human nasal form has often been interpreted as a climatic adaptation, owing to the nasal air-conditioning function. The aim of this study was to further address morphofunctional issues of the nasal cavity, using three human groups from subarctic, temperate, and subtropical regions of the Japanese Archipelago: prehistoric Okhotsk, early-modern Honshu and Okinawa groups. Using three-dimensional coordinates of craniometric landmarks surrounding the nasal cavity, we compared linear measurements regarding nasal cavity form among the three groups and also conducted 3D geometric morphometrics. Both linear measurements and morphometric analyses corroborate the previously reported covariation pattern of nasal cavity shape with climate, where humans from a cold/dry climate tend to possess a relatively tall, narrow, and deep nasal cavity compared with those from a warm/humid environment. The northern Okhotsk group had overall larger cranial airways, which may be attributable to their large facial skeleton. However, the ratio of nasal/bimaxillary breadth was significantly lower in the Okhotsk group, indicating that maxillary size does not necessarily constrain the nasal breadth. In addition, despite the presence of obvious geographic clines in anterior nasal shape, posterior choanal shape lacked the north-south geographic cline. This suggests a certain level of morphofunctional independence between the anterior and posterior nasal openings. The observed geographic variations must, however, be partly considered as a reflection of different ancestral traits and population histories of the three groups. Nevertheless, the results indicate that intergroup variations in nasal cavity morphology can be largely explained by climatic conditions. Am. J. Hum. Biol. 28:343-351, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  7. Emissions reduction and economic implications of renewable energy market penetration of power generation for residential consumption in the MENA region

    International Nuclear Information System (INIS)

    El Fadel, M.; Rachid, G.; El-Samra, R.; Bou Boutros, G.; Hashisho, J.

    2013-01-01

    This paper examines the implications of renewable energy (RE) deployment in power generation for residential consumption in the Middle East and North Africa (MENA) region under various RE penetration targets. A comparative assessment revealed a great heterogeneity among countries with Turkey dominating as the highest emitter. At the sub-regional level, the Middle East sub-region contributes more than double the GHG emissions estimated for the Gulf and North Africa sub-regions with all sub-regions achieving reductions in the range of 6–38% depending on the RE target penetration and promising up to 54% savings on investment excluding positive externalities associated with the offset of greenhouse gas (GHG) emissions savings. - Highlights: ► Heterogeneity in GHG emissions in MENA region with Turkey contributing the most. ► Average regional GHG tCO 2 e/capita of 0.42 decreases to 0.17 with RE penetration. ► GHG emissions regional reduction reaches 8–36% depending on RE target penetration. ► Return on investment in RE promises up to 54% savings excluding positive externalities. ► Carbon credits offer economic incentives rendering RE investment more attractive.

  8. Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

    Science.gov (United States)

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

    2018-03-01

    We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

  9. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

    2015-01-01

    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  10. A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

    Directory of Open Access Journals (Sweden)

    Mariem Ben Rekaya

    2014-01-01

    Full Text Available Xeroderma pigmentosum Variant (XP-V form is characterized by a late onset of skin symptoms. Our aim is the clinical and genetic investigations of XP-V Tunisian patients in order to develop a simple tool for early diagnosis. We investigated 16 suspected XP patients belonging to ten consanguineous families. Analysis of the POLH gene was performed by linkage analysis, long range PCR, and sequencing. Genetic analysis showed linkage to the POLH gene with a founder haplotype in all affected patients. Long range PCR of exon 9 to exon 11 showed a 3926 bp deletion compared to control individuals. Sequence analysis demonstrates that this deletion has occurred between two Alu-Sq2 repetitive sequences in the same orientation, respectively, in introns 9 and 10. We suggest that this mutation POLH NG_009252.1: g.36847_40771del3925 is caused by an equal crossover event that occurred between two homologous chromosomes at meiosis. These results allowed us to develop a simple test based on a simple PCR in order to screen suspected XP-V patients. In Tunisia, the prevalence of XP-V group seems to be underestimated and clinical diagnosis is usually later. Cascade screening of this founder mutation by PCR in regions with high frequency of XP provides a rapid and cost-effective tool for early diagnosis of XP-V in Tunisia and North Africa.

  11. A founder large deletion mutation in Xeroderma pigmentosum-Variant form in Tunisia: implication for molecular diagnosis and therapy.

    Science.gov (United States)

    Ben Rekaya, Mariem; Laroussi, Nadia; Messaoud, Olfa; Jones, Mariem; Jerbi, Manel; Naouali, Chokri; Bouyacoub, Yosra; Chargui, Mariem; Kefi, Rym; Fazaa, Becima; Boubaker, Mohamed Samir; Boussen, Hamouda; Mokni, Mourad; Abdelhak, Sonia; Zghal, Mohamed; Khaled, Aida; Yacoub-Youssef, Houda

    2014-01-01

    Xeroderma pigmentosum Variant (XP-V) form is characterized by a late onset of skin symptoms. Our aim is the clinical and genetic investigations of XP-V Tunisian patients in order to develop a simple tool for early diagnosis. We investigated 16 suspected XP patients belonging to ten consanguineous families. Analysis of the POLH gene was performed by linkage analysis, long range PCR, and sequencing. Genetic analysis showed linkage to the POLH gene with a founder haplotype in all affected patients. Long range PCR of exon 9 to exon 11 showed a 3926 bp deletion compared to control individuals. Sequence analysis demonstrates that this deletion has occurred between two Alu-Sq2 repetitive sequences in the same orientation, respectively, in introns 9 and 10. We suggest that this mutation POLH NG_009252.1: g.36847_40771del3925 is caused by an equal crossover event that occurred between two homologous chromosomes at meiosis. These results allowed us to develop a simple test based on a simple PCR in order to screen suspected XP-V patients. In Tunisia, the prevalence of XP-V group seems to be underestimated and clinical diagnosis is usually later. Cascade screening of this founder mutation by PCR in regions with high frequency of XP provides a rapid and cost-effective tool for early diagnosis of XP-V in Tunisia and North Africa.

  12. Forms of educational support for students with disabilities or educational needs in the Universidad National de Costa Rica, and implications for their professional training

    Directory of Open Access Journals (Sweden)

    Angélica Fontana Hernández

    2017-09-01

    Full Text Available This article presents the forms of educational support for students with disabilities or educational needs in the university environment, and their implications for these students’ professional training, according to results obtained through the FIDA Proyecto Percepciones y realidades en la atención de las necesidades educativas: propuesta de desarrollo profesional y su implementación en la Universidad Nacional (código 0524-10 del año 2012 al 2015. [Project Perceptions and realities in addressing educational needs: professional development proposal, and its implementation in the Universidad Nacional (code 0524-10 between 2012 and 2015[. One hundred and ninety-one students participated in this study (76 men and 115 women, who were enrolled in different careers in several UNA Sites (Central, Brunca, and Chorotega, as well as 427 staff members (181 men, and 246 women. The methodology uses a qualitative approach; 15 workshops and 65 individual interviews were conducted with students to gather their observations. It was found that only some of the students receive individual assistance (during and outside classes, and occasionally tutoring (in English, Mathematics and Chemistry by academic staff of the institution in the Central Site. For instance, more time is provided for them to take exams, during which they receive individual instructions; this is also done when they prepare research projects. One finding that stands out is that most students of UNA Regional Sites stated that their opinion is not taken into consideration by academic staff when determining and implementing adjustments in methodology or for evaluating the courses they receive. On the other hand, in the Central Site, most members of the group of students with disabilities talk with academic staff about defining at least types of adjustment or educational assistance.

  13. Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

    International Nuclear Information System (INIS)

    Kobushkin, A.P.; Syamtomov, A.I.

    1994-01-01

    Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

  14. Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

    Energy Technology Data Exchange (ETDEWEB)

    Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)

    2014-06-01

    A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

  15. Modern and last glacial maximum snowline in Peru and Bolivia: implications for regional climatic change

    Directory of Open Access Journals (Sweden)

    1995-01-01

    Full Text Available LIMITES DES NEIGES ACTUELLE ET DURANT LE DERNIER MAXIMUM GLACIAIRE AU PÉROU ET EN BOLIVIE : IMPLICATIONS EN TERMES DE CHANGEMENTS CLIMATIQUES RÉGIONAUX. Dans les Andes centrales (5°-23°S, le front actuel des neiges éternelles et celui datant du dernier maximum glaciaire (DMG ou LMG ont été cartographiés par télédétection et par un système utilisant une technologie basée sur des informations géographiques. La configuration générale du front des neiges éternelles du DMG est semblable à la configuration actuelle. Ce front s’élève d’est en ouest suivant des précipitations décroissantes. La limite des neiges éternelles du DMG dans la région s’écarte considérablement des 1 000 m souvent rencontrés dans les zones de basse latitude. Un modèle décrivant l’abaissement du front des neiges éternelles (Kuhn, 1989 a été utilisé afin de déterminer les changements de températures et de précipitations responsables de l’abaissement du front des neiges DMG. L’abaissement du front des neiges éternelles à 800-1 200 m dans la cordillère occidentale durant le DMG s’explique en partie par une augmentation des précipitations. Sur les flancs de la cordillère orientale, l’abaissement du front neigeux supérieur à 1 200 m est ce qui révèle le mieux le refroidissement subi par la région pendant le DMG. Il correspond à une baisse d’environ 5 à 7,5 °C. LÍMITES DE NIEVE ACTUAL Y DURANTE EL ÚLTIMO MÁXIMO GLACIAL EN PERÚ Y EN BOLIVIA: IMPLICACIONES EN TÉRMINOS CLIMÁTICOS REGIONALES. El límite de nieve perenne actual y la correspondiente a la de la última máxima glaciación (UMG de los Andes Centrales (5°-23° S han sido mapeadas utilizando técnicas de sensores remotos y sistema de información geográfica. La configuración general del límite de nieve perenne durante la UMG era similar a la actual, elevándose de este a oeste en respuesta a la disminución de las precipitaciones. La depresión del límite de

  16. Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

    CERN Multimedia

    2002-01-01

    The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

  17. Modelling the impact of urban form on household energy demand and related CO2 emissions in the Greater Dublin Region

    International Nuclear Information System (INIS)

    Liu Xiaochen; Sweeney, John

    2012-01-01

    This study aims to investigate the relationship between household space heating energy use and urban form (land use characteristics) for the Greater Dublin Region. The geographical distributions of household energy use are evaluated at the Enumeration Districts (ED) level based on the building thermal balance model. Moreover, it estimates the impact of possible factors on the household space heating consumption. Results illustrate that the distribution profile of dwellings is a significant factor related to overall heating energy demand and individual dwelling energy consumption for space heating. Residents living in compact dwellings with small floor areas consume less energy for space heating than residents living in dwellings with big floor areas. Moreover, domestic heating energy demand per household was also estimated for two extreme urban development scenarios: the compact city scenario and the dispersed scenario. The results illustrate that the compact city scenario is likely to decrease the domestic heating energy consumption per household by 16.2% compared with the dispersed city scenario. Correspondingly, the energy-related CO 2 emissions could be significantly decreased by compact city scenario compared with the dispersed city scenario. - Highlights: ► A method was developed to investigate urban form impacts on energy demand. ► This study estimates impacts of possible factors on the household energy consumption. ► Household heating energy demand is sensitive to dwelling distribution profile. ► The compact case could reduce domestic energy demand compared with the dispersed case.

  18. On the Implications of Knowledge Bases for Regional Innovation Policies in Germany

    Directory of Open Access Journals (Sweden)

    Hassink Robert

    2014-12-01

    Full Text Available Regional innovation policies have been criticised for being too standardised, one-size-fits-all and place-neutral in character. Embedded in these debates, this paper has two aims: first, to analyse whether industries with different knowledge bases in regions in Germany have different needs for regional innovation policies, and secondly, to investigate whether knowledge bases can contribute to the fine-tuning of regional innovation policies in particular and to a modern, tailor-made, place-based regional innovation policy in general. It concludes that although needs differ due to differences in knowledge bases, those bases are useful only to a limited extent in fine-tuning regional innovation policies

  19. Regional differences in entrepreneurial perceptions and implications for the Romanian competitiveness policy

    Directory of Open Access Journals (Sweden)

    Nicolae Mariana

    2016-04-01

    Full Text Available Understanding entrepreneurship as being spatially rooted transforms it in a regional and national competitiveness factor. Despite the increasing importance of the territorial dimension in supporting economic growth at policy and declarative levels, in practice, in Romania, the territorial structure and spatial organization of the economy contributes little to the national value added. In this context, we study regional differences in entrepreneurial initiative and perception and their possible impact on the national competitiveness strategy. We use primary data collected in three Romanian regions (Centre, North-East, Bucureşti-Ilfov and conduct a statistical analysis of the data. The results indicate different comparative regional profiles. The regional differences in the intentions, motivations, barriers and limitation for entrepreneurship confirm the theoretical view that personal motivations of becoming an entrepreneur are determined by environmental conditions. We conclude that the regional differences should be taken into account in the elaboration of the competitiveness policy, corroborated with the results of other similar studies.

  20. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    International Nuclear Information System (INIS)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel

    2015-01-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions

  1. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)

    2015-02-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

  2. Assessing Climate Vulnerabilities of Food Distribution Center Sites in Greater Boston and Their Regional Implications: Climate Adaptation Planning in Practice

    Science.gov (United States)

    Teferra, A.; Watson, C.; Douglas, E. M.

    2016-12-01

    The Metro Boston region, an area whose civic leaders have been at the forefront of climate resilience initiatives in recent years, is finalizing a flood vulnerability assessment of food distribution center sites located north of Boston, with the support of the University of Massachusetts Boston and the American Geophysical Union's Thriving Earth Exchange program. The community-scientist collaboration emerged because of the need for more local analyses of the area to inform climate resiliency policy and planning actions for the region. A significant amount of the metro region's food supply passes through two major distribution centers in the cities of Everett and Chelsea, just north of the Mystic River. The Metropolitan Area Planning Council (MAPC), on behalf of the Metro Boston Climate Preparedness Taskforce, is working with Chris Watson and Ellen Douglas of UMass Boston to build on existing analyses of the region's food system and climate vulnerabilities and to develop a report identifying flood risk exposure to the sites. The analysis brings in dynamic modeling techniques that incorporate storm surge and sea level rise projections under different climate scenarios, and aims to align methodologies with those of other regional analyses, such as Climate Ready Boston and the City of Cambridge's Vulnerability Assessment. The study is helping to inform MAPC's and the Metro Boston Climate Preparedness Taskforce's understanding of this critical food distribution infrastructure, illustrate the larger regional implications of climate impacts on food distribution in the Greater Boston area, and guide the development of site-specific strategies for addressing identified vulnerabilities.

  3. Demographic trends in the Lodz region and their implications for seniors 50+

    OpenAIRE

    Jolanta Woźnica; Andrzej Tokarski

    2014-01-01

    The situation on the labor market in the Lodz region will change much in the short term , among other things as a result of unfavorable demographic trends, associated with a decrease in population, and also due to a lowering of labor resources. Decreasing labor resources may in the future adversely affect both the balance between the regional labor market by inducing a state of labor shortages and limit the opportunities for development of the region. Simultaneously, due to declining bi...

  4. An Entropy Approach to Regional Differences in Carbon Dioxide Emissions: Implications for Ethanol Usage

    Directory of Open Access Journals (Sweden)

    Dong Hee Suh

    2018-01-01

    Full Text Available The growth of the U.S. economy has been accompanied with a significant rise in carbon dioxide (CO2 emissions. As CO2 emissions are dependent on regional climatic conditions and energy-related activities in states, this study examines the extent to which the distribution of CO2 emissions vary across nine climatically consistent regions in the U.S. The results obtained from the entropy approach reveal that the inequalities of CO2 emissions vary across the regions. While the total inequality of CO2 emissions is determined by the between-region and the average within-region inequalities, the between-region inequality begins to dominate the average within-region inequalities around 1980s; the emission inequalities between regions increase, but those within each region decrease. Given that ethanol usage is relevant to energy-related CO2 emissions, this study also evaluates the impact of ethanol usage on the changes in the emission inequalities. The results show that an increase in the ratio of ethanol to fossil fuels is associated closely with the reductions in the inequalities of CO2 emissions.

  5. Implications of Sino-American Strategic Competition on Southeast Asia's Post-Cold War Regional Order

    National Research Council Canada - National Science Library

    Suryodipuro, Sidharto

    2003-01-01

    .... The study of international politics after the Cold War has rediscovered the importance of regional interaction as the framework for understanding countries' security strategies and the great powers...

  6. Rural Policy and the New Regional Economics: Implications for Rural America.

    Science.gov (United States)

    Quigley, John M.

    This paper discusses gross economic and demographic trends in rural and urban America during the past 30 years, the kinds of competitive advantages enjoyed by urban and rural regions, and insights offered by the new regional economics concerning exploitation of those advantages. The importance of agriculture has declined in rural areas, while that…

  7. Agricultural transformations, livelihoods and rural-city connections. Policy implications for regional development

    NARCIS (Netherlands)

    Steel, G.|info:eu-repo/dai/nl/304349828; van Lindert, P.H.C.M.|info:eu-repo/dai/nl/069299382; Fold, Niels; Mynborg, Tobias

    2016-01-01

    This report analyses agricultural transformations, livelihoods and rural-city connections in Sub-Saharan Africa with the aim to identify key policy areas for regional development. The report draws on the results from comparative empirical studies in various dynamic rural regions characterized by

  8. Implications of Climate Change for Rural Tourism in the Nordic Region

    NARCIS (Netherlands)

    Nicholls, S.; Amelung, B.

    2015-01-01

    In many rural regions, including those of the Nordic region, a former dependence on primary activities such as fishing, forestry, mining and/or agriculture has been superseded in recent decades by increasing involvement in the tourism sector. The purpose of this paper is to explore the potential

  9. Regional hydrological impacts of climate change: implications for water management in India

    Directory of Open Access Journals (Sweden)

    A. Mondal

    2015-04-01

    Full Text Available Climate change is most likely to introduce an additional stress to already stressed water systems in developing countries. Climate change is inherently linked with the hydrological cycle and is expected to cause significant alterations in regional water resources systems necessitating measures for adaptation and mitigation. Increasing temperatures, for example, are likely to change precipitation patterns resulting in alterations of regional water availability, evapotranspirative water demand of crops and vegetation, extremes of floods and droughts, and water quality. A comprehensive assessment of regional hydrological impacts of climate change is thus necessary. Global climate model simulations provide future projections of the climate system taking into consideration changes in external forcings, such as atmospheric carbon-dioxide and aerosols, especially those resulting from anthropogenic emissions. However, such simulations are typically run at a coarse scale, and are not equipped to reproduce regional hydrological processes. This paper summarizes recent research on the assessment of climate change impacts on regional hydrology, addressing the scale and physical processes mismatch issues. Particular attention is given to changes in water availability, irrigation demands and water quality. This paper also includes description of the methodologies developed to address uncertainties in the projections resulting from incomplete knowledge about future evolution of the human-induced emissions and from using multiple climate models. Approaches for investigating possible causes of historically observed changes in regional hydrological variables are also discussed. Illustrations of all the above-mentioned methods are provided for Indian regions with a view to specifically aiding water management in India.

  10. Innervation of periesophageal region of cat's diaphragm - Implication for studies of control of vomiting

    Science.gov (United States)

    Tan, L. K.; Miller, A. D.

    1986-01-01

    The extent of the region of the diaphragm around the esophagus that displays greatly reduced activity during the expulsive phase of vomiting was determined from electromyographic studies in cats to be about 0.75-1.0 cm from the esophagus. Horseradish peroxidase injected into this region retrogradely labeled motoneurons throughout most of the rostral-caudal extent of the phrenic nucleus, with the exception of caudal C6 and rostral C7. This widespread intermingling of motoneurons that innervate the region of reduced activity with other phrenic motoneurons creates a difficulty for needed follow-up studies of diaphragmatic control during vomiting.

  11. Modeling the Impact of Uganda's Safe Male Circumcision Program: Implications for Age and Regional Targeting.

    Science.gov (United States)

    Kripke, Katharine; Vazzano, Andrea; Kirungi, William; Musinguzi, Joshua; Opio, Alex; Ssempebwa, Rhobbinah; Nakawunde, Susan; Kyobutungi, Sheila; Akao, Juliet N; Magala, Fred; Mwidu, George; Castor, Delivette; Njeuhmeli, Emmanuel

    2016-01-01

    Uganda aims to provide safe male circumcision (SMC) to 80% of men ages 15-49 by 2016. To date, only 2 million men have received SMC of the 4.2 million men required. In response to age and regional trends in SMC uptake, the country sought to re-examine its targets with respect to age and subnational region, to assess the program's progress, and to refine the implementation approach. The Decision Makers' Program Planning Tool, Version 2.0 (DMPPT 2.0), was used in conjunction with incidence projections from the Spectrum/AIDS Impact Module (AIM) to conduct this analysis. Population, births, deaths, and HIV incidence and prevalence were used to populate the model. Baseline male circumcision prevalence was derived from the 2011 AIDS Indicator Survey. Uganda can achieve the most immediate impact on HIV incidence by circumcising men ages 20-34. This group will also require the fewest circumcisions for each HIV infection averted. Focusing on men ages 10-19 will offer the greatest impact over a 15-year period, while focusing on men ages 15-34 offers the most cost-effective strategy over the same period. A regional analysis showed little variation in cost-effectiveness of scaling up SMC across eight regions. Scale-up is cost-saving in all regions. There is geographic variability in program progress, highlighting two regions with low baseline rates of circumcision where additional efforts will be needed. Focusing SMC efforts on specific age groups and regions may help to accelerate Uganda's SMC program progress. Policy makers in Uganda have already used model outputs in planning efforts, proposing males ages 10-34 as a priority group for SMC in the 2014 application to the Global Fund's new funding model. As scale-up continues, the country should also consider a greater effort to expand SMC in regions with low MC prevalence.

  12. Modeling the Impact of Uganda's Safe Male Circumcision Program: Implications for Age and Regional Targeting.

    Directory of Open Access Journals (Sweden)

    Katharine Kripke

    Full Text Available Uganda aims to provide safe male circumcision (SMC to 80% of men ages 15-49 by 2016. To date, only 2 million men have received SMC of the 4.2 million men required. In response to age and regional trends in SMC uptake, the country sought to re-examine its targets with respect to age and subnational region, to assess the program's progress, and to refine the implementation approach.The Decision Makers' Program Planning Tool, Version 2.0 (DMPPT 2.0, was used in conjunction with incidence projections from the Spectrum/AIDS Impact Module (AIM to conduct this analysis. Population, births, deaths, and HIV incidence and prevalence were used to populate the model. Baseline male circumcision prevalence was derived from the 2011 AIDS Indicator Survey. Uganda can achieve the most immediate impact on HIV incidence by circumcising men ages 20-34. This group will also require the fewest circumcisions for each HIV infection averted. Focusing on men ages 10-19 will offer the greatest impact over a 15-year period, while focusing on men ages 15-34 offers the most cost-effective strategy over the same period. A regional analysis showed little variation in cost-effectiveness of scaling up SMC across eight regions. Scale-up is cost-saving in all regions. There is geographic variability in program progress, highlighting two regions with low baseline rates of circumcision where additional efforts will be needed.Focusing SMC efforts on specific age groups and regions may help to accelerate Uganda's SMC program progress. Policy makers in Uganda have already used model outputs in planning efforts, proposing males ages 10-34 as a priority group for SMC in the 2014 application to the Global Fund's new funding model. As scale-up continues, the country should also consider a greater effort to expand SMC in regions with low MC prevalence.

  13. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: rbeaton@virginia.edu [Department of Physics, New York University, New York, NY 10003 (United States)

    2014-08-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  14. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    International Nuclear Information System (INIS)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael

    2014-01-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  15. TADPOL: A 1.3 mm SURVEY OF DUST POLARIZATION IN STAR-FORMING CORES AND REGIONS

    International Nuclear Information System (INIS)

    Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article

  16. Climatic change and environmental implications in the Medicine Hat region using Billings, Montana as an analogue

    International Nuclear Information System (INIS)

    Proudfoot, W.A.

    1994-01-01

    There is concern that climatic change due to anthropogenic enhancement of the greenhouse effect may have considerable impacts on the natural and agricultural environments in Canada. The Palliser Triangle in the southern prairie region is an area in which the impacts of climatic change could be significant; it is an important agricultural zone and is already sensitive due to its semi-arid climate. The possible effects of a change in the climate of the Medicine Hat (Alberta) area in the Palliser Triangle is examined through the use of a regional analogue in a warmer, more southerly area. The selected analogue region is the area around Billings, Montana. Aspects of the natural environment, including potential vegetation distribution, frost-free period, and drought, as well as aspects of the agricultural environment, including agricultural practices and examination of wheat yields, are studied within each region. Comparisons are drawn between the two regions to evaluate whether significant differences exist in the environmental aspects examined. It is shown that although a change in Medicine Hat's climate to one more like that of Billings may not have drastic impacts on the environment, such a change may require adjustments in current practices or adaptations to altered environmental conditions. Reviews of several policy areas will be necessary to ensure appropriate adjustments in agricultural or resource management practices. Regional analogy is shown to be an essential preliminary tool for determining possible effects of climatic change. 138 refs., 42 figs., 22 tabs

  17. A trans-national monarch butterfly population model and implications for regional conservation priorities

    Science.gov (United States)

    Oberhauser, Karen; Wiederholt, Ruscena; Diffendorfer, James E.; Semmens, Darius J.; Ries, Leslie; Thogmartin, Wayne E.; Lopez-Hoffman, Laura; Semmens, Brice

    2017-01-01

    1. The monarch has undergone considerable population declines over the past decade, and the governments of Mexico, Canada, and the United States have agreed to work together to conserve the species.2. Given limited resources, understanding where to focus conservation action is key for widespread species like monarchs. To support planning for continental-scale monarch habitat restoration, we address the question of where restoration efforts are likely to have the largest impacts on monarch butterfly (Danaus plexippus Linn.) population growth rates.3. We present a spatially explicit demographic model simulating the multi-generational annual cycle of the eastern monarch population, and use the model to examine management scenarios, some of which focus on particular regions of North America.4. Improving the monarch habitat in the north central or southern parts of the monarch range yields a slightly greater increase in the population growth rate than restoration in other regions. However, combining restoration efforts across multiple regions yields population growth rates above 1 with smaller simulated improvements in habitat per region than single-region strategies.5. Synthesis and applications: These findings suggest that conservation investment in projects across the full monarch range will be more effective than focusing on one or a few regions, and will require international cooperation across many land use categories.

  18. DECONVOLUTION OF IMAGES FROM BLAST 2005: INSIGHT INTO THE K3-50 AND IC 5146 STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Roy, Arabindo; Netterfield, Calvin B.; Ade, Peter A. R.; Griffin, Matthew; Hargrave, Peter C.; Mauskopf, Philip; Bock, James J.; Brunt, Christopher M.; Chapin, Edward L.; Gibb, Andrew G.; Halpern, Mark; Marsden, Gaelen; Devlin, Mark J.; Dicker, Simon R.; Klein, Jeff; France, Kevin; Gundersen, Joshua O.; Hughes, David H.; Martin, Peter G.; Olmi, Luca

    2011-01-01

    We present an implementation of the iterative flux-conserving Lucy-Richardson (L-R) deconvolution method of image restoration for maps produced by the Balloon-borne Large Aperture Submillimeter Telescope (BLAST). Compared to the direct Fourier transform method of deconvolution, the L-R operation restores images with better-controlled background noise and increases source detectability. Intermediate iterated images are useful for studying extended diffuse structures, while the later iterations truly enhance point sources to near the designed diffraction limit of the telescope. The L-R method of deconvolution is efficient in resolving compact sources in crowded regions while simultaneously conserving their respective flux densities. We have analyzed its performance and convergence extensively through simulations and cross-correlations of the deconvolved images with available high-resolution maps. We present new science results from two BLAST surveys, in the Galactic regions K3-50 and IC 5146, further demonstrating the benefits of performing this deconvolution. We have resolved three clumps within a radius of 4.'5 inside the star-forming molecular cloud containing K3-50. Combining the well-resolved dust emission map with available multi-wavelength data, we have constrained the spectral energy distributions (SEDs) of five clumps to obtain masses (M), bolometric luminosities (L), and dust temperatures (T). The L-M diagram has been used as a diagnostic tool to estimate the evolutionary stages of the clumps. There are close relationships between dust continuum emission and both 21 cm radio continuum and 12 CO molecular line emission. The restored extended large-scale structures in the Northern Streamer of IC 5146 have a strong spatial correlation with both SCUBA and high-resolution extinction images. A dust temperature of 12 K has been obtained for the central filament. We report physical properties of ten compact sources, including six associated protostars, by fitting

  19. Unraveling the nexus between water and food security in Latin America and the Caribbean: regional and global implications

    Science.gov (United States)

    Willaarts, Barbara; Garrido, Alberto; Soriano, Barbara; De Stefano, Lucia; López Gunn, Elena; Aldaya, Maite; Martínez-Santos, Pedro; Llamas, Ramon

    2014-05-01

    Latin American and the Caribbean (LAC) is a water and land abundant region, and plays a key role in meeting global food and water security. During the last decade, LAC has experience a rapid socio-economic growth, largely sustained by its competitive advantage in the production and exports of agricultural and mining products and by the high commodity prices in the global market. This study seeks to quantify the contribution of LAC's agriculture to global food and water security, i.e. virtual water trade, and evaluate the environmental and societal implications for regional development. Results show that between 2000 and 2011, LAC has increase its agricultural production 27%, and it now accounts for nearly 18% of the global agricultural market. As a result, the agricultural water footprint (WF) of LAC was augmented 65%; and yet, nearly 19% to 44% of the actual agricultural WF - depending on the countries - is virtual water exported to third countries. In fact, almost 50% of the increase in global virtual water trade during the last decade, corresponds to LAC. Such global contribution has significant implications for regional water and food security. From an environmental perspective, crop expansion (mostly rain-fed) resulted in the deforestation of nearly 1 million km2, turning this region into the second most important deforestation hotspots worldwide. This land clearing is having large impacts of ecosystem services, e.g. carbon sequestration, water quality or biodiversity conservation. From a socio-economic perspective, increasing agricultural production has improved regional food security indicators, although one every seven children is still stunted in LAC and nearly 10% of the population remains undernourished. Dietary shifts and socio-cultural factors also lag behind the growing problem of malnutrition in the region, i.e. overweight and obesity. Improvements of water access and sanitation, have had a positive impact on food security indicators, especially

  20. Reliability and equivalence of alternate forms for the Symbol Digit Modalities Test: implications for multiple sclerosis clinical trials.

    Science.gov (United States)

    Benedict, Ralph H B; Smerbeck, Audrey; Parikh, Rajavi; Rodgers, Jonathan; Cadavid, Diego; Erlanger, David

    2012-09-01

    Cognitive impairment is common in multiple sclerosis (MS), but is seldom assessed in clinical trials investigating the effects of disease-modifying therapies. The Symbol Digit Modalities Test (SDMT) is a particularly promising tool due to its sensitivity and robust correlation with brain magnetic resonance imaging (MRI) and vocational disability. Unfortunately, there are no validated alternate SDMT forms, which are needed to mitigate practice effects. The aim of the study was to assess the reliability and equivalence of SDMT alternate forms. Twenty-five healthy participants completed each of five alternate versions of the SDMT - the standard form, two versions from the Rao Brief Repeatable Battery, and two forms specifically designed for this study. Order effects were controlled using a Latin-square research design. All five versions of the SDMT produced mean values within 3 raw score points of one another. Three forms were very consistent, and not different by conservative statistical tests. The SDMT test-retest reliability using these forms was good to excellent, with all r values exceeding 0.80. For the first time, we find good evidence that at least three alternate versions of the SDMT are of equivalent difficulty in healthy adults. The forms are reliable, and can be implemented in clinical trials emphasizing cognitive outcomes.

  1. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Esplin, T. L.; Luhman, K. L., E-mail: taran.esplin@psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States)

    2017-10-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K{sub s}, which should have masses as low as ∼4–5 M {sub Jup} according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M{sub Jup}).

  2. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    International Nuclear Information System (INIS)

    Luhman, K. L.; Mamajek, E. E.; Shukla, S. J.; Loutrel, N. P.

    2017-01-01

    Previous studies have found that ∼1 deg 2 fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg 2 ) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  3. The Tarantula Nebula as a template for extragalactic star forming regions from VLT/MUSE and HST/STIS

    Science.gov (United States)

    Crowther, Paul A.; Caballero-Nieves, Saida M.; Castro, Norberto; Evans, Christopher J.

    2017-11-01

    We present VLT/MUSE observations of NGC 2070, the dominant ionizing nebula of 30 Doradus in the LMC, plus HST/STIS spectroscopy of its central star cluster R136. Integral Field Spectroscopy (MUSE) and pseudo IFS (STIS) together provides a complete census of all massive stars within the central 30×30 parsec2 of the Tarantula. We discuss the integrated far-UV spectrum of R136, of particular interest for UV studies of young extragalactic star clusters. Strong He iiλ1640 emission at very early ages (1-2 Myr) from very massive stars cannot be reproduced by current population synthesis models, even those incorporating binary evolution and very massive stars. A nebular analysis of the integrated MUSE dataset implies an age of ~4.5 Myr for NGC 2070. Wolf-Rayet features provide alternative age diagnostics, with the primary contribution to the integrated Wolf-Rayet bumps arising from R140 rather than the more numerous H-rich WN stars in R136. Caution should be used when interpreting spatially extended observations of extragalactic star-forming regions.

  4. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory

    2009-01-01

    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  5. A structural model of the pore-forming region of the skeletal muscle ryanodine receptor (RyR1.

    Directory of Open Access Journals (Sweden)

    Srinivas Ramachandran

    2009-04-01

    Full Text Available Ryanodine receptors (RyRs are ion channels that regulate muscle contraction by releasing calcium ions from intracellular stores into the cytoplasm. Mutations in skeletal muscle RyR (RyR1 give rise to congenital diseases such as central core disease. The absence of high-resolution structures of RyR1 has limited our understanding of channel function and disease mechanisms at the molecular level. Here, we report a structural model of the pore-forming region of RyR1. Molecular dynamics simulations show high ion binding to putative pore residues D4899, E4900, D4938, and D4945, which are experimentally known to be critical for channel conductance and selectivity. We also observe preferential localization of Ca(2+ over K(+ in the selectivity filter of RyR1. Simulations of RyR1-D4899Q mutant show a loss of preference to Ca(2+ in the selectivity filter as seen experimentally. Electrophysiological experiments on a central core disease mutant, RyR1-G4898R, show constitutively open channels that conduct K(+ but not Ca(2+. Our simulations with G4898R likewise show a decrease in the preference of Ca(2+ over K(+ in the selectivity filter. Together, the computational and experimental results shed light on ion conductance and selectivity of RyR1 at an atomistic level.

  6. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    International Nuclear Information System (INIS)

    Esplin, T. L.; Luhman, K. L.

    2017-01-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K s , which should have masses as low as ∼4–5 M Jup according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M Jup ).

  7. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Mamajek, E. E. [Department of Physics and Astronomy, The University of Rochester, Rochester, NY 14627 (United States); Shukla, S. J. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Loutrel, N. P., E-mail: kluhman@astro.psu.edu [eXtreme Gravity Institute, Department of Physics, Montana State University, Bozeman, MT 59715 (United States)

    2017-01-01

    Previous studies have found that ∼1 deg{sup 2} fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg{sup 2}) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  8. Community-led local development approach principles implementation when forming a regional local development projects support system in Ukraine

    Directory of Open Access Journals (Sweden)

    Y. G. Udod

    2017-03-01

    Full Text Available The article contains a brief description of the Community-led local development approach (local development under the leadership of the community, CLLD and the main purpose of its use in the European Union. The study indicated periods of the major initiatives to support local development in EU. Moreover the article posted CLLD approach principles’ evolution and the basic principles of the LEADER method and its application in CLLD, which can be applied in Ukraine. Subject to the provisions of the European Economic and Social Committee (EESC for further CLLD-approach distribution the five trends were identified that must be considered when forming a Regional local development projects support system in Ukraine: Multi-fund financing; Unification; Networking and collaboration; Extending the approach; Simplifying the process. The characteristic of the present phase of CLLD-approach, in particular, of the European Network for Rural Development (ENRD, which attaches great importance to the dissemination of the most effective CLLD practices and establish partnerships between communities and territories where the approach is implemented. The study found out the relationship between Community-led local development and Community-driven development (CDD supported by the World Bank.

  9. Implications of Seismically Active Fault Structures in Ankay and Alaotra Regions of Northern and Central Madagascar

    Science.gov (United States)

    Malloy, S.; Stamps, D. S.

    2017-12-01

    The purpose of the study is to gain a better understanding of the seismically active fault structures in central and northern Madagascar. We study the Ankay and Lake Alaotra regions of Madagascar, which are segmented by multiple faults that strike N-S. In general, normal seismic events occur on faults bounding the Alaotra-Ankay rift basin where Quaternary alluvium is present. Due to this pattern and moderate amounts of low magnitude seismic activity along these faults, it is hypothesized the region currently undergoes E-W extension. In this work we test how variations in fault strength and net slip changes influence expected crustal movement in the region. Using the Coulomb stress failure point as a test of strength we are able to model the Alaotra-Ankay region using MATLAB Coulomb 3.3.01. This program allows us to define realistic Poisson's ratio and Young's modulus of mapped rock compositions in the region, i.e. paragneiss and orthogneiss, create 3D fault geometries, and calculate static stress changes with coinciding surface displacements. We impose slip along multiple faults and calculate seismic moment that we balance by the 3 observed earthquake magnitudes available in the USGS CMT database. Our calculations of surface displacements indicate 1-3 millimeters could be observed across the Alaotra-Ankay rift. These values are within the observable range of precision GNSS observations, therefore our results will guide future research into the area and direct potential GNSS station installation.

  10. Holocene sediment distribution on the inner continental shelf of northeastern South Carolina: implications for the regional sediment budget and long-term shoreline response

    Science.gov (United States)

    Denny, Jane F.; Schwab, William C.; Baldwin, Wayne E.; Barnhardt, Walter A.; Gayes, Paul T.; Morton, R.A.; Warner, John C.; Driscoll, Neal W.; Voulgaris, George

    2013-01-01

    High-resolution geophysical and sediment sampling surveys were conducted offshore of the Grand Strand, South Carolina to define the shallow geologic framework of the inner shelf. Results are used to identify and map Holocene sediment deposits, infer sediment transport pathways, and discuss implications for the regional coastal sediment budget. The thickest deposits of Holocene sediment observed on the inner shelf form shoal complexes composed of moderately sorted fine sand, which are primarily located offshore of modern tidal inlets. These shoal deposits contain ~67 M m3 of sediment, approximately 96% of Holocene sediment stored on the inner shelf. Due to the lack of any significant modern fluvial input of sand to the region, the Holocene deposits are likely derived from reworking of relict Pleistocene and older inner-shelf deposits during the Holocene marine transgression. The Holocene sediments are concentrated in the southern part of the study area, due to a combination of ancestral drainage patterns, a regional shift in sediment supply from the northeast to the southwest in the late Pleistocene, and proximity to modern inlet systems. Where sediment is limited, only small, low relief ridges have formed and Pleistocene and older deposits are exposed on the seafloor. The low-relief ridges are likely the result of a thin, mobile veneer of sediment being transported across an irregular, erosional surface formed during the last transgression. Sediment textural trends and seafloor morphology indicate a long-term net transport of sediment to the southwest. This is supported by oceanographic studies that suggest the long-term sediment transport direction is controlled by the frequency and intensity of storms that pass through the region, where low pressure systems yield net along-shore flow to the southwest and a weak onshore component. Current sediment budget estimates for the Grand Strand yield a deficit for the region. Volume calculations of Holocene deposits on the

  11. Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

    NARCIS (Netherlands)

    van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

    Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with

  12. Historical Determinants of Regional Divisions of Georgia and their Implications for Territorial Governance

    Directory of Open Access Journals (Sweden)

    Mądry Cezary

    2016-06-01

    Full Text Available Georgia can be characterised by its turbulent history, centuries-old traditions, and a great ethnic diversity. This makes it necessary to include historical determinants, in addition to geopolitical and economic factors, when making a regional analysis of its territory and contemporary governance issues. Five stages of the development of the present territorial division of Georgia are distinguished. They have been identified by means of an analysis of key events (critical junctures of significance in the formation of its historical regions. Additionally, their influence at each of the three levels of the current territorial division of independent Georgia is discussed, in particular in the context of territorial governance.

  13. Dead regions in the cochlea: Implications for speech recognition and applicability of articulation index theory

    DEFF Research Database (Denmark)

    Vestergaard, Martin David

    2003-01-01

    Dead regions in the cochlea have been suggested to be responsible for failure by hearing aid users to benefit front apparently increased audibility in terms of speech intelligibility. As an alternative to the more cumbersome psychoacoustic tuning curve measurement, threshold-equalizing noise (TEN...

  14. Implications of Boy Scout group use of public lands for natural resource managers: a regional comparison

    Science.gov (United States)

    Gail A. Vander Stoep

    1992-01-01

    Resource managers can apply group-specific rather than generic communications and management strategies to different public land user groups. This study compares use patterns of one user group, Boy Scout troops, from two regions of the United States. It identifies their public land use patterns, activities, needs, and motivations. Results can be used by resource...

  15. ESA STSE “SST Diurnal Variability: Regional Extend - Implications in Atmospheric Modelling”

    DEFF Research Database (Denmark)

    Karagali, Ioanna

    The diurnal variability of SST, driven by the coincident occurrence of low enough wind and solar heating, has been observed in various regions of the global ocean [4, 5, 6]. Atmospheric, oceanic and climate models are not adequately resolving the daily SST cycle, resulting in biases of the total...

  16. The 1950-1998 warm ENSO events and regional implications to ...

    African Journals Online (AJOL)

    1998 seasonal El Niño/Southern Oscillation (ENSO) is investigated in 502 rivers gauged in 9 countries of the Southern African region. We found some evidence of possible links between available surface water resources in terms of mean annual ...

  17. Water balances of two Piedmont headwater catchments: implications for regional hydrologic landscape classification

    Science.gov (United States)

    C. Dreps; G. Sun; J. Boggs

    2014-01-01

    In the Piedmont of North Carolina, a traditionally water-rich region, reservoirs that serve over 1 million people are under increasing pressure due to naturally occurring droughts and increasing land development. Innovative development approaches aim to maintain hydrologic conditions of the undisturbed landscape, but are based on insufficient target information. This...

  18. Implications of global climate change on water resources of the south Asian region

    International Nuclear Information System (INIS)

    Lal, M.

    1994-01-01

    An assessment of future changes in the mean and/or variances of hydrological parameters due to anthropogenic increases in greenhouse gases is much warranted for south Asia for developing adaptive response strategies. The evolution of changes in surface meteorological as well as hydrological parameters in the transient numerical experiments with the current state-of-art coupled climate models holds much promise for a better understanding of the interannual variability of climate and its change on a regional scale. A plausible future hydrological scenario for the south Asian region based on the numerical results obtained from the reference control and greenhouse warming simulations (using the Business-as-Usual scenario of CO 2 concentration in the atmosphere) with the Hamburg climate model is presented in this paper. For validation of regional-scale model-simulated hydrology and the assessment of future changes, analysis of data has been performed for annual mean conditions as well as for two seasons, namely, winter (December to February) and summer (June to August). Their results suggest a rise in annual mean surface air temperature of about 1.0 to 2.5 C over the ocean and between 2.0 to 4.5 C over the land regions of south Asia during the next hundred years. During the NH-winter, surface warming in the land regions of India and China is considerably higher (3.6 C) than during the NH-summer (2.7 C). The model simulates an increase in total (averaged for land points over the study area) annual precipitation of about 16 cm per year in a warmer atmosphere

  19. Characterization of crystalline rocks in the Lake Superior region, USA: implications for nuclear waste isolation

    International Nuclear Information System (INIS)

    Sood, M.K.; Flower, M.F.J.; Edgar, D.E.

    1984-01-01

    The Lake Superior region (Wisconsin, the Upper Peninsula of Michigan, and Minnesota) contains 41 Precambrian crystalline rock complexes comprising 64 individual but related rock bodies with known surface exposures. Each complex has a map area greater than 78 km 2 . About 54% of the rock complexes have areas of up to 500 km 2 , 15% fall between 500 km 2 and 1000 km 2 , 19% lie between 1000 km 2 and 2500 km 2 , and 12% are over 2500 km 2 . Crystalline rocks of the region vary widely in composition, but they are predominantly granitic. Repeated thermo-tectonic events have produced early Archean gneisses, migmatites, and amphibolites with highly tectonized fabrics that impart a heterogeneous and anisotropic character to the rocks. Late Archean rocks are usually but not invariably gneissose and migmatitic. Proterozoic rocks of the region include synorogenic (foliated) granitic rocks, anorogenic (non-foliated) granites, and the layered gabbro-anorthosite-troctolite intrusives of the rift-related Keweenawan igneous activity. Compared with the Archean rocks of the region, the Proterozoic bodies generally lack highly tectonized fabrics and have more definable contacts where visible. Anorogenic intrusions are relatively homogeneous and isotropic. On the basis of observed geologic characteristics, postorogenic and anorogenic crystalline rock bodies located away from recognized tectonic systems have attributes that make them relatively more desirable as a possible site for a nuclear waste repository in the region. This study was conducted at Argonne National Laboratory under the sponsorship of the US Department of Energy through the Office of Crystalline Repository Development at Battelle Memorial Institute, Columbus, Ohio. 84 references, 4 figures, 3 tables

  20. Characterization of crystalline rocks in the Lake Superior region, USA: implications for nuclear waste isolation

    International Nuclear Information System (INIS)

    Sood, M.K.; Edgar, D.E.; Flower, M.F.J.

    1984-01-01

    The Lake Superior region (Wisconsin, the Upper Peninsula of Michigan, and Minnesota) contains 41 Precambrian crystalline (medium- to coarse-grained igneous and high-grade metamorphic) rock complexes comprising 64 individual but related rock bodies with known surface exposures. Each complex has a map area greater than 78 km 2 . About 54% of the rock complexes have areas of up to 500 km 2 , 15% fall between 500 km 2 and 1000 km 2 , 19% lie between 1000 km 2 and 2500 km 2 , and 12% are over 2500 km 2 . Crystalline rocks of the region vary widely in composition, but they are predominantly granitic. Repeated thermo-tectonic events have produced early Archean gneisses, migmatites, and amphibolites with highly tectonized fabrics that impart a heterogeneous and anisotropic character to the rocks. Late Archean rocks are usually but not invariably gneissose an migmatitic. Proterozoic rocks of the region include synorogenic (foliated) granitic rocks, anorogenic (nonfoliated) granites, and the layered gabbro-anorthosite-troctolite intrusives of the rift-related Keweenawan igneous activity. Compared with the Archean rocks of the region, the Proterozoic bodies generally lack highly tectonized fabrics and have more definable contacts where visible. Anorogenic intrusions are relatively homogeneous and isotropic. On the basis of observed geologic characteristics, postorogenic and anorogenic crystalline rock bodies located away from recognized tectonic systems have attributes that make them relatively more desirable as a possible site for a nuclear waste repository in the region. This study was conducted at Argonne National Laboratory under the sponsorship of the US Department of Energy through the Office of Crystalline Repository Development at Battelle Memorial Institute, Columbus, Ohio

  1. THE MASSIVE STAR-FORMING REGION CYGNUS OB2. II. INTEGRATED STELLAR PROPERTIES AND THE STAR FORMATION HISTORY

    International Nuclear Information System (INIS)

    Wright, N. J.; Drake, J. J.; Drew, J. E.; Vink, J. S.

    2010-01-01

    Cygnus OB2 is the nearest example of a massive star-forming region (SFR), containing over 50 O-type stars and hundreds of B-type stars. We have analyzed the properties of young stars in two fields in Cyg OB2 using the recently published deep catalog of Chandra X-ray point sources with complementary optical and near-IR photometry. Our sample is complete to ∼1 M sun (excluding A- and B-type stars that do not emit X-rays), making this the deepest study of the stellar properties and star formation history in Cyg OB2 to date. From Siess et al. isochrone fits to the near-IR color-magnitude diagram, we derive ages of 3.5 +0.75 -1.0 and 5.25 +1.5 -1.0 Myr for sources in the two fields, both with considerable spreads around the pre-main-sequence isochrones. The presence of a stellar population somewhat older than the present-day O-type stars, also fits in with the low fraction of sources with inner circumstellar disks (as traced by the K-band excess) that we find to be very low, but appropriate for a population of age ∼5 Myr. We also find that the region lacks a population of highly embedded sources that is often observed in young SFRs, suggesting star formation in the vicinity has declined. We measure the stellar mass functions (MFs) in this limit and find a power-law slope of Γ = -1.09 ± 0.13, in good agreement with the global mean value estimated by Kroupa. A steepening of the slope at higher masses is observed and suggested as due to the presence of the previous generation of stars that have lost their most massive members. Finally, combining our MF and an estimate of the radial density profile of the association suggests a total mass of Cyg OB2 of ∼3 x 10 4 M sun , similar to that of many of our Galaxy's most massive SFRs.

  2. A model of characteristic earthquakes and its implications for regional seismicity

    DEFF Research Database (Denmark)

    López-Ruiz, R.; Vázquez-Prada, M.; Pacheco, A.F.

    2004-01-01

    Regional seismicity (i.e. that averaged over large enough areas over long enough periods of time) has a size-frequency relationship, the Gutenberg-Richter law, which differs from that found for some seismic faults, the Characteristic Earthquake relationship. But all seismicity comes in the end from...... active faults, so the question arises of how one seismicity pattern could emerge from the other. The recently introduced Minimalist Model of Vázquez-Prada et al. of characteristic earthquakes provides a simple representation of the seismicity originating from a single fault. Here, we show...... that a Characteristic Earthquake relationship together with a fractal distribution of fault lengths can accurately describe the total seismicity produced in a region. The resulting earthquake catalogue accounts for the addition of both all the characteristic and all the non-characteristic events triggered in the faults...

  3. The transport implications of regional policies for the disposal of intermediate level radioactive wastes

    International Nuclear Information System (INIS)

    James, I.A.

    1985-09-01

    This report aims to evaluate transport parameters and logistics associated with the disposal of intermediate-level radioactive wastes, as generated by CEGB, SSEB, UKAEA and BNFL. The assumed power scenario is DoE Scheme 3, which approximates to a moderate power generation scenario, with a 15 GWe PWR programme commissioned between 1991 and 2010, existing Magnox and AGR stations are assumed to have a 30 year lifespan. Three transport options are again assumed, namely; road, rail and a hybrid system, as is consistent with previous studies. These three options will be used in investigating regional policies of disposal, initially at the national level and then progressively disaggregating to a system of three regional depositories serving their respective catchment areas. (author)

  4. Patient Cross-Border Mobility: New Findings and Implications in Spanish Regions

    Directory of Open Access Journals (Sweden)

    Carla Blázquez-Fernández

    2017-06-01

    Full Text Available Spain has a National Health Service with a mixed public-private funded system. In the last decades, a huge effort has gone into reducing barriers to patient migration. We estimate a panel data based on a gravity model of migration since the process of health care decentralization has been completed in Spain. Our empirical results show that income is one of the most important drivers in explaining mobility as well as supply variables. Individual characteristics are not among the main factors for mobility. Besides, it is demonstrated there is a quality-driven mobility in Spain. However, there was no significant difference in the influence on patients’ mobility between those living in the North of the country and the Mediterranean regions. The empirical results also suggest that current regional health policies in Spain, that explain patients’ mobility, should be associated with greater funding system.

  5. Integrated regional changes in arctic climate feedbacks: Implications for the global climate system

    Science.gov (United States)

    McGuire, A.D.; Chapin, F. S.; Walsh, J.E.; Wirth, C.; ,

    2006-01-01

    The Arctic is a key part of the global climate system because the net positive energy input to the tropics must ultimately be resolved through substantial energy losses in high-latitude regions. The Arctic influences the global climate system through both positive and negative feedbacks that involve physical, ecological, and human systems of the Arctic. The balance of evidence suggests that positive feedbacks to global warming will likely dominate in the Arctic during the next 50 to 100 years. However, the negative feedbacks associated with changing the freshwater balance of the Arctic Ocean might abruptly launch the planet into another glacial period on longer timescales. In light of uncertainties and the vulnerabilities of the climate system to responses in the Arctic, it is important that we improve our understanding of how integrated regional changes in the Arctic will likely influence the evolution of the global climate system. Copyright ?? 2006 by Annual Reviews. All rights reserved.

  6. Structural Heterogeneities in Southeast Tibet: Implications for Regional Flow in the Lower Crust and Upper Mantle

    Directory of Open Access Journals (Sweden)

    Zhi Wang

    2012-01-01

    Full Text Available Our seismic study together with the MT analysis reveal a “R-shape” flow existing in both the lower crust and uppermost mantle, which suggests the crustal deformation along the deep, large sutures (such as the Longmen Shan fault and the Anninghe Fault under the southeastern Tibetan Plateau is maintained by dynamic pressure from the regional flow intermingled with the hot upwelling asthenosphere. The material in the lower crust and uppermost mantle flowing outward from the center of the plateau is buttressed by the old, strong lithosphere that underlies the Sichuan basin, pushing up on the crust above and maintaining steep orogenic belt through dynamic pressure. We therefore consider that the “R-shape” regional flow played a key role in the crustal deformation along the deep suture zones of the Bangong-Nujiang, the Longmen-Shan faults, and other local heavily faulted zones beneath the southeastern Tibetan Plateau.

  7. STAR-FORMING ACTIVITY IN THE H ii REGIONS ASSOCIATED WITH THE IRAS 17160–3707 COMPLEX

    Energy Technology Data Exchange (ETDEWEB)

    Nandakumar, G.; Veena, V. S.; Vig, S.; Tej, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695 547 (India); Ghosh, S. K.; Ojha, D. K. [Tata Institute of Fundamental Research, Mumbai (Bombay) 400 005 (India)

    2016-11-01

    We present a multiwavelength investigation of star formation activity toward the southern H ii regions associated with IRAS 17160–3707, located at a distance of 6.2 kpc with a bolometric luminosity of 8.3 × 10{sup 5} L {sub ⊙}. The ionized gas distribution and dust clumps in the parental molecular cloud are examined in detail using measurements at infrared, submillimeter and radio wavelengths. The radio continuum images at 1280 and 610 MHz obtained using the Giant Metrewave Radio Telescope reveal the presence of multiple compact sources as well as nebulous emission. At submillimeter wavelengths, we identify seven dust clumps and estimate their physical properties such as temperature: 24–30 K, mass: 300–4800 M {sub ⊙} and luminosity: 9–317 × 10{sup 2} L {sub ⊙} using modified blackbody fits to the spectral energy distributions (SEDs) between 70 and 870 μ m. We find 24 young stellar objects (YSOs) in the mid-infrared, with a few of them coincident with the compact radio sources. The SEDs of the YSOs have been fitted by the Robitaille models and the results indicate that those having radio compact sources as counterparts host massive objects in early evolutionary stages with best fit age ≤0.2 Myr. We compare the relative evolutionary stages of clumps using various signposts such as masers, ionized gas, presence of YSOs and infrared nebulosity, and find six massive star-forming clumps and one quiescent clump. Of the former, five are in a relatively advanced stage and one in an earlier stage.

  8. WEAK AND COMPACT RADIO EMISSION IN EARLY HIGH-MASS STAR-FORMING REGIONS. I. VLA OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Rosero, V.; Hofner, P. [Physics Department, New Mexico Tech, 801 Leroy Pl., Socorro, NM 87801 (United States); Claussen, M. [National Radio Astronomy Observatory, 1003 Lopezville Rd., Socorro, NM 87801 (United States); Kurtz, S.; Carrasco-González, C.; Rodríguez, L. F.; Loinard, L. [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, Morelia 58090, México (Mexico); Cesaroni, R. [INAF, Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy); Araya, E. D. [Physics Department, Western Illinois University, 1 University Circle, Macomb, IL 61455 (United States); Menten, K. M.; Wyrowski, F. [Max-Planck-Institute für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Ellingsen, S. P. [School of Physical Sciences, University of Tasmania, Private Bag 37, Hobart, Tasmania 7001 (Australia)

    2016-12-01

    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sources associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.

  9. Asymmetric Power Balance and Its Implications for Regionalism in South Asia

    Science.gov (United States)

    2015-03-01

    constitutes an ideal grouping for economic integration.16 The political dimensions are mainly overshadowed with security concerns among member states...United States’ to the North American Free Trade Agreement ( NAFTA ).39 The region’s geo-politics strongly suggest that India is the best candidate for...dynamics in South Asia. Many scholars have put forth their view on what constitutes regional cooperation and integration. E.B. Haas defines the

  10. Central Asia: Regional Developments and Implications for U.S. Interests

    Science.gov (United States)

    2012-09-19

    the Trilateral Cooperation at the Former Semipalatinsk Test Site , March 26, 2012. 13 U.S. Senate, Committee on Foreign Relations, Subcommittee on...former Semipalatinsk Test Site in East Kazakhstan Region.127 Kazakhstan and Uzbekistan hosted major chemical and biological warfare (CBW) facilities...Uzbekistan’s Nukus chemical weapons research facility. CTR aid also was used to eliminate active anthrax spores at a former CBW test site on an island in

  11. Signal displacement in spiral-in acquisitions: simulations and implications for imaging in SFG regions.

    Science.gov (United States)

    Brewer, Kimberly D; Rioux, James A; Klassen, Martyn; Bowen, Chris V; Beyea, Steven D

    2012-07-01

    Susceptibility field gradients (SFGs) cause problems for functional magnetic resonance imaging (fMRI) in regions like the orbital frontal lobes, leading to signal loss and image artifacts (signal displacement and "pile-up"). Pulse sequences with spiral-in k-space trajectories are often used when acquiring fMRI in SFG regions such as inferior/medial temporal cortex because it is believed that they have improved signal recovery and decreased signal displacement properties. Previously postulated theories explain differing reasons why spiral-in appears to perform better than spiral-out; however it is clear that multiple mechanisms are occurring in parallel. This study explores differences in spiral-in and spiral-out images using human and phantom empirical data, as well as simulations consistent with the phantom model. Using image simulations, the displacement of signal was characterized using point spread functions (PSFs) and target maps, the latter of which are conceptually inverse PSFs describing which spatial locations contribute signal to a particular voxel. The magnitude of both PSFs and target maps was found to be identical for spiral-out and spiral-in acquisitions, with signal in target maps being displaced from distant regions in both cases. However, differences in the phase of the signal displacement patterns that consequently lead to changes in the intervoxel phase coherence were found to be a significant mechanism explaining differences between the spiral sequences. The results demonstrate that spiral-in trajectories do preserve more total signal in SFG regions than spiral-out; however, spiral-in does not in fact exhibit decreased signal displacement. Given that this signal can be displaced by significant distances, its recovery may not be preferable for all fMRI applications. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Vegetation-induced turbulence influencing evapotranspiration-soil moisture coupling: Implications for semiarid regions

    Science.gov (United States)

    Haghighi, E.; Kirchner, J. W.; Entekhabi, D.

    2016-12-01

    The relationship between soil moisture and evapotranspiration (ET) fluxes is an important component of land-atmosphere interactions controlling hydrology-climate feedback processes. Important as this relationship is, it remains empirical and physical mechanisms governing its dynamics are insufficiently studied. This is particularly of importance for semiarid regions (currently comprising about half of the Earth's land surface) where the shallow surface soil layer is the primary source of ET and direct evaporation from bare soil is likely a large component of the total flux. Hence, ET-soil moisture coupling in these regions is hypothesized to be strongly influenced by soil evaporation and associated mechanisms. Motivated by recent progress in mechanistic modeling of localized heat and mass exchange rates from bare soil surfaces covered by cylindrical bluff-body elements, we developed a physically based ET model explicitly incorporating coupled impacts of soil moisture and vegetation-induced turbulence in the near-surface region. Model predictions of ET and its partitioning were in good agreement with measured data and suggest that the strength and nature of ET-soil moisture interactions in sparsely vegetated areas are strongly influenced by aerodynamic (rather than radiative) forcing namely wind speed and near-surface turbulence generation as a function of vegetation type and cover fraction. The results demonstrated that the relationship between ET and soil moisture varies from a nonlinear function (the dual regime behavior) to a single moisture-limited regime (linear relationship) by increasing wind velocity and enhancing turbulence generation in the near-surface region (small-scale woody vegetation species of low cover fraction). Potential benefits of this study for improving accuracy and predictive capabilities of remote sensing techniques when applied to semiarid environments will also be discussed.

  13. VOCs and OVOCs distribution and control policy implications in Pearl River Delta region, China

    Science.gov (United States)

    Louie, Peter K. K.; Ho, Josephine W. K.; Tsang, Roy C. W.; Blake, Donald R.; Lau, Alexis K. H.; Yu, Jian Zhen; Yuan, Zibing; Wang, Xinming; Shao, Min; Zhong, Liuju

    2013-09-01

    Ambient air measurements of volatile organic compounds (VOCs) and oxygenated volatile organic compounds (OVOCs) were conducted and characterised during a two-year grid study in the Pearl River Delta (PRD) region of southern China. The present grid study pioneered the systematic investigation of the nature and characteristics of complex VOC and OVOC sources at a regional scale. The largest contributing VOCs, accounting over 80% of the total VOCs mixing ratio, were toluene, ethane, ethyne, propane, ethene, butane, benzene, pentane, ethylbenzene, and xylenes. Sub-regional VOC spatial characteristics were identified, namely: i) relatively fresh pollutants, consistent with elevated vehicular and industrial activities, around the PRD estuary; and ii) a concentration gradient with higher mixing ratios of VOCs in the west as compared with the eastern part of PRD. Based on alkyl nitrate aging determination, a high hydroxyl radical (OH) concentration favoured fast hydrocarbon reactions and formation of locally produced ozone. The photochemical reactivity analysis showed aromatic hydrocarbons and alkenes together consisted of around 80% of the ozone formation potential (OFP) among the key VOCs. We also found that the OFP from OVOCs should not be neglected since their OFP contribution was more than one-third of that from VOCs alone. These findings support the choice of current air pollution control policy which focuses on vehicular sources but warrants further controls. Industrial emissions and VOCs emitted by solvents should be the next targets for ground-level ozone abatement.

  14. Modeling a clean energy standard for electricity: Policy design implications for emissions, supply, prices, and regions

    International Nuclear Information System (INIS)

    Paul, Anthony; Palmer, Karen; Woerman, Matt

    2013-01-01

    The electricity sector is responsible for roughly 40% of U.S. carbon dioxide (CO 2 ) emissions, and a reduction in CO 2 emissions from electricity generation is an important component of the U.S. strategy to reduce greenhouse gas emissions. Toward that goal, several proposals for a clean energy standard (CES) have been put forth, including one espoused by the Obama administration that calls for 80% clean electricity by 2035 phased in from current levels of roughly 40%. This paper looks at the effects of such a policy on CO 2 emissions from the electricity sector, the mix of technologies used to supply electricity, electricity prices, and regional flows of clean energy credits. The CES leads to a 30% reduction in cumulative CO 2 emissions between 2013 and 2035 and results in dramatic reductions in generation from conventional coal. The policy also results in fairly modest increases on national electricity prices, but this masks a wide variety of effects across regions. - Highlights: ► We model a clean energy standard (CES) for electricity at 80% by 2035. ► We analyze effects on CO 2 emissions, investment, prices, and credit trading. ► 80% CES leads to 30% reduction in cumulative CO 2 emissions by 2035. ► Modest national average electricity price increase masks regional heterogeneity

  15. Implications of the cattle trade network in Cameroon for regional disease prevention and control

    Science.gov (United States)

    Motta, Paolo; Porphyre, Thibaud; Handel, Ian; Hamman, Saidou M.; Ngu Ngwa, Victor; Tanya, Vincent; Morgan, Kenton; Christley, Rob; Bronsvoort, Barend M. Dec.

    2017-03-01

    Movement of live animals is a major risk factor for the spread of livestock diseases and zoonotic infections. Understanding contact patterns is key to informing cost-effective surveillance and control strategies. In West and Central Africa some of the most rapid urbanization globally is expected to increase the demand for animal-source foods and the need for safer and more efficient animal production. Livestock trading points represent a strategic contact node in the dissemination of multiple pathogens. From October 2014 to May 2015 official transaction records were collected and a questionnaire-based survey was carried out in cattle markets throughout Western and Central-Northern Cameroon. The data were used to analyse the cattle trade network including a total of 127 livestock markets within Cameroon and five neighboring countries. This study explores for the first time the influence of animal trade on infectious disease spread in the region. The investigations showed that national borders do not present a barrier against pathogen dissemination and that non-neighbouring countries are epidemiologically connected, highlighting the importance of a regional approach to disease surveillance, prevention and control. Furthermore, these findings provide evidence for the benefit of strategic risk-based approaches for disease monitoring, surveillance and control, as well as for communication and training purposes through targeting key regions, highly connected livestock markets and central trading links.

  16. Progress in the Use of Rapid Molecular Techniques to Detect Life Forms in Soil: Implications for Interplanetary Astrobiology Missions

    Science.gov (United States)

    Warmflash, D.; Larios-Sanz, M.; Fox, G. E.; McKay, D. S.

    2002-01-01

    To demonstrate the feasibility of two promising technologies, we have applied Enzyme-Linked Immunosorbent Assay (ELISA) as well as probes that target the 16S rRNA molecule to search for life in terrestrial soil samples, known to contain numerous life forms. Additional information is contained in the original extended abstract.

  17. Geodynamic models assist in determining the South Loyalty Basin's slab location and its implications for regional topography

    Science.gov (United States)

    Clark, Stuart R.

    2010-05-01

    In the Western Pacific, two competing kinematic reconstructions exist: one with wholly westward subduction of the Pacific plate at what is now the Tonga-Kermadec trench and one combining a degree of eastward subduction under what has been termed the New Caledonia trench. New seismological observations indicate that eastward subduction could explain the existence of a fast anomaly, the hyothesised South Loyalty Basin slab, below the 660km transition zone distinct from the fast anomaly aligned with the Tonga-Kermadec slab. A plate reconstruction dated from the suggested initiation of New Caledonia subduction in the Eocene has been developed. This reconstruction is then used to predict the thermal history of the region and together provide kinematic and thermal boundary conditions for a regional mantle convection model. The model-predicted location of the South Loyalty Basin slab's location will be presented along with the location's dependence on the mantle rheological parameters and the hotspot reference frame. The implications for the topography of the region will also be discussed.

  18. Regional flood reconstruction in Kullu District (Himachal Pradesh, India): implication for Disaster Risk Management

    Science.gov (United States)

    Ballesteros-Cánovas, Juan Antonio; Stoffel, Markus; Trappmann, Daniel; Shekhar, Mayank; Bhattacharyya, Amalava

    2016-04-01

    Floods are a common natural hazard in the Western Indian Himalayas. They usually occur when humid monsoon airs are lifted along the Himalayan relief, thereby creating intense orographic rainfall and runoff, a process which is often enhanced by simultaneous snowmelt. Monsoon floods are considered a major threat in the region and frequently affect inhabited valleys, disturbing the status quo of communities, stressing the future welfare and condition of their economic development. Given the assumption that ongoing and future climatic changes may impact on monsoon patterns and extreme precipitation, the implementation of adaptation policies in this region is critically needed in order to improve local resilience of Himalayan communities. However, its success implementation is highly dependent on system knowledge and hence reliable baseline data of past disasters. In this communication, we demonstrate how newly gained knowledge on past flood incidents may improve flood hazard and risk assessments. Based on growth-ring analysis of trees growing in the floodplains and other, more classical paleo-hydrology techniques, we reconstruct the regional flood activity for the last decades. This information is then included as non-systematic data into the regional flood frequency by using Bayesian Markov Monte Carlo Chain algorithms, so as to analyse the impact of the additional data on flood hazard assessments. Moreover, through a detailed analysis of three flood risk hotspots, we demonstrate how the newly gained knowledge on past flood disasters derived from indirect proxies can explain failures in the implementation of disaster risk management (DRM). Our methodology allowed identification of thirty-four unrecorded flood events at the study sites located in the upper reaches since the early 20th century, and thus completion of the existing flood history in the region based on flow measurements in the lower part of the catchment. We observe that 56% of the floods occurred

  19. Regional Distribution Shifts Help Explain Local Changes in Wintering Raptor Abundance: Implications for Interpreting Population Trends

    Science.gov (United States)

    Paprocki, Neil; Heath, Julie A.; Novak, Stephen J.

    2014-01-01

    Studies of multiple taxa across broad-scales suggest that species distributions are shifting poleward in response to global climate change. Recognizing the influence of distribution shifts on population indices will be an important part of interpreting trends within management units because current practice often assumes that changes in local populations reflect local habitat conditions. However, the individual- and population-level processes that drive distribution shifts may occur across a large, regional scale and have little to do with the habitats within the management unit. We examined the latitudinal center of abundance for the winter distributions of six western North America raptor species using Christmas Bird Counts from 1975–2011. Also, we considered whether population indices within western North America Bird Conservation Regions (BCRs) were explained by distribution shifts. All six raptors had significant poleward shifts in their wintering distributions over time. Rough-legged Hawks (Buteo lagopus) and Golden Eagles (Aquila chrysaetos) showed the fastest rate of change, with 8.41 km yr−1 and 7.74 km yr−1 shifts, respectively. Raptors may be particularly responsive to warming winters because of variable migration tendencies, intraspecific competition for nesting sites that drives males to winter farther north, or both. Overall, 40% of BCR population trend models were improved by incorporating information about wintering distributions; however, support for the effect of distribution on BCR indices varied by species with Rough-legged Hawks showing the most evidence. These results emphasize the importance of understanding how regional distribution shifts influence local-scale population indices. If global climate change is altering distribution patterns, then trends within some management units may not reflect changes in local habitat conditions. The methods used to monitor and manage bird populations within local BCRs will fundamentally change as

  20. Global and regional phosphorus budgets in agricultural systems and their implications for phosphorus-use efficiency

    Directory of Open Access Journals (Sweden)

    F. Lun

    2018-01-01

    Full Text Available The application of phosphorus (P fertilizer to agricultural soils increased by 3.2 % annually from 2002 to 2010. We quantified in detail the P inputs and outputs of cropland and pasture and the P fluxes through human and livestock consumers of agricultural products on global, regional, and national scales from 2002 to 2010. Globally, half of the total P inputs into agricultural systems accumulated in agricultural soils during this period, with the rest lost to bodies of water through complex flows. Global P accumulation in agricultural soil increased from 2002 to 2010 despite decreases in 2008 and 2009, and the P accumulation occurred primarily in cropland. Despite the global increase in soil P, 32 % of the world's cropland and 43 % of the pasture had soil P deficits. Increasing soil P deficits were found for African cropland vs. increasing P accumulation in eastern Asia. European and North American pasture had a soil P deficit because the continuous removal of biomass P by grazing exceeded P inputs. International trade played a significant role in P redistribution among countries through the flows of P in fertilizer and food among countries. Based on country-scale budgets and trends we propose policy options to potentially mitigate regional P imbalances in agricultural soils, particularly by optimizing the use of phosphate fertilizer and the recycling of waste P. The trend of the increasing consumption of livestock products will require more P inputs to the agricultural system, implying a low P-use efficiency and aggravating P-stock scarcity in the future. The global and regional phosphorus budgets and their PUEs in agricultural systems are publicly available at https://doi.pangaea.de/10.1594/PANGAEA.875296.

  1. Implications of regional improvement in global climate models for agricultural impact research

    International Nuclear Information System (INIS)

    Ramirez-Villegas, Julian; Thornton, Philip K; Jarvis, Andy; Challinor, Andrew J

    2013-01-01

    Global climate models (GCMs) have become increasingly important for climate change science and provide the basis for most impact studies. Since impact models are highly sensitive to input climate data, GCM skill is crucial for getting better short-, medium- and long-term outlooks for agricultural production and food security. The Coupled Model Intercomparison Project (CMIP) phase 5 ensemble is likely to underpin the majority of climate impact assessments over the next few years. We assess 24 CMIP3 and 26 CMIP5 simulations of present climate against climate observations for five tropical regions, as well as regional improvements in model skill and, through literature review, the sensitivities of impact estimates to model error. Climatological means of seasonal mean temperatures depict mean errors between 1 and 18 ° C (2–130% with respect to mean), whereas seasonal precipitation and wet-day frequency depict larger errors, often offsetting observed means and variability beyond 100%. Simulated interannual climate variability in GCMs warrants particular attention, given that no single GCM matches observations in more than 30% of the areas for monthly precipitation and wet-day frequency, 50% for diurnal range and 70% for mean temperatures. We report improvements in mean climate skill of 5–15% for climatological mean temperatures, 3–5% for diurnal range and 1–2% in precipitation. At these improvement rates, we estimate that at least 5–30 years of CMIP work is required to improve regional temperature simulations and at least 30–50 years for precipitation simulations, for these to be directly input into impact models. We conclude with some recommendations for the use of CMIP5 in agricultural impact studies. (letter)

  2. Managing saltwater intrusion in coastal arid regions and its societal implications for agriculture

    Directory of Open Access Journals (Sweden)

    J. Grundmann

    2016-05-01

    Full Text Available Coastal aquifers in arid and semiarid regions are particularly at risk due to intrusion of salty marine water. Since groundwater is predominantly used in irrigated agriculture, its excessive pumping – above the natural rate of replenishment – strengthen the intrusion process. Using this increasingly saline water for irrigation, leads to a destruction of valuable agricultural resources and the economic basis of farmers and their communities. The limitation of resources (water and soil in these regions requires a societal adaptation and change in behaviour as well as the development of appropriate management strategies for a transition towards stable and sustainable future hydrosystem states. Besides a description of the system dynamics and the spatial consequences of adaptation on the resources availability, the contribution combines results of an empirical survey with stakeholders and physically based modelling of the groundwater-agriculture hydrosystem interactions. This includes an analysis of stakeholders' (farmers and decision makers behaviour and opinions regarding several management interventions aiming on water demand and water resources management as well as the thinking of decision makers how farmers will behave. In this context, the technical counter measures to manage the saltwater intrusion by simulating different groundwater pumping strategies and scenarios are evaluated from the economic and social point of view and if the spatial variability of the aquifer's hydrogeology is taken into consideration. The study is exemplarily investigated for the south Batinah region in the Sultanate of Oman, which is affected by saltwater intrusion into a coastal aquifer system due to excessive groundwater withdrawal for irrigated agriculture.

  3. Global and regional phosphorus budgets in agricultural systems and their implications for phosphorus-use efficiency

    Science.gov (United States)

    Lun, Fei; Liu, Junguo; Ciais, Philippe; Nesme, Thomas; Chang, Jinfeng; Wang, Rong; Goll, Daniel; Sardans, Jordi; Peñuelas, Josep; Obersteiner, Michael

    2018-01-01

    The application of phosphorus (P) fertilizer to agricultural soils increased by 3.2 % annually from 2002 to 2010. We quantified in detail the P inputs and outputs of cropland and pasture and the P fluxes through human and livestock consumers of agricultural products on global, regional, and national scales from 2002 to 2010. Globally, half of the total P inputs into agricultural systems accumulated in agricultural soils during this period, with the rest lost to bodies of water through complex flows. Global P accumulation in agricultural soil increased from 2002 to 2010 despite decreases in 2008 and 2009, and the P accumulation occurred primarily in cropland. Despite the global increase in soil P, 32 % of the world's cropland and 43 % of the pasture had soil P deficits. Increasing soil P deficits were found for African cropland vs. increasing P accumulation in eastern Asia. European and North American pasture had a soil P deficit because the continuous removal of biomass P by grazing exceeded P inputs. International trade played a significant role in P redistribution among countries through the flows of P in fertilizer and food among countries. Based on country-scale budgets and trends we propose policy options to potentially mitigate regional P imbalances in agricultural soils, particularly by optimizing the use of phosphate fertilizer and the recycling of waste P. The trend of the increasing consumption of livestock products will require more P inputs to the agricultural system, implying a low P-use efficiency and aggravating P-stock scarcity in the future. The global and regional phosphorus budgets and their PUEs in agricultural systems are publicly available at https://doi.pangaea.de/10.1594/PANGAEA.875296.

  4. Regional distribution shifts help explain local changes in wintering raptor abundance: implications for interpreting population trends.

    Directory of Open Access Journals (Sweden)

    Neil Paprocki

    Full Text Available Studies of multiple taxa across broad-scales suggest that species distributions are shifting poleward in response to global climate change. Recognizing the influence of distribution shifts on population indices will be an important part of interpreting trends within management units because current practice often assumes that changes in local populations reflect local habitat conditions. However, the individual- and population-level processes that drive distribution shifts may occur across a large, regional scale and have little to do with the habitats within the management unit. We examined the latitudinal center of abundance for the winter distributions of six western North America raptor species using Christmas Bird Counts from 1975-2011. Also, we considered whether population indices within western North America Bird Conservation Regions (BCRs were explained by distribution shifts. All six raptors had significant poleward shifts in their wintering distributions over time. Rough-legged Hawks (Buteo lagopus and Golden Eagles (Aquila chrysaetos showed the fastest rate of change, with 8.41 km yr(-1 and 7.74 km yr(-1 shifts, respectively. Raptors may be particularly responsive to warming winters because of variable migration tendencies, intraspecific competition for nesting sites that drives males to winter farther north, or both. Overall, 40% of BCR population trend models were improved by incorporating information about wintering distributions; however, support for the effect of distribution on BCR indices varied by species with Rough-legged Hawks showing the most evidence. These results emphasize the importance of understanding how regional distribution shifts influence local-scale population indices. If global climate change is altering distribution patterns, then trends within some management units may not reflect changes in local habitat conditions. The methods used to monitor and manage bird populations within local BCRs will fundamentally

  5. Comparison of regional and global land cover products and the implications for biogenic emission modeling.

    Science.gov (United States)

    Huang, Ling; McDonald-Buller, Elena; McGaughey, Gary; Kimura, Yosuke; Allen, David T

    2015-10-01

    Accurate estimates of biogenic emissions are required for air quality models that support the development of air quality management plans and attainment demonstrations. Land cover characterization is an essential driving input for most biogenic emissions models. This work contrasted the global Moderate Resolution Imaging Spectroradiometer (MODIS) land cover product against a regional land cover product developed for the Texas Commissions on Environmental Quality (TCEQ) over four climate regions in eastern Texas, where biogenic emissions comprise a large fraction of the total inventory of volatile organic compounds (VOCs) and land cover is highly diverse. The Model of Emissions of Gases and Aerosols from Nature (MEGAN) was utilized to investigate the influences of land cover characterization on modeled isoprene and monoterpene emissions through changes in the standard emission potential and emission activity factor, both separately and simultaneously. In Central Texas, forest coverage was significantly lower in the MODIS land cover product relative to the TCEQ data, which resulted in substantially lower estimates of isoprene and monoterpene emissions by as much as 90%. Differences in predicted isoprene and monoterpene emissions associated with variability in land cover characterization were primarily caused by differences in the standard emission potential, which is dependent on plant functional type. Photochemical modeling was conducted to investigate the effects of differences in estimated biogenic emissions associated with land cover characterization on predicted ozone concentrations using the Comprehensive Air Quality Model with Extensions (CAMx). Mean differences in maximum daily average 8-hour (MDA8) ozone concentrations were 2 to 6 ppb with maximum differences exceeding 20 ppb. Continued focus should be on reducing uncertainties in the representation of land cover through field validation. Uncertainties in the estimation of biogenic emissions associated with

  6. Duration of Parana magmatism and implications for the evolution and source regions of continental flood basalts

    International Nuclear Information System (INIS)

    Mantovani, M.S.M.; Stewart, K.; Turner, S.; Hawkesworth, C.J.

    1995-01-01

    Duration of Continental Floods Basalts magmatism has generally been considered to be extremely short. Ar-Ar data for different magma type, over a broad region within Parana, demonstrate a duration of 10 Ma, an order of magnitude greater than the usually accepted duration of magmatism. The dating method included rigorous geochemical selection tests, to discard altered samples, combined with the analysis of laser spot technique using the isochron approach. This methodology allows discrimination between rocks which yield precise ages and those which are too altered or heterogeneous. The agreement between the determined age and the relative stratigraphic position of samples supports the above statement. 4 figs

  7. Duration of Parana magmatism and implications for the evolution and source regions of continental flood basalts

    Energy Technology Data Exchange (ETDEWEB)

    Mantovani, M.S.M. [Sao Paulo Univ., SP (Brazil). Inst. Astronomico e Geofisico; Stewart, K.; Turner, S.; Hawkesworth, C.J. [Open Univ., Milton Keynes (United Kingdom). Dept. of Earth Sciences

    1995-12-31

    Duration of Continental Floods Basalts magmatism has generally been considered to be extremely short. Ar-Ar data for different magma type, over a broad region within Parana, demonstrate a duration of 10 Ma, an order of magnitude greater than the usually accepted duration of magmatism. The dating method included rigorous geochemical selection tests, to discard altered samples, combined with the analysis of laser spot technique using the isochron approach. This methodology allows discrimination between rocks which yield precise ages and those which are too altered or heterogeneous. The agreement between the determined age and the relative stratigraphic position of samples supports the above statement. 4 figs.

  8. Demographic trends in the Lodz region and their implications for seniors 50+

    Directory of Open Access Journals (Sweden)

    Jolanta Woźnica

    2014-12-01

    Simultaneously, due to declining birth rates, prolongation of human life and emigration, especially young people, are progressing aging of the population, including labor resources. It is already a serious problem is the high proportion of economically inactive older people , and also low rates of labor force participation and employment. Shaped so the situation there is a need to take action at the regional level, aimed at creating conditions for continuation of work for persons having a retirement age through measures to improve the functioning of the working environment of older people.

  9. Comparative Genomics of Methanopyrus sp. SNP6 and KOL6 Revealing Genomic Regions of Plasticity Implicated in Extremely Thermophilic Profiles

    Directory of Open Access Journals (Sweden)

    Zhiliang Yu

    2017-07-01

    Full Text Available Methanopyrus spp. are usually isolated from harsh niches, such as high osmotic pressure and extreme temperature. However, the molecular mechanisms for their environmental adaption are poorly understood. Archaeal species is commonly considered as primitive organism. The evolutional placement of archaea is a fundamental and intriguing scientific question. We sequenced the genomes of Methanopyrus strains SNP6 and KOL6 isolated from the Atlantic and Iceland, respectively. Comparative genomic analysis revealed genetic diversity and instability implicated in niche adaption, including a number of transporter- and integrase/transposase-related genes. Pan-genome analysis also defined the gene pool of Methanopyrus spp., in addition of ~120-Kb genomic region of plasticity impacting cognate genomic architecture. We believe that Methanopyrus genomics could facilitate efficient investigation/recognition of archaeal phylogenetic diverse patterns, as well as improve understanding of biological roles and significance of these versatile microbes.

  10. Climate change in the four corners and adjacent regions: Implications for environmental restoration and land-use planning

    Energy Technology Data Exchange (ETDEWEB)

    Waugh, W.J. [ed.

    1995-09-01

    This document contains the workshop proceedings on Climate Change in the Four Corners and Adjacent Regions: Implications for Environmental Restoration and Land-Use Planning which took place September 12-14, 1994 in Grand Junction, Colorado. The workshop addressed three ways we can use paleoenvironmental data to gain a better understanding of climate change and its effects. (1) To serve as a retrospective baseline for interpreting past and projecting future climate-induced environmental change, (2) To differentiate the influences of climate and humans on past environmental change, and (3) To improve ecosystem management and restoration practices in the future. The papers presented at this workshop contained information on the following subjects: Paleoclimatic data from the Pleistocene and Holocene epochs, climate change and past cultures, and ecological resources and environmental restoration. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

  11. Segmentation of the eastern North Greenland oblique-shear margin – regional plate tectonic implications

    DEFF Research Database (Denmark)

    Andreasen, Arne Døssing; Stemmerik, Lars; Dahl-Jensen, T.

    2010-01-01

    a highly complex, Paleozoic–early Cenozoic pre-opening setting. However, due to extreme ice conditions, very little is known about the offshore areas seawards of – and between – the peninsulas. Consequently, prevailing structural-tectonic models of the margin tend to be significantly oversimplified...... anticipated. In particular, we interpret strong margin segmentation along N/NE-striking fault structures. The structures are likely to have formed by Late Mesozoic–early Cenozoic strike-slip tectonics and have continued to be active during the late Cenozoic. A more than 8 km deep sedimentary basin...

  12. Implication of Soluble Forms of Cell Adhesion Molecules in Infectious Disease and Tumor: Insights from Transgenic Animal Models

    Directory of Open Access Journals (Sweden)

    Etsuro Ono

    2018-01-01

    Full Text Available Cell adhesion molecules (CAMs are surface ligands, usually glycoproteins, which mediate cell-to-cell adhesion. They play a critical role in maintaining tissue integrity and mediating migration of cells, and some of them also act as viral receptors. It has been known that soluble forms of the viral receptors bind to the surface glycoproteins of the viruses and neutralize them, resulting in inhibition of the viral entry into cells. Nectin-1 is one of important CAMs belonging to immunoglobulin superfamily and herpesvirus entry mediator (HVEM is a member of the tumor necrosis factor (TNF receptor family. Both CAMs also act as alphaherpesvirus receptor. Transgenic mice expressing the soluble form of nectin-1 or HVEM showed almost complete resistance against the alphaherpesviruses. As another CAM, sialic acid-binding immunoglobulin-like lectins (Siglecs that recognize sialic acids are also known as an immunoglobulin superfamily member. Siglecs play an important role in the regulation of immune cell functions in infectious diseases, inflammation, neurodegeneration, autoimmune diseases and cancer. Siglec-9 is one of Siglecs and capsular polysaccharide (CPS of group B Streptococcus (GBS binds to Siglec-9 on neutrophils, leading to suppress host immune response and provide a survival advantage to the pathogen. In addition, Siglec-9 also binds to tumor-produced mucins such as MUC1 to lead negative immunomodulation. Transgenic mice expressing the soluble form of Siglec-9 showed significant resistance against GBS infection and remarkable suppression of MUC1 expressing tumor proliferation. This review describes recent developments in the understanding of the potency of soluble forms of CAMs in the transgenic mice and discusses potential therapeutic interventions that may alter the outcomes of certain diseases.

  13. [Tobacco cultivationin Salento (Apulia Region, Southern Italy) from 1929 to 1993: possible health implications].

    Science.gov (United States)

    Montinari, Maria Rosa; Minelli, Pierluca; Gianicolo, Emilio Antonio Luca

    2018-01-01

    The Province of Lecce (Apulia Region, Southern Italy) is one of the Italian areas where the prevalence of respiratory disease and cancer of the respitartory tract is very high. Through a descriptive analysis of the historical series of tobacco culture indicators, a historical reconstruction of the development of tobacco cultivation in Salento (the area where the Province of Lecce is located) is here presented, in order to provide an additional element of knowledge on potential risk factors for respiratory diseases and cancers. Data regarding extensions in hectares and crop productions in the province of Lecce, in Apulia, and in Italy are from the Chamber of commerce of Lecce province and from the Italian National Institute of Statistics (Istat). From 1929 to 1993, the province of Lecce provided between 75% and 94% of the tobacco cultivated in Apulia Region and 25% of the national tobacco until 1945. Since the late Sixties, a growing increase in annual average production was observed, reaching 21.5 quintals per hectare in 1991 in Salento. This large tobacco production, associated with intensive use of pesticides, could be an element to be observed in analytical studies as a determining potential for the high prevalence of respiratory diseases and pulmonary cancers in the male population of the province of Lecce.

  14. Regional cerebral glucose metabolic changes in oculopalatal myoclonus: implication for neural pathways, underlying the disorder

    International Nuclear Information System (INIS)

    Cho, Sang Soo; Moon, So Young; Kim, Ji Soo; Kim, Sang Eun

    2004-01-01

    Palatal myoclonus (PM) is characterized by rhythmic involuntary jerky movements of the soft palate of the throat. When associated with eye movements, it is called oculopalatal myoclonus (OPM). Ordinary PM is characterized by hypertrophic olivary degeneration, a trans-synaptic degeneration following loss of neuronal input to the inferior olivary nucleus due to an interruption of the Guillain-Mollaret triangle usually by a hemorrhage. However, the neural pathways underlying the disorder are uncertain. In an attempt to understand the pathologic neural pathways, we examined the metabolic correlates of this tremulous condition. Brain FDG PET scans were acquired in 8 patients with OPM (age, 49.9±4.6 y: all males: 7 with pontine hemorrhage, 1 with diffuse brainstem infarction) and age-matched 50 healthy males (age, 50.7± 9.0) and the regional glucose metabolism compared using SPM99. For group analysis, the hemispheres containing lesions were assigned to the right side of the brain. Patients with OPM had significant hypometabolism in the ipsilateral (to the lesion) brainstem and superior temporal and parahippocampal gyri (P < 0.05 corrected, k = 100). By contrast, there was significant hypermetabolism in the contralateral middle and inferior temporal gyri, thalamus, middle frontal gyrus and precuneus (P < 0.05 corrected, k=l00). Our data demonstrate the distinct metabolic changes between several ipsilateral and contralateral brain regions (hypometabolism vs. hypermetabolism) in patients with OPM. This may provide clues for understanding the neural pathways underlying the disorder

  15. Regional cerebral glucose metabolic changes in oculopalatal myoclonus: implication for neural pathways, underlying the disorder

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Sang Soo; Moon, So Young; Kim, Ji Soo; Kim, Sang Eun [College of Medicine, Seoul National University, Seoul (Korea, Republic of)

    2004-07-01

    Palatal myoclonus (PM) is characterized by rhythmic involuntary jerky movements of the soft palate of the throat. When associated with eye movements, it is called oculopalatal myoclonus (OPM). Ordinary PM is characterized by hypertrophic olivary degeneration, a trans-synaptic degeneration following loss of neuronal input to the inferior olivary nucleus due to an interruption of the Guillain-Mollaret triangle usually by a hemorrhage. However, the neural pathways underlying the disorder are uncertain. In an attempt to understand the pathologic neural pathways, we examined the metabolic correlates of this tremulous condition. Brain FDG PET scans were acquired in 8 patients with OPM (age, 49.9{+-}4.6 y: all males: 7 with pontine hemorrhage, 1 with diffuse brainstem infarction) and age-matched 50 healthy males (age, 50.7{+-} 9.0) and the regional glucose metabolism compared using SPM99. For group analysis, the hemispheres containing lesions were assigned to the right side of the brain. Patients with OPM had significant hypometabolism in the ipsilateral (to the lesion) brainstem and superior temporal and parahippocampal gyri (P < 0.05 corrected, k = 100). By contrast, there was significant hypermetabolism in the contralateral middle and inferior temporal gyri, thalamus, middle frontal gyrus and precuneus (P < 0.05 corrected, k=l00). Our data demonstrate the distinct metabolic changes between several ipsilateral and contralateral brain regions (hypometabolism vs. hypermetabolism) in patients with OPM. This may provide clues for understanding the neural pathways underlying the disorder.

  16. Enrichment of risk SNPs in regulatory regions implicate diverse tissues in Parkinson's disease etiology.

    Science.gov (United States)

    Coetzee, Simon G; Pierce, Steven; Brundin, Patrik; Brundin, Lena; Hazelett, Dennis J; Coetzee, Gerhard A

    2016-07-27

    Recent genome-wide association studies (GWAS) of Parkinson's disease (PD) revealed at least 26 risk loci, with associated single nucleotide polymorphisms (SNPs) located in non-coding DNA having unknown functions in risk. In order to explore in which cell types these SNPs (and their correlated surrogates at r(2) ≥ 0.8) could alter cellular function, we assessed their location overlap with histone modification regions that indicate transcription regulation in 77 diverse cell types. We found statistically significant enrichment of risk SNPs at 12 loci in active enhancers or promoters. We investigated 4 risk loci in depth that were most significantly enriched (-logeP > 14) and contained 8 putative enhancers in the different cell types. These enriched loci, along with eQTL associations, were unexpectedly present in non-neuronal cell types. These included lymphocytes, mesendoderm, liver- and fat-cells, indicating that cell types outside the brain are involved in the genetic predisposition to PD. Annotating regulatory risk regions within specific cell types may unravel new putative risk mechanisms and molecular pathways that contribute to PD development.

  17. Enrichment of risk SNPs in regulatory regions implicate diverse tissues in Parkinson’s disease etiology

    Science.gov (United States)

    Coetzee, Simon G.; Pierce, Steven; Brundin, Patrik; Brundin, Lena; Hazelett, Dennis J.; Coetzee, Gerhard A.

    2016-01-01

    Recent genome-wide association studies (GWAS) of Parkinson’s disease (PD) revealed at least 26 risk loci, with associated single nucleotide polymorphisms (SNPs) located in non-coding DNA having unknown functions in risk. In order to explore in which cell types these SNPs (and their correlated surrogates at r2 ≥ 0.8) could alter cellular function, we assessed their location overlap with histone modification regions that indicate transcription regulation in 77 diverse cell types. We found statistically significant enrichment of risk SNPs at 12 loci in active enhancers or promoters. We investigated 4 risk loci in depth that were most significantly enriched (−logeP > 14) and contained 8 putative enhancers in the different cell types. These enriched loci, along with eQTL associations, were unexpectedly present in non-neuronal cell types. These included lymphocytes, mesendoderm, liver- and fat-cells, indicating that cell types outside the brain are involved in the genetic predisposition to PD. Annotating regulatory risk regions within specific cell types may unravel new putative risk mechanisms and molecular pathways that contribute to PD development. PMID:27461410

  18. Climate Change, Extreme Weather Events, and Human Health Implications in the Asia Pacific Region.

    Science.gov (United States)

    Hashim, Jamal Hisham; Hashim, Zailina

    2016-03-01

    The Asia Pacific region is regarded as the most disaster-prone area of the world. Since 2000, 1.2 billion people have been exposed to hydrometeorological hazards alone through 1215 disaster events. The impacts of climate change on meteorological phenomena and environmental consequences are well documented. However, the impacts on health are more elusive. Nevertheless, climate change is believed to alter weather patterns on the regional scale, giving rise to extreme weather events. The impacts from extreme weather events are definitely more acute and traumatic in nature, leading to deaths and injuries, as well as debilitating and fatal communicable diseases. Extreme weather events include heat waves, cold waves, floods, droughts, hurricanes, tropical cyclones, heavy rain, and snowfalls. Globally, within the 20-year period from 1993 to 2012, more than 530 000 people died as a direct result of almost 15 000 extreme weather events, with losses of more than US$2.5 trillion in purchasing power parity. © 2015 APJPH.

  19. Local knowledge of the flora of a region: implications in biodiversity conservation

    Directory of Open Access Journals (Sweden)

    Maria da Conceição Pereira

    2016-11-01

    Full Text Available The flora of a region is important in aesthetic, environmental and economic terms. Academic degree holders are fundamental for the sustainable development of a geographically isolated region such as the Azores, the University of Azores (UAc contributing to that goal. We assessed the perception of the UAc students about the origin and the importance of the Azorean flora for conservation, culture and economy, by applying a questionnaire to 309 students in different scientific areas, addressing origin, symbolic importance, economic importance, and environmental functions. Students showed some knowledge about the concepts of endemic, native, introduced and invasive species, but often failed to connect those to specific plant taxa. Most species cited as symbolic were animals, and the plants mentioned were mainly exotic/invasive. Respondents had a sense of the most important crops and forest species, and attributed several functions related to biodiversity and environmental conservation to the flora. Despite the many actions already implemented, more initiatives are required to increase the connection between Azoreans and Azorean flora.

  20. Hearing Impaired Education of the Department of Education in Region X, Philippines: Its Approaches and Implication

    Directory of Open Access Journals (Sweden)

    James Mirabeau B. Undalok

    2015-11-01

    Full Text Available One way to attain improvement of the educational programs of the hearing impaired is by conducting survey and assessment of the status of the hearing impaired education of the Department of Education in Region X, Philippines. The Special Education (SpEd teachers play a vital role for the pupils of the hearing impaired children as they are viewed as linchpins in the learning process of the children. This cannot be attained without the different approaches on hearing impaired education. Survey -questionnaires were used to gather information needed. Data were analyzed using the descriptive statistics such as weighted mean and standard deviation. The ANOVA test was used to determine the significance of the hearing impaired education of the Department of Education in Region X. Anchored on the findings, the following conclusions are made about different educational approaches should be given priority by the SPED teachers is further enhance the lifelong learning skills of the pupils. It helps them for their learning process and acquiring language skills. There should be an advocacy on the hearing impaired education program to the public and stakeholders.

  1. Colloquy and workshops: regional implications of the engineering manpower requirements of the National Energy Program

    Energy Technology Data Exchange (ETDEWEB)

    Segool, H. D. [ed.

    1979-05-01

    The crucial interrelationships of engineering manpower, technological innovation, productivity and capital re-formaton were keynoted. Near-term, a study has indicated a much larger New England energy demand-reduction/economic/market potential, with a probably larger engineering manpower requirement, for energy-conservation measures characterized by technological innovation and cost-effective capital services than for alternative energy-supply measures. Federal, regional, and state energy program responsibilities described a wide-ranging panorama of activities among many possible energy options which conveyed much endeavor without identifiable engineering manpower demand coefficients. Similarly, engineering manpower assessment data was described as uneven and unfocused to the energy program at the national level, disaggregated data as non-existent at the regional/state levels, although some qualitative inferences were drawn. A separate abstract was prepared for each of the 16 individual presentations for the DOE Energy Data Base (EDB); 14 of these were selected for Energy Abstracts for Policy Analysis (EAPA) and 2 for Energy Research Abstracts (ERA).

  2. Local and regional energy companies offering energy services: Key activities and implications for the business model

    International Nuclear Information System (INIS)

    Kindström, Daniel; Ottosson, Mikael

    2016-01-01

    Highlights: • Many companies providing energy services are experiencing difficulties. • This research identifies key activities for the provision of energy services. • Findings are aggregated to the business-model level providing managerial insights. • This research identifies two different business model innovation paths. • Energy companies may need to renew parts of, or the entire, business model. - Abstract: Energy services play a key role in increasing energy efficiency in the industry. The key actors in these services are the local and regional energy companies that are increasingly implementing energy services as part of their market offering and developing service portfolios. Although expectations for energy services have been high, progress has so far been limited, and many companies offering energy services, including energy companies, are experiencing difficulties in implementing energy services and providing them to the market. Overall, this research examines what is needed for local and regional energy companies to successfully implement energy services (and consequently provide them to the market). In doing this, a two-stage process is used: first, we identify key activities for the successful implementation of energy services, and second, we aggregate the findings to the business model level. This research demonstrates that to succeed in implementing energy services, an energy company may need to renew parts or all of its existing product-based business model, formulate a new business model, or develop coexisting multiple business models. By discussing two distinct business model innovation processes, this research demonstrates that there can be different paths to success.

  3. Search for OB stars running away from young star clusters. II. The NGC 6357 star-forming region

    Science.gov (United States)

    Gvaramadze, V. V.; Kniazev, A. Y.; Kroupa, P.; Oh, S.

    2011-11-01

    Dynamical few-body encounters in the dense cores of young massive star clusters are responsible for the loss of a significant fraction of their massive stellar content. Some of the escaping (runaway) stars move through the ambient medium supersonically and can be revealed via detection of their bow shocks (visible in the infrared, optical or radio). In this paper, which is the second of a series of papers devoted to the search for OB stars running away from young ( ≲ several Myr) Galactic clusters and OB associations, we present the results of the search for bow shocks around the star-forming region NGC 6357. Using the archival data of the Midcourse Space Experiment (MSX) satellite and the Spitzer Space Telescope, and the preliminary data release of the Wide-Field Infrared Survey Explorer (WISE), we discovered seven bow shocks, whose geometry is consistent with the possibility that they are generated by stars expelled from the young (~1-2 Myr) star clusters, Pismis 24 and AH03 J1725-34.4, associated with NGC 6357. Two of the seven bow shocks are driven by the already known OB stars, HD 319881 and [N78] 34. Follow-up spectroscopy of three other bow-shock-producing stars showed that they are massive (O-type) stars as well, while the 2MASS photometry of the remaining two stars suggests that they could be B0 V stars, provided that both are located at the same distance as NGC 6357. Detection of numerous massive stars ejected from the very young clusters is consistent with the theoretical expectation that star clusters can effectively lose massive stars at the very beginning of their dynamical evolution (long before the second mechanism for production of runaway stars, based on a supernova explosion in a massive tight binary system, begins to operate) and lends strong support to the idea that probably all field OB stars have been dynamically ejected from their birth clusters. A by-product of our search for bow shocks around NGC 6357 is the detection of three circular

  4. HOW SOCIAL CAPITAL HELPS SMALL ENTERPRISE?: IMPLICATIONS FOR REGIONAL ECONOMIC DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Feray ERSELCAN

    2011-07-01

    Full Text Available Presenting findings from a sample survey carried among manufacturing small and medium sized enterprises in Kayseri Sub-Region (TR72 – Sivas, Kayseri and Yozgat, this study attempts to understand whether and how social capital has an impact on small firms’ performance. Besides, the study goes further to bring into question the effectiveness of different types of social capital, norms and networks and how social capital is created at local level. Social capital is measured at two different (potential and actual levels. Results of our analysis point to the fact that measuring social capital at its “actual” level might be more useful than measuring it as a “potential”. Our findings suggest that firms perform better, if they enjoy higher levels of collective action and can reduce their transaction costs through social relations.

  5. Important historical efforts at emergency department categorization in the United States and implications for regionalization.

    Science.gov (United States)

    Mehrotra, Abhishek; Sklar, David P; Tayal, Vivek S; Kocher, Keith E; Handel, Daniel A; Myles Riner, R

    2010-12-01

    This article is drawn from a report created for the American College of Emergency Physicians (ACEP) Emergency Department (ED) Categorization Task Force and also reflects the proceedings of a breakout session, "Beyond ED Categorization-Matching Networks to Patient Needs," at the 2010 Academic Emergency Medicine consensus conference, "Beyond Regionalization: Integrated Networks of Emergency Care." The authors describe a brief history of the significant national and state efforts at categorization and suggest reasons why many of these efforts failed to persevere or gain wider implementation. The history of efforts to categorize hospital (and ED) emergency services demonstrates recognition of the potential benefits of categorization, but reflects repeated failures to implement full categorization systems or limited excursions into categorization through licensing of EDs or designation of receiving and referral facilities. An understanding of the history of hospital and ED categorization could better inform current efforts to develop categorization schemes and processes. 2010 by the Society for Academic Emergency Medicine.

  6. The Korean Peninsula Energy Development Organization : implications for Northeast Asian regional security co-operation?

    International Nuclear Information System (INIS)

    Snyder, S.

    2000-01-01

    This paper identifies opportunities for co-operation on regional development and security in the North Pacific region. The Korean Peninsula Energy Development Organization (KEDO) was created in 1993 during bilateral negotiations between the United States and the Democratic People's Republic of Korea (US-DPRK) over North Korea's alleged nuclear weapons program. The negotiations resulted in an agreement to freeze North Korea's known nuclear weapons program in return for the construction of two proliferation-resistant 100 MWe light water reactors (LWR) in North Korea, and the provision of 500,000 tons of heavy fuel oil per year until the completion of the LWR construction as compensation for lost energy production capacity resulting from the shutting down of North Korea's nuclear reactors. The author described the activities of KEDO and examined its internal dynamics. The unique circumstances that produced the Agreed Framework and KEDO in response to a major international crisis of the nuclear program in the DPRK were also highlighted along with the US-DPRK bilateral agreement and the multilateral institution involving the United States, South Korea, Japan and the European Union. Financial support from Australia and Canada was discussed along with the mechanism for engaging North Korea in regularized interaction and technical cooperation. It was concluded that KEDO's record of successes and failures is mixed. The energy security issue has been identified as an area that could result in conflict among Northeast Asian countries which are increasingly dependent on oil supplies from the Middle East. In response, numerous multilateral financing mechanisms have been developed to promote joint business opportunities that exploit natural gas resources in the Russian Far East to address Japanese, Korean and Chinese energy needs. 35 refs

  7. GHG emissions from primary aluminum production in China: Regional disparity and policy implications

    International Nuclear Information System (INIS)

    Hao, Han; Geng, Yong; Hang, Wen

    2016-01-01

    Highlights: • GHG emissions from primary aluminum production in China were accounted. • The impact of regional disparity of power generation was considered for this study. • GHG emissions factor of China’s primary aluminum production was 16.5 t CO_2e/t Al ingot in 2013. • Total GHG emissions from China’s primary aluminum production were 421 mt CO_2e in 2013. - Abstract: China is the world-leading primary aluminum production country, which contributed to over half of global production in 2014. Primary aluminum production is power-intensive, for which power generation has substantial impact on overall Greenhouse Gas (GHG) emissions. In this study, we explore the impact of regional disparity of China’s power generation system on GHG emissions for the sector of primary aluminum production. Our analysis reveals that the national GHG emissions factor (GEF) of China’s primary aluminum production was 16.5 t CO_2e/t Al ingot in 2013, with province-level GEFs ranging from 8.2 to 21.7 t CO_2e/t Al ingot. There is a high coincidence of provinces with high aluminum productions and high GEFs. Total GHG emissions from China’s primary aluminum production were 421 mt CO_2e in 2013, approximately accounting for 4% of China’s total GHG emissions. Under the 2020 scenario, GEF shows a 13.2% reduction compared to the 2013 level, but total GHG emissions will increase to 551 mt CO_2e. Based on our analysis, we recommend that the government should further promote energy efficiency improvement, facilitate aluminum industry redistribution with low-carbon consideration, promote secondary aluminum production, and improve aluminum industry data reporting and disclosure.

  8. Relating coccolithophore calcification rates to phytoplankton community dynamics: Regional differences and implications for carbon export

    Science.gov (United States)

    Poulton, Alex J.; Adey, Tim R.; Balch, William M.; Holligan, Patrick M.

    2007-03-01

    Recent measurements of surface coccolithophore calcification from the Atlantic Ocean (50°N-50°S) are compared to similar measurements from other oceanic settings. By combining the different data sets of surface measurements, we examine general and regional patterns of calcification relative to organic carbon production (photosynthesis) and other characteristics of the phytoplankton community. Generally, surface calcification and photosynthesis are positively correlated, although the strength of the relationship differs between biogeochemical provinces. Relationships between surface calcification, chlorophyll- a and calcite concentrations are also statistically significant, although again there is considerable regional variability. Such variability appears unrelated to phytoplankton community composition or hydrographic conditions, and may instead reflect variations in coccolithophore physiology. The contribution of inorganic carbon fixation (calcification) to total carbon fixation (calcification plus photosynthesis) is ˜1-10%, and we estimate a similar contribution from coccolithophores to total organic carbon fixation. However, these contributions vary between biogeochemical provinces, and occasionally coccolithophores may account for >20% of total carbon fixation in unproductive central subtropical gyres. Combining surface calcification and photosynthetic rates with standing stocks of calcite, particulate organic carbon, and estimated phytoplankton carbon allows us to examine the fates of these three carbon pools. The relative turnover times vary between different biogeochemical provinces, with no clear relationship to the overall productivity or phytoplankton community structure found in each province. Rather, interaction between coccolithophore physiology (coccolith production and detachment rates), species diversity (cell size), and food web dynamics (grazer ecology) may control the composition and turnover times of calcite particles in the upper ocean.

  9. Activation of midbrain and ventral striatal regions implicates salience processing during a modified beads task.

    Directory of Open Access Journals (Sweden)

    Christine Esslinger

    Full Text Available INTRODUCTION: Metacognition, i.e. critically reflecting on and monitoring one's own reasoning, has been linked behaviorally to the emergence of delusions and is a focus of cognitive therapy in patients with schizophrenia. However, little is known about the neural processing underlying metacognitive function. To address this issue, we studied brain activity during a modified beads task which has been used to measure a "Jumping to Conclusions" (JTC bias in schizophrenia patients. METHODS: We used functional magnetic resonance imaging to identify neural systems active in twenty-five healthy subjects when solving a modified version of the "beads task", which requires a probabilistic decision after a variable amount of data has been requested by the participants. We assessed brain activation over the duration of a trial and at the time point of decision making. RESULTS: Analysis of activation during the whole process of probabilistic reasoning showed an extended network including the prefronto-parietal executive functioning network as well as medial parieto-occipital regions. During the decision process alone, activity in midbrain and ventral striatum was detected, as well as in thalamus, medial occipital cortex and anterior insula. CONCLUSIONS: Our data show that probabilistic reasoning shares neural substrates with executive functions. In addition, our finding that brain regions commonly associated with salience processing are active during probabilistic reasoning identifies a candidate mechanism that could underlie the behavioral link between dopamine-dependent aberrant salience and JTC in schizophrenia. Further studies with delusional schizophrenia patients will have to be performed to substantiate this link.

  10. New Directions in European Regional Policy and their Implications for Spain

    Directory of Open Access Journals (Sweden)

    Keith Salmon

    2008-01-01

    Full Text Available Este artículo se centra en la nueva arquitectura de la Política de Cohesión y del nuevo marco financiero europeo dentro del cual se establece. La discusión se divide en cinco secciones. La primera sección examina la estructura del nuevo marco financiero europeo, destacando su impacto en las transferencias financieras entre Europa y España. En la segunda sección se explica la nueva arquitectura de la Política de Cohesión, precisando que relaciones mantiene con las políticas agrícolas y pesqueras y se concluye con una presentación de las características principales de esta nueva arquitectura. La tercera sección examina los recursos financieros que sustentan la Política de Cohesión y su distribución en España. En la sección cuatro la discusión gira en torno a la consideración de los conceptos de convergencia y de la naturaleza de regiones. Finalmente, las conclusiones sugieren que existen implicaciones significativas en los ámbitos administrativos, financieros y en el planeamiento estratégico del nuevo marco financiero y de la renovada Política de Cohesión: para el desarrollo económico en general y para el desarrollo regional en particular en los próximos años.

  11. Can Trade Help Overcome Economic Crisis? Implications for Northeast Asia Creating Regional FTA between Korea, China, and Japan and Mega FTAs such as RCEP and TPP

    Directory of Open Access Journals (Sweden)

    Sang-Chul Park

    2017-08-01

    Full Text Available Globalization processes have formed a triad of economic and trade systems in terms of GDP and trade volume. These are the European Union (EU, North America Free Trade Association (NAFTA, and Northeast Asia, the major actors in the global economic system and trade since 1990s. However, the global financial crisis in 2008 created a new global economic order and governance that consisted of existing global economic power such as the G7 as well as new emerging economic powers, such as G20 and BRICS. Under such rapidly changing global economic conditions, global trade has contributed to rapid economic growth in the world in the last half-century. Regarding FTAs, the European Union (EU is the frontrunner and has developed the most advanced system for regional economic integration. The EU’s single market provides several implications for Northeast Asian countries trying to build their own regional bilateral and multilateral FTAs and participate in different mega-FTAs such as RCEP and TPP. As a result, their economic interests are rather divided deeply and related to political and security issues in the context of Northeast Asia. Therefore, it is more difficult for Northeast Asian countries to economically integrate in a way that is comparable with the EU. This paper addresses a regional FTA between South Korea, China, and Japan that could be a starting point for their formal economic integration and create a reliable platform to strengthen their trade, boosting further economic growth. It also asks which of the three nations’ economic interests are served by participating in mega FTAs such as RCEP and TPP. Finally, it analyses the best scenario for participating in the multilateral FTA and mega FTAs for each nation.

  12. THE SCHMIDT-KENNICUTT LAW OF MATCHED-AGE STAR-FORMING REGIONS; Paα OBSERVATIONS OF THE EARLY-PHASE INTERACTING GALAXY TAFFY I

    International Nuclear Information System (INIS)

    Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.

    2012-01-01

    In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

  13. Regional metamorphism at extreme conditions: Implications for orogeny at convergent plate margins

    Science.gov (United States)

    Zheng, Yong-Fei; Chen, Ren-Xu

    2017-09-01

    Regional metamorphism at extreme conditions refers either to Alpine-type metamorphism at low geothermal gradients of geothermal gradients of >30 °C/km. Extreme pressures refer to those above the polymorphic transition of quartz to coesite, so that ultrahigh-pressure (UHP) eclogite-facies metamorphism occurs at mantle depths of >80 km. Extreme temperatures refer to those higher than 900 °C at crustal depths of ≤80 km, so that ultrahigh-temperature (UHT) granulite-facies metamorphism occurs at medium to high pressures. While crustal subduction at the low geothermal gradients results in blueschist-eclogite facies series without arc volcanism, heating of the thinned orogenic lithosphere brings about the high geothermal gradients for amphibolite-granulite facies series with abundant magmatism. Therefore, UHP metamorphic rocks result from cold lithospheric subduction to the mantle depths, whereas UHT metamorphic rocks are produced by hot underplating of the asthenospheric mantle at the crustal depths. Active continental rifting is developed on the thinned lithosphere in response to asthenospheric upwelling, and this tectonism is suggested as a feasible mechanism for regional granulite-facies metamorphism, with the maximum temperature depending on the extent to which the mantle lithosphere is thinned prior to the rifting. While lithospheric compression is associated with subduction metamorphism in accretionary and collisional orogens, the thinned orogenic lithosphere undergoes extension due to the asthenospheric upwelling to result in orogen-parallel rifting metamorphism and magmatism. Thus, the rifting metamorphism provides a complement to the subduction metamorphism and its operation marks the asthenospheric heating of the orogenic lithosphere. Because of the partial melting and melt extraction of the lower continental crust, contemporaneous granite-migmatite-granulite associations may serve as a petrological indicator of rifting orogeny that is superimposed on

  14. Implications of climate change for wetland-dependent birds in the Prairie Pothole Region

    Science.gov (United States)

    Steen, Valerie; Skagen, Susan K.; Melcher, Cynthia P.

    2016-01-01

    The habitats and food resources required to support breeding and migrant birds dependent on North American prairie wetlands are threatened by impending climate change. The North American Prairie Pothole Region (PPR) hosts nearly 120 species of wetland-dependent birds representing 21 families. Strategic management requires knowledge of avian habitat requirements and assessment of species most vulnerable to future threats. We applied bioclimatic species distribution models (SDMs) to project range changes of 29 wetland-dependent bird species using ensemble modeling techniques, a large number of General Circulation Models (GCMs), and hydrological climate covariates. For the U.S. PPR, mean projected range change, expressed as a proportion of currently occupied range, was −0.31 (± 0.22 SD; range − 0.75 to 0.16), and all but two species were projected to lose habitat. Species associated with deeper water were expected to experience smaller negative impacts of climate change. The magnitude of climate change impacts was somewhat lower in this study than earlier efforts most likely due to use of different focal species, varying methodologies, different modeling decisions, or alternative GCMs. Quantification of the projected species-specific impacts of climate change using species distribution modeling offers valuable information for vulnerability assessments within the conservation planning process.

  15. Quantifying spatial scaling patterns and their local and regional correlates in headwater streams: implications for resilience

    Directory of Open Access Journals (Sweden)

    Emma Göthe

    2014-09-01

    Full Text Available The distribution of functional traits within and across spatiotemporal scales has been used to quantify and infer the relative resilience across ecosystems. We use explicit spatial modeling to evaluate within- and cross-scale redundancy in headwater streams, an ecosystem type with a hierarchical and dendritic network structure. We assessed the cross-scale distribution of functional feeding groups of benthic invertebrates in Swedish headwater streams during two seasons. We evaluated functional metrics, i.e., Shannon diversity, richness, and evenness, and the degree of redundancy within and across modeled spatial scales for individual feeding groups. We also estimated the correlates of environmental versus spatial factors of both functional composition and the taxonomic composition of functional groups for each spatial scale identified. Measures of functional diversity and within-scale redundancy of functions were similar during both seasons, but both within- and cross-scale redundancy were low. This apparent low redundancy was partly attributable to a few dominant taxa explaining the spatial models. However, rare taxa with stochastic spatial distributions might provide additional information and should therefore be considered explicitly for complementing future resilience assessments. Otherwise, resilience may be underestimated. Finally, both environmental and spatial factors correlated with the scale-specific functional and taxonomic composition. This finding suggests that resilience in stream networks emerges as a function of not only local conditions but also regional factors such as habitat connectivity and invertebrate dispersal.

  16. Western Region Renewable Energy Markets: Implications for the Bureau of Land Management

    Energy Technology Data Exchange (ETDEWEB)

    Haase, S.; Billman, L.; Gelman, R.

    2012-01-01

    The purpose of this analysis is to provide the U.S. Department of the Interior (DOI) and the Bureau of Land Management (BLM) with an overview of renewable energy (RE) generation markets, transmission planning efforts, and the ongoing role of the BLM RE projects in the electricity markets of the 11 states (Arizona, California, Colorado, Idaho, Montana, Nevada, New Mexico, Oregon, Utah, Washington, and Wyoming) that comprise the Western Electricity Coordinating Council (WECC) Region. This analysis focuses on the status of, and projections for, likely development of non-hydroelectric renewable electricity from solar (including photovoltaic [PV] and concentrating solar power [CSP]), wind, biomass and geothermal resources in these states. Absent new policy drivers and without the extension of the DOE loan guarantee program and Treasury's 1603 program, state RPS requirements are likely to remain a primary driver for new RE deployment in the western United States. Assuming no additional policy incentives are implemented, projected RE demand for the WECC states by 2020 is 134,000 GWh. Installed capacity to meet that demand will need to be within the range of 28,000-46,000 MW.

  17. Integrating Recovery within a Resilience Framework: Empirical Insights and Policy Implications from Regional Australia

    Directory of Open Access Journals (Sweden)

    Lex Drennan

    2016-12-01

    Full Text Available Within Australia’s federal system, responsibility for preventing, preparing for, responding to and recovering from natural disasters is shared between the three tiers of government. Intergovernmental policy and funding arrangements are premised on shared responsibility and aim to foster individual, business and community resilience. These arrangements underpin Australia’s international reputation for effectiveness in its management of natural disasters. The capacity of the diverse networks that comprise the disaster management system to coordinate and deliver in the preparedness and response phases of a disaster, and to provide relief in the immediate aftermath, has been developed over time and tested and refined through the experience of frequent, severe disaster events over recent decades. Less well developed is the system’s ability to support economic recovery in disaster-affected communities over the longer term. This paper presents case studies of regional communities affected by two of Australia’s most expensive and deadly natural disasters—the 2009 Victorian bushfires and the cyclones and floods that struck the state of Queensland in 2010–2011. It highlights significant gaps in policy and funding arrangements to support recovery and offers lessons for aligning recovery within a resilience framework.

  18. Quantifying spatial scaling patterns and their local and regional correlates in headwater streams: Implications for resilience

    Science.gov (United States)

    Gothe, Emma; Sandin, Leonard; Allen, Craig R.; Angeler, David G.

    2014-01-01

    The distribution of functional traits within and across spatiotemporal scales has been used to quantify and infer the relative resilience across ecosystems. We use explicit spatial modeling to evaluate within- and cross-scale redundancy in headwater streams, an ecosystem type with a hierarchical and dendritic network structure. We assessed the cross-scale distribution of functional feeding groups of benthic invertebrates in Swedish headwater streams during two seasons. We evaluated functional metrics, i.e., Shannon diversity, richness, and evenness, and the degree of redundancy within and across modeled spatial scales for individual feeding groups. We also estimated the correlates of environmental versus spatial factors of both functional composition and the taxonomic composition of functional groups for each spatial scale identified. Measures of functional diversity and within-scale redundancy of functions were similar during both seasons, but both within- and cross-scale redundancy were low. This apparent low redundancy was partly attributable to a few dominant taxa explaining the spatial models. However, rare taxa with stochastic spatial distributions might provide additional information and should therefore be considered explicitly for complementing future resilience assessments. Otherwise, resilience may be underestimated. Finally, both environmental and spatial factors correlated with the scale-specific functional and taxonomic composition. This finding suggests that resilience in stream networks emerges as a function of not only local conditions but also regional factors such as habitat connectivity and invertebrate dispersal.

  19. Positive implications from socially accountable, community-engaged medical education across two Philippines regions.

    Science.gov (United States)

    Woolley, Torres; Cristobal, Fortunato; Siega-Sur, Jusie; Ross, Simone; Neusy, Andre-Jacques; Halili, Servando; Reeve, Carole

    2018-02-01

    Hundreds of millions of people worldwide lack access to quality health services, largely because of geographic and socioeconomic maldistribution of qualified practitioners. This study describes differences between the practice locations of Philippines medical graduates from two 'socially accountable, community-engaged' health professional education (SAHPE) schools and the practice locations of graduates from two 'conventionally trained' medical schools located in the same respective geographic regions. Licensed medical graduates were currently practising in the Philippines and had been practising for at least 6 months. Graduates were from two Philippines SAHPE schools (Ateneo de Zamboanga University-School of Medicine (ADZU-SOM) on the Zamboanga Peninsula (n=212) and the University of the Philippines Manila-School of Health Sciences (SHS-Palo) in Eastern Visayas (n=71), and from two 'conventional' medical schools Methods: Current graduate practice locations in municipalities or cities were linked with their respective population size and socioeconomic income class, and geocoded using Geographical Information System software onto a geospatial map of the Philippines. Bivariate analysis compared the population size and socioeconomic class of communities where the SAHPE medical graduates practised to communities where 'conventional' medical school graduates practised. Thirty-one percent of ADZU-SOM medical graduates practised in communities play a significant role in graduates choosing to practice in rural and/or economically disadvantaged communities. Governments experiencing medical workforce maldistributions similar to those in the Philippines should consider SAHPE as a potentially cost-effective strategy in recruiting and retaining health graduates to underserved areas.

  20. The diagnostic and prognostic implications of silver-binding nucleolar organizer regions in periodontal lesions

    Directory of Open Access Journals (Sweden)

    Saluja Mini

    2008-01-01

    Full Text Available Background: The periodontal lesions with cellular proliferation can be assessed by various methods. One of the most recent methods to determine the proliferative activity is silver-staining nucleolar organizer region (AgNOR staining. The purpose of the present study was to evaluate, if AgNOR count can act as a proliferative marker and can aid in the diagnosis and prognosis of periodontal lesions. Materials and Methods: For this study, subjects with healthy gingival status, non-neoplastic lesions, neoplastic lesions, and plaque-induced gingivitis were included. Following the provisional diagnosis of clinical entity, biopsies were taken from the respective selected sites for histopathological diagnosis. In plaque-induced gingivitis cases, a second biopsy was taken from the selected sites 3 weeks following scaling. After histological confirmation, one more section was prepared, which was subjected to AgNOR staining, and AgNOR numbers were counted by individual and cluster counts and statistically analyzed. Results: Results showed the highest AgNOR count in neoplastic lesions. Non-neoplastic lesions showed a higher AgNOR count as compared to clinically healthy gingiva. Plaque-induced gingivitis showed a considerable reduction in AgNOR count after treatment. Conclusion: Results of this study confirmed that AgNOR count reflects the cellular proliferation and has a limited diagnostic value. However, the prognostic value of AgNOR for periodontal lesions is dependable.

  1. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region.

    Science.gov (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter

    2018-03-01

    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  2. Eastern Canadian crude oil supply and its implications for regional energy security

    International Nuclear Information System (INIS)

    Hughes, Larry

    2010-01-01

    Canada has been blessed with immense energy resources; however, their distribution is not uniform. One such example is crude oil, which is found primarily in western Canada. Eastern Canada, consisting of the six eastern-most provinces (Newfoundland and Labrador, New Brunswick, Nova Scotia, Ontario, Prince Edward Island, and Quebec), produce limited quantities of crude oil, most of which is exported to the United States. Ideally, western Canadian crude oil would meet the demands of eastern Canada; however, the North American Free Trade Agreement (NAFTA) and the absence of oil pipelines means that eastern Canada increasingly relies on supplies of crude oil from a small number of oil exporting countries, many with declining production. This paper examines crude oil production, supply, and its refining in eastern Canada. It shows that crude production in the region has reached its peak and that increasing global competition for crude oil will affect energy security in eastern Canada, either through price increases or supply shortages, or both. (author)

  3. [Ethics in clinical research: contextualizing and reductionist problem definitions, forms of ethical reflection and some particular implications].

    Science.gov (United States)

    Roelcke, Volker

    2003-12-01

    The present paper starts off with a short outline of issues, conflicts, and goals of ethical reflection about clinical research. It is then argued that non-reductionist, patient-centred ethics should critically reflect on medically preformed problem definitions, ways of problem solution, and evaluations. The shortcomings of such preformed perceptions and interpretations are illustrated using the examples of dementia research, and the complexities of the notion of risk. A more comprehensive approach including the perceptions, interpretations, and evaluations of the patients' perspective necessitates a form of ethical reflection which takes into account the social and cultural contexts of clinical research, and which therefore relies on concepts and methods of the cultural sciences (in particular history, sociology, and cultural anthropology). The decision for a reductionist, or for a contextualising mode of ethical reflection represents in itself a value decision and needs to be explicitly justified.

  4. Variation in light absorption properties of mentha aquatica L. as a function of leaf form: Implications for plant growth

    DEFF Research Database (Denmark)

    Enriquez, Susana; Jensen, Kaj Sand

    2008-01-01

    To understand the association between leaf form and leaf optical properties, we examined light absorption variations in the leaves of Mentha aquatica L., an amphibious freshwater macrophyte. Specific absorption of leaves of M. aquatica showed a 7.5-fold variation, decreasing as pigment per unit...... area increased. This relationship indicates that dispersive samples, such as leaves, although efficient light traps, can also be affected by the "package effect." Mentha aquatica leaves, by expanding their biomass (increased specific leaf area [SLA]), improve their light absorption efficiency per unit...... of both pigment and leaf biomass. Changes in leaf biomass expansion were mainly a result of changes in leaf density, and as a consequence, leaf density appears to be a better descriptor of light absorption efficiency in M. aquatica leaves than does leaf thickness. Light absorption efficiency per unit...

  5. Positive selection neighboring functionally essential sites and disease-implicated regions of mammalian reproductive proteins.

    LENUS (Irish Health Repository)

    Morgan, Claire C

    2010-01-01

    ABSTRACT: BACKGROUND: Reproductive proteins are central to the continuation of all mammalian species. The evolution of these proteins has been greatly influenced by environmental pressures induced by pathogens, rival sperm, sexual selection and sexual conflict. Positive selection has been demonstrated in many of these proteins with particular focus on primate lineages. However, the mammalia are a diverse group in terms of mating habits, population sizes and germ line generation times. We have examined the selective pressures at work on a number of novel reproductive proteins across a wide variety of mammalia. RESULTS: We show that selective pressures on reproductive proteins are highly varied. Of the 10 genes analyzed in detail, all contain signatures of positive selection either across specific sites or in specific lineages or a combination of both. Our analysis of SP56 and Col1a1 are entirely novel and the results show positively selected sites present in each gene. Our findings for the Col1a1 gene are suggestive of a link between positive selection and severe disease type. We find evidence in our dataset to suggest that interacting proteins are evolving in symphony: most likely to maintain interacting functionality. CONCLUSION: Our in silico analyses show positively selected sites are occurring near catalytically important regions suggesting selective pressure to maximize efficient fertilization. In those cases where a mechanism of protein function is not fully understood, the sites presented here represent ideal candidates for mutational study. This work has highlighted the widespread rate heterogeneity in mutational rates across the mammalia and specifically has shown that the evolution of reproductive proteins is highly varied depending on the species and interacting partners. We have shown that positive selection and disease are closely linked in the Col1a1 gene.

  6. Brain local and regional neuroglial alterations in Alzheimer's Disease: cell types, responses and implications.

    Science.gov (United States)

    Toledano, Adolfo; Álvarez, María-Isabel; Toledano-Díaz, Adolfo; Merino, José-Joaquín; Rodríguez, José Julio

    2016-01-01

    From birth to death, neurons are dynamically accompanied by neuroglial cells in a very close morphological and functional relationship. Three families have been classically considered within the CNS: astroglia, oligodendroglia and microglia. Many types/subtypes (including NGR2+ cells), with a wide variety of physiological and pathological effects on neurons, have been described using morphological and immunocytochemical criteria. Glio-glial, glio-neuronal and neuro-glial cell signaling and gliotransmission are phenomena that are essential to support brain functions. Morphofunctional changes resulting from the plasticity of all the glial cell types parallel the plastic neuronal changes that optimize the functionality of neuronal circuits. Moreover, neuroglia possesses the ability to adopt a reactive status (gliosis) in which, generally, new functions arise to improve and restore if needed the neural functionality. All these features make neuroglial cells elements of paramount importance when attempting to explain any physiological or pathological processes in the CNS, because they are involved in both, neuroprotection/neurorepair and neurodegeneration. There exist diverse and profound, regional and local, neuroglial changes in all involutive processes (physiological and pathological aging; neurodegenerative disorders, including Alzheimer ´s disease -AD-), but today, the exact meaning of such modifications (the modifications of the different neuroglial types, in time and place), is not well understood. In this review we consider the different neuroglial cells and their responses in order to understand the possible role they fulfill in pathogenesis, diagnosis and treatment (preventive or palliative) of AD. The existence of differentiated and/or concurrent pathogenic and neuro-protective/neuro-restorative astroglial and microglial responses is highlighted.

  7. Evaporative concentration of arsenic in groundwater: health and environmental implications, La Laguna Region, Mexico.

    Science.gov (United States)

    Ortega-Guerrero, Adrián

    2017-10-01

    High arsenic concentrations in groundwater have been documented in La Laguna Region (LLR) in arid northern Mexico, where arsenic poisoning is both chronic and endemic. A heated debate has continued for decades on its origin. LLR consisted of a series of ancient connected lakes that developed at the end of a topographic depression under closed basin conditions. This study addresses the isotopic, chemical composition of the groundwater and geochemical modeling in the southeasternmost part of the LLR to determine the origin of arsenic. Groundwater samples were obtained from a carbonate and granular aquifers and from a clayey aquitard at terminal Viesca Lake. Results show that groundwater originated as meteoric water that reached the lakes mainly via abundant springs in the carbonate aquifer and perennial flooding of the Nazas-Aguanaval Rivers. Paleo-lake water underwent progressive evaporation as demonstrated by the enrichment of δ 18 O, δ 2 H and characteristic geochemical patterns in the granular aquifer and aquitard that resulted in highly saline (>90,000 mS/cm), arsenic-rich (up to 5000 μg/L) paleo-groundwater (>30,000 years BP). However, adsorption or co-precipitation on iron oxides, clay-mineral surfaces and organic carbon limited arsenic concentration in the groundwater. Arsenic-rich groundwater and other solutes are advancing progressively from the lacustrine margins toward the main granular aquifer, due to reversal of hydraulic gradients caused by intensive groundwater exploitation and the reduction in freshwater runoff provoked by dam construction on the main rivers. Desorption of arsenic will incorporate additional concentrations of arsenic into the groundwater and continue to have significant negative effects on human health and the environment.

  8. Regional dynamics of persistent organic pollutants (POPs) in the Pearl River Delta, China: Implications and perspectives

    International Nuclear Information System (INIS)

    Zhang Kai; Zhang Baozhong; Li Shaomeng; Zeng, Eddy Y.

    2011-01-01

    The mass transport budgets of 1,1,1-trichloro-2,2-bis(chlorophenyl)ethane (p,p'-DDT) and decabromodiphenyl ether (BDE-209) in the Pearl River Delta, South China were calculated based on previously collected data. Residual p,p'-DDT, mostly related to historical use, has largely settled into soil (780,000 kg), while the soil BDE-209 inventory (44,000 kg) is considerably smaller. Conversely, large amounts of BDE-209 currently used in numerous commercial products have resulted in a much higher atmospheric depositional flux of BDE-209 (28,100 kg/yr) relative to p,p'-DDT (310 kg/yr). The soil inventory of p,p'-DDT is predicted to decrease to half of its current value after 22 years, and the percent area containing soil p,p'-DDT at levels exceeding the effects range-medium (27 ng/g) will decrease from 40% to 20%. Finally, soil BDE-209 inventory will reach an equilibrium value of 940 tons in ∼60 years, when BDE-209 levels in 50% of soil will be above an equivalent risk guideline value (125 ng/g). - Highlights: → Transport budgets of p,p'-DDT and BDE-209 in the Pearl River Delta were built. → Dry aerial deposition is the dominant route to transport p,p'-DDT and BDE-209. → Soil inventory of p,p'-DDT is much larger than that of BDE-209. → Soil inventory of p,p'-DDT would decline to half of its current value in 22 years. → Soil BDE-209 inventory is expected to reach an equilibrium value in ∼60 years. - Regional dynamics of p,p'-DDT and BDE-209 in the Pearl River Delta (South China) are examined and used to predict temporal variances.

  9. Mediterranean Outflow Water dynamics during the past 570 kyr: Regional and global implications

    Science.gov (United States)

    Kaboth, Stefanie; de Boer, Bas; Bahr, André; Zeeden, Christian; Lourens, Lucas J.

    2017-06-01

    The Gulf of Cadiz constitutes a prime area to study teleconnections between the North Atlantic Ocean and climate change in the Mediterranean realm. In particular, the highly saline Mediterranean Outflow Water (MOW) is an important modulator of the North Atlantic salt budget on intermediate water levels. However, our understanding of its paleoceanographic evolution is poorly constrained due to the lack of high-resolution proxy records that predate the last glacial cycle. Here we present the first continuous and high-resolution ( 1 kyr) benthic δ18O and δ13C as well as grain size records from Integrated Ocean Drilling Program Site U1386 representing the last 570 kyr. We find three distinct phases of MOW variability throughout the Late to Middle Pleistocene at Site U1386 associated with prominent shifts in its composition and flow strength. We attribute this long-term variability to changes in water mass sourcing of the MOW. Superimposed on the long-term change in water mass sourcing is the occurrence of distinct and precession paced δ18O enrichment events, which contrast the pattern of global ice volume change as inferred from the global mean δ18O signal (i.e., LR04) but mimics that of the adjacent Mediterranean Sea. We attribute these enrichment events to a profound temperature reduction and salinity increases of the MOW, aligning with similar changes in the Mediterranean source region. These events might further signify ice volume increases as inferred from significant sea level drops recorded in the Red Sea and/or increased influence of North Atlantic intermediate water masses when MOW influence was absent at Site U1386.

  10. Regional facies variations in the Vempalle formation of Cuddapah Basin: implications on uranium exploration

    International Nuclear Information System (INIS)

    Rajaraman, H.S.; Mukundhan, A.R.; Ramesh Kumar, K.; Achar, K.K.; Umamaheswar, K.

    2012-01-01

    Strata-bound large tonnage uranium deposit hosted by the Grey-impure-dolostone of Vempalle Formation of Cuddapah Basin is known in Tummalapalle-Rachakuntapalle sector. Deposition of rocks of Cuddapah Basin commenced with Papaghni Group, which comprises Clastic - Gulcheru Formation and Chemogenic - Vempalle Formation. The Vempalle Formation is developed over 280 km stretch from south to north along the western margin of Cuddapah Basin with maximum thickness of about 2.1 km. Recent studies helped in classifying the Vempalle Formation into five major lithofacies viz. Massive Dolostone, Conglomerate, Grey-impure-dolostone (host rock for uranium mineralization), Purple shale and Cherty Dolostone. The lithofacies studies along selected traverses from Tummalapalle in south to Dhone in north revealed the development of all five facies upto Narpala near Chitravati River whereas towards its north, the Grey-impure-dolostone and Cherty Dolostone dominate. The study also revealed over lapping nature of Cherty Dolostone in North of Nossam-Peddapaya lineament; where it directly rests above the Gulcheru Formation. Environment of deposition for these facies of Vempalle Formation place this in a Shallowing-upward carbonate depositional system with characteristic tidal flat environment. The Grey-impure-dolostone facies hosting uranium is interpreted to be developed in Supratidal environment with a narrow pH range of 7.0 - 7.5 in a reducing environment along with precipitation of phosphate. Since the tidal flats have later extension over several kilometers, favorable environment of Grey-impure-dolostone may exist over wide area in northern part also. The search for Grey-impure-dolostone hosted uranium, therefore has a bearing an understanding the regional facies variations in Vempalle Formation. The paper presents the studies carried out in this direction and results thereof. (author)

  11. Stratigraphic units overlying the Zambales Ophiolite Complex (ZOC) in Luzon, (Philippines): Tectonostratigraphic significance and regional implications

    Science.gov (United States)

    Queaño, Karlo L.; Dimalanta, Carla B.; Yumul, Graciano P.; Marquez, Edanjarlo J.; Faustino-Eslava, Decibel V.; Suzuki, Shigeyuki; Ishida, Keisuke

    2017-07-01

    The Zambales Ophiolite Complex (ZOC) on the island of Luzon, Philippines is one of the most well-studied crust-mantle sequences in the region. Several massifs comprise the ZOC, one of which is the Coto Block overlain by clastic sedimentary units previously dated as Eocene. Geochronologic studies from diabase, granodiorites and other late-stage magmatic products similarly yielded the same age. Succeeding tectonic models have therefore all been grounded on the assumption that the entire ZOC is Eocene. Recent investigations, however, revealed the presence of chert blocks within the Early to Middle Miocene clastic formation overlying the Acoje Block in the northern part of the ophiolite complex. Radiolarians extracted from the cherts yielded a stratigraphic range that suggests a Late Jurassic to Early Cretaceous age. The recognition of a much older age than previously reported of the ZOC warrants a re-examination of its actual distribution and genesis. Correlating with other similarly-aged ophiolites, we suggest defining a western Mesozoic ophiolite belt, largely extending from the west-central portion of the archipelago to the northeastern tip of Luzon island. Tentatively, we attribute the Mesozoic ophiolitic and associated rocks in western Luzon to an arc-continent collision involving the Philippine Mobile Belt and the Palawan Microcontinental Block. In addition, differences in the clastic compositions of the Cenozoic sedimentary formations provide material not only for deciphering the ZOC's unroofing history but also for constraining the timing of province linkage. The intermittent appearance of lithic fragments and detrital minerals from the ophiolite in the units of the Middle Miocene Candelaria Limestone and the Late Miocene to Early Pliocene Sta. Cruz Formation indicates significant but geographically variable contributions from the ophiolite complex. In the northern Zambales Range, the Sta. Cruz Formation caps the Coto Block and the Acoje Block of the ZOC

  12. Paleoseismicity of two historically quiescent faults in Australia: Implications for fault behavior in stable continental regions

    Science.gov (United States)

    Crone, A.J.; De Martini, P. M.; Machette, M.M.; Okumura, K.; Prescott, J.R.

    2003-01-01

    Paleoseismic studies of two historically aseismic Quaternary faults in Australia confirm that cratonic faults in stable continental regions (SCR) typically have a long-term behavior characterized by episodes of activity separated by quiescent intervals of at least 10,000 and commonly 100,000 years or more. Studies of the approximately 30-km-long Roopena fault in South Australia and the approximately 30-km-long Hyden fault in Western Australia document multiple Quaternary surface-faulting events that are unevenly spaced in time. The episodic clustering of events on cratonic SCR faults may be related to temporal fluctuations of fault-zone fluid pore pressures in a volume of strained crust. The long-term slip rate on cratonic SCR faults is extremely low, so the geomorphic expression of many cratonic SCR faults is subtle, and scarps may be difficult to detect because they are poorly preserved. Both the Roopena and Hyden faults are in areas of limited or no significant seismicity; these and other faults that we have studied indicate that many potentially hazardous SCR faults cannot be recognized solely on the basis of instrumental data or historical earthquakes. Although cratonic SCR faults may appear to be nonhazardous because they have been historically aseismic, those that are favorably oriented for movement in the current stress field can and have produced unexpected damaging earthquakes. Paleoseismic studies of modern and prehistoric SCR faulting events provide the basis for understanding of the long-term behavior of these faults and ultimately contribute to better seismic-hazard assessments.

  13. ROTATIONAL VARIABILITY OF EARTH'S POLAR REGIONS: IMPLICATIONS FOR DETECTING SNOWBALL PLANETS

    International Nuclear Information System (INIS)

    Cowan, Nicolas B.; Robinson, Tyler; Agol, Eric; Meadows, Victoria S.; Shields, Aomawa L.; Livengood, Timothy A.; Deming, Drake; A'Hearn, Michael F.; Wellnitz, Dennis D.; Charbonneau, David; Lisse, Carey M.; Seager, Sara

    2011-01-01

    We have obtained the first time-resolved, disk-integrated observations of Earth's poles with the Deep Impact spacecraft as part of the EPOXI mission of opportunity. These data mimic what we will see when we point next-generation space telescopes at nearby exoplanets. We use principal component analysis (PCA) and rotational light curve inversion to characterize color inhomogeneities and map their spatial distribution from these unusual vantage points, as a complement to the equatorial views presented by Cowan et al. in 2009. We also perform the same PCA on a suite of simulated rotational multi-band light curves from NASA's Virtual Planetary Laboratory three-dimensional spectral Earth model. This numerical experiment allows us to understand what sorts of surface features PCA can robustly identify. We find that the EPOXI polar observations have similar broadband colors as the equatorial Earth, but with 20%-30% greater apparent albedo. This is because the polar observations are most sensitive to mid-latitudes, which tend to be more cloudy than the equatorial latitudes emphasized by the original EPOXI Earth observations. The cloudiness of the mid-latitudes also manifests itself in the form of increased variability at short wavelengths in the polar observations and as a dominant gray eigencolor in the south polar observation. We construct a simple reflectance model for a snowball Earth. By construction, our model has a higher Bond albedo than the modern Earth; its surface albedo is so high that Rayleigh scattering does not noticeably affect its spectrum. The rotational color variations occur at short wavelengths due to the large contrast between glacier ice and bare land in those wavebands. Thus, we find that both the broadband colors and diurnal color variations of such a planet would be easily distinguishable from the modern-day Earth, regardless of viewing angle.

  14. Characterization of phyllosilicates observed in the central Mawrth Vallis region, Mars, their potential formational processes, and implications for past climate

    Science.gov (United States)

    McKeown, N.K.; Bishop, J.L.; Noe Dobrea, E.Z.; Ehlmann, B.L.; Parente, M.; Mustard, J.F.; Murchie, S.L.; Swayze, G.A.; Bibring, J.-P.; Silver, E.A.

    2009-01-01

    Mawrth Vallis contains one of the largest exposures of phyllosilicates on Mars. Nontronite, montmorillonite, kaolinite, and hydrated silica have been identified throughout the region using data from the Compact Reconnaissance Imaging Spectrometer for Mars (CRISM). In addition, saponite has been identified in one observation within a crater. These individual minerals are identified and distinguished by features at 1.38-1.42, ???1.91, and 2.17-2.41 ??m. There are two main phyllosilicate units in the Mawrth Vallis region. The lowermost unit is nontronite bearing, unconformably overlain by an Al-phyllosilicate unit containing montmorillonite plus hydrated silica, with a thin layer of kaolinite plus hydrated silica at the top of the unit. These two units are draped by a spectrally unremarkable capping unit. Smectites generally form in neutral to alkaline environments, while kaolinite and hydrated silica typically form in slightly acidic conditions; thus, the observed phyllosilicates may reflect a change in aqueous chemistry. Spectra retrieved near the boundary between the nontronite and Al-phyllosilicate units exhibit a strong positive slope from 1 to 2 ??m, likely from a ferrous component within the rock. This ferrous component indicates either rapid deposition in an oxidizing environment or reducing conditions. Formation of each of the phyllosilicate minerals identified requires liquid water, thus indicating a regional wet period in the Noachian when these units formed. The two main phyllosilicate units may be extensive layers of altered volcanic ash. Other potential formational processes include sediment deposition into a marine or lacustrine basin or pedogenesis. Copyright 2009 by the American Geophysical Union.

  15. Phylogenetic and functional implications of the ear region anatomy of Glossotherium robustum (Xenarthra, Mylodontidae) from the Late Pleistocene of Argentina

    Science.gov (United States)

    Boscaini, Alberto; Iurino, Dawid A.; Billet, Guillaume; Hautier, Lionel; Sardella, Raffaele; Tirao, German; Gaudin, Timothy J.; Pujos, François

    2018-04-01

    Several detailed studies of the external morphology of the ear region in extinct sloths have been published in the past few decades, and this anatomical region has proved extremely helpful in elucidating the phylogenetic relationships among the members of this mammalian clade. Few studies of the inner ear anatomy in these peculiar animals were conducted historically, but these are increasing in number in recent years, in both the extinct and extant representatives, due to wider access to CT-scanning facilities, which allow non-destructive access to internal morphologies. In the present study, we analyze the extinct ground sloth Glossotherium robustum and provide a description of the external features of the ear region and the endocranial side of the petrosal bone, coupled with the first data on the anatomy of the bony labyrinth. Some features observable in the ear region of G. robustum (e.g., the shape and size of the entotympanic bone and the morphology of the posteromedial surface of the petrosal) are highly variable, both intraspecifically and intraindividually. The form of the bony labyrinth of G. robustum is also described, providing the first data from this anatomical region for the family Mylodontidae. The anatomy of the bony labyrinth of the genus Glossotherium is here compared at the level of the superorder Xenarthra, including all available extant and extinct representatives, using geometric morphometric methods. In light of the new data, we discuss the evolution of inner ear anatomy in the xenarthran clade, and most particularly in sloths, considering the influence of phylogeny, allometry, and physiology on the shape of this highly informative region of the skull. These analyses show that the inner ear of Glossotherium more closely resembles that of the extant anteaters, and to a lesser extent those of the giant ground sloth Megatherium and euphractine armadillos, than those of the extant sloths Bradypus and Choloepus, further demonstrating the striking

  16. Beta transmutations in apatites with ferric iron as an electron acceptor - implication for nuclear waste form development.

    Science.gov (United States)

    Yao, Ge; Zhang, Zelong; Wang, Jianwei

    2017-09-27

    , which is consistent with the minor structure distortions. Increased stability with favorable energetics and structural distortion by incorporating ferric ion is significant with respect without variable valence ions. The results confirm the structural and compositional adaptability of apatites upon beta transmutations. The study suggests that apatite-structured materials could be promising nuclear waste forms to mitigate the beta decay induced instability, by incorporating variable valence cations such as ferric iron in the structure. The study demonstrates a methodology which evaluates the structural stability of waste forms incorporating fission products undergoing beta decay.

  17. Heat flow study of the Emeishan large igneous province region: Implications for the geodynamics of the Emeishan mantle plume

    Science.gov (United States)

    Jiang, Qiang; Qiu, Nansheng; Zhu, Chuanqing

    2018-01-01

    The Emeishan large igneous province (ELIP) is widely considered to be a consequence of a mantle plume. The supporting evidence includes rapid emplacement, voluminous flood basalt eruptions, and high mantle potential temperature estimates. Several studies have suggested that there was surface uplift prior to the eruption of the Emeishan flood basalts. Additionally, the plume's lateral extent is hard to constrain and has been variously estimated to be 800-1400 km in diameter. In this study, we analyzed present-day heat flow data and reconstructed the Permian paleo-heat flow using vitrinite reflectance and zircon (U-Th)/He thermochronology data in the ELIP region and discussed implications for the geodynamics of the Emeishan mantle plume. The present-day heat flow is higher in the inner and intermediate zones than in the outer zone, with a decrease of average heat flow from 76 mW/m2 to 51 mW/m2. Thermal history modeling results show that an abnormal high paleo-heat flow of 90-110 mW/m2 was caused by the Emeishan mantle plume activity. Based on the present-day heat flow data, we can calculate that there is lithospheric thinning in the central ELIP region, which may be due to the destruction of the lithosphere by mantle plume upwelling and magmatic underplating. The Permian paleo-heat flow anomaly implies that there was a temperature anomaly in the mantle. The ascending high-temperature mantle plume and the thinned lithosphere may have induced the large-scale uplift in the ELIP region. According to the range of the surface heat flow anomaly, it can be estimated that the diameter of the flattened head of the Emeishan mantle plume could have reached 1600-1800 km. Our research provides new insights into the geodynamics of the Emeishan mantle plume through study of heat flow.

  18. Pathok Negoro mosque as the form of territorial defense region of Mataram Kingdom of Islam Java in Jogjakarta

    Science.gov (United States)

    Setyowati, E.; Hardiman, G.; Murtini, T. W.

    2018-01-01

    Territory is the space boundary of ownership. Defense concepts of an area also include territory. The defense concept of a territory of power or ownership is usually in the form of fortress, ditch, river, road, alley or gate. Many of these are seen in the forms of old city of Dutch’s inheritances. Javanese Islamic Kingdom in Yogyakarta has territory in the form of mosque. The mosque is called the Pathok Negoro as consists of 4 mosques. This territorial not same with another Islamic kingdoms. The research problem is why mosque used as a form of defense? What is the uniqueness?The purpose of the research is to reveal the form of territory of Javanese Islamic Kingdom. The benefit of this research is to get the characteristic form of territory of Javanese Islamic Kingdom in Yogyakarta. Their located in Ploso Kuning, Mlangi, babadan, Dongkelan, and Wonokromo. The research method that was used was qualitative method with grounded research, by using history and map search.In the analysis was carried out identification and comparison between mosques.The results show that there are characteristics on the location, the building orientation, the landscape, the area pattern and the shape of the building.

  19. Signatures in magnetites formed by (Ca,Mg,Fe)CO3 thermal decomposition: Terrestrial and extraterrestrial implications

    Science.gov (United States)

    Jimenez-Lopez, Concepcion; Rodriguez-Navarro, Carlos; Rodriguez-Navarro, Alejandro; Perez-Gonzalez, Teresa; Bazylinski, Dennis A.; Lauer, Howard V.; Romanek, Christopher S.

    2012-06-01

    It has never been demonstrated whether magnetite synthesized through the heat-dependent decomposition of carbonate precursors retains the chemical and structural features of the carbonates. In this study, synthetic (Ca,Mg,Fe)CO3 was thermally decomposed by heating from 25 to 700 °C under 1 atm CO2, and by in situ exposure under vacuum to the electron beam of a transmission electron microscope. In both cases, the decomposition of the carbonate was topotactic and resulted in porous pseudomorphs composed of oriented aggregates of magnetite nanocrystals. Both calcium and magnesium were incorporated into nanophase magnetite, forming (Ca,Mg)-magnetites and (Ca,Mg)-ferrites when these elements were present in the parent material, thus preserving the chemical signature of the precursor. These results show that magnetites synthesized in this way acquire a chemical and structural inheritance from their carbonate precursor that indicates how they were produced. These results are not only important in the determination of the origin of chemically-impure, oriented nanophase magnetite crystals in general, but they also provide important insights into the origin of the large, euhedral, chemically-pure, [111]-elongated magnetites found within Ca-, Mg- and Fe-rich carbonates of the Martian meteorite ALH84001. Based on our experimental results, the chemically-pure magnetites within ALH84001 cannot be genetically related to the Ca-, Mg- and Fe-rich carbonate matrix within which they are embedded, and an alternative explanation for their occurrence is warranted.

  20. Mutation of the N-Terminal Region of Chikungunya Virus Capsid Protein: Implications for Vaccine Design.

    Science.gov (United States)

    Taylor, Adam; Liu, Xiang; Zaid, Ali; Goh, Lucas Y H; Hobson-Peters, Jody; Hall, Roy A; Merits, Andres; Mahalingam, Suresh

    2017-02-21

    Mosquito-transmitted chikungunya virus (CHIKV) is an arthritogenic alphavirus of the Togaviridae family responsible for frequent outbreaks of arthritic disease in humans. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleolus. In encephalitic alphaviruses, nuclear translocation induces host cell transcriptional shutoff; however, the role of capsid protein nucleolar localization in arthritogenic alphaviruses remains unclear. Using recombinant enhanced green fluorescent protein (EGFP)-tagged expression constructs and CHIKV infectious clones, we describe a nucleolar localization sequence (NoLS) in the N-terminal region of capsid protein, previously uncharacterized in CHIKV. Mutation of the NoLS by site-directed mutagenesis reduced efficiency of nuclear import of CHIKV capsid protein. In the virus, mutation of the capsid protein NoLS (CHIKV-NoLS) attenuated replication in mammalian and mosquito cells, producing a small-plaque phenotype. Attenuation of CHIKV-NoLS is likely due to disruption of the viral replication cycle downstream of viral RNA synthesis. In mice, CHIKV-NoLS infection caused no disease signs compared to wild-type CHIKV (CHIKV-WT)-infected mice; lack of disease signs correlated with significantly reduced viremia and decreased expression of proinflammatory factors. Mice immunized with CHIKV-NoLS, challenged with CHIKV-WT at 30 days postimmunization, develop no disease signs and no detectable viremia. Serum from CHIKV-NoLS-immunized mice is able to efficiently neutralize CHIKV infection in vitro Additionally, CHIKV-NoLS-immunized mice challenged with the related alphavirus Ross River virus showed reduced early and peak viremia postchallenge, indicating a cross-protective effect. The high degree of CHIKV-NoLS attenuation may improve CHIKV antiviral and rational vaccine design. IMPORTANCE CHIKV is a mosquito-borne pathogen capable of causing explosive epidemics of incapacitating joint pain

  1. Greigite formed in early Pleistocene lacustrine sediments from the Heqing Basin, southwest China, and its paleoenvironmental implications

    Science.gov (United States)

    Qiang, Xiaoke; Xu, Xinwen; Zhao, Hui; Fu, Chaofeng

    2018-05-01

    The ferrimagnetic iron sulfide greigite (Fe3S4) occurs widely in sulfidic lacustrine and marine sedimentary environments. Knowledge of its formation and persistence is important for both magnetostratigraphic and paleoenvironmental studies. Although the formation mechanism of greigite has been widely demonstrated, the sedimentary environments associated with greigite formation in lakes, especially on relatively long timescales, are poorly understood. A long and continuous sequence of Pleistocene lacustrine sediments was recovered in the Heqing drill core from southwestern China, which provides an outstanding record of continental climate and environment. Integrated magnetic, geochemical, and paleoclimatic analysis of the lacustrine sequence provides an opportunity to improve our understanding of the environmental controls on greigite formation. Rock magnetic and scanning electron microscope analyses of selected samples from the core reveal that greigite is present in the lower part of the core (part 1, 665.8-372.5 m). Greigite occurs throughout this interval and is the dominant magnetic mineral, irrespective of the climatic state. The magnetic susceptibility (χ) record, which is mainly controlled by the concentration of greigite, matches well with variations in the Indian Summer Monsoon (ISM) index and total organic carbon (TOC) content, with no significant time lag. This indicates that the greigite formed during early diagenesis. In greigite-bearing intervals, with the χ increase, Bc value increase and tends to be stable at about 50 mT. Therefore, we suggest that χ values could estimate the variation of greigite concentration approximately in the Heqing core. Greigite favored more abundant in terrigenous-rich and organic-poor layers associated with weak summer monsoon which are characterized by high χ values, high Fe content, high Rb/Sr ratio and low TOC content. Greigite enhancement can be explained by variations in terrigenous inputs. Our studies demonstrate

  2. Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

    DEFF Research Database (Denmark)

    Coutens, Audrey; Vastel, C.; Hincelin, U.

    2014-01-01

    Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

  3. CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

    NARCIS (Netherlands)

    Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.

    2010-01-01

    We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

  4. The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

    Science.gov (United States)

    Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

    2018-05-01

    Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  5. From Theory to Experiment: Hadron Electromagnetic Form Factors in Space-like and Time-like Regions

    International Nuclear Information System (INIS)

    Tomasi-Gustafsson, E.; Gakh, G.I.; Rekalo, A.P.

    2007-01-01

    Hadron electromagnetic form factors contain information on the intrinsic structure of the hadrons. The pioneering work developed at the Kharkov Physical-Technical Institute in the 60's on the relation between the polarized cross section and the proton form factors triggered a number of experiments. Such experiments could be performed only recently due to the progress in accelerator and polarimetry techniques. The principle of these measurements is recalled and surprise and very precise results obtained on proton are presented. The actual status of nucleon electromagnetic form factors is reviewed, with special attention to the basic work done in Kharkov Physical-Technical Institute. This Paper is devoted to the memory of Prof. M.P. Rekalo

  6. Indocyanine Green Angiographic and Multifocal Electroretinographic Features in the Diffuse and Regional Form of Bietti′s Crystalline Retinopathy

    Institute of Scientific and Technical Information of China (English)

    Libin Jiang; Feng Wen; Lezheng Wu; Hong Yan; Shixing Hu

    2002-01-01

    Prpose: To observe different features of indocyanine green angiography(ICGA) andtifocal electroretinography (ERG) in the diffuse and regional type of Bieti′sc stalline retinopathy (BCR). Thods: ICGA and the multifocal ERG were performed in two cases of the diffuse andregional type of BCR respectively. These data were compared with fluoresceinangiography (FA), standard Ganzfeld ERG, and visual field testing. Results: In the regional case, ICGA revealed reduced perfusion of the choroidalcirculation in the early phase and multiple hypofluorescent spots in the posterior pole in the late phase, due to choriocapillaris filling defect; the extent of choroiocapillaris losswas shown in early phase of ICGA and there were multifocal hyperfluorescent dotssurrounding hypofluorescent spots in late phase in the diffuse case. The multifocal ERGshowed that the central responses were markedly depressed, corresponding to the visualfield defects, while the findings of Ganzfeld ERG were normal in the regional BCR;however, both the multifocal ERG and Ganzfeld ERG were severely subnormal in thediffuse case.Conclusions: The features of ICGA and multifocal ERG are different between the diffuseand regional BCR. In the meantime, the two tools are also useful to differentiate the typeand assess the extentof evolution in BCR.

  7. Preliminary results from the ESA STSE project on SST diurnal variability, its regional extent and implications in atmospheric modelling (SSTDV:R.EX.–IM.A.M.)

    DEFF Research Database (Denmark)

    Karagali, Ioanna; Hasager, Charlotte Bay; Høyer, Jacob L.

    2013-01-01

    This study presents some preliminary results of the ESA Support To Science Element (STSE) funded project on the Diurnal Variability of the Sea Surface Temperature, regarding its Regional Extend and Implications in Atmospheric Modelling (SSTDV:R.EX.–IM.A.M.). Comparisons of SEVIRI SST with AATSR...

  8. Direct Measurement of Dust Attenuation in z approx. 1.5 Star-Forming Galaxies from 3D-HST: Implications for Dust Geometry and Star Formation Rates

    Science.gov (United States)

    Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B; Conroy, Charlie; Schreiber, Natascha M. Foerster; Franx, Marijn; Fumagalli, Mattia; Lundren, Britt; Momcheva, Ivelina; Nelson, Erica J.; hide

    2013-01-01

    The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust towards star-forming regions (measured using Balmer decrements) and the integrated dust properties (derived by comparing spectral energy distributions [SEDs] with stellar population and dust models) for a statistically significant sample of distant galaxies. We select a sample of 163 galaxies between 1.36 or = 5 and measure Balmer decrements from stacked spectra. First, we stack spectra in bins of integrated stellar dust attenuation, and find that there is extra dust extinction towards star-forming regions (AV,HII is 1.81 times the integrated AV, star), though slightly lower than found for low-redshift starburst galaxies. Next, we stack spectra in bins of specific star formation rate (log sSFR), star formation rate (log SFR), and stellar mass (logM*). We find that on average AV,HII increases with SFR and mass, but decreases with increasing sSFR. The amount of extra extinction also decreases with increasing sSFR and decreasing stellar mass. Our results are consistent with the two-phase dust model - in which galaxies contain both a diffuse and a stellar birth cloud dust component - as the extra extinction will increase once older stars outside the star-forming regions become more dominant. Finally, using our Balmer decrements we derive dust-corrected H(alpha) SFRs, and find evidence that SED fitting produces incorrect SFRs if very rapidly declining SFHs are included in the explored parameter space. Subject headings: dust, extinction- galaxies: evolution- galaxies: high-redshift

  9. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia.

    Science.gov (United States)

    Gilaie-Dotan, Sharon

    2016-03-01

    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. A PHOTON-DOMINATED REGION MODEL FOR THE FIR MID-J CO LADDER WITH UNIVERSAL ROTATIONAL TEMPERATURE IN STAR FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seokho; Park, Yong-Sun [Astronomy Program, Department of Physics and Astronomy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Lee, Jeong-Eun [Department of Astronomy and Space Science, Kyung Hee University, Yongin-shi, Kyungki-do 449-701 (Korea, Republic of); Bergin, Edwin A., E-mail: shlee@astro.snu.ac.kr [Department of Astronomy, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States)

    2014-08-01

    A photon-dominated region (PDR) is one of the leading candidate mechanisms for the origin of warm CO gas with near universal ∼300 K rotational temperature inferred from the CO emission detected toward embedded protostars by Herschel/PACS. We have developed a PDR model in general coordinates, where we can use the most adequate coordinate system for an embedded protostar having outflow cavity walls, to solve chemistry and gas energetics self-consistently for given UV radiation fields with different spectral shapes. Simple one-dimensional tests and applications show that FIR mid-J (14 ≤ J ≤ 24) CO lines are emitted from close to the surface of a dense region exposed to high UV fluxes. We apply our model to HH46 and find that the UV-heated outflow cavity wall can reproduce the mid-J CO transitions observed by Herschel/PACS. A model with UV radiation corresponding to a blackbody of 10,000 K results in a rotational temperature lower than 300 K, while models with the Draine interstellar radiation field and the 15,000 K blackbody radiation field predict a rotational temperature similar to the observed one.

  11. Can regional strain and strain rate measurement be performed during both dobutamine and exercise echocardiography, and do regional deformation responses differ with different forms of stress testing?

    Science.gov (United States)

    Davidavicius, Giedrius; Kowalski, Miroslaw; Williams, R Ian; D'hooge, Jan; Di Salvo, Giovanni; Pierre-Justin, Gilbert; Claus, Piet; Rademakers, Frank; Herregods, Marie-Christine; Fraser, Alan G; Pierard, Luc A; Bijnens, Bart; Sutherland, George R

    2003-04-01

    Regional strain (epsilon) and strain rate (SR) measurement could be the optimal approach to quantifying stress echocardiography images. However, signal noise could preclude their use. Study aims Our aim was to compare the feasibility of regional peak systolic (p) velocity (Vel), pSR/epsilon measurement, and their normal responses during upright (group 1, n = 10) and supine (group 2, n = 10) bicycle exercise and (group 3, n = 10) dobutamine stress. For each type of stress study, pVel/pSR/epsilon data were acquired at baseline, low (100-120 bpm), and peak (140-160 bpm) heart rate (HR); and during recovery. During dobutamine pVel/pSR/epsilon were interpretable in >95% of segments at every stress stage, whereas in groups 1 and 2 pSR/epsilon responses were noninterpretable in >36% of segments (P pVel and SR values increased linearly and reached maximal value at peak HR (P pVel increased linearly, whereas pepsilon response was biphasic as a result of the reduced filling at higher HRs.

  12. The Implication of Agricultural Expansion on the Groundwater Flow Regime of Saq Aquifer in Al Qassim Region, Saudi Arabia

    Science.gov (United States)

    Alharbi, T.; Mansour Helmy, B. M.

    2017-12-01

    Al-Qassim Region in Saudi Arabia is characterized by expanding agricultural activities. Most agricultural fields are irrigated by groundwater, mainly from the Saq aquifer. Excessive water extraction from this aquifer and arid climatic conditions negatively alter the quality and quantity of the groundwater. In this study, detailed hydrological and hydrogeological investigations were carried out to characterize spatially the potential groundwater recharge zones, deal with the estimation of groundwater balance of the Saq aquifer in the study area and to assess the safe yield of the aquifer. Accordingly, the implication of agricultural expansion on groundwater flow regime of Saq aquifer and its relation with safe yield and groundwater recharge was evaluated. The water-budget was calculated and the main water Inputs and outputs were measured. Change detections of agricultural areas in the region for years, 1983, 1995 and 2005 were conducted using Landsat Satellite images and results were compared to water levels for same years. There are two potential recharge zones for Saq aquifer in the area, both are structurally controlled. The first zone is the outlet of wadi Ar Risha basin in south-eastern corner of the study area. The second is the western water divide of wadi Turfiya basin in the North west. Results of the study also indicated that 96.4 % of the total abstraction is consumed for agriculture supply. The present abstractions exceed both recharge and safe yield of the aquifer system, thus the aquifer is overexploited and mined. The average decrease in groundwater storage during the year 1983-2005 was estimated to be 33.4 Mm3, representing an average yearly decline of 1.98 m of the water table.

  13. First recorded loss of an emperor penguin colony in the recent period of Antarctic regional warming: implications for other colonies.

    Directory of Open Access Journals (Sweden)

    Philip N Trathan

    Full Text Available In 1948, a small colony of emperor penguins Aptenodytes forsteri was discovered breeding on Emperor Island (67° 51' 52″ S, 68° 42' 20″ W, in the Dion Islands, close to the West Antarctic Peninsula (Stonehouse 1952. When discovered, the colony comprised approximately 150 breeding pairs; these numbers were maintained until 1970, after which time the colony showed a continuous decline. By 1999 there were fewer than 20 pairs, and in 2009 high-resolution aerial photography revealed no remaining trace of the colony. Here we relate the decline and loss of the Emperor Island colony to a well-documented rise in local mean annual air temperature and coincident decline in seasonal sea ice duration. The loss of this colony provides empirical support for recent studies (Barbraud & Weimerskirch 2001; Jenouvrier et al 2005, 2009; Ainley et al 2010; Barber-Meyer et al 2005 that have highlighted the vulnerability of emperor penguins to changes in sea ice duration and distribution. These studies suggest that continued climate change is likely to impact upon future breeding success and colony viability for this species. Furthermore, a recent circumpolar study by Fretwell & Trathan (2009 highlighted those Antarctic coastal regions where colonies appear most vulnerable to such changes. Here we examine which other colonies might be at risk, discussing various ecological factors, some previously unexplored, that may also contribute to future declines. The implications of this are important for future modelling work and for understanding which colonies actually are most vulnerable.

  14. Regions of existence of two forms of the critical void fraction dependence on heat flux density at burnout

    International Nuclear Information System (INIS)

    Smolin, V.N.

    1981-01-01

    On the basis of the available experimental data considered is the burnout during the movement of steam-water flow in vertical heated tubes with internal diameter from 8 to 40 mm. Critical steam content Xsub(cr) dependences on the critical heat flux qsub(cr) in different tubes and under different pressure are analyzed. Two main regions of the weak and strong dependences Xsub(cr)=f(qsub(cr)) at burnout are found out [ru

  15. Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

    Directory of Open Access Journals (Sweden)

    Darya-Anna Alekseevna Kaibiyainen

    2015-03-01

    Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

  16. Air pollution and health implications of regional electricity transfer at generational centre and design of compensation mechanism

    Science.gov (United States)

    Relhan, Nemika

    India's electricity generation is primarily from coal. As a result of interconnection of grid and establishment of pithead power plants, there has been increased electricity transfer from one region to the other. This results in imbalance of pollution loads between the communities located in generation vis-a-vis consumption region. There may be some states, which are major power generation centres and hence are facing excessive environmental degradation. On the other hand, electricity importing regions are reaping the benefits without paying proper charges for it because present tariff structure does not include the full externalities in it. The present study investigates the distributional implications in terms of air pollution loads between the electricity generation and consumption regions at the state level. It identifies the major electricity importing and exporting states in India. Next, as a case study, it estimates the health damage as a result of air pollution from thermal power plants (TPPs) located in a critically polluted region that is one of the major generator and exporter of electricity. The methodology used to estimate the health damage is based on impact pathway approach. In this method, air pollution modelling has been performed in order to estimate the gridded Particulate Matter (PM) concentration at various receptor locations in the study domain. The air quality modeling exercise helps to quantify the air pollution concentration in each grid and also apportion the contribution of power plants to the total concentration. The health impacts as a result of PM have been estimated in terms of number of mortality and morbidity cases using Concentration Response Function (CRF's) available in the literature. Mortality has been converted into Years of Life Lost (YOLL) using life expectancy table and age wise death distribution. Morbidity has been estimated in terms of number of cases with respect to various health end points. To convert this health

  17. Evaluation of the ability of commercial wine yeasts to form biofilms (mats) and adhere to plastic: implications for the microbiota of the winery environment.

    Science.gov (United States)

    Tek, Ee Lin; Sundstrom, Joanna F; Gardner, Jennifer M; Oliver, Stephen G; Jiranek, Vladimir

    2018-02-01

    Commercially available active dried wine yeasts are regularly used by winemakers worldwide to achieve reliable fermentations and obtain quality wine. This practice has led to increased evidence of traces of commercial wine yeast in the vineyard, winery and uninoculated musts. The mechanism(s) that enables commercial wine yeast to persist in the winery environment and the influence to native microbial communities on this persistence is poorly understood. This study has investigated the ability of commercial wine yeasts to form biofilms and adhere to plastic. The results indicate that the biofilms formed by commercial yeasts consist of cells with a combination of different lifestyles (replicative and non-replicative) and growth modes including invasive growth, bud elongation, sporulation and a mat sectoring-like phenotype. Invasive growth was greatly enhanced on grape pulp regardless of strain, while adhesion on plastic varied between strains. The findings suggest a possible mechanism that allows commercial yeast to colonise and survive in the winery environment, which may have implications for the indigenous microbiota profile as well as the population profile in uninoculated fermentations if their dissemination is not controlled. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Understanding culture in territorial management and its implications for spatial planning. The case of floodplain management in urbanised delta regions in the Netherlands and Thailand

    Directory of Open Access Journals (Sweden)

    Suwanna Rongwiriyaphanich

    2014-08-01

    Full Text Available Previous experiences have shown that the implementation of planning policy does not always lead to the originally intended territorial management outcomes. This issue
is particularly crucial when policy ideas, institutions, models and programmes are transferred into places with different cultural settings without adaptations (Knieling and Othengrafen 2009b; Sanyal 2005. These unexpected consequences in planning practice and management outcomes have brought a significant amount of attention to the importance and roles of culture on shaping decision-making in territorial management process and determining transferability of a policy (Friedmann 2005a, 2005b; de Jong and Mamadouh 2002; Sanyal 2005; Ostrom 2005a; Knieling and Othengrafen 2009b. However, conceptual frameworks that seek to understand the roles of culture and its implications for spatial planning are still rather limited. This study presents and applies an integrative conceptual framework which is used
to explain how culture, planning policy and territorial management outcomes are interrelated, and what the implications are for spatial planning. The framework integrates relevant theories and ideas from anthropology, organisational management and political sciences to understand influences of culture on spatial planning. The integrative framework suggests a way of characterising territorial management in the form of ideal types. This helps simplify cultures regarding territorial management to make them comparable. It enables an analysis of ‘cultures’ that includes a broader scope of culture than existing frameworks that focus primarily on ‘planning cultures’ expressed in forms of planning systems, organisations and instruments. This broader scope includes also the implicit expressions of culture in informal forms, such as ideas, customs and social behaviours shared by involved actors in the management of a given territory. The framework also offers two analytical perspectives

  19. Notes on the origin of extensive endorheic regions in central and northern Mexico, and some implications for paleozoogeography

    Science.gov (United States)

    Aranda-Gómez, José Jorge; Carranza-Castañeda, Oscar; Wang, Xiaoming; Tseng, Z. Jack; Pacheco-Castro, Adolfo

    2018-04-01

    speciations that are interpreted as evidence of several events of drainage system rearrangement either by stream capture, beheading, or river diversion or by fragmentation caused by formation of closed basins by faulting, volcanic activity or isostatic rebound in the footwall block of normal faults. The western boundaries of the extensive endorheic regions in Mexico are controlled mainly by a highland produced by intense felsic volcanism during the Sierra Madre Occidental activity (Eocene - Miocene), and the eastern hydrological divide coincides with mountains associated with the fold and thrust belt produced by the Hidalgoan orogeny in early Cenozoic time. Normal faulting associated with Basin and Range extension formed additional closed basins. Another major factor in the formation of the endorheic regions is the terminal Miocene climate change, which caused runoff reduction and lowered the rivers capacity of erosion. Opening of the Gulf of California changed the overall slope of rivers draining into the Pacific in northwestern Mexico triggering the capture of rivers formerly confined to the closed basins or draining to the Gulf of Mexico. Quaternary normal faults have been documented a few tens of kilometers from the hydrological divides of the endorheic regions, suggesting that in some regions there is an active tectonic component in their formation. The location of the crossing point for the otters is uncertain as the fossil record is scant and investigation on the evolution of drainage systems through time in Mexico is in the early stages. However, it is argued that there is a fair chance that the crossing occurred via the Mezquital river capture near Durango city. Isotopic age of the sediments where the Enhydritherium terraenovae fossil was collected, imply that the capture must have occurred in the late Miocene.

  20. The carbonate mineralogy and distribution of habitat-forming deep-sea corals in the southwest pacific region

    Science.gov (United States)

    Bostock, Helen C.; Tracey, Dianne M.; Currie, Kim I.; Dunbar, Gavin B.; Handler, Monica R.; Mikaloff Fletcher, Sara E.; Smith, Abigail M.; Williams, Michael J. M.

    2015-06-01

    Habitat-forming deep-sea scleractinian and alcyonacean corals from around the southwest Pacific were analysed for their calcium carbonate mineralogy. Scleractinian coral species Solenosmilia variabilis, Enallopsammia rostrata, Goniocorella dumosa, Madrepora oculata and Oculina virgosa were all found to be 100% aragonitic, while some members of the alcyonacean taxa Keratoisis spp., Lepidisis spp., and Paragorgia spp. were determined to be high magnesium (Mg) calcite (with 8-11 mol% MgCO3) and Primnoa sp. is bimineralic with both aragonite and Mg calcite. The majority of these habitat-forming deep-sea corals are found at intermediate depths (800-1200 m) in the Antarctic Intermediate Waters (AAIW) with low salinities (~34.5), temperatures of 4-8 °C and high oxygen concentrations (>180 μmol/kg) and currently sitting above the aragonite saturation horizon (ASH). However, habitat-forming corals have been recorded from greater depths, in cooler waters (2-4 °C) that are undersaturated with respect to aragonite (Ωaragonite160 μmol/kg. To address the sampling depth bias the coral records were normalised by the number of benthic stations (sampling effort) in the same depth range. This shows that the highest number of corals per sampling effort is between 1000 and 1400 m with corals present in over 5% of the stations at these depths. The normalised records and Boot Strap analyses suggests that scleractinian corals, especially S. variabilis should be present in >1% of stations down to 1800 m water depth, with E. rostrata, M. oculata and G. dumosa slightly shallower. While alcyonacean corals are found in >1% down to 2600 m, with Keratoisis spp. the deepest down to 2600 m, while Lepidisis spp. and Paragorgia spp. found down to 1800 m. This suggests that most species can probably tolerate some undersaturation of aragonite (Ωaragonite=0.8-0.9), with several species/genera (S. variabilis; Keratoisis spp.) even more tolerant of lower carbonate concentrations ([CO3 2 -]), down

  1. Geophysical Data (Gravity and Magnetic) from the Area Between Adana, Kahramanmaras and Hatay in the Eastern Mediterranean Region: Tectonic Implications

    Science.gov (United States)

    Over, Semir; Akin, Ugur; Sen, Rahime

    2018-01-01

    The gravity and magnetic maps of the area between Adana-Kahramanmaras-Hatay provinces were produced from a compilation of data gathered during the period between 1973 and 1989. Reduced to the pole (RTP) and pseudo-gravity transformation (PGT) methods were applied to the magnetic data, while derivative ratio (DR) processing was applied to both gravity and magnetic data, respectively. Bouguer, RTP and PGT maps show the image of a buried structure corresponding to ophiolites under undifferentiated Quaternary deposits in the Adana depression and Iskenderun Gulf. DR maps show two important faults which reflect the tectonic framework in the study area: (1) the Karatas-Osmaniye Fault extending from Osmaniye to Karatas in the south between Adana and Iskenderun depressions and (2) Amanos Fault (southern part of East Anatolian Fault) in the Hatay region running southward from Turkoglu to Amik Basin along Amanos Mountain forming the actual plate boundary between the Anatolian block (part of Eurasian plate) and Arabian plate.

  2. Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

    International Nuclear Information System (INIS)

    Quenzer, A.

    1977-01-01

    The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

  3. Forecasting how residential urban form affects the regional carbon savings and costs of retrofitting and decentralized energy supply

    International Nuclear Information System (INIS)

    Hargreaves, Anthony; Cheng, Vicky; Deshmukh, Sandip; Leach, Matthew; Steemers, Koen

    2017-01-01

    Highlights: • An innovative model for testing combinations of spatial planning and decentralised energy supply. • An improved method of modelling the spatial variability of energy consumption per dwelling type. • Shows how spatial planning would affect the future carbon reduction of decentralised supply. • Forecasts the future carbon reduction and costs of retrofitting and decentralised supply. • A method of forecasting how residential space would affect the suitability of decentralised supply. - Abstract: Low carbon energy supply technologies are increasingly used at the building and community scale and are an important part of the government decarbonisation strategy. However, with their present state of development and costs, many of these decentralised technologies rely on public subsidies to be financially viable. It is questionable whether they are cost effective compared to other ways of reducing carbon emissions, such as decarbonisation of conventional supply and improving the energy efficiency of dwellings. Previous studies have found it difficult to reliably estimate the future potential of decentralised supply because this depends on the available residential space which varies greatly within a city region. To address this problem, we used an integrated modelling framework that converted the residential density forecasts of a regional model into a representation of the building dimensions and land of the future housing stock. This included a method of estimating the variability of the dwellings and residential land. We present the findings of a case study of the wider south east regions of England that forecasted the impacts of energy efficiency and decentralised supply scenarios to year 2031. Our novel and innovative method substantially improves the spatial estimates of energy consumption compared to building energy models that only use standard dwelling typologies. We tested the impact of an alternative spatial planning policy on the future

  4. Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

    Directory of Open Access Journals (Sweden)

    Mahesh Anantha Narayanan

    2014-01-01

    Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.

  5. CONDITION OF DECENTRALIZATION AND ORGANIZATIONAL LEGAL FORMS OF SUSTAINABLE DEVELOPMENT OF REGIONS OF UKRAINE IN THE CONTEXT OF THE GLOBAL EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Nadiia Kulchytska

    2016-06-01

    Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

  6. Atomic motions in the αβ-region of glass-forming polymers: molecular versus mode coupling theory approach

    International Nuclear Information System (INIS)

    Colmenero, Juan; Narros, Arturo; Alvarez, Fernando; Arbe, Arantxa; Moreno, Angel J

    2007-01-01

    We present fully atomistic molecular dynamics simulation results on a main-chain polymer, 1,4-polybutadiene, in the merging region of the α- and β-relaxations. A real-space analysis reveals the occurrence of localized motions ('β-like') in addition to the diffusive structural relaxation. A molecular approach provides a direct connection between the local conformational changes reflected in the atomic motions and the secondary relaxations in this polymer. Such local processes occur just in the time window where the β-process of the mode coupling theory is expected. We show that the application of this theory is still possible and yields an unusually large value of the exponent parameter. This result might originate from the competition between two mechanisms for dynamic arrest: intermolecular packing and intramolecular barriers for local conformational changes ('β-like')

  7. Introduction of the flora, life forms and chorology of plants of some regions in western Chabahar (Sistan and Baluchestan Province

    Directory of Open Access Journals (Sweden)

    Somayeh Salimi

    2014-12-01

    Full Text Available This study focused on Zarabad, Cheraghabad and Nogombecom plants of sub-basin watershed city of Chabahar, Iran. The studied flora included 78 species which belonged to 66 genera and 29 families. Poaceae with 16 genera and 19 species, Asteraceae with 7 genera and 8 species, Chenopodiaceae with 5 genera and 4 species, Papilionaceae, with 5 genera and 6 species, constituted the largest plant families respectively. The largest genera of the region were: Salsola, Heliotropium and Plantago, respectively. 42% of the flora belonged to Nobo-Sindian elements, 35%to Irano-Turanian, 18%were bioregional elements and 5% of the species were cosmopolitan. Flora of the studied area, included therophytes (56%, chamaephytes (15%, phanerophytes (14%, geophytes (12% and hemicryptophytes (3%.

  8. [FEATURES OF THE CONTENT OF MOVABLE FORMS OF HEAVY METALS AND SELENIUM IN SOILS OF THE YAROSLAVL REGION].

    Science.gov (United States)

    Bakaeva, E A; Eremeyshvili, A V

    2016-01-01

    With the use of the method of inversion voltammetry there was analyzed the content of movableforms of trace elements: (selenium, zinc, copper lead, cadmium) in soils in the Yaroslavl district of the Yaroslavl region, and also content of zinc, copper lead, cadmium in soils and snow cover in the city of Yaroslavl. According to values of concentrations of movable compounds in soils determined trace elements can be ranked into the following row: zinc > lead > copper > selenium > cadmium. There was revealed insufficient if compared with literature data concentrations, content of movable compounds of selenium, copper and zinc in examined explored soils. The maximal concentrations of lead are revealed in the close proximity to both the city of Yaroslavl and large highways of the city. It indicates to the anthropogenic pollution of soils by this element.

  9. The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Oleynik Olga Stepanovna

    2014-12-01

    Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

  10. Regional variation in pig farmer awareness and actions regarding Japanese encephalitis in Nepal: implications for public health education.

    Directory of Open Access Journals (Sweden)

    Santosh Dhakal

    Full Text Available Japanese encephalitis (JE is a mosquito-borne zoonotic disease that has pigs as the major amplifying hosts. It is the most important cause of viral encephalitis in people in Nepal and is spreading in its geographic distribution in that country. Pig farming is increasing in Nepal due to reducing cultural biases against pigs and government programs to support pig farming for poverty alleviation. Major strategies for JE prevention and control include education, vector control, and immunization of people and pigs. This study used a survey of 400 pig farmers in 4 areas of Nepal with different JE and pig farming histories to explore regional variations in farmer awareness and actions towards JE, the association of awareness and actions with farm and farmer variables, and the implications of these associations for public health education. Exposure to JE risk factors was common across pig farms and pig farming districts but there were significant district level differences in knowledge and practices related to on-farm JE risk reduction. Social factors such as literacy, gender, and cultural practices were associated with farmer attitudes, knowledge and practices for JE control. JE vaccine uptake was almost non-existent and mosquito control steps were inconsistently applied across all 4 districts. Income was not a determining factor of the differences, but all farmers were very poor. The low uptake of vaccine and lack of infrastructure or financial capacity to house pigs indoors or away from people suggest that farmer personal protection should be a priority target for education in Nepal. This study re-enforces the need to attack root causes of people's personal disease prevention behaviours and take into account local variation in needs and capacities when designing health or agriculture education programs.

  11. Trace element and isotopic compositions of Vietnamese basalts: implications for mantle dynamics in the southeast Asian region

    International Nuclear Information System (INIS)

    Nguyen, H.; Fower, M.; Nguyen, H.; Nguyen, X.B.; Nguyen, T.Y.

    1996-01-01

    Cenozoic basalts in Indo-China are part of a regional melting episode along the rifted Eurasian margin. Trace element and isotopic compositions of Vietnamese basalts are used to place constraints on the extent of lithospheric and asthenosphere contributions to the melts and possible mantle dynamic implications. The 87 Sr/ 86 Sr, 207 Pb/ 204 Pb, and 208 Pb/ 204 Pb isotopic ratios of the basalts reflect minimal crustal wall rock reaction, and variable enrichment in EM1 and EM2 of a 208 Pb-rich MORB-like source. Some, but not all, of this variation corresponds to the age of lithospheric sector penetrated. Basalts erupted through a cratonic, central sector (e.g. at Quang Ngai, Pleiku, Song Cau, Kong Plong, and Buon Ma Thuot) and off-cratonic, southwest sector (e.g. Phuoc Long) resemble those of EM2-rich basalts from southern and southeaster China and the South China Sea. Basalts from an off-cratonic, southeast sector (e.g. from Dalat, Xuan Loc, and the offshore Ile des Cendres-Phu Cuy complex) reflect mixing between a low- 206 Pb/ 204 Pb, high- 208 Pb/ 204 Pb, EM1-like component, and resemble basalts from northwest Taiwan, eastern and northeastern China, and parts of the Japan Sea. While EM2 tends to characterise lithospheric sectors, presence of EM1 in off-cratonic rather than cratonic basalts implies an asthenosphere rather than lithospheric source. Pervasive presence of EM1 in southeast Asian and marginal basin asthenosphere corresponds with thermally-anomalous mantle and may involve delaminated cratonic substrate entrained by mobile, extruded asthenosphere. (authors)

  12. A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

    Directory of Open Access Journals (Sweden)

    Barrado y Navascués D.

    2011-07-01

    Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

  13. Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey.

    Science.gov (United States)

    Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A

    2014-10-01

    Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

  14. Increased functional connectivity between superior colliculus and brain regions implicated in bodily self-consciousness during the rubber hand illusion.

    Science.gov (United States)

    Olivé, Isadora; Tempelmann, Claus; Berthoz, Alain; Heinze, Hans-Joachim

    2015-02-01

    Bodily self-consciousness refers to bodily processes operating at personal, peripersonal, and extrapersonal spatial dimensions. Although the neural underpinnings of representations of personal and peripersonal space associated with bodily self-consciousness were thoroughly investigated, relatively few is known about the neural underpinnings of representations of extrapersonal space relevant for bodily self-consciousness. In the search to unravel brain structures generating a representation of the extrapersonal space relevant for bodily self-consciousness, we developed a functional magnetic resonance imaging (fMRI) study to investigate the implication of the superior colliculus (SC) in bodily illusions, and more specifically in the rubber hand illusion (RHi), which constitutes an established paradigm to study the neural underpinnings of bodily self-consciousness. We observed activation of the colliculus ipsilateral to the manipulated hand associated with eliciting of RHi. A generalized form of context-dependent psychophysiological interaction analysis unravelled increased illusion-dependent functional connectivity between the SC and some of the main brain areas previously involved in bodily self-consciousness: right temporoparietal junction (rTPJ), bilateral ventral premotor cortex (vPM), and bilateral postcentral gyrus. We hypothesize that the collicular map of the extrapersonal space interacts with maps of the peripersonal and personal space generated at rTPJ, vPM and the postcentral gyrus, producing a unified representation of space that is relevant for bodily self-consciousness. We suggest that processes of multisensory integration of bodily-related sensory inputs located in this unified representation of space constitute one main factor underpinning emergence of bodily self-consciousness. © 2014 Wiley Periodicals, Inc.

  15. Regulations of irrigation on regional climate in the Heihe watershed, China, and its implications to water budget

    Science.gov (United States)

    Zhang, X.

    2015-12-01

    In the arid area, such as the Heihe watershed in Northwest China, agriculture is heavily dependent on the irrigation. Irrigation suggests human-induced hydro process, which modifies the local climate and water budget. In this study, we simulated the irrigation-induced changes in surface energy/moisture budgets and modifications on regional climate, using the WRF-NoahMP modle with an irrigation scheme. The irrigation scheme was implemented following the roles that soil moisture is assigned a saturated value once the mean soil moisture of all root layers is lower than 70% of fileld capacity. Across the growth season refering from May to September, the simulated mean irrigation amount of the 1181 cropland gridcells is ~900 mm, wihch is close to the field measurments of around 1000 mm. Such an irrigation largely modified the surface energy budget. Due to irrigation, the surface net solar radiation increased by ~76.7 MJ (~11 Wm-2) accouting for ~2.3%, surface latent and senbile heat flux increased by 97.7 Wm-2 and decreased by ~79.7 Wm-2 respectively; and local daily mean surface air temperature was thereby cooling by ~1.1°C. Corresponding to the surface energy changes, wind and circulation were also modified and regional water budget is therefore regulated. The total rainfall in the irrigation area increased due to more moisture from surface. However, the increased rainfall is only ~6.5mm (accounting for ~5% of background rainfall) which is much less than the increased evaporation of ~521.5mm from surface. The ~515mm of water accounting for 57% of total irrigation was transported outward by wind. The other ~385 mm accounting for 43% of total irrigation was transformed to be runoff and soil water. These results suggest that in the Heihe watershed irrigation largely modify local energy budget and cooling surface. This study also implicate that the existing irrigation may waste a large number of water. It is thereby valuable to develope effective irrigation scheme to

  16. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  17. Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region.

    Science.gov (United States)

    Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J

    2017-01-01

    The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  18. Social theory and the region: from the Regional Planning Association of America to the restructuring of sociospatial theory, with policy implications

    OpenAIRE

    R Banai

    1993-01-01

    In this paper an argument is developed in support of the relevance of social theory for the region. Characterized by bridging across conceptual and methodological divides, by the increasing prominence of the role of space, context, and human agency, social theory exhibits an affinity with the regional development theory of the Regional Planning Association of America (RPAA) in the 1920s. This paper provides a brief account of the RPAA's approach to regional synthesis. The author alms to build...

  19. The Gould's Belt Distances Survey (GOBELINS). IV. Distance, Depth, and Kinematics of the Taurus Star-forming Region

    Science.gov (United States)

    Galli, Phillip A. B.; Loinard, Laurent; Ortiz-Léon, Gisela N.; Kounkel, Marina; Dzib, Sergio A.; Mioduszewski, Amy J.; Rodríguez, Luis F.; Hartmann, Lee; Teixeira, Ramachrisna; Torres, Rosa M.; Rivera, Juana L.; Boden, Andrew F.; Evans, Neal J., II; Briceño, Cesar; Tobin, John J.; Heyer, Mark

    2018-05-01

    We present new trigonometric parallaxes and proper motions of young stellar objects in the Taurus molecular cloud complex from observations collected with the Very Long Baseline Array as part of the Gould’s Belt Distances Survey. We detected 26 young stellar objects and derived trigonometric parallaxes for 18 stars with an accuracy of 0.3% to a few percent. We modeled the orbits of six binaries and determined the dynamical masses of the individual components in four of these systems (V1023 Tau, T Tau S, V807 Tau, and V1000 Tau). Our results are consistent with the first trigonometric parallaxes delivered by the Gaia satellite and reveal the existence of significant depth effects. We find that the central portion of the dark cloud Lynds 1495 is located at d =129.5 ± 0.3 pc, while the B216 clump in the filamentary structure connected to it is at d = 158.1 ± 1.2 pc. The closest and remotest stars in our sample are located at d = 126.6 ± 1.7 pc and d = 162.7 ± 0.8 pc, yielding a distance difference of about 36 pc. We also provide a new distance estimate for HL Tau that was recently imaged. Finally, we compute the spatial velocity of the stars with published radial velocity and investigate the kinematic properties of the various clouds and gas structures in this region.

  20. Premonsoon Aerosol Characterization and Radiative Effects Over the Indo-Gangetic Plains: Implications for Regional Climate Warming

    Science.gov (United States)

    Gautam, Ritesh; Hsu, N. Christina; Lau, K.-M.

    2010-01-01

    The Himalayas have a profound effect on the South Asian climate and the regional hydrological cycle, as it forms a barrier for the strong monsoon winds and serves as an elevated heat source, thus controlling the onset and distribution of precipitation during the Indian summer monsoon. Recent studies have suggested that radiative heating by absorbing aerosols, such as dust and black carbon over the Indo-Gangetic Plains (IGP) and slopes of the Himalayas, may significantly accelerate the seasonal warming of the Hindu Kush-Himalayas-Tibetan Plateau (HKHT) and influence the subsequent evolution of the summer monsoon. This paper presents a detailed characterization of aerosols over the IGP and their radiative effects during the premonsoon season (April-May-June) when dust transport constitutes the bulk of the regional aerosol loading, using ground radiometric and spaceborne observations. During the dust-laden period, there is a strong response of surface shortwave flux to aerosol absorption indicated by the diurnally averaged forcing efficiency of -70 W/sq m per unit optical depth. The simulated aerosol single-scattering albedo, constrained by surface flux and aerosol measurements, is estimated to be 0.89+/- 0.01 (at approx.550 nm) with diurnal mean surface and top-of-atmosphere forcing values ranging from -11 to -79.8 W/sq m and +1.4 to +12 W/sq m, respectively, for the premonsoon period. The model-simulated solar heating rate profile peaks in the lower troposphere with enhanced heating penetrating into the middle troposphere (5-6 km), caused by vertically extended aerosols over the IGP with peak altitude of approx.5 km as indicated by spaceborne Cloud-Aerosol Lidar with Orthogonal Polarization observations. On a long-term climate scale, our analysis, on the basis of microwave satellite measurements of tropospheric temperatures from 1979 to 2007, indicates accelerated annual mean warming rates found over the Himalayan-Hindu Kush region (0.21 C/decade+/-0.08 C

  1. Direct Measurements of Dust Attenuation in z ~ 1.5 Star-forming Galaxies from 3D-HST: Implications for Dust Geometry and Star Formation Rates

    Science.gov (United States)

    Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B.; Conroy, Charlie; Förster Schreiber, Natascha M.; Franx, Marijn; Fumagalli, Mattia; Lundgren, Britt; Momcheva, Ivelina; Nelson, Erica J.; Skelton, Rosalind E.; van Dokkum, Pieter G.; Whitaker, Katherine E.; Wuyts, Stijn

    2014-06-01

    The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust around star-forming regions (A V, H II ) and the integrated dust content (A V, star). We select a sample of 163 galaxies between 1.36 =5 and measure Balmer decrements from stacked spectra to calculate A V, H II . First, we stack spectra in bins of A V, star, and find that A V, H II = 1.86 A V, star, with a significance of σ = 1.7. Our result is consistent with the two-component dust model, in which galaxies contain both diffuse and stellar birth cloud dust. Next, we stack spectra in bins of specific star formation rate (log SSFR), star formation rate (log SFR), and stellar mass (log M *). We find that on average A V, H II increases with SFR and mass, but decreases with increasing SSFR. Interestingly, the data hint that the amount of extra attenuation decreases with increasing SSFR. This trend is expected from the two-component model, as the extra attenuation will increase once older stars outside the star-forming regions become more dominant in the galaxy spectrum. Finally, using Balmer decrements we derive dust-corrected Hα SFRs, and find that stellar population modeling produces incorrect SFRs if rapidly declining star formation histories are included in the explored parameter space.

  2. Direct measurements of dust attenuation in z ∼ 1.5 star-forming galaxies from 3D-HST: Implications for dust geometry and star formation rates

    International Nuclear Information System (INIS)

    Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B.; Conroy, Charlie; Schreiber, Natascha M. Förster; Wuyts, Stijn; Franx, Marijn; Fumagalli, Mattia; Lundgren, Britt; Momcheva, Ivelina; Nelson, Erica J.; Van Dokkum, Pieter G.; Skelton, Rosalind E.; Whitaker, Katherine E.

    2014-01-01

    The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust around star-forming regions (A V, H II ) and the integrated dust content (A V, star ). We select a sample of 163 galaxies between 1.36 ≤ z ≤ 1.5 with Hα signal-to-noise ratio ≥5 and measure Balmer decrements from stacked spectra to calculate A V, H II . First, we stack spectra in bins of A V, star , and find that A V, H II = 1.86 A V, star , with a significance of σ = 1.7. Our result is consistent with the two-component dust model, in which galaxies contain both diffuse and stellar birth cloud dust. Next, we stack spectra in bins of specific star formation rate (log SSFR), star formation rate (log SFR), and stellar mass (log M * ). We find that on average A V, H II increases with SFR and mass, but decreases with increasing SSFR. Interestingly, the data hint that the amount of extra attenuation decreases with increasing SSFR. This trend is expected from the two-component model, as the extra attenuation will increase once older stars outside the star-forming regions become more dominant in the galaxy spectrum. Finally, using Balmer decrements we derive dust-corrected Hα SFRs, and find that stellar population modeling produces incorrect SFRs if rapidly declining star formation histories are included in the explored parameter space.

  3. X-RAY EMISSION FROM YOUNG STARS IN THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    International Nuclear Information System (INIS)

    Anderson, C. N.; Hofner, P.; Creech-Eakman, M.; Shepherd, D.

    2011-01-01

    We present a 40 ks Chandra observation of the IRAS 20126+4104 core region. In the inner 6'' two X-ray sources were detected, which are coincident with the radio jet source I20S and the variable radio source I20Var. No X-ray emission was detected from the nearby massive protostar I20N. The spectra of both detected sources are hard and highly absorbed, with no emission below 3 keV. For I20S, the measured 0.5-8 keV count rate was 4.3 counts ks -1 . The X-ray spectrum was fitted with an absorbed 1T APEC model with an energy of kT =10 keV and an absorbing column of N H = 1.2 x 10 23 cm -2 . An unabsorbed X-ray luminosity of about 1.4 x 10 32 erg s -1 was estimated. The spectrum shows broad line emission between 6.4 and 6.7 keV, indicative of emission from both neutral and highly ionized iron. The X-ray light curve indicates that I20S is marginally variable; however, no flare emission was observed. The variable radio source I20Var was detected with a count rate of 0.9 counts ks -1 but there was no evidence of X-ray variability. The best-fit spectral model is a 1T APEC model with an absorbing hydrogen column of N H = 1.1 x 10 23 cm -2 and a plasma energy of kT = 6.0 keV. The unabsorbed X-ray luminosity is about 3 x 10 31 erg s -1 .

  4. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. NATO advanced research workshop on implications of climate change and disasters on military activities: building resiliency and mitigating vulnerability in the Balkan Region

    CERN Document Server

    Veeravalli, Swathi

    2017-01-01

    This volume provides preliminary recommendations on ways to educate and develop experience-based expertise among disaster response, security and other professionals from diverse backgrounds, whose current and future interests relate to crisis management. The book takes a multidisciplinary approach to improving regional security cooperation and to addressing the complex issues of climate change and disasters on military activities. The main aims of this proceedings volume are: -to provide an Education and Individual Training Activity Common Core Curriculum, whose main purpose is to support increased awareness of the implications of Climate Change; -to identify broad issues on climate change and disasters, particularly those with the highest importance and relevance to regional security. The Crisis Management and Disaster Response Centre of Excellence (CMDR COE) conducted an Advanced Research Workshop “Climate Change Implications on Military Activities in the Balkans Region” between 05-07 July, 2016. The ev...

  6. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

  7. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

    Science.gov (United States)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

  8. Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

    Directory of Open Access Journals (Sweden)

    Ke WEI

    2018-04-01

    Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization

  9. SEQUENTIAL STAR FORMATION IN RCW 34: A SPECTROSCOPIC CENSUS OF THE STELLAR CONTENT OF HIGH-MASS STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.

    2010-01-01

    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

  10. The role of personality in the transmission of cultural forms an example of the bearer of regional traditions in central Moravia (the ethnographic area of Haná

    Directory of Open Access Journals (Sweden)

    Válka Miroslav

    2017-01-01

    Full Text Available The ethnographic area of Haná in Central Moravia (Czech Republic has been among distinctive ethnographic regions since the 16th century. Even though traditional regional forms had gradually disappeared as a consequence of the modernization of village life, these returned alongside new functions in terms of national consciousness from the late 19th century. It was the intelligentsia, mainly teachers, priests, physicians and artists, who contributed to the spread of these forms. The personalities´ activities did not stop even in the 20th century. The teacher Marie Pachtová (born 1932 is an example of one such person (in study by Miroslav Válka. She not only led a children´s folklore ensemble, moderated programmes aimed at presentation of folklore, and worked as a lector, but she also tries to involve older folk traditions of Haná in the present cultural calendar of the town where she lives. Among other things, she was instrumental in the preservation of the production of Easter eggs from Haná which are decorated with stuck-on straw. She paid similar attention to the ceremonial pastries. With the focus of this example, it is possible to prove the transformations of regional culture´s expression into the contemporary social life as well as the mechanism of the creation of a new tradition.

  11. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-12-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  12. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-11-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  13. Herschel/HIFI observations of high-J CO lines in the NGC 1333 low-mass star-forming region

    DEFF Research Database (Denmark)

    Yildiz, U. A.; van Dishoeck, E. F.; Kristensen, L. E.

    2010-01-01

    Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally-resolved......Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally....... Their intensities require a jump in the CO abundance at an evaporation temperature around 25 K, thus providing new direct evidence for a CO ice evaporation zone around low-mass protostars. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia...... and with important participation from NASA.Appendices and acknowledgements (pages 5 to 7) are only available in electronic form at http://www.aanda.org...

  14. Reprint of "A proposed cell model for multiple-occurrence regional landslide events: Implications for landslide susceptibility mapping"

    Science.gov (United States)

    Crozier, M. J.

    2018-04-01

    Multiple-occurrence regional landslide events (MORLEs) consist of hundreds to thousands of shallow landslides occurring more or less simultaneously within defined areas, ranging from tens to thousands of square kilometres. While MORLEs can be triggered by rainstorms and earthquakes, this paper is confined to those landslide events triggered by rainstorms. Globally, MORLEs occur in a range of geological settings in areas of moderate to steep slopes subject to intense rainstorms. Individual landslides in rainstorm-triggered events are dominantly small, shallow debris and earth flows, and debris and earth slides involving regolith or weathered bedrock. The model used to characterise these events assumes that energy distribution within the event area is represented on the land surface by a cell structure; with maximum energy expenditure within an identifiable core and rapid dissipation concentrically away from the centre. The version of the model presented here has been developed for rainfall-triggered landslide events. It proposes that rainfall intensity can be used to determine different critical landslide response zones within the cell (referred to as core, middle, and periphery zones). These zones are most readily distinguished by two conditions: the proportion of the slope that fails and the particular type of the slope stability factor that assumes dominance in determining specific sites of landslide occurrence. The latter condition means that the power of any slope stability factor to distinguish between stable and unstable sites varies throughout the affected area in accordance with the landslide response zones within the cell; certain factors critical for determining the location of landslide sites in one part of the event area have little influence in other parts of the event area. The implication is that landslide susceptibility maps (and subsequently derived mitigation measures) based on conventional slope stability factors may have only limited validity

  15. Scientific Collaboration Along the Trinational Frontier of Brazil-Bolivia-Peru: Implications for Regional Land-Use in the MAP Region of Southwestern Amazonia

    Science.gov (United States)

    Brown, I.

    2002-12-01

    High-speed road systems are connecting southwestern Amazonia (~1.5 million km2) to Pacific and Atlantic ports as well as providing greater access to Brazilian, Bolivian and Peruvian urban markets. Coupled with this increased accessibility are ambitious governmental plans to expand production of timber, non-timber forest products, and beef, all of which are likely to modify human migrations in the region. The heart of southwestern Amazonia lies in the trinational frontier region of Madre de Dios Department/Peru, eastern Acre State/Brazil and Pando Department/Bolivia (MAP region: ~200,000 km2, ~500,000 inhabitants). The MAP region composes a global hot spot of terrestrial biodiversity and has become an axis of integration for the three countries. Faced with rapid change in socioeconomic trends, regional environmental scientists and professionals have promoted collaborative projects to analyze land use trends and their forcing functions and to supply these results to local and regional societies. In addition, they have begun to develop a regional scientific community that bridges different nationalities and specialties. The projects are both international - as they involve three countries - and local/regional as they involve institutions that are within a radius of 300 km of the border. In the past two years, LBA-sponsored activities have helped bring over 100 professionals together in the region in five MAP-oriented workshops. The research results are now influencing public policy and are being incorporated into the regional school systems with the objective of maximizing the benefits and minimizing the adverse impacts of the changing socio-economic trends on land-use and development in the MAP region.

  16. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  17. Paleospring tufa deposition in the Kurkur Oasis region and implications for tributary integration with the River Nile in southern Egypt

    Science.gov (United States)

    Nicoll, Kathleen; Sallam, Emad S.

    2017-12-01

    Though southern Egypt is currently hyperarid, relict freshwater carbonate deposits called tufas near Kurkur (region centered at 23° 54‧ N, 32° 19‧ E) indicate that ambient rainwater-fed alkaline springs formerly sourced drainages in the Sinn El-Kaddab or Eocene scarp, and precipitated carbonate tufa deposits at waterfall cascades, pools, and streams. Petrographic analysis enables the reconstruction of a variety of vegetated microenvironments during Quaternary time. The Kurkur tufas are very porous rocks with an abundance of fossil plant casts and molds making up the petrofabrics at the macroscale. The tufas also preserve laminations of successive generations of calcified remains of microbes visible at the microscopic scale. Original carbonate framework architectures are massive carbonate structures to the decameter scale, with characteristic highly porous and permeable rock fabrics, including vegetation-rich phytoherms and stromatolite forms. The tufas are relatively pristine, preserving their original rock textures with minimal post-depositional alteration. Structural controls affecting the development of tufa deposits near Kurkur include fissure, cracks and fault planes that would have enhanced groundwater recharge and emergence of carbonate-saturated springs from perched aquifers above the Nubian Aquifer System during periods of greater effective rainfall in the past when the water table was significantly higher. The Kurkur tufas are relict archives from phases when groundwater discharge supported comparatively more vegetation than the modern day, and spring flows sustained baseflow in the Wadi Kurkur tributary of the Upper Nile. Episodes of tufa deposition along now-defunct tributaries therefore reflect phases of a more integrated Nile drainage system.

  18. Youth tobacco use in South-East Asia: Implications for tobacco epidemic and options for its control in the region.

    Science.gov (United States)

    Rani, Manju; Thamarangsi, Thaksaphon; Agarwal, Naveen

    2017-09-01

    Nearly half of all male population and two in every five females in the WHO South-East Asia Region (SEAR) consume some form of tobacco. Preventing initiation among adolescents is critical for overall tobacco control. We assessed the trends in youth tobacco use and policies in SEAR. Data are used from school-based youth (Global Youth Tobacco Survey and global school student-based health survey) and adult (Global Adult Tobacco Survey, STEPS) tobacco surveys and the WHO Framework of Convention of Tobacco Control (FCTC) implementation database. More than 10% of 13-15-year-old adolescent students reported tobacco use in 8 out of 11 countries. The prevalence of smokeless tobacco exceeded that of cigarettes except in Indonesia, Thailand, and Timor-Leste. No consistent declining trends in tobacco use were observed in any of the countries with 3 or more data points. More than half of all daily smokers aged 20-34 years initiated "daily" smoking before 20 years of age. 19% (Bangladesh) to 55% (Timor-Leste) of 13-17-year old students tried their first cigarette before their 14th birthday. Majority of adolescent students in most of the SEAR countries reported purchasing their cigarettes from store/shop/vendor and as single sticks, with few exceptions and purchased them as "single" cigarette. There is a limited change in affordability of cigarettes in SEAR over time. Tobacco use remains high among youth in SEAR. Efforts should be strengthened to fully implement/enforce recommended policy measures (legal minimum age, fiscal measures to reduce tobacco affordability; prohibiting sale of single cigarettes, etc.) and to explore new measures (e.g., tobacco-free generation).

  19. Field Investigation of Surface Deformation Induced by the 2016 Meinong Earthquake and its Implications to Regional Geological Structures

    Science.gov (United States)

    Yi, De-Cheng; Chuang, Ray Y.; Lin, Ching-Weei

    2017-04-01

    We demonstrate mapping results of a newly-identified active folding-associated fault in southwestern Taiwan, which was triggered by the distant ML 6.6 Meinong earthquake in 2016. The 14.6-km-deep main shock occurred in Meinong at 3:57 (GMT +08) on February 6th while a series of 21-27 km deep aftershocks were induced after 160 seconds in Guanmiao, where is 25km NW away from the epicenter of the main shock. The focal mechanism of the Meinong main shock shows a westward oblique thrust with the fault plane of 275°/42°/17° (strike/dip/rake) but Guanmiao aftershocks show the N-S striking eastward normal movement. The study area locates at an on-going fold-and-thrust belt close to the deformation front of Taiwan orogeny with high rates of convergence, uplift and erosion. The geology of SW Taiwan is characterized by the 3-km-thick mudstones with high fluid pressure underlying the loose sedimentary rocks forming mud diapirs or mud-core anticlines. The significance of the Meinong earthquake is (1) aftershocks are far away from the main shock, and (2) the surface cracks partially distributed systematically along lineaments observed from InSAR, which has never been recognized as geological structures before. This study aims to establish possible kinematic processes of shallow deformation induced by the Meinong earthquake. We mapped surface cracks around the lineaments by using hand-held GPS and measured surface cracks by the compass and vernier. Among 249 kinematic data measured from 244 observed surface cracks and ruptures, the type of deformation was mostly identified as dilation or lateral translation and only 4 data were compressional deformation. The overall surface displacement moved to the northwest and west, consistent with the regional coseismic movement. The opening of the surface cracks range from 0.5 to 105 mm and 85% of them are less than 10 mm. Preseismic deformed features such as failure of the retaining wall were also observed along the western and eastern

  20. Substitutions in conserved regions preceding and within the linker affect activity and flexibility of tRNase ZL, the long form of tRNase Z.

    Directory of Open Access Journals (Sweden)

    Makenzie Saoura

    Full Text Available The enzyme tRNase Z, a member of the metallo-β-lactamase family, endonucleolytically removes 3' trailers from precursor tRNAs, preparing them for CCA addition and aminoacylation. The short form of tRNase Z, tRNase ZS, functions as a homodimer and is found in all prokaryotes and some eukaryotes. The long form, tRNase ZL, related to tRNase ZS through tandem duplication and found only in eukaryotes, possesses ~2,000-fold greater catalytic efficiency than tRNase ZS. tRNase ZL consists of related but diverged amino and carboxy domains connected by a flexible linker (also referred to as a flexible tether and functions as a monomer. The amino domain retains the flexible arm responsible for substrate recognition and binding while the carboxy domain retains the active site. The linker region was explored by Ala-scanning through two conserved regions of D. melanogaster tRNase Z: NdomTprox, located at the carboxy end of the amino domain proximal to the linker, and Tflex, a flexible site in the linker. Periodic substitutions in a hydrophobic patch (F329 and L332 at the carboxy end of NdomTprox show 2,700 and 670-fold impairment relative to wild type, respectively, accompanied by reduced linker flexibility at N-T inside the Ndom- linker boundary. The Ala substitution for N378 in the Tflex region has 10-fold higher catalytic efficiency than wild type and locally decreased flexibility, while the Ala substitution at R382 reduces catalytic efficiency ~50-fold. These changes in pre-tRNA processing kinetics and protein flexibility are interpreted in light of a recent crystal structure for S. cerevisiae tRNase Z, suggesting transmission of local changes in hydrophobicity into the skeleton of the amino domain.

  1. The Star Formation in Radio Survey: Jansky Very Large Array 33 GHz Observations of Nearby Galaxy Nuclei and Extranuclear Star-forming Regions

    Science.gov (United States)

    Murphy, E. J.; Dong, D.; Momjian, E.; Linden, S.; Kennicutt, R. C., Jr.; Meier, D. S.; Schinnerer, E.; Turner, J. L.

    2018-02-01

    We present 33 GHz imaging for 112 pointings toward galaxy nuclei and extranuclear star-forming regions at ≈2″ resolution using the Karl G. Jansky Very Large Array (VLA) as part of the Star Formation in Radio Survey. A comparison with 33 GHz Robert C. Byrd Green Bank Telescope single-dish observations indicates that the interferometric VLA observations recover 78% ± 4% of the total flux density over 25″ regions (≈kpc scales) among all fields. On these scales, the emission being resolved out is most likely diffuse non-thermal synchrotron emission. Consequently, on the ≈30–300 pc scales sampled by our VLA observations, the bulk of the 33 GHz emission is recovered and primarily powered by free–free emission from discrete H II regions, making it an excellent tracer of massive star formation. Of the 225 discrete regions used for aperture photometry, 162 are extranuclear (i.e., having galactocentric radii r G ≥ 250 pc) and detected at >3σ significance at 33 GHz and in Hα. Assuming a typical 33 GHz thermal fraction of 90%, the ratio of optically-thin 33 GHz to uncorrected Hα star formation rates indicates a median extinction value on ≈30–300 pc scales of A Hα ≈ 1.26 ± 0.09 mag, with an associated median absolute deviation of 0.87 mag. We find that 10% of these sources are “highly embedded” (i.e., A Hα ≳ 3.3 mag), suggesting that on average, H II regions remain embedded for ≲1 Myr. Finally, we find the median 33 GHz continuum-to-Hα line flux ratio to be statistically larger within r G < 250 pc relative to the outer disk regions by a factor of 1.82 ± 0.39, while the ratio of 33 GHz to 24 μm flux densities is lower by a factor of 0.45 ± 0.08, which may suggest increased extinction in the central regions.

  2. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  3. Rapid intranasal delivery of chloramphenicol acetyltransferase in the active form to different brain regions as a model for enzyme therapy in the CNS.

    Science.gov (United States)

    Appu, Abhilash P; Arun, Peethambaran; Krishnan, Jishnu K S; Moffett, John R; Namboodiri, Aryan M A

    2016-02-01

    The blood brain barrier (BBB) is critical for maintaining central nervous system (CNS) homeostasis by restricting entry of potentially toxic substances. However, the BBB is a major obstacle in the treatment of neurotoxicity and neurological disorders due to the restrictive nature of the barrier to many medications. Intranasal delivery of active enzymes to the brain has therapeutic potential for the treatment of numerous CNS enzyme deficiency disorders and CNS toxicity caused by chemical threat agents. The aim of this work is to provide a sensitive model system for analyzing the rapid delivery of active enzymes into various regions of the brain with therapeutic bioavailability. We tested intranasal delivery of chloramphenicol acetyltransferase (CAT), a relatively large (75kD) enzyme, in its active form into different regions of the brain. CAT was delivered intranasally to anaesthetized rats and enzyme activity was measured in different regions using a highly specific High Performance Thin Layer Chromatography (HP-TLC)-radiometry coupled assay. Active enzyme reached all examined areas of the brain within 15min (the earliest time point tested). In addition, the yield of enzyme activity in the brain was almost doubled in the brains of rats pre-treated with matrix metalloproteinase-9 (MMP-9). Intranasal administration of active enzymes in conjunction with MMP-9 to the CNS is both rapid and effective. The present results suggest that intranasal enzyme therapy is a promising method for counteracting CNS chemical threat poisoning, as well as for treating CNS enzyme deficiency disorders. Published by Elsevier B.V.

  4. Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

    International Nuclear Information System (INIS)

    Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

    1995-01-01

    A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

  5. Floodplain inundation response to climate, valley form, and flow regulation on a gravel-bed river in a Mediterranean-climate region

    Science.gov (United States)

    Cienciala, P.; Pasternack, G. B.

    2017-04-01

    Floodplain inundation regime defines hydrological connectivity between river channel and floodplain and thus strongly controls structure and function of these highly diverse and productive ecosystems. We combined an extensive LiDAR data set on topography and vegetation, long-term hydrological records, as well as the outputs of hydrological and two-dimensional hydraulic models to examine how floodplain inundation regimes in a dynamic, regulated, gravel-cobble river in a Mediterranean-climate region are controlled by reach-scale valley morphology, hydroclimatic conditions, and flow regulation. Estimated relative differences in the extent, duration, and cumulative duration of inundation events were often as large as an order of magnitude and generally greatest for large and long duration events. The relative impact of flow regulation was greatest under dry hydroclimatic conditions. Although the effects of hydroclimate and flow impairment are larger than that of valley floor topography, the latter controls sensitivity of floodplain hydroperiod to flow regime changes and should not be ignored. These quantitative estimates of the relative importance of factors that control floodplain processes in Mediterranean, semiarid rivers contributes to better understanding of hydrology and geomorphology of this important class of channels. We also discuss implications of our findings for processes that shape floodplain habitat for riparian vegetation and salmonid fish, especially in the context of ecological restoration.

  6. Regional molecular and cellular differences in the female rabbit Achilles tendon complex: potential implications for understanding responses to loading.

    Science.gov (United States)

    Huisman, Elise S; Andersson, Gustav; Scott, Alexander; Reno, Carol R; Hart, David A; Thornton, Gail M

    2014-05-01

    The aim of this study was: (i) to analyze the morphology and expression of extracellular matrix genes in six different regions of the Achilles tendon complex of intact normal rabbits; and (ii) to assess the effect of ovariohysterectomy (OVH) on the regional expression of these genes. Female New Zealand White rabbits were separated into two groups: (i) intact normal rabbits (n = 4); and (ii) OVH rabbits (n = 8). For each rabbit, the Achilles tendon complex was dissected into six regions: distal gastrocnemius (DG); distal flexor digitorum superficialis; proximal lateral gastrocnemius (PLG); proximal medial gastrocnemius; proximal flexor digitorum superficialis; and paratenon. For each of the regions, hematoxylin and eosin staining was performed for histological evaluation of intact normal rabbit tissues and mRNA levels for proteoglycans, collagens and genes associated with collagen regulation were assessed by real-time reverse transcription-quantitative polymerase chain reaction for both the intact normal and OVH rabbit tissues. The distal regions displayed a more fibrocartilaginous phenotype. For intact normal rabbits, aggrecan mRNA expression was higher in the distal regions of the Achilles tendon complex compared with the proximal regions. Collagen Type I and matrix metalloproteinase-2 expression levels were increased in the PLG compared to the DG in the intact normal rabbit tissues. The tendons from OVH rabbits had lower gene expressions for the proteoglycans aggrecan, biglycan, decorin and versican compared with the intact normal rabbits, although the regional differences of increased aggrecan expression in distal regions compared with proximal regions persisted. The tensile and compressive forces experienced in the examined regions may be related to the regional differences found in gene expression. The lower mRNA expression of the genes examined in the OVH group confirms a potential effect of systemic estrogen on tendon. © 2014 Anatomical Society.

  7. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  8. Rising global burden of breast cancer: the case of sub-Saharan Africa (with emphasis on Nigeria) and implications for regional development: a review.

    Science.gov (United States)

    Azubuike, Samuel O; Muirhead, Colin; Hayes, Louise; McNally, Richard

    2018-03-22

    Despite mortality from breast cancer in Africa being higher than in high income countries, breast cancer has not been extensively studied in the region. The aim of this paper was to highlight the rising burden of breast cancer with an emphasis on sub-Saharan Africa as well as trends, characteristics, controversies and their implications for regional development. A review of published studies and documents was conducted in Medline, Scopus, Pubmed and Google using combinations of key words-breast neoplasm, breast cancer, cancer, incidence, mortality, Africa, Nigeria. Graphical and frequency analyses were carried out on some of the incidence and mortality figures retrieved from published papers and the GLOBOCAN website. Globally, about 25% and 15% of all new cancer cases and cancer deaths respectively among females were due to breast cancer. Africa currently had the highest age-standardized breast cancer mortality rate globally, with the highest incidence rates being recorded within the sub-Saharan African sub-region. Incidence trends such as inherently aggressive tumour and younger age profile had been subject to controversies. Certain factors such as westernized diet, urbanization and possibly increasing awareness had been implicated, though their specific contributions were yet to be fully established. Unless urgent action is taken, breast cancer will compound sub-Saharan Africa's disease burden, increase poverty and gender inequality as well as reverse the current global gains against maternal and neonatal mortality.

  9. Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey

    Science.gov (United States)

    Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.

    2015-05-01

    Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

  10. Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars

    Science.gov (United States)

    Hargitai, H. I.; Gulick, V. C.; Glines, N. H.

    2017-09-01

    The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

  11. White pine blister rust in Korea, Japan and other Asian regions: comparisons and implications for North America

    Science.gov (United States)

    M.-S. Kim; N. B. Klopfenstein; Y. Ota; S. K. Lee; K.-S. Woo; S. Kaneko

    2010-01-01

    This article briefly reviews the history of white pine blister rust, attributed to Cronartium ribicola, and addresses current research and management issues in South Korea, Japan and other regions of eastern Asia (China, Russia and Himalaya). For each region, the distribution, damage, aecial hosts, telial hosts and management of C. ribicola and other blister rust fungi...

  12. Japanese sake and evolution of technology: A comparative view with wine and its implications for regional branding and tourism

    Directory of Open Access Journals (Sweden)

    Jun Sato

    2017-06-01

    Conclusion: The use of acid and collaboration with the local and regional community is observed in wine production. Similar processes are observed with Japanese sake, and this implies that wine and sake may have similar futures. Visits to sake breweries have potential in the spheres of tourism, regional branding, and destination management.

  13. Further assessment of seismic hazard/risk in the Bushveld Complex platinum mines and the implication for regional and local support design.

    CSIR Research Space (South Africa)

    Brink, AVZ

    2002-03-01

    Full Text Available Final Project Report Further assessment of seismic hazard/risk in the Bushveld Complex platinum mines and the implication for regional and local support design. A.v.Z Brink, M.K.C. Roberts, S.M Spottiswoode Research Agency: CSIR: Division of Mining... on the VCR. An industry workshop on local support requirements in areas of higher seismic risk resulted in the specification of support requirements. A maximum design parameter for yielding support in terms of the ground motion velocity is 1 m...

  14. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  15. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. III. HP TAU/G2 AND THE THREE-DIMENSIONAL STRUCTURE OF TAURUS

    International Nuclear Information System (INIS)

    Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.

    2009-01-01

    Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

  16. Differences in neurogenesis differentiate between core and shell regions of auditory nuclei in the turtle (Pelodiscus sinensis): evolutionary implications.

    Science.gov (United States)

    Zeng, Shao-Ju; Xi, Chao; Zhang, Xin-Wen; Zuo, Ming-Xue

    2007-01-01

    There is a clear core-versus-shell distinction in cytoarchitecture, electrophysiological properties and neural connections in the mesencephalic and diencephalic auditory nuclei of amniotes. Determining whether the embryogenesis of auditory nuclei shows a similar organization is helpful for further understanding the constituent organization and evolution of auditory nuclei. Therefore in the present study, we injected [(3)H]-thymidine into turtle embryos (Pelodiscus sinensis) at various stages of development. Upon hatching, [(3)H]-thymidine labeling was examined in both the core and shell auditory regions in the midbrain, diencephalon and dorsal ventricular ridge. Met-enkephalin and substance P immunohistochemistry was used to distinguish the core and shell regions. In the mesencephalic auditory nucleus, the occurrence of heavily labeled neurons in the nucleus centralis of the torus semicircularis reached its peak at embryonic day 9, one day later than the surrounding shell. In the diencephalic auditory nucleus, the production of heavily labeled neurons in the central region of the reuniens (Re) was highest at embryonic day (E) 8, one day later than that in the shell region of reuniens. In the region of the dorsal ventricular ridge that received inputs from the central region of Re, the appearance of heavily labeled neurons also reached a peak one day later than that in the area receiving inputs from the shell region of reuniens. Thus, there is a core-versus-shell organization of neuronal generation in reptilian auditory areas. Copyright (c) 2007 S. Karger AG, Basel.

  17. The implications of cross-regional differences for the design of In-vehicle Information Systems: a comparison of Australian and Chinese drivers.

    Science.gov (United States)

    Young, Kristie L; Rudin-Brown, Christina M; Lenné, Michael G; Williamson, Amy R

    2012-05-01

    The increasing global distribution of automobiles necessitates that the design of In-vehicle Information Systems (IVIS) is appropriate for the regions to which they are being exported. Differences between regions such as culture, environment and traffic context can influence the needs, usability and acceptance of IVIS. This paper describes two studies aimed at identifying regional differences in IVIS design needs and preferences across drivers from Australia and China to determine the impact of any differences on IVIS design. Using a questionnaire and interaction clinics, the influence of cultural values and driving patterns on drivers' preferences for, and comprehension of, surface- and interaction-level aspects of IVIS interfaces was explored. Similarities and differences were found between the two regional groups in terms of preferences for IVIS input control types and labels and in the comprehension of IVIS functions. Specifically, Chinese drivers preferred symbols and Chinese characters over English words and were less successful (compared to Australians) at comprehending English abbreviations, particularly for complex IVIS functions. Implications in terms of the current trend to introduce Western-styled interfaces into other regions with little or no adaptation are discussed. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  18. Eastern Turkish high plateau as a small Turkic-type orogen: Implications for post-collisional crust-forming processes in Turkic-type orogens

    Science.gov (United States)

    Şengör, A. M. Celâl; Özeren, Mehmet Sinan; Keskin, Mehmet; Sakınç, Mehmet; Özbakır, Ali Değer; Kayan, İlhan

    Post-collisional magmatism may be generated by extensive crustal melting in Tibet-type collisional environments or by falling out of slabs from under giant subduction-accretion complexes in Turkic-type collisional orogens giving rise to decompression melting of the asthenospheric mantle replacing the removed oceanic lithosphere. In Turkic-type post-collisional magmatism, the magmatic products are dominantly alkalic to peralkalic and greatly resemble those of extensional regions giving rise to much confusion especially in interpreting old collisional orogenic belts. Such magmatic regions are also host to a variety of economically valuable ore deposits, including gold. One place in the world where today active, Turkic-type post-collisional magmatism is present is the eastern Anatolian high plateau, produced after the terminal Arabia/Eurasia collision in the late Miocene. The plateau is mostly underlain by the late Cretaceous to Oligocene East Anatolian Accretionary Complex, which formed south of the Rhodope-Pontide magmatic arc. This subduction-accretion complex has been further shortening since the collision, but it has also since been domed and became almost entirely covered by at least 15,000 km 3 of volcanic rocks. The volcanic rocks are calc-alkalic in the north, transitional in the middle, and alkalic in the south of the plateau. Where the crust is thinnest today (less than 38 km), the volcanics are derived almost entirely from an enriched mantle. The ages of the volcanics also become younger from north to south, from about 11 Ma to possibly 17th century AD. We interpret the origin of the magmatic rocks as the result of decompression melting of the asthenospheric mantle sucked towards the exposed base of the East Anatolian Accretionary Complex as the oceanic lithosphere beneath it fell out. The lower density of the hot asthospheric material was the cause of the doming. We believe that similar processes dominated the post-collisional tectonics of such vast

  19. Increasing meltwater discharge from the Nuuk region of the Greenland ice sheet and implications for mass balance (1960-2012)

    DEFF Research Database (Denmark)

    van As, Dirk; Langer Andersen, Morten; Petersen, Dorthe

    2014-01-01

    We assess the runoff and surface mass balance (SMB) of the Greenland ice sheet in the Nuuk region (southwest) using output of two regional climate models (RCMs) evaluated by observations. The region encompasses six glaciers that drain into Godthåbsfjord. RCM data (1960-2012) are resampled to a high...... spatial resolution to include the narrow (relative to the native grid spacing) glacier trunks in the ice mask. Comparing RCM gridded results with automaticweather station (AWS) point measurements reveals that locally models can underestimate ablation andoverestimate accumulation by up to tens of per cent...

  20. Innovative Model of Practice-Oriented Training of Employees of the Town-Forming Enterprise in the Mining Region (by the Example of JSC "SUEK-Kuzbass")

    Science.gov (United States)

    Kulay, Svetlana; Kayachev, Gennady

    2017-11-01

    The article proposes to improve the system of training of employees of joint-stock company SUEK-Kuzbass in the educational institutions of the Kemerovo region according to the requirements of the company using practice-oriented training technology. The aim of the work is to substantiate the effectiveness of implementing practice-oriented training, identify priority directions and ways of its development. The main objectives of the study are: to identify the main advantages for the company and students; determine the criteria for the success and practical value of applying practice-oriented training for the company; conduct a comparative analysis of the target and practice-oriented model of training for the company. The real needs of the employer through the dual form of training were taking into account. The expansion of positive experience in training engineering personnel in higher education in technology-based training with the involvement of specialists from other regions of the company and expanding training in mining was also included.

  1. Far-infrared to Millimeter Data of Protoplanetary Disks: Dust Growth in the Taurus, Ophiuchus, and Chamaeleon I Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Ribas, Álvaro; Espaillat, Catherine C.; Macías, Enrique [Department of Astronomy, Boston University, Boston, MA 02215 (United States); Bouy, Hervé [Laboratoire d’Astrophysique de Bordeaux, Univ. Bordeaux, CNRS, F-33615 Pessac (France); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Calvet, Nuria [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Naylor, David A.; Van der Wiel, Matthijs H. D. [Institute for Space Imaging Science, Department of Physics and Astronomy, University of Lethbridge (Canada); Riviere-Marichalar, Pablo, E-mail: aribas@bu.edu [Instituto de Ciencia de Materiales de Madrid (CSIC). Calle Sor Juana Inés de la Cruz 3, E-28049 Cantoblanco, Madrid (Spain)

    2017-11-01

    Far-infrared and (sub)millimeter fluxes can be used to study dust in protoplanetary disks, the building blocks of planets. Here, we combine observations from the Herschel Space Observatory with ancillary data of 284 protoplanetary disks in the Taurus, Chamaeleon I, and Ophiuchus star-forming regions, covering from the optical to mm/cm wavelengths. We analyze their spectral indices as a function of wavelength and determine their (sub)millimeter slopes when possible. Most disks display observational evidence of grain growth, in agreement with previous studies. No correlation is found between other tracers of disk evolution and the millimeter spectral indices. A simple disk model is used to fit these sources, and we derive posterior distributions for the optical depth at 1.3 mm and 10 au, the disk temperature at this same radius, and the dust opacity spectral index β . We find the fluxes at 70 μ m to correlate strongly with disk temperatures at 10 au, as derived from these simple models. We find tentative evidence for spectral indices in Chamaeleon I being steeper than those of disks in Taurus/Ophiuchus, although more millimeter observations are needed to confirm this trend and identify its possible origin. Additionally, we determine the median spectral energy distribution of each region and find them to be similar across the entire wavelength range studied, possibly due to the large scatter in disk properties and morphologies.

  2. A new crystal form of human tear lipocalin reveals high flexibility in the loop region and induced fit in the ligand cavity

    International Nuclear Information System (INIS)

    Breustedt, Daniel A.; Chatwell, Lorenz; Skerra, Arne

    2009-01-01

    The crystal structure of tear lipocalin determined in space group P2 1 revealed large structural deviations from the previously solved X-ray structure in space group C2, especially in the loop region and adjoining parts of the β-barrel which give rise to the ligand-binding site. These findings illustrate a novel mechanism for promiscuity in ligand recognition by the lipocalin protein family. Tear lipocalin (TLC) with the bound artificial ligand 1,4-butanediol has been crystallized in space group P2 1 with four protein molecules in the asymmetric unit and its X-ray structure has been solved at 2.6 Å resolution. TLC is a member of the lipocalin family that binds ligands with diverse chemical structures, such as fatty acids, phospholipids and cholesterol as well as microbial siderophores and the antibiotic rifampin. Previous X-ray structural analysis of apo TLC crystallized in space group C2 revealed a rather large bifurcated ligand pocket and a partially disordered loop region at the entrace to the cavity. Analysis of the P2 1 crystal form uncovered major conformational changes (i) in β-strands B, C and D, (ii) in loops 1, 2 and 4 at the open end of the β-barrel and (iii) in the extended C-terminal segment, which is attached to the β-barrel via a disulfide bridge. The structural comparison indicates high conformational plasticity of the loop region as well as of deeper parts of the ligand pocket, thus allowing adaptation to ligands that differ vastly in size and shape. This illustrates a mechanism for promiscuity in ligand recognition which may also be relevant for some other physiologically important members of the lipocalin protein family

  3. Two unique patients with novel microdeletions in 4p16.3 that exclude the WHS critical regions: implications for critical region designation.

    Science.gov (United States)

    South, Sarah T; Bleyl, Steven B; Carey, John C

    2007-09-15

    Wolf-Hirschhorn syndrome (WHS) is characterized by growth delay, developmental delay, hypotonia, seizures, feeding difficulties, and characteristic facial features. Deletion of either of two critical regions (WHSCR and WHSCR-2) within chromosome band 4p16.3 has been proposed as necessary for the minimal clinical manifestations of WHS and controversy remains regarding their designation. We describe two patients with novel terminal microdeletions in 4p16.3 who lack the characteristic facial features but do show some of the more nonspecific manifestations of WHS. The first patient had a ring chromosome 4 with an intact 4q subtelomere and a terminal 4p microdeletion of approximately 1.27-1.46 Mb. This deletion was distal to both proposed critical regions. The second patient had a normal karyotype with a terminal 4p microdeletion of approximately 1.78 Mb. This deletion was distal to WHSCR and the breakpoint was near or within the known distal boundary for WHSCR-2. Both patients showed significant postnatal growth delay, mild developmental delays and feeding difficulties. Their facial features were not typical for WHS. The phenotype of the first patient may have been influenced by the presence of a ring chromosome. Seizures were absent in the first patient whereas the second patient had a complex seizure disorder. Characterization of these patients supports the hypothesis that a gene in WHSCR-2, LETM1, plays a direct role in seizure development, and demonstrates that components of the WHS phenotype can be seen with deletions distal to the known boundaries of the two proposed critical regions. These patients also emphasize the difficulty of mapping clinical manifestations common to many aneusomy syndromes. (c) 2007 Wiley-Liss, Inc.

  4. Radiative transfer modelling of W33A MM1: 3-D structure and dynamics of a complex massive star forming region

    Science.gov (United States)

    Izquierdo, Andrés F.; Galván-Madrid, Roberto; Maud, Luke T.; Hoare, Melvin G.; Johnston, Katharine G.; Keto, Eric R.; Zhang, Qizhou; de Wit, Willem-Jan

    2018-05-01

    We present a composite model and radiative transfer simulations of the massive star forming core W33A MM1. The model was tailored to reproduce the complex features observed with ALMA at ≈0.2 arcsec resolution in CH3CN and dust emission. The MM1 core is fragmented into six compact sources coexisting within ˜1000 au. In our models, three of these compact sources are better represented as disc-envelope systems around a central (proto)star, two as envelopes with a central object, and one as a pure envelope. The model of the most prominent object (Main) contains the most massive (proto)star (M⋆ ≈ 7 M⊙) and disc+envelope (Mgas ≈ 0.4 M⊙), and is the most luminous (LMain ˜ 104 L⊙). The model discs are small (a few hundred au) for all sources. The composite model shows that the elongated spiral-like feature converging to the MM1 core can be convincingly interpreted as a filamentary accretion flow that feeds the rising stellar system. The kinematics of this filament is reproduced by a parabolic trajectory with focus at the center of mass of the region. Radial collapse and fragmentation within this filament, as well as smaller filamentary flows between pairs of sources are proposed to exist. Our modelling supports an interpretation where what was once considered as a single massive star with a ˜103 au disc and envelope, is instead a forming stellar association which appears to be virialized and to form several low-mass stars per high-mass object.

  5. The Santa Izabel Complex, Gavião Block, Brazil: Components, geocronology, regional correlations and tectonic implications

    Science.gov (United States)

    Medeiros, Eder Luis Mathias; Cruz, Simone Cerqueira Pereira; Barbosa, Johildo Salomão Figueiredo; Paquette, Jean Louis; Peucat, Jean Jacques; Jesus, Silvandira dos Santos Góes Pereira de; Barbosa, Rafael Gordilho; Brito, Reinaldo Santana Correia de; Carneiro, Mauricio Antônio

    2017-12-01

    Cratons, as well as the basement of their marginal orogens, may represent important sites of research regarding the formation and evolution of Archean continental crusts. The Gavião Block is one of the oldest terranes in South America with rocks aged up to 3.6 Ga. Among the Archean units that outcrop in the southern sector of this block is the Santa Izabel Complex, which for the most part is located in the São Francisco Craton, close to its limit with the Araçuaí-West Congo Orogen. This complex has generally been described as comprising ortho- and paraderived rocks that were metamorphosed in high amphibolite facies. Studies in the southern region of this complex have shown the main components: (i) orthogneisses, whose protoliths are the Mesoarchean rocks of the Santa Izabel Magmatic Suite; and (iii) migmatites. and (iv) amphibolitic and metaultramafic enclaves. U-Pb studies (LA-ICPMS and SHRIMP) performed on zircons of the paleosome in metatexites and inherited zircons in migmatites indicate crystallization ages between 3091 ± 24 and 3136 ± 8 Ma for the rocks of the Santa Izabel Magmatic Suite. Inherited zircons aged ca. 3.4 Ga in paleosomes demonstrate the influence of older continental crust in the formation of these rocks. For the Caraguatai Magmatic Suite, the alignment of zircons and monazites suggests a crystallization age around 2.6 Ga. The Rhyacian migmatites were divided into metatexites and diatexites. Diatexites were divided into: (i) discontinuous boudinated early diatexites, which are parallel to stromatic metatexites, composing the gneissic banding. These rocks have diffuse metamorphic banding and features that suggest the action of mylonitization processes; and (ii) late diatexites, forming more continuous bodies, which truncate the gneissic banding. The migmatization occurred in two stages, with time interval between ca. 2.1 Ga and 2.07 Ga. The structural framework reveal the existence of four progressive Rhyacian deformation phases (Dn to Dn

  6. Geochemistry of thermal/mineral waters in the Clear Lake region, California, and implications for hot dry rock geothermal development

    Energy Technology Data Exchange (ETDEWEB)

    Goff, F.; Adams, A.I.; Trujillo, P.E.; Counce, D.; Mansfield, J.

    1993-02-01

    Thermal/mineral waters of the Clear Lake region are broadly classified as thermal meteoric and connote types based on chemical and isotopic criteria. Ratios of conservative components such as B/Cl are extremely different among all thermal/mineral waters of the Clear Lake region except for clusters of waters emerging from specific areas such as the Wilbur Springs district and the Agricultural Park area south of Mt. Konocti. In contrast, ratios of conservative components in large, homogeneous geothermal reservoirs are constant. Stable isotope values of Clear Lake region waters show a mixing trend between thermal meteoric and connote end-members. The latter end-member has enriched [delta]D as well as enriched d[sup l8]O, very different from typical high-temperature geothermal reservoir waters. Tritium data and modeling of ages indicate most Clear Lake region waters are 500 to > 10,000 yr., although mixing of old and young components is implied by the data. The age of end-member connate water is probably > 10,000 yr. Subsurface equilibration temperature of most thermal/mineral waters of the Clear Lake region is [le] 150[degrees]C based on chemical geothermometers but it is recognized that Clear Lake region waters are not typical geothermal fluids and that they violate rules of application of many geothermometers. The combined data indicate that no large geothermal reservoir underlies the Clear Lake region and that small localized reservoirs have equilibration temperatures [le] 150[degrees]C (except for Sulphur Bank Mine). Hot dry rock technologies are the best way to commercially exploit the known high temperatures existing beneath the Clear Lake region, particularly within the main Clear Lake volcanic field.

  7. Measuring Job Satisfaction Patterns in Saudi ArabiaÕs Southern Regions Hospitals: Implications for Hospital Staff Retention

    OpenAIRE

    Alshahrani Bander Sayaf

    2015-01-01

    Saudi Arabia Southern Region hospitals have shortage of health professionals especially doctors. Retention of quality doctors and minimizing staff turnover has, therefore, become a major priority for hospitals. Job satisfaction is recognized as key factor influencing retention of doctors. In our paper special emphasis is put on doctors working is Southern Region hospitals of Saudi Arabia. By conducting correlation analysis we determine the most important factors conducive to job satisfaction....

  8. Modeling the Impact of Uganda’s Safe Male Circumcision Program: Implications for Age and Regional Targeting

    Science.gov (United States)

    Kripke, Katharine; Vazzano, Andrea; Kirungi, William; Musinguzi, Joshua; Opio, Alex; Ssempebwa, Rhobbinah; Nakawunde, Susan; Kyobutungi, Sheila; Akao, Juliet N.; Magala, Fred; Mwidu, George; Castor, Delivette

    2016-01-01

    Background Uganda aims to provide safe male circumcision (SMC) to 80% of men ages 15–49 by 2016. To date, only 2 million men have received SMC of the 4.2 million men required. In response to age and regional trends in SMC uptake, the country sought to re-examine its targets with respect to age and subnational region, to assess the program’s progress, and to refine the implementation approach. Methods and Findings The Decision Makers’ Program Planning Tool, Version 2.0 (DMPPT 2.0), was used in conjunction with incidence projections from the Spectrum/AIDS Impact Module (AIM) to conduct this analysis. Population, births, deaths, and HIV incidence and prevalence were used to populate the model. Baseline male circumcision prevalence was derived from the 2011 AIDS Indicator Survey. Uganda can achieve the most immediate impact on HIV incidence by circumcising men ages 20–34. This group will also require the fewest circumcisions for each HIV infection averted. Focusing on men ages 10–19 will offer the greatest impact over a 15-year period, while focusing on men ages 15–34 offers the most cost-effective strategy over the same period. A regional analysis showed little variation in cost-effectiveness of scaling up SMC across eight regions. Scale-up is cost-saving in all regions. There is geographic variability in program progress, highlighting two regions with low baseline rates of circumcision where additional efforts will be needed. Conclusion Focusing SMC efforts on specific age groups and regions may help to accelerate Uganda’s SMC program progress. Policy makers in Uganda have already used model outputs in planning efforts, proposing males ages 10–34 as a priority group for SMC in the 2014 application to the Global Fund’s new funding model. As scale-up continues, the country should also consider a greater effort to expand SMC in regions with low MC prevalence. PMID:27410234

  9. Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

    OpenAIRE

    Kato, J; Ito, K; Nakamura, A; Watanabe, H

    1989-01-01

    Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

  10. Quantum histories and their implications

    International Nuclear Information System (INIS)

    Kent, A.

    2000-01-01

    Classical mechanics and standard Copenhagen quantum mechanics respect subspace implications. For example, if a particle is confined in a particular region R of space, then in these theories we can deduce that it is confined in regions containing R. However, subspace implications are generally violated by versions of quantum theory that assign probabilities to histories, such as the consistent histories approach. I define here a new criterion, ordered consistency, which refines the criterion of consistency and has the property that inferences made by ordered consistent sets do not violate subspace relations. This raises the question: do the operators defining our observations form an ordered consistent history? If so, ordered consistency defines a version of quantum theory with greater predictive power than the consistent histories formalism. If not, and our observations are defined by a non-ordered consistent quantum history, then subspace implications are not generally valid. (orig.)

  11. Opposite poles: A comparison between two Spanish regions in health-related quality of life, with implications for health policy

    Directory of Open Access Journals (Sweden)

    López-Valcárcel Beatriz G

    2010-09-01

    Full Text Available Abstract Background Although health is one of the main determinants of the welfare of societies, few studies have evaluated health related quality of life in representative samples of the population of a region or a country. Our aim is to describe the health-related quality of life of the inhabitants of two quite different Spanish regions (Canary Islands and Catalonia and to compare the prevalence of health problems between age-sex groups. Methods We use data obtained from the 2006 Health Survey of Catalonia and the 2004 Canary Islands Health Survey. With an ordinal composite variable measuring HRQOL we identify the association of characteristics of individuals with self-reported quality of life and test for differences between the regions. Results The prevalence of problems in the five EQ-5 D dimensions increases with age and is generally higher for women than for men. The dimension with the highest prevalence of problems is "anxiety/depression", and there is noteworthy the extent of discomfort and pain among Canary Island women. Education, especially among the elderly, has an important effect on health-related quality of life. Conclusions There are substantial structural and compositional differences between the two regions. Regional context is a significant factor, independent of the compositional differences, and the effects of context are manifest above all in women. The findings show the importance of disease prevention and the need for improving the educational level of the population in order to reduce health inequalities.

  12. Maslov shear-waveforms in highly anisotropic shales and implications for shear-wave splitting analyses; Formes d`onde transversales de Maslov dans les argiles fortement anisotropes et implications dans les analyses de birefringence des ondes transversales

    Energy Technology Data Exchange (ETDEWEB)

    Caddick, J. [Leeds Univ. (United Kingdom). Dept. of Earth Sciences; Kendall, J.M.; Raymer, D.G. [Western Geophysical, Middlesex (United Kingdom). Dept. of Earth Sciences

    1998-09-01

    Shales are the most common sedimentary rocks in hydrocarbon environments often forming the source rock and trapping rock for a reservoir. Due to the platy nature of the constituent grains, shales are commonly anisotropic. In this paper we calculate seismic waveforms for highly anisotropic shales using Maslow asymptotic theory (MAT). This theory is an extension of classical ray theory which provides valid waveforms in regions of caustics (wavefront folding) where ray theory amplitudes are unstable. Asymptotic ray theory (ART) is based on the Fermat or geometrical ray which connects the source and receiver. In contrast, the Maslov solution integrates the contributions from neighbouring non-Fermat rays. Ray-paths, travel-times, amplitudes and synthetic seismograms are presented for three highly anisotropic shales using a very simple 1D model comprised of an anisotropic shale overlying an isotropic shale. The ART waveforms fail to account for complex waveform effects due to triplications. In comparison, the MAT waveforms predict nonsingular amplitudes at wavefront cusps and it predicts the diffracted signals from these cusps. A Maslov solution which integrates ray contributions over a single slowness component will break down when rays focus in 3D (at a point rather than along a line). One of the tested shales shows such a point caustic and integration over 2 slowness components is required to remove the amplitude singularity. Finally, we examine the effects of wavefront triplications on Alford rotations which are used to estimate shear-wave splitting. In such cases, the rotation successfully finds the fast shear-wave polarization, but it can be unreliable in its estimate of the time separation. (authors) 21 refs.

  13. Molecular studies of Callithrix pygmaea (Primates, Platyrrhini based on transferrin intronic and ND1 regions: implications for taxonomy and conservation

    Directory of Open Access Journals (Sweden)

    Tagliaro Claudia Helena

    2000-01-01

    Full Text Available Traditional classifications of Platyrrhini monkeys, based mainly on morphological features, are being contested by recent molecular data. The subfamily Callitrichinae (Platyrrhini, Primates consists of a diverse group of species, many of them considered endangered. Our analysis of two DNA regions, a mtDNA gene (ND1 and a nuclear gene (intronic regions of the transferrin gene, suggests that Callithrix pygmaea may have sufficient variability to justify the existence of subspecies or even separate species. Phylogenetic dendrograms based on the ND1 region show that this species is more closely related to Amazonian than to Atlantic forest marmosets. These results reopen the discussion about diversity and conservation programs based exclusively on traditional classifications.

  14. Finding your ideal (foreign) non-academic partner: Implications for university-industry collaboration, in peripheral and metropolitan regions?

    DEFF Research Database (Denmark)

    Guerrero, David Fernández

    2018-01-01

    This paper develops a theoretical framework, and a set of testable propositions, on how collaboration with non-academic partners located abroad might affect businesses’ absorptive capacity, and businesses’ propensity to engage in collaboration with universities, depending on the characteristics...... of the region. The present document also includes a research agenda with the goal of testing the propositions, in a further developed version of the paper. It is hypothesized that businesses in peripheral regions will be able to develop their absorptive capacity to a greater extent, if they are engaged...... in collaboration with foreign non-academic partners, and that these improvements in absorptive capacity will increase the ability of businesses to engage in university-industry collaboration. It is assumed that peripheral regions will provide access to a small variety of potential non-academic partners (such...

  15. Implications of the regional haze rule on renewable and wind energy development on native American lands in the west

    International Nuclear Information System (INIS)

    Acker, T.L.; Auberle, W.M.; Duque, E.P.N.; Jeffery, W.D.; LaRoche, D.R.; Masayesva, V.; Smith, D.H.

    2003-01-01

    A study conducted at Northern Arizona University investigated the barriers and opportunities facing Native American tribes in the West when considering development of their renewable energy resources in order to reduce regional haze. This article summarizes some of the findings of that work with special attention to wind energy. Background information is presented concerning the Regional Haze Rule and the Western Regional Air Partnership, and some of the circumstances surrounding development of tribal energy resources. An assessment of tribal energy issues revealed that many Native American tribes are interested in developing their renewable resources. However, this development should occur within the context of maintaining and strengthening their cultural, social, economic and political integrity. Furthermore, it is shown that Native American lands possess an abundant wind resource. A list of potential actions in which tribes may participate prior to or during development of their wind or renewable resources is provided. (author)

  16. Spatio-temporal modelling of heat stress and climate change implications for the Murray dairy region, Australia

    Science.gov (United States)

    Nidumolu, Uday; Crimp, Steven; Gobbett, David; Laing, Alison; Howden, Mark; Little, Stephen

    2014-08-01

    The Murray dairy region produces approximately 1.85 billion litres of milk each year, representing about 20 % of Australia's total annual milk production. An ongoing production challenge in this region is the management of the impacts of heat stress during spring and summer. An increase in the frequency and severity of extreme temperature events due to climate change may result in additional heat stress and production losses. This paper assesses the changing nature of heat stress now, and into the future, using historical data and climate change projections for the region using the temperature humidity index (THI). Projected temperature and relative humidity changes from two global climate models (GCMs), CSIRO MK3.5 and CCR-MIROC-H, have been used to calculate THI values for 2025 and 2050, and summarized as mean occurrence of, and mean length of consecutive high heat stress periods. The future climate scenarios explored show that by 2025 an additional 12-15 days (compared to 1971 to 2000 baseline data) of moderate to severe heat stress are likely across much of the study region. By 2050, larger increases in severity and occurrence of heat stress are likely (i.e. an additional 31-42 moderate to severe heat stress days compared with baseline data). This increasing trend will have a negative impact on milk production among dairy cattle in the region. The results from this study provide useful insights on the trends in THI in the region. Dairy farmers and the dairy industry could use these results to devise and prioritise adaptation options to deal with projected increases in heat stress frequency and severity.

  17. Air pollution over the North China Plain and its implication of regional transport: A new sight from the observed evidences.

    Science.gov (United States)

    Ge, Baozhu; Wang, Zifa; Lin, Weili; Xu, Xiaobin; Li, Jie; Ji, Dongshen; Ma, Zhiqiang

    2018-03-01

    High concentrations of the fine particles (PM 2.5 ) are frequently observed during all seasons over the North China Plain (NCP) region in recent years. In NCP, the contributions of regional transports to certain area, e.g. Beijing city, are often discussed and estimated by models when considering an effective air pollution controlling strategy. In this study, we selected three sites from southwest to northeast in NCP, in which the concentrations of air pollutants displayed a multi-step decreasing trend in space. An approach based on the measurement results at these sites has been developed to calculate the relative contributions of the minimal local emission (MinLEC) and the maximum regional transport (MaxRTC) to the air pollutants (e.g., SO 2 , NO 2 , CO, PM 2.5 ) in Beijing. The minimal influence of local emission is estimated by the difference of the air pollutants' concentrations between urban and rural areas under the assumption of a similar influence of regional transport. Therefore, it's convenient to estimate the contributions of local emission from regional transport based on the selective measurement results instead of the complex numerical model simulation. For the whole year of 2013, the averaged contributions of MinLEC (MaxRTC) for NO 2 , SO 2 , PM 2.5 and CO are 61.7% (30.7%), 46.6% (48%), 52.1% (40.2%) and 35.8% (45.5%), respectively. The diurnal variation of MaxRTC for SO 2 , PM 2.5 and CO shows an increased pattern during the afternoon and reached a peak (more than 50%) around 18:00, which indicates that the regional transport is the important role for the daytime air pollution in Beijing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Geologic mapping of the Amirani-Gish Bar region of Io: Implications for the global geologic mapping of Io

    Science.gov (United States)

    Williams, D.A.; Keszthelyi, L.P.; Crown, D.A.; Jaeger, W.L.; Schenk, P.M.

    2007-01-01

    We produced the first geologic map of the Amirani-Gish Bar region of Io, the last of four regional maps generated from Galileo mission data. The Amirani-Gish Bar region has five primary types of geologic materials: plains, mountains, patera floors, flows, and diffuse deposits. The flows and patera floors are thought to be compositionally similar, but are subdivided based on interpretations regarding their emplacement environments and mechanisms. Our mapping shows that volcanic activity in the Amirani-Gish Bar region is dominated by the Amirani Eruptive Center (AEC), now recognized to be part of an extensive, combined Amirani-Maui flow field. A mappable flow connects Amirani and Maui, suggesting that Maui is fed from Amirani, such that the post-Voyager designation "Maui Eruptive Center" should be revised. Amirani contains at least four hot spots detected by Galileo, and is the source of widespread bright (sulfur?) flows and active dark (silicate?) flows being emplaced in the Promethean style (slowly emplaced, compound flow fields). The floor of Gish Bar Patera has been partially resurfaced by dark lava flows, although other parts of its floor are bright and appeared unchanged during the Galileo mission. This suggests that the floor did not undergo complete resurfacing as a lava lake as proposed for other ionian paterae. There are several other hot spots in the region that are the sources of both active dark flows (confined within paterae), and SO2- and S2-rich diffuse deposits. Mapped diffuse deposits around fractures on mountains and in the plains appear to serve as the source for gas venting without the release of magma, an association previously unrecognized in this region. The six mountains mapped in this region exhibit various states of degradation. In addition to gaining insight into this region of Io, all four maps are studied to assess the best methodology to use to produce a new global geologic map of Io based on the newly released, combined Galileo

  19. Negative Symptom Dimensions of the Positive and Negative Syndrome Scale Across Geographical Regions: Implications for Social, Linguistic, and Cultural Consistency.

    Science.gov (United States)

    Khan, Anzalee; Liharska, Lora; Harvey, Philip D; Atkins, Alexandra; Ulshen, Daniel; Keefe, Richard S E

    2017-12-01

    Objective: Recognizing the discrete dimensions that underlie negative symptoms in schizophrenia and how these dimensions are understood across localities might result in better understanding and treatment of these symptoms. To this end, the objectives of this study were to 1) identify the Positive and Negative Syndrome Scale negative symptom dimensions of expressive deficits and experiential deficits and 2) analyze performance on these dimensions over 15 geographical regions to determine whether the items defining them manifest similar reliability across these regions. Design: Data were obtained for the baseline Positive and Negative Syndrome Scale visits of 6,889 subjects across 15 geographical regions. Using confirmatory factor analysis, we examined whether a two-factor negative symptom structure that is found in schizophrenia (experiential deficits and expressive deficits) would be replicated in our sample, and using differential item functioning, we tested the degree to which specific items from each negative symptom subfactor performed across geographical regions in comparison with the United States. Results: The two-factor negative symptom solution was replicated in this sample. Most geographical regions showed moderate-to-large differential item functioning for Positive and Negative Syndrome Scale expressive deficit items, especially N3 Poor Rapport, as compared with Positive and Negative Syndrome Scale experiential deficit items, showing that these items might be interpreted or scored differently in different regions. Across countries, except for India, the differential item functioning values did not favor raters in the United States. Conclusion: These results suggest that the Positive and Negative Syndrome Scale negative symptom factor can be better represented by a two-factor model than by a single-factor model. Additionally, the results show significant differences in responses to items representing the Positive and Negative Syndrome Scale expressive

  20. Dental artifacts in the head and neck region: implications for Dixon-based attenuation correction in PET/MR

    Energy Technology Data Exchange (ETDEWEB)

    Ladefoged, Claes N; Hansen, Adam E; Keller, Sune H; Fischer, Barbara M [Department of Clinical Physiology, Nuclear Medicine and PET, Rigshospitalet, University of Copenhagen, Blegdamsvej 9, 2100 Copenhagen East (Denmark); Rasmussen, Jacob H [Department of Oncology, Rigshospitalet, University of Copenhagen, Blegdamsvej 9, 2100 Copenhagen East (Denmark); Law, Ian; Kjær, Andreas; Højgaard, Liselotte [Department of Clinical Physiology, Nuclear Medicine and PET, Rigshospitalet, University of Copenhagen, Blegdamsvej 9, 2100 Copenhagen East (Denmark); Lauze, Francois [Department of Computer Science, University of Copenhagen, Universitetsparken 5, 2100 Copenhagen East (Denmark); Beyer, Thomas [Centre for Medical Physics and Biomedical Engineering, Medical University of Vienna, Waehringer Guertel 18-20/4L, Vienna, A-1090 (Austria); Andersen, Flemming L [Department of Clinical Physiology, Nuclear Medicine and PET, Rigshospitalet, University of Copenhagen, Blegdamsvej 9, 2100 Copenhagen East (Denmark)

    2015-03-11

    In the absence of CT or traditional transmission sources in combined clinical positron emission tomography/magnetic resonance (PET/MR) systems, MR images are used for MR-based attenuation correction (MR-AC). The susceptibility effects due to metal implants challenge MR-AC in the neck region of patients with dental implants. The purpose of this study was to assess the frequency and magnitude of subsequent PET image distortions following MR-AC. A total of 148 PET/MR patients with clear visual signal voids on the attenuation map in the dental region were included in this study. Patients were injected with [{sup 18}F]-FDG, [{sup 11}C]-PiB, [{sup 18}F]-FET, or [{sup 64}Cu]-DOTATATE. The PET/MR data were acquired over a single-bed position of 25.8 cm covering the head and neck. MR-AC was based on either standard MR-AC{sub DIXON} or MR-AC{sub INPAINTED} where the susceptibility-induced signal voids were substituted with soft tissue information. Our inpainting algorithm delineates the outer contour of signal voids breaching the anatomical volume using the non-attenuation-corrected PET image and classifies the inner air regions based on an aligned template of likely dental artifact areas. The reconstructed PET images were evaluated visually and quantitatively using regions of interests in reference regions. The volume of the artifacts and the computed relative differences in mean and max standardized uptake value (SUV) between the two PET images are reported. The MR-based volume of the susceptibility-induced signal voids on the MR-AC attenuation maps was between 1.6 and 520.8 mL. The corresponding/resulting bias of the reconstructed tracer distribution was localized mainly in the area of the signal void. The mean and maximum SUVs averaged across all patients increased after inpainting by 52% (± 11%) and 28% (± 11%), respectively, in the corrected region. SUV underestimation decreased with the distance to the signal void and correlated with the volume of the susceptibility

  1. A preliminary assessment of earthquake ground shaking hazard at Yucca Mountain, Nevada and implications to the Las Vegas region

    Energy Technology Data Exchange (ETDEWEB)

    Wong, I.G.; Green, R.K.; Sun, J.I. [Woodward-Clyde Federal Services, Oakland, CA (United States); Pezzopane, S.K. [Geological Survey, Denver, CO (United States); Abrahamson, N.A. [Abrahamson (Norm A.), Piedmont, CA (United States); Quittmeyer, R.C. [Woodward-Clyde Federal Services, Las Vegas, NV (United States)

    1996-12-31

    As part of early design studies for the potential Yucca Mountain nuclear waste repository, the authors have performed a preliminary probabilistic seismic hazard analysis of ground shaking. A total of 88 Quaternary faults within 100 km of the site were considered in the hazard analysis. They were characterized in terms of their probability o being seismogenic, and their geometry, maximum earthquake magnitude, recurrence model, and slip rate. Individual faults were characterized by maximum earthquakes that ranged from moment magnitude (M{sub w}) 5.1 to 7.6. Fault slip rates ranged from a very low 0.00001 mm/yr to as much as 4 mm/yr. An areal source zone representing background earthquakes up to M{sub w} 6 1/4 = 1/4 was also included in the analysis. Recurrence for these background events was based on the 1904--1994 historical record, which contains events up to M{sub w} 5.6. Based on this analysis, the peak horizontal rock accelerations are 0.16, 0.21, 0.28, and 0.50 g for return periods of 500, 1,000, 2,000, and 10,000 years, respectively. In general, the dominant contributor to the ground shaking hazard at Yucca Mountain are background earthquakes because of the low slip rates of the Basin and Range faults. A significant effect on the probabilistic ground motions is due to the inclusion of a new attenuation relation developed specifically for earthquakes in extensional tectonic regimes. This relation gives significantly lower peak accelerations than five other predominantly California-based relations used in the analysis, possibly due to the lower stress drops of extensional earthquakes compared to California events. Because Las Vegas is located within the same tectonic regime as Yucca Mountain, the seismic sources and path and site factors affecting the seismic hazard at Yucca Mountain also have implications to Las Vegas. These implications are discussed in this paper.

  2. A preliminary assessment of earthquake ground shaking hazard at Yucca Mountain, Nevada and implications to the Las Vegas region

    International Nuclear Information System (INIS)

    Wong, I.G.; Green, R.K.; Sun, J.I.; Pezzopane, S.K.; Abrahamson, N.A.; Quittmeyer, R.C.

    1996-01-01

    As part of early design studies for the potential Yucca Mountain nuclear waste repository, the authors have performed a preliminary probabilistic seismic hazard analysis of ground shaking. A total of 88 Quaternary faults within 100 km of the site were considered in the hazard analysis. They were characterized in terms of their probability o being seismogenic, and their geometry, maximum earthquake magnitude, recurrence model, and slip rate. Individual faults were characterized by maximum earthquakes that ranged from moment magnitude (M w ) 5.1 to 7.6. Fault slip rates ranged from a very low 0.00001 mm/yr to as much as 4 mm/yr. An areal source zone representing background earthquakes up to M w 6 1/4 = 1/4 was also included in the analysis. Recurrence for these background events was based on the 1904--1994 historical record, which contains events up to M w 5.6. Based on this analysis, the peak horizontal rock accelerations are 0.16, 0.21, 0.28, and 0.50 g for return periods of 500, 1,000, 2,000, and 10,000 years, respectively. In general, the dominant contributor to the ground shaking hazard at Yucca Mountain are background earthquakes because of the low slip rates of the Basin and Range faults. A significant effect on the probabilistic ground motions is due to the inclusion of a new attenuation relation developed specifically for earthquakes in extensional tectonic regimes. This relation gives significantly lower peak accelerations than five other predominantly California-based relations used in the analysis, possibly due to the lower stress drops of extensional earthquakes compared to California events. Because Las Vegas is located within the same tectonic regime as Yucca Mountain, the seismic sources and path and site factors affecting the seismic hazard at Yucca Mountain also have implications to Las Vegas. These implications are discussed in this paper

  3. Characterizing the emission implications of future natural gas production and use in the U.S. and Rocky Mountain region: A scenario-based energy system modeling approach

    Science.gov (United States)

    McLeod, Jeffrey

    The recent increase in U.S. natural gas production made possible through advancements in extraction techniques including hydraulic fracturing has transformed the U.S. energy supply landscape while raising questions regarding the balance of environmental impacts associated with natural gas production and use. Impact areas at issue include emissions of methane and criteria pollutants from natural gas production, alongside changes in emissions from increased use of natural gas in place of coal for electricity generation. In the Rocky Mountain region, these impact areas have been subject to additional scrutiny due to the high level of regional oil and gas production activity and concerns over its links to air quality. Here, the MARKAL (MArket ALlocation) least-cost energy system optimization model in conjunction with the EPA-MARKAL nine-region database has been used to characterize future regional and national emissions of CO 2, CH4, VOC, and NOx attributed to natural gas production and use in several sectors of the economy. The analysis is informed by comparing and contrasting a base case, business-as-usual scenario with scenarios featuring variations in future natural gas supply characteristics, constraints affecting the electricity generation mix, carbon emission reduction strategies and increased demand for natural gas in the transportation sector. Emission trends and their associated sensitivities are identified and contrasted between the Rocky Mountain region and the U.S. as a whole. The modeling results of this study illustrate the resilience of the short term greenhouse gas emission benefits associated with fuel switching from coal to gas in the electric sector, but also call attention to the long term implications of increasing natural gas production and use for emissions of methane and VOCs, especially in the Rocky Mountain region. This analysis can help to inform the broader discussion of the potential environmental impacts of future natural gas production

  4. A Preliminary Assessment of the Regionally Aligned Forces (RAF) Concept’s Implications for Army Personnel Management

    Science.gov (United States)

    2015-01-01

    document is HQD146655. v Contents Preface...characteristics of a full range of countries in a region, however, is probably infeasible. For the moment, we are content to operate on the...27,021, is made up of infantry (CMF 11), followed by supply (92) at 19,264, medical personnel (68) at 13,959, and audiovisual (25) at 16,611

  5. Genomic regions under selection in crop-wild hybrids of lettuce: implications for crop breeding and environmental risk assessment

    NARCIS (Netherlands)

    Hartman, Y.

    2012-01-01

    The results of this thesis show that the probability of introgression of a putative transgene to wild relatives indeed depends strongly on the insertion location of the transgene. The study of genomic selection patterns can identify crop genomic regions under negative selection in multiple

  6. Ancient paralogy in the cpDNA trnL-F region in Annonaceae: implications for plant molecular systematics

    NARCIS (Netherlands)

    Pirie, M.D.; Vargas, M.P.B.; Botermans, M.; Bakker, F.T.; Chatrou, L.W.

    2007-01-01

    The plastid trnL-F region has proved useful in molecular phylogenetic studies addressing diverse evolutionary questions from biogeographic history to character evolution in a broad range of plant groups. An important assumption for phylogenetic reconstruction is that data used in combined analyses

  7. Emissions implications of future natural gas production and use in the U.S. and in the Rocky Mountain region.

    Science.gov (United States)

    McLeod, Jeffrey D; Brinkman, Gregory L; Milford, Jana B

    2014-11-18

    Enhanced prospects for natural gas production raise questions about the balance of impacts on air quality, as increased emissions from production activities are considered alongside the reductions expected when natural gas is burned in place of other fossil fuels. This study explores how trends in natural gas production over the coming decades might affect emissions of greenhouse gases (GHG), volatile organic compounds (VOCs) and nitrogen oxides (NOx) for the United States and its Rocky Mountain region. The MARKAL (MARKet ALlocation) energy system optimization model is used with the U.S. Environmental Protection Agency's nine-region database to compare scenarios for natural gas supply and demand, constraints on the electricity generation mix, and GHG emissions fees. Through 2050, total energy system GHG emissions show little response to natural gas supply assumptions, due to offsetting changes across sectors. Policy-driven constraints or emissions fees are needed to achieve net reductions. In most scenarios, wind is a less expensive source of new electricity supplies in the Rocky Mountain region than natural gas. U.S. NOx emissions decline in all the scenarios considered. Increased VOC emissions from natural gas production offset part of the anticipated reductions from the transportation sector, especially in the Rocky Mountain region.

  8. MAPT expression and splicing is differentially regulated by brain region: relation to genotype and implication for tauopathies

    Science.gov (United States)

    Trabzuni, Daniah; Wray, Selina; Vandrovcova, Jana; Ramasamy, Adaikalavan; Walker, Robert; Smith, Colin; Luk, Connie; Gibbs, J. Raphael; Dillman, Allissa; Hernandez, Dena G.; Arepalli, Sampath; Singleton, Andrew B.; Cookson, Mark R.; Pittman, Alan M.; de Silva, Rohan; Weale, Michael E.; Hardy, John; Ryten, Mina

    2012-01-01

    The MAPT (microtubule-associated protein tau) locus is one of the most remarkable in neurogenetics due not only to its involvement in multiple neurodegenerative disorders, including progressive supranuclear palsy, corticobasal degeneration, Parksinson's disease and possibly Alzheimer's disease, but also due its genetic evolution and complex alternative splicing features which are, to some extent, linked and so all the more intriguing. Therefore, obtaining robust information regarding the expression, splicing and genetic regulation of this gene within the human brain is of immense importance. In this study, we used 2011 brain samples originating from 439 individuals to provide the most reliable and coherent information on the regional expression, splicing and regulation of MAPT available to date. We found significant regional variation in mRNA expression and splicing of MAPT within the human brain. Furthermore, at the gene level, the regional distribution of mRNA expression and total tau protein expression levels were largely in agreement, appearing to be highly correlated. Finally and most importantly, we show that while the reported H1/H2 association with gene level expression is likely to be due to a technical artefact, this polymorphism is associated with the expression of exon 3-containing isoforms in human brain. These findings would suggest that contrary to the prevailing view, genetic risk factors for neurodegenerative diseases at the MAPT locus are likely to operate by changing mRNA splicing in different brain regions, as opposed to the overall expression of the MAPT gene. PMID:22723018

  9. WHO Environmental Noise Guidelines for the European Region - What is new? 4. Implementation of guidelines and implications for practice

    NARCIS (Netherlands)

    Brink, M.; Babisch, W.; Belojevic, G.; Heroux, M.E.; Janssen, S.; Lercher, P.; Paviotti, M.; Pershagen, G.; Persson Waye, K.; Preis, A.; Stansfeld, S.; Van Den Berg, M.; Verbeek, J.

    2016-01-01

    WHO Environmental Noise Guidelines focus on the WHO European Region and provide guidance to its Member States that is compatible with the noise indicators used in the EU Environmental Noise Directive. The