WorldWideScience

Sample records for forming region cepheus

  1. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. VI. THE DISTANCE TO THE YOUNG STELLAR OBJECT HW 9 IN CEPHEUS A

    International Nuclear Information System (INIS)

    Dzib, Sergio; Loinard, Laurent; RodrIguez, Luis F.; Mioduszewski, Amy J.; Torres, Rosa M.

    2011-01-01

    Using the Very Long Baseline Array (VLBA), we have observed the radio continuum emission from the young stellar object HW 9 in the Cepheus A star-forming region at 10 epochs between 2007 February and 2009 November. Due to its strong radio variability, the source was detected at only four of the ten epochs. From these observations, the trigonometric parallax of HW 9 was determined to be π = 1.43 ± 0.07 mas, in excellent agreement with a recent independent determination by Moscadelli et al. of the trigonometric parallax of a methanol maser associated with the nearby young stellar source HW 2 (π = 1.43 ± 0.08 mas). This concordance in results, obtained in one case from continuum and in the other from line observations, confirms the reliability of VLBA trigonometric parallax measurements. By combining the two results, we constrain the distance to Cepheus A to be 700 +31 - 28 pc, an uncertainty of 3.5%.

  2. Cepheus

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    (abbrev. Cep, gen. Cephei; area 588 sq. deg.) A northern constellation which lies between Draco and Cassiopeia, and culminates at midnight in late August. It is named after King Cepheus, husband of Queen Cassiopeia and father of Andromeda in Greek mythology. Its brightest stars were cataloged by Ptolemy (c. AD 100-175) in the Almagest....

  3. A survey of formaldehyde in the Cepheus OB3 molecular cloud

    International Nuclear Information System (INIS)

    Few, R.W.; Cohen, R.J.

    1983-01-01

    The 1 11 - 1 10 absorption line of formaldehyde at 6-cm wavelength has been surveyed over the region of the Cepheus OB3 molecular cloud, using the Jodrell Bank Mk II radio telescope (beamwidth 9 x 10 arcmin 2 ). The measurements have a velocity resolution of 0.27 km s - 1 and an rms noise level of approx. 0.01 K. The formaldehyde has a very clumpy distribution which is broadly similar to the CO distribution found by Sargent. A total molecular mass of 1.9 x 10 4 solar masses is implied by the formaldehyde measurements. Cepheus A is not the dominant concentration in the formaldehyde map. The most massive formaldehyde concentration is Cepheus C, which has a mass of 3600 solar masses. It appears to be stabilized by rotation. (author)

  4. Far-infrared and CO observations of Cep F: Implications for star formation in Cepheus OB3

    International Nuclear Information System (INIS)

    Sargent, A.I.; van Duinen, R.J.; Nordh, H.L.; Fridlund, C.V.M.; Aalders, J.W.G.; Beintema, D.

    1983-01-01

    Observations at 80-μm and 130-μm have revealed a source of far-infrared emission in the Cep F portion of the Cepheus OB3 molecular cloud. Molecular line measurements of this region, at the CO J = 1-0 line frequency, have led to the discovery of two CO maxima. One of these coincides with the new far-infrared source. The other is at least as intense as Cep B, until now considered to be the hottest part of the cloud. There is some evidence to suggest that a second far-infrared source is associated with this hotspot. If the far-infrared emission results from the presence of embedded protostars, their location, relative to the OB association stars and to the other active region, Cep A, requires a reexamination of how stars form in the Cepheus OB3 association

  5. Into the Darkness: Interstellar Extinction Near the Cepheus OB3 Molecular Cloud

    Science.gov (United States)

    Fitzpatrick, Edward L.; Jacklin, S.; Massa, D.

    2014-01-01

    We present the results of a followup investigation to a study performed by Massa and Savage (1984, ApJ, 279, 310) of the properties of UV interstellar extinction in the region of the Cepheus OB3 molecular cloud. That study was performed using UV photometry and spectro-photometry from the ANS and IUE satellites. We have extended this study into the IR, utilizing the uniform database of IR photometry available from the 2MASS project. This is a part of a larger program whose goal is to study the properties of extinction in localized regions, where we hope to find clues to dust grain growth and destruction processes through spatial correlations of extinction with distinct environmental properties. Similarly to Massa and Savage’s UV results, we find that the IR extinction properties on the Cepheus OB3 region vary systematically with the apparent proximity of the target stars to the molecular cloud. We also find that the UV extinction and the IR extinction are crudely correlated. The methodology leading to these results and their implications are discussed.

  6. Searching for Young Stars in Cepheus C

    Science.gov (United States)

    Evans, Sam; Rebull, Luisa; Rutherford, Thomas; Stalnaker, Olivia; Taylor, John; Efsits, Gabriel; Harl, Linda; Keil, Shayna; Learman, Duncan; Leonard, Liam; Russell, Aaron

    2018-01-01

    We used archival Herschel Space Observatory data to search for young stellar objects (YSOs) in the Cepheus C region of the molecular cloud Cepheus OB3. Previous work by Gutermuth et al. (2009) identified 114 YSO candidates in this region based on Spitzer/IRAC data. Work by Orr et al. (2016) refined a list of approximately 300 young star candidates to 245 likely YSOs. Our initial search focused on longer infrared wavelength data – Herschel (70, 160, 250, 350, 500 μm) archival data and SCUBA (450, 850 μm) data from the literature (DiFrancesco et al. 2008). Through image inspection and catalog matching, we assembled a list of 54 candidate YSOs detected at wavelengths longer than 22 μm. For each source, we constructed a spectral energy distribution (SED) by aggregating available shorter wavelength data from the literature and assembling photometry from released PACS catalogs, preliminary SPIRE catalogs, and our own photometric measurements. We also created color-color and color-magnitude diagrams to see how these sources compared to each other, other populations of YSOs, and objects in extragalactic regions. Each source was then classified based on its SED shape and its locations on color-color and color-magnitude diagrams. From the initial list of 54 candidates, we suspect all are likely YSOs, some of which are very embedded; ~40% are likely SED Class I or 0. Approximately 20% of the 54 sources have not been previously identified. By beginning the investigation of YSOs in this region, we are adding to the body of YSO knowledge which can be used to understand the process of star formation. This research was made possible through the NASA/IPAC Teacher Archive Research Program (NITARP) and was funded by NASA Astrophysics Data Program.

  7. Astrometric Observation of Delta Cepheus

    Science.gov (United States)

    Warren, Naomi; Wilson, Betsie; Estrada, Chris; Crisafi, Kim; King, Jackie; Jones, Stephany; Salam, Akash; Warren, Glenn; Collins, S. Jananne; Genet, Russell

    2012-04-01

    Members of a Cuesta College astronomy research seminar used a manually-controlled 10-inch Newtonian Reflector telescope to determine the separation and position angle of the binary star Delta Cepheus. It was observed on the night of Saturday, October 29, 2011, at Star Hill in Santa Margarita, California. Their values of 40.2 arc seconds and 192.4 degrees were similar to those reported in the WDS (1910).

  8. A PULSED, PRECESSING JET IN CEPHEUS A

    International Nuclear Information System (INIS)

    Cunningham, Nathaniel J.; Moeckel, Nickolas; Bally, John

    2009-01-01

    We present near-infrared H 2 , radio CO, and thermal infrared observations of the nearby massive star-forming region Cepheus A (Cep A). From H 2 bow shocks arranged along four distinct jet axes, we infer that the massive protostellar source HW2 drives a pulsed, precessing jet that has changed its orientation by about 45 deg. in roughly 10 4 years. The current HW2 radio jet represents the most recent event in this time series of eruptions. This scenario is consistent with the recent discovery of a disk around HW2, perpendicular to the current jet orientation, and with the presence of companions at projected distances comparable to the disk radius. We propose that the Cep A system formed by the disk-assisted capture of a sibling star by HW2. We present a numerical model of a 15 M sun star with a circumstellar disk, orbited by a companion in an inclined, eccentric orbit. Close passages of the companion through or near the disk result in periods of enhanced accretion and mass loss, as well as forced precession of the disk and associated orientation changes in the jet. The observations reveal a second powerful outflow that emerges from radio source HW3c or HW3d. This flow is associated with blueshifted CO emission and a faint H 2 bow shock to the east, and with HH 168 to the west. A collision between the flows from HW2 and HW3c/d may be responsible for X-ray and radio continuum emission in Cep A West.

  9. THE VARIABLE REFLECTION NEBULA CEPHEUS A EAST

    International Nuclear Information System (INIS)

    Hodapp, Klaus W.; Bressert, Eli

    2009-01-01

    We report K'-band imaging observations of the reflection nebula associated with Cepheus A East covering the time interval from 1990 to 2004. Over this time the reflection nebula shows variations of flux distribution, which we interpret as the effect of inhomogeneous and varying extinction in the light path from the illuminating source HW2 to the reflection nebula. The obscuring material is located within typical distances of ∼ 10 AU from the illuminating source.

  10. The Green Bank Ammonia Survey: Observations of Hierarchical Dense Gas Structures in Cepheus-L1251

    Science.gov (United States)

    Keown, Jared; Di Francesco, James; Kirk, Helen; Friesen, Rachel K.; Pineda, Jaime E.; Rosolowsky, Erik; Ginsburg, Adam; Offner, Stella S. R.; Caselli, Paola; Alves, Felipe; Chacón-Tanarro, Ana; Punanova, Anna; Redaelli, Elena; Seo, Young Min; Matzner, Christopher D.; Chun-Yuan Chen, Michael; Goodman, Alyssa A.; Chen, How-Huan; Shirley, Yancy; Singh, Ayushi; Arce, Hector G.; Martin, Peter; Myers, Philip C.

    2017-11-01

    We use Green Bank Ammonia Survey observations of NH3 (1, 1) and (2, 2) emission with 32″ FWHM resolution from a ˜10 pc2 portion of the Cepheus-L1251 molecular cloud to identify hierarchical dense gas structures. Our dendrogram analysis of the NH3 data results in 22 top-level structures, which reside within 13 lower-level parent structures. The structures are compact (0.01 {pc}≲ {R}{eff}≲ 0.1 {pc}) and are spatially correlated with the highest H2 column density portions of the cloud. We also compare the ammonia data to a catalog of dense cores identified by higher-resolution (18.″2 FWHM) Herschel Space Observatory observations of dust continuum emission from Cepheus-L1251. Maps of kinetic gas temperature, velocity dispersion, and NH3 column density, derived from detailed modeling of the NH3 data, are used to investigate the stability and chemistry of the ammonia-identified and Herschel-identified structures. We show that the dust and dense gas in the structures have similar temperatures, with median T dust and T K measurements of 11.7 ± 1.1 K and 10.3 ± 2.0 K, respectively. Based on a virial analysis, we find that the ammonia-identified structures are gravitationally dominated, yet may be in or near a state of virial equilibrium. Meanwhile, the majority of the Herschel-identified dense cores appear to be not bound by their own gravity and instead confined by external pressure. CCS (20 - 10) and HC5N (9-8) emission from the region reveal broader line widths and centroid velocity offsets when compared to the NH3 (1, 1) emission in some cases, likely due to these carbon-based molecules tracing the turbulent outer layers of the dense cores.

  11. Water masers in NGC7538 region

    Science.gov (United States)

    Kameya, Osamu

    We observed H2O masers towards NGC7538 molecular-cloud core using VERA (VLBI Experiment of Radio Astrometry). This region is in the Perseus arm at a distance of about 2.7 kpc and is famous for its multiple, massive star formation. There are three areas there, N(IRS1-3), E(IRS9), and S(IRS11), each having a strong IR source(s), ultra-compact HII region(s), bipolar outflow, high-density core, and OH/H2O/CH3OH masers. We made differential VLBI observations towards the NGC7538 H2O maser sources at N and S and a reference source, Cepheus A H2O maser, simultaneously. The Cepheus A region is separated by 2 degrees from the NGC7538 region. The positions of H2O masers in N and S regions, distributed around the ultra-compact HII regions, are basically consistent with those found by means of interferometric observations of past 29 years. The masers may come from interface regions between the ultra-compact HII regions and the environments of dense molecular gas.

  12. A circumstellar molecular gas structure associated with the massive young star Cepheus A-HW 2

    Science.gov (United States)

    Torrelles, Jose M.; Rodriguez, Luis F.; Canto, Jorge; Ho, Paul T. P.

    1993-01-01

    We report the detection via VLA-D observations of ammonia of a circumstellar high-density molecular gas structure toward the massive young star related to the object Cepheus A-HW 2, a firm candidate for the powering source of the high-velocity molecular outflow in the region. We suggest that the circumstellar molecular gas structure could be related to the circumstellar disk previously suggested from infrared, H2O, and OH maser observations. We consider as a plausible scenario that the double radio continuum source of HW 2 could represent the ionized inner part of the circumstellar disk, in the same way as proposed to explain the double radio source in L1551. The observed motions in the circumstellar molecular gas can be produced by bound motions (e.g., infall or rotation) around a central mass of about 10-20 solar masses (B0.5 V star or earlier).

  13. EXTREMELY BROAD RADIO RECOMBINATION MASER LINES TOWARD THE HIGH-VELOCITY IONIZED JET IN CEPHEUS A HW2

    International Nuclear Information System (INIS)

    Jimenez-Serra, I.; Patel, N.; Martin-Pintado, J.; Baez-Rubio, A.; Thum, C.

    2011-01-01

    We present the first detection of the H40α, H34α, and H31α radio recombination lines (RRLs) at millimeter wavelengths toward the high-velocity ionized jet in the Cepheus A HW2 star-forming region. From our single-dish and interferometric observations, we find that the measured RRLs show extremely broad asymmetric line profiles with zero-intensity line widths of ∼1100 km s -1 . From the line widths, we estimate a terminal velocity for the ionized gas in the jet of ≥500 km s -1 , consistent with that obtained from the proper motions of the HW2 radio jet. The total integrated line-to-continuum flux ratios of the H40α, H34α, and H31α lines are 43, 229, and 280 km s -1 , clearly deviating from LTE predictions. These ratios are very similar to those observed for the RRL masers toward MWC349A, suggesting that the intensities of the RRLs toward HW2 are affected by maser emission. Our radiative transfer modeling of the RRLs shows that their asymmetric profiles could be explained by maser emission arising from a bi-conical radio jet with a semi-opening angle of 18 deg., electron density distribution varying as r -2.11 , and turbulent and expanding wind velocities of 60 and 500 km s -1 .

  14. From bipolar to quadrupolar - The collimation processes of the Cepheus A outflow

    Science.gov (United States)

    Torrelles, Jose M.; Verdes-Montenegro, Lourdes; Ho, Paul T. P.; Rodriguez, Luis F.; Canto, Jorge

    1993-01-01

    Results of new K-band observations of the (1, 1) and (2, 2) ammonia lines toward Cepheus A are reported. The lines are mapped with approximately 2 arcsec of angular resolution and 0.3 km/s of velocity resolution. A sensitivity of 10 mJy has been achieved. The observations reveal details of the spatial and kinematics structure of the ambient high-density gas. It is suggested that the interstellar high-density gas is diverting and redirecting the outflow in the sense that the quadrupolar structure of the molecular outflow is produced by the interaction with the ammonia condensationss, with Cep A-1 and Cep A-3 splitting in two halves, respectively the blue- and redshifted lobes of an east-west bipolar molecular outflow.

  15. Areas and forms of regional cooperation in multi-structured (matreshka-style) regions (Tyumen region, Russia)

    OpenAIRE

    LARIONOV ANDREY V.

    2015-01-01

    The problem of the administrative, economic and social sustainability of a group consisting of neighboring regions with close ties has no clear solution yet. Should closely-tied regions in the long run form a centralized system of administrative bodies, compress their budgets into one, and construct unified social programs, or not? To answer this question, in the article we describe a case that represents the paramount form of cooperation amongst closely-tied regions. It is the case of the so...

  16. Gemini Spectroscopic Survey of Young Intermediate-Mass Star-Forming Regions

    Science.gov (United States)

    Lundquist, Michael; Kobulnicky, Henry

    2018-01-01

    The majority of stars form in embedded clusters. Current research into star formation has focused on either high-mass star-forming regions or low-mass star-forming regions. We present the results from a Gemini spectroscopic survey of young intermediate-mass star-forming regions. These are star forming regions selected to produce stars up to but not exceeding 8 solar masses. We obtained spectra of these regions with GNIRS on Gemini North and Flamingos-2 on Gemini South. We also combine this with near-infrared imaging from 2MASS, UKIDSS, and VVV to study the stellar content.

  17. Spatial and kinematic structure of Monoceros star-forming region

    Science.gov (United States)

    Costado, M. T.; Alfaro, E. J.

    2018-05-01

    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  18. Forming the development program of industrial cooperation in the region

    Directory of Open Access Journals (Sweden)

    Aleksandr Viktorovich Makarov

    2011-09-01

    Full Text Available The paper defines the role of industrial cooperation in the process of ensuring the competitiveness of the Russian economy. Economic nature of this form of long-term cooperation specified subjects and objects of cooperatives, the effects of its introduction is disclosed. Formed concept of the Programme of development of industrial cooperation in the region, taking into account the state gained in building industrial complex and the differentiation of state support measures at various stages of development cooperation. Forecast parameters on implementation of cooperation development in Sverdlovsk region for the period up to 2020 are formed. According to the reported characteristics and conducted author's calculations, based on realistic projections of engineering enterprises of Sverdlovsk region, a four-indicator sectorgram for the performance evaluation of the program for the development of industrial and technological cooperation in the field of engineering is presented. The described approach to the establishment of a development program for the industrial cooperation in the region can monitor the situation, timely adjust regional performance standards and policies in this field

  19. Multimolecular studies of Galactic star-forming regions

    NARCIS (Netherlands)

    Baan, W. A.; Loenen, A. F.; Spaans, M.

    2014-01-01

    Molecular emission-line observations of isolated Galactic star-forming regions are used to model the physical properties of the molecular interstellar medium in these systems. Observed line ratios are compared with the results predicted by models that incorporate gas-phase chemistry and the heating

  20. Orion star-forming region - far-infrared and radio molecular observations

    International Nuclear Information System (INIS)

    Thronson, H.A. Jr.; Harper, D.A.; Bally, J.; Dragovan, M.; Mozurkewich, D.; Yerkes Observatory, Williams Bay, WI; ATandT Bell Labs., Holmdel, NJ; Chicago Uni., IL; E. O. Hulburt Center for Space Research, Washington, DC)

    1986-01-01

    New J = 1-0 CO and far-infrared maps of the Orion star-forming region are presented and discussed. The total infrared luminosity of the Orion star-forming ridge is 250,000 solar luminosities. The material that is emitting strongly at 60 microns is traced and found to be highly centrally concentrated. However, the majority of the extended emission from this region comes from dust that is ultimately heated by the visible Trapezium cluster stars. The luminosity of IRc 2, the most luminous member of the infrared cluster, is estimated to be 40,000-50,000 solar luminosities. A schematic drawing of the Ori MC 1 region is presented. 30 references

  1. Forming controlled inset regions by ion implantation and laser bombardment

    International Nuclear Information System (INIS)

    Gibbons, J.F.

    1981-01-01

    A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

  2. CEPHEUS results: measurements and occupants' satisfaction provide evidence for Passive Houses being an option for sustainable building

    International Nuclear Information System (INIS)

    Schnieders, Juergen; Hermelink, Andreas

    2006-01-01

    Passive houses offer extended living comfort with only 15-20% of the space heating demand of conventional new buildings while the extra costs of this standard are only about 10% of the total building costs. In the first part of this paper, detailed measurements for 11 'Passive House' projects with more than 100 dwelling units from the EU-funded demonstration project CEPHEUS (Cost Efficient Passive Houses as EUropean Standards) are presented. All projects exhibit extraordinarily low space heat consumptions. Compared with ordinary, newly erected buildings, 80% of the space heat consumption could be saved. The total primary energy consumption (including household electricity) was less than 50% of that of conventional new buildings. The measurements show that the buildings also offer comfortable indoor conditions in both summer and winter. Several social research studies revealed that the users are well pleased with their homes. The second part of the paper focuses on low-income tenant's satisfaction in the world's first multi-story Passive Houses in Kassel, Germany. This building contrasts sharply with the 'standard' Passive House, occupied by its owners. A 2.5 year study was conducted from spring of 2000 to autumn of 2002. The development of opinions, attitudes, behaviour, and satisfaction over time could be recorded. The building is a clear success, the tenant's satisfaction is high. It is concluded that this building type fulfils the conditions of sustainability in social, ecological and economic respects and should therefore be disseminated on a larger scale. To this end, the last part of the paper describes the development of the Passive House standard in Germany, Austria and Switzerland, from the first demonstration project in 1991 to about 3500 dwelling units today. The prerequisites for this development are analysed. Finally, the authors give their view about the political possibilities for pushing Passive Houses into the market as well as for stimulating a

  3. Academy panel proposes new form of regional institution

    International Nuclear Information System (INIS)

    Kloman, E.H.

    1977-01-01

    A panel of the National Academy of Public Administration has proposed development of a new form of interstate regional institution as an instrument for the siting, licensing, and regulating of nuclear facilities. Noting the danger that the nation's energy supplies may prove inadequate to meet basic needs of the economy despite increasing emphasis on greater use of coal and energy conservation, the panel pointed to the virtual stalemate in the national decision-making process for siting and licensing nuclear plants. A basic cause of the logjam is the growing conflict and overlap between federal and state agencies for authorizing nuclear development. The panel recommended setting up a new form of regional organization to fill an institutional void between federal and state levels of government. The proposed regional organizations would be established through federal legislation preempting to the Federal Government the regulation of siting, licensing, and construction of nuclear facilities. They would have jurisdiction over all matters in the operation of nuclear plants relating to public health and safety including those environmental factors and socio-economic factors covered in the preparation of environmental impact statements

  4. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

    Science.gov (United States)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

    2018-01-01

    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  5. Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region

    Science.gov (United States)

    Bajaj, Ketan; Anbazhagan, P.

    2018-01-01

    Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

  6. OH outflows in star-forming regions

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Ruiz, A.; Rodriguez, L.F.; Canto, J.; Universidad de Puer; Universidad de Puerto Rico, Rio Piedras; Universidad Nacional Autonoma de Mexico, Mexico City)

    1987-01-01

    The results from a survey for high-velocity OH in molecular outflows in star-forming regions are reported. High-velocity OH was detected in absorption in nine of these regions. When the telescope beam can resolve the outflows, they show similar anisotropic angular distribution as the redshifted and blueshifted CO. The OH transitions are markedly subthermal since for several sources it is found that the radiation that is being absorbed is a background continuum constituted by the cosmic component plus a small Galactic contribution. The absorbing OH appears to trace gas with higher velocities and lower densities than does the CO and, in some cases, provides information on the structure of the outflows at larger distances from the central source. At scales of 0.1 pc, the outflows are elongated in the direction of the steepest density gradient of the ambient cloud, suggesting that the large-scale collimation of the outflow is produced by the density structure of the ambient cloud. 29 references

  7. Stellar Feedback in Massive Star-Forming Regions

    Science.gov (United States)

    Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret

    2008-02-01

    Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

  8. YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: gsaral@cfa.harvard.edu [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2015-11-01

    We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

  9. VLBA Changes Picture of Famous Star-Forming Region

    Science.gov (United States)

    2007-10-01

    Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

  10. New far infrared images of bright, nearby, star-forming regions

    Science.gov (United States)

    Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

    1995-01-01

    Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

  11. Cassiopeia

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    (abbrev. Cas, gen. Cassiopeiae; area 598 sq. deg.) A northern constellation which lies between Cepheus and Andromeda, and culminates at midnight in early October. It is named after Queen Cassiopeia, wife of King Cepheus and mother of Andromeda in Greek mythology, and is usually shown on early celestial charts as a seated figure. Its brightest stars were cataloged by Ptolemy (c. AD 100-175) in the ...

  12. The distribution of warm gas in the G327.3-0.6 star forming region

    NARCIS (Netherlands)

    Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

    Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

  13. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

    2000-01-01

    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  14. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

    2000-01-01

    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  15. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    Energy Technology Data Exchange (ETDEWEB)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: edf@astro.psu.edu [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)

    2016-12-20

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  16. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    International Nuclear Information System (INIS)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.

    2016-01-01

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  17. Dynamical evolution of star-forming regions - II. Basic kinematics

    Science.gov (United States)

    Parker, Richard J.; Wright, Nicholas J.

    2016-04-01

    We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

  18. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    Science.gov (United States)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  19. WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  20. 76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

    Science.gov (United States)

    2011-07-15

    ... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

  1. FERMI LARGE AREA TELESCOPE STUDY OF COSMIC RAYS AND THE INTERSTELLAR MEDIUM IN NEARBY MOLECULAR CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Ackermann, M. [Deutsches Elektronen Synchrotron DESY, D-15738 Zeuthen (Germany); Ajello, M.; Allafort, A.; Bechtol, K.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Bottacini, E.; Buehler, R. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Baldini, L.; Bellazzini, R.; Bregeon, J. [Istituto Nazionale di Fisica Nucleare, Sezione di Pisa, I-56127 Pisa (Italy); Ballet, J. [Laboratoire AIM, CEA-IRFU/CNRS/Universite Paris Diderot, Service d' Astrophysique, CEA Saclay, F-91191 Gif sur Yvette (France); Barbiellini, G. [Istituto Nazionale di Fisica Nucleare, Sezione di Trieste, I-34127 Trieste (Italy); Bastieri, D. [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131 Padova (Italy); Bonamente, E. [Istituto Nazionale di Fisica Nucleare, Sezione di Perugia, I-06123 Perugia (Italy); Brandt, T. J. [CNRS, IRAP, F-31028 Toulouse cedex 4 (France); Brigida, M. [Dipartimento di Fisica ' M. Merlin' dell' Universita e del Politecnico di Bari, I-70126 Bari (Italy); Bruel, P., E-mail: hayashi@hep01.hepl.hiroshima-u.ac.jp, E-mail: mizuno@hep01.hepl.hiroshima-u.ac.jp [Laboratoire Leprince-Ringuet, Ecole polytechnique, CNRS/IN2P3, Palaiseau (France); and others

    2012-08-10

    We report an analysis of the interstellar {gamma}-ray emission from the Chamaeleon, R Coronae Australis (R CrA), and Cepheus and Polaris flare regions with the Fermi Large Area Telescope. They are among the nearest molecular cloud complexes, within {approx}300 pc from the solar system. The {gamma}-ray emission produced by interactions of cosmic rays (CRs) and interstellar gas in those molecular clouds is useful to study the CR densities and distributions of molecular gas close to the solar system. The obtained {gamma}-ray emissivities above 250 MeV are (5.9 {+-} 0.1{sub stat}{sup +0.9}{sub -1.0sys}) Multiplication-Sign 10{sup -27} photons s{sup -1} sr{sup -1} H-atom{sup -1}, (10.2 {+-} 0.4{sub stat}{sup +1.2}{sub -1.7sys}) Multiplication-Sign 10{sup -27} photons s{sup -1} sr{sup -1} H-atom{sup -1}, and (9.1 {+-} 0.3{sub stat}{sup +1.5}{sub -0.6sys}) Multiplication-Sign 10{sup -27} photons s{sup -1} sr{sup -1} H-atom{sup -1} for the Chamaeleon, R CrA, and Cepheus and Polaris flare regions, respectively. Whereas the energy dependences of the emissivities agree well with that predicted from direct CR observations at the Earth, the measured emissivities from 250 MeV to 10 GeV indicate a variation of the CR density by {approx}20% in the neighborhood of the solar system, even if we consider systematic uncertainties. The molecular mass calibrating ratio, X{sub CO} = N(H{sub 2})/W{sub CO}, is found to be (0.96 {+-} 0.06{sub stat}{sup +0.15}{sub -0.12sys}) Multiplication-Sign 10{sup 20} H{sub 2}-molecule cm{sup -2} (K km s{sup -1}){sup -1}, (0.99 {+-} 0.08{sub stat}{sup +0.18}{sub -0.10sys}) Multiplication-Sign 10{sup 20} H{sub 2}-molecule cm{sup -2} (K km s{sup -1}){sup -1}, and (0.63 {+-} 0.02{sub stat}{sup +0.09}{sub -0.07sys}) Multiplication-Sign 10{sup 20} H{sub 2}-molecule cm{sup -2} (K km s{sup -1}){sup -1} for the Chamaeleon, R CrA, and Cepheus and Polaris flare regions, respectively, suggesting a variation of X{sub CO} in the vicinity of the solar system. From the

  2. 77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

    Science.gov (United States)

    2012-11-14

    ... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

  3. Observations of star-forming regions with the Midcourse Space Experiment

    NARCIS (Netherlands)

    Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

    We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large

  4. Water in low-mass star-forming regions with Herschel

    DEFF Research Database (Denmark)

    Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.

    2010-01-01

    "Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...

  5. HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

    Science.gov (United States)

    2002-01-01

    NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

  6. Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: natsuko.izumi@nao.ac.jp [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)

    2017-10-01

    The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

  7. Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

    DEFF Research Database (Denmark)

    Grunfelder, Julien; Nielsen, Thomas Alexander Sick

    2012-01-01

    is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

  8. The Structure of the Nearby Giant Star-Forming Region 30 Doradus

    Science.gov (United States)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

    2007-08-01

    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  9. H2O masers in star-forming regions

    International Nuclear Information System (INIS)

    Downes, D.

    1985-01-01

    Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)

  10. Water in Star-forming Regions with Herschel (WISH): recent results and trends

    Science.gov (United States)

    van Dishoeck, E. F.

    2012-03-01

    Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at http://www.strw.leidenuniv.nl/WISH, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

  11. THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.

    2010-01-01

    We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

  12. Problems of regional innovation strategy forming

    Directory of Open Access Journals (Sweden)

    I. M. Golova

    2010-09-01

    Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

  13. Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

    DEFF Research Database (Denmark)

    O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine

    2013-01-01

    of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...

  14. Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

  15. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  16. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  17. VLA and CARMA observations of protostars in the Cepheus clouds: Sub-arcsecond proto-binaries formed via disk fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Tobin, John J.; Looney, Leslie W. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Chandler, Claire J. [National Radio Astronomy Observatory, Socorro, NM (United States); Wilner, David J.; Bourke, Tyler L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Loinard, Laurent; D' Alessio, Paola [Centro de Radioastronomía y Astrofísica, UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacán (Mexico); Chiang, Hsin-Fang [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii at Manoa, Hilo, HI 96720 (United States); Hartmann, Lee; Calvet, Nuria [Department of Astronomy, University of Michigan, Ann Arbor, MI 48109 (United States); Kwon, Woojin, E-mail: jtobin@nrao.edu [SRON Netherlands Institute for Space Research, Landleven 12, 9747 AD Groningen (Netherlands)

    2013-12-20

    We present observations of three Class 0/I protostars (L1157-mm, CB230 IRS1, and L1165-SMM1) using the Karl G. Jansky Very Large Array (VLA) and observations of two (L1165-SMM1 and CB230 IRS1) with the Combined Array for Research in Millimeter-wave Astronomy (CARMA). The VLA observations were taken at wavelengths of λ = 7.3 mm, 1.4 cm, 3.3 cm, 4.0 cm, and 6.5 cm with a best resolution of ∼0.''06 (18 AU) at 7.3 mm. The L1165-SMM1 CARMA observations were taken at λ = 1.3 mm with a best resolution of ∼0.''3 (100 AU) and the CB230 IRS1 observations were taken at λ = 3.4 mm with a best resolution of ∼3'' (900 AU). We find that L1165-SMM1 and CB230 IRS1 have probable binary companions at separations of ∼0.''3 (100 AU) from detections of secondary peaks at multiple wavelengths. The position angles of these companions are nearly orthogonal to the direction of the observed bipolar outflows, consistent with the expected protostellar disk orientations. We suggest that these companions may have formed from disk fragmentation; turbulent fragmentation would not preferentially arrange the binary companions to be orthogonal to the outflow direction. For L1165-SMM1, both the 7.3 mm and 1.3 mm emission show evidence of a large (R > 100 AU) disk. For the L1165-SMM1 primary protostar and the CB230 IRS1 secondary protostar, the 7.3 mm emission is resolved into structures consistent with ∼20 AU radius disks. For the other protostars, including L1157-mm, the emission is unresolved, suggesting disks with radii <20 AU.

  18. Shear viscosity of glass-forming melts in the liquid-glass transition region

    International Nuclear Information System (INIS)

    Sanditov, D. S.

    2010-01-01

    A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

  19. Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

    Directory of Open Access Journals (Sweden)

    Jahanbakhsh Pairanj

    2011-09-01

    Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

  20. Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region?

    Science.gov (United States)

    Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac

    2018-01-01

    To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

  1. The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

    Science.gov (United States)

    Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

    2016-04-01

    The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

  2. 77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

    Science.gov (United States)

    2012-08-08

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  3. Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions

    OpenAIRE

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

  4. 78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

    Science.gov (United States)

    2013-04-02

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

  5. MANAGEMENT OF THE INTERNAL LABOR MARKET (BASING ON CASES OF THE SVERDLOVSK REGION CITY-FORMING ENTERPRISES

    Directory of Open Access Journals (Sweden)

    S.V. Orekhova

    2008-12-01

    Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.

  6. Molecular line study of massive star-forming regions from the Red MSX Source survey

    Science.gov (United States)

    Yu, Naiping; Wang, Jun-Jie

    2014-05-01

    In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

  7. Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

    Science.gov (United States)

    Povich, Matthew Samuel; Binder, Breanna Arlene

    2018-01-01

    We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

  8. Functional modulation of cardiac form through regionally confined cell shape changes.

    Directory of Open Access Journals (Sweden)

    Heidi J Auman

    2007-03-01

    Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.

  9. THE SCHMIDT-KENNICUTT LAW OF MATCHED-AGE STAR-FORMING REGIONS; Paα OBSERVATIONS OF THE EARLY-PHASE INTERACTING GALAXY TAFFY I

    International Nuclear Information System (INIS)

    Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.

    2012-01-01

    In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

  10. Complex organic molecules toward low-mass and high-mass star forming regions

    Science.gov (United States)

    Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.

    2016-12-01

    One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

  11. Extended high circular polarization in the Orion massive star forming region: implications for the origin of homochirality in the solar system.

    Science.gov (United States)

    Fukue, Tsubasa; Tamura, Motohide; Kandori, Ryo; Kusakabe, Nobuhiko; Hough, James H; Bailey, Jeremy; Whittet, Douglas C B; Lucas, Philip W; Nakajima, Yasushi; Hashimoto, Jun

    2010-06-01

    We present a wide-field (approximately 6' x 6') and deep near-infrared (K(s) band: 2.14 mum) circular polarization image in the Orion nebula, where massive stars and many low-mass stars are forming. Our results reveal that a high circular polarization region is spatially extended (approximately 0.4 pc) around the massive star-forming region, the BN/KL nebula. However, other regions, including the linearly polarized Orion bar, show no significant circular polarization. Most of the low-mass young stars do not show detectable extended structure in either linear or circular polarization, in contrast to the BN/KL nebula. If our solar system formed in a massive star-forming region and was irradiated by net circularly polarized radiation, then enantiomeric excesses could have been induced, through asymmetric photochemistry, in the parent bodies of the meteorites and subsequently delivered to Earth. These could then have played a role in the development of biological homochirality on Earth.

  12. TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions

    OpenAIRE

    Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

  13. Water in massive star-forming regions with Herschel Space Observatory

    Science.gov (United States)

    Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.

    2011-05-01

    High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

  14. Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.

    1989-01-01

    The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

  15. COMPETITION AS A FORM OF ORGANIZING CULTURAL ACTIVITIES OF THE KRASNOYARSK REGION POPULATION IN THE 1960-1980S

    Directory of Open Access Journals (Sweden)

    Ekaterina Ivanovna Lobyneva

    2014-08-01

    Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

  16. Optical polarimetry of star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Gledhill, T M

    1987-01-01

    The polarimetric investigation of nebulosity associated with loss-mass pre-main sequence (PMS) stellar objects is detailed. Three regions of on-going star formation are considered, specifically, the Haro 6-5 and the HL/XZ Tau systems - both associated with dark clouds in the Taurus complex - and the PV Cephei nebulosity near NGC7023. In each region the imaging observations suggest bipolarity in the optical structure of the nebulosity, and the polarimetric data are used to determine the locations of the illuminating sources. Evidence is found for the association of circumstellar discs of obscuration with the PMS objects Haro 6-5A (FS Tau), Haro 6-5B, HL Tau, and PV Cephei. In each case the polarimetric data suggest that the local magnetic field has played an important role in the evolution of the star and the circumstellar material. Examination of the source-region polarization maps suggests that at least one of the objects considered is surrounded by a dust grain-aligning magnetic field with a predominantly toroidal geometry in the plane of the circumstellar disc. Implications for current theories of outflow acceleration and cloud evolution are discussed.

  17. Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace

    OpenAIRE

    Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte

    2006-01-01

    This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

  18. THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)

    2013-09-20

    We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

  19. The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

    Directory of Open Access Journals (Sweden)

    Tatyana O. Boiko

    2012-03-01

    Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

  20. «Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

    Directory of Open Access Journals (Sweden)

    Anishenko Anatoly

    2012-01-01

    Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

  1. Preferential Pathway for Glycine Formation in Star-Forming Regions

    Science.gov (United States)

    Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

    Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

  2. CHEMICAL SEGREGATION TOWARD MASSIVE HOT CORES: THE AFGL2591 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail: ijimenez-serra@cfa.harvard.edu, E-mail: qzhang@cfa.harvard.edu, E-mail: sv@star.ucl.ac.uk, E-mail: jmartin@cab.inta-csic.es, E-mail: wdewit@eso.org [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)

    2012-07-01

    We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

  3. Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

    International Nuclear Information System (INIS)

    De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.

    2000-01-01

    Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

  4. Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

    International Nuclear Information System (INIS)

    Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.

    1990-01-01

    New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs

  5. X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    Energy Technology Data Exchange (ETDEWEB)

    Montes, V. A.; Hofner, P.; Anderson, C.; Rosero, V. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States)

    2015-08-15

    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-ray sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.

  6. Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

    Science.gov (United States)

    Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

    2017-09-01

    Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

  7. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    International Nuclear Information System (INIS)

    Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping

    2017-01-01

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  8. Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

    DEFF Research Database (Denmark)

    Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne

    2015-01-01

    displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

  9. Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

    International Nuclear Information System (INIS)

    Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.

    2009-05-01

    In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

  10. Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

    International Nuclear Information System (INIS)

    Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.

    1990-01-01

    The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

  11. Herschel/HIFI observations of high-J CO lines in the NGC 1333 low-mass star-forming region

    DEFF Research Database (Denmark)

    Yildiz, U. A.; van Dishoeck, E. F.; Kristensen, L. E.

    2010-01-01

    Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally-resolved......Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally....... Their intensities require a jump in the CO abundance at an evaporation temperature around 25 K, thus providing new direct evidence for a CO ice evaporation zone around low-mass protostars. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia...... and with important participation from NASA.Appendices and acknowledgements (pages 5 to 7) are only available in electronic form at http://www.aanda.org...

  12. Long-term Variability of H2CO Masers in Star-forming Regions

    Science.gov (United States)

    Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

    2017-10-01

    We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

  13. Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

    Science.gov (United States)

    Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

    2011-01-01

    The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

  14. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    Energy Technology Data Exchange (ETDEWEB)

    Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: juarez@ice.cat [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)

    2017-07-20

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  15. Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

    International Nuclear Information System (INIS)

    Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan

    2009-01-01

    According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

  16. The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Oleynik Olga Stepanovna

    2014-12-01

    Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

  17. New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

    Science.gov (United States)

    van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

    2018-02-01

    Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

  18. Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function

    Science.gov (United States)

    Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.

    1990-01-01

    Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

  19. HIGH-VELOCITY LINE FORMING REGIONS IN THE TYPE Ia SUPERNOVA 2009ig

    International Nuclear Information System (INIS)

    Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng

    2013-01-01

    We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

  20. Young Stellar Objects in the Massive Star-forming Regions W51 and W43

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)

    2017-04-20

    We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

  1. Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

    CERN Document Server

    Hartquist, T W

    2006-01-01

    John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

  2. AN INFRARED/X-RAY SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.

    2009-01-01

    We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.

  3. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    Energy Technology Data Exchange (ETDEWEB)

    Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: asarma@depaul.edu [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)

    2013-04-10

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  4. VERY LARGE ARRAY OH ZEEMAN OBSERVATIONS OF THE STAR-FORMING REGION S88B

    International Nuclear Information System (INIS)

    Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.

    2013-01-01

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  5. Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

    Science.gov (United States)

    Giroux, Mark; Smith, B.; Struck, C.

    2011-05-01

    Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

  6. A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

    Directory of Open Access Journals (Sweden)

    Barrado y Navascués D.

    2011-07-01

    Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

  7. B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

    2013-01-01

    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  8. Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region.

    Science.gov (United States)

    Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J

    2017-01-01

    The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  9. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  10. A Study of THT Cold Cores Population in the Star-Forming Region in Serpens

    Science.gov (United States)

    Fiorellino, Eleonora

    2017-11-01

    The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

  11. CHEMICAL EVOLUTION IN HIGH-MASS STAR-FORMING REGIONS: RESULTS FROM THE MALT90 SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail: shoq@bu.edu, E-mail: jackson@bu.edu, E-mail: patricio@bu.edu, E-mail: claysmit@bu.edu, E-mail: jonathan.b.foster@yale.edu, E-mail: aguzmanf@cfa.harvard.edu, E-mail: scott@bu.edu, E-mail: rathborne@csiro.au, E-mail: tv3h@virginia.edu, E-mail: aiv3f@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2013-11-10

    The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.

  12. Millimetre wavelength methanol masers survey towards massive star forming regions

    Science.gov (United States)

    Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

    2007-03-01

    We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

  13. The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

    Science.gov (United States)

    Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

    2018-05-01

    Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  14. CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

    NARCIS (Netherlands)

    Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.

    2010-01-01

    We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

  15. DISK EVOLUTION IN THE THREE NEARBY STAR-FORMING REGIONS OF TAURUS, CHAMAELEON, AND OPHIUCHUS

    International Nuclear Information System (INIS)

    Furlan, E.; Watson, Dan M.; McClure, M. K.

    2009-01-01

    We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

  16. Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey

    Science.gov (United States)

    Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

    2018-06-01

    We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

  17. TRIGONOMETRIC PARALLAXES OF MASSIVE STAR-FORMING REGIONS. II. CEP A AND NGC 7538

    International Nuclear Information System (INIS)

    Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.

    2009-01-01

    We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

  18. Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

    Directory of Open Access Journals (Sweden)

    Darya-Anna Alekseevna Kaibiyainen

    2015-03-01

    Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

  19. The Depletion of Water During Dispersal of Planet-forming Disk Regions

    Science.gov (United States)

    Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.

    2017-01-01

    We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

  20. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

    Science.gov (United States)

    Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

    2013-04-11

    Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

  1. Extreme Variables in Star Forming Regions

    Science.gov (United States)

    Contreras Peña, Carlos Eduardo

    2015-01-01

    in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

  2. EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: johan.lindberg@nasa.gov [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)

    2017-01-20

    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

  3. SEQUENTIAL STAR FORMATION IN RCW 34: A SPECTROSCOPIC CENSUS OF THE STELLAR CONTENT OF HIGH-MASS STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.

    2010-01-01

    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

  4. Trigonometric parallaxes of star forming regions in the Scutum spiral arm

    International Nuclear Information System (INIS)

    Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.

    2014-01-01

    We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

  5. Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

    International Nuclear Information System (INIS)

    Kim, Kyungsik

    2011-01-01

    We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

  6. Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

    NARCIS (Netherlands)

    van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

    Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with

  7. Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

    International Nuclear Information System (INIS)

    Kobushkin, A.P.; Syamtomov, A.I.

    1994-01-01

    Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

  8. Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

    OpenAIRE

    Kato, J; Ito, K; Nakamura, A; Watanabe, H

    1989-01-01

    Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

  9. Travel and urban form in the Greater Copenhagen region

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

  10. Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

    Directory of Open Access Journals (Sweden)

    Marzena RUSZKOWSKA

    2017-11-01

    Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

  11. Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions

    Science.gov (United States)

    Kulesa, Craig A.

    Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us

  12. YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

    Energy Technology Data Exchange (ETDEWEB)

    Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

    2014-12-01

    The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

  13. CONDITION OF DECENTRALIZATION AND ORGANIZATIONAL LEGAL FORMS OF SUSTAINABLE DEVELOPMENT OF REGIONS OF UKRAINE IN THE CONTEXT OF THE GLOBAL EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Nadiia Kulchytska

    2016-06-01

    Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

  14. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

    2015-01-01

    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  15. Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey.

    Science.gov (United States)

    Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A

    2014-10-01

    Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

  16. Escape of ionizing radiation from star-forming regions in Young galaxies

    DEFF Research Database (Denmark)

    Razoumov, A; Sommer-Larsen, Jesper

    2006-01-01

    Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

  17. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-12-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  18. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg

    2013-11-01

    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  19. Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

    Directory of Open Access Journals (Sweden)

    Ke WEI

    2018-04-01

    Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization

  20. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  1. Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

    Energy Technology Data Exchange (ETDEWEB)

    Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)

    2014-06-01

    A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

  2. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    International Nuclear Information System (INIS)

    Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.

    2014-01-01

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  3. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: todorovk@phys.ethz.ch [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2014-06-10

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  4. Transformation of the Zagreb urban region

    Directory of Open Access Journals (Sweden)

    Milan Ilić

    2004-01-01

    Full Text Available Several aspects of the transformation of theZagreb urban region are considered in this work: change in the regionćssize and form, socio-economic transformation, functional transformation andphysiognomic or morphological transformation. It was established that theregionćs form has changed: it is moving from the classic star-like form,characteristic of the early developmental phase of the urban region, to acircular form. The region has experienced evolution in the developmentalsense and reached a phase of absolute decentralization. The process oftransformation in the region is continuing at full pace, while onlyperipheral, mainly small and poorly linked settlements with an unfavorabledemographic balance and processes are lagging behind.

  5. Forming Spirals From Shadows

    Science.gov (United States)

    Kohler, Susanna

    2016-07-01

    What causes the large-scale spiral structures found in some protoplanetary disks? Most models assume theyre created by newly-forming planets, but a new study suggests that planets might have nothing to do with it.Perturbations from Planets?In some transition disks protoplanetary disks with gaps in their inner regions weve directly imaged large-scale spiral arms. Many theories currently attribute the formation of these structures to young planets: either the direct perturbations of a planet embedded in the disk cause the spirals, or theyre indirectly caused by the orbit of a planetary body outside of the arms.Another example of spiral arms detected in a protoplanetary disk, MWC 758. [NASA/ESA/ESO/M. Benisty et al.]But what if you could get spirals without any planets? A team of scientists led by Matas Montesinos (University of Chile) have recently published a study in which they examine what happens to a shadowed protoplanetary disk.Casting Shadows with WarpsIn the teams setup, they envision a protoplanetary disk that is warped: the inner region is slightly tilted relative to the outer region. As the central star casts light out over its protoplanetary disk, this disk warping would cause some regions of the disk to be shaded in a way that isnt axially symmetric with potentially interesting implications.Montesinos and collaborators ran 2D hydrodynamics simulations to determine what happens to the motion of particles within the disk when they pass in and out of the shadowed regions. Since the shadowed regions are significantly colder than the illuminated disk, the pressure in these regions is much lower. Particles are therefore accelerated and decelerated as they pass through these regions, and the lack of axial symmetry causes spiral density waves to form in the disk as a result.Initial profile for the stellar heating rate per unit area for one of the authors simulations. The regions shadowed as a result of the disk warp subtend 0.5 radians each (shown on the left

  6. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  7. Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: katsuta@hep01.hepl.hiroshima-u.ac.jp [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)

    2017-04-20

    We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.

  8. Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

    CERN Multimedia

    2002-01-01

    The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

  9. Article, component, and method of forming an article

    Science.gov (United States)

    Lacy, Benjamin Paul; Itzel, Gary Michael; Kottilingam, Srikanth Chandrudu; Dutta, Sandip; Schick, David Edward

    2018-05-22

    An article and method of forming an article are provided. The article includes a body portion separating an inner region and an outer region, an aperture in the body portion, the aperture fluidly connecting the inner region to the outer region, and a conduit extending from an outer surface of the body portion at the aperture and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The method includes providing a body portion separating an inner region and an outer region, providing an aperture in the body portion, and forming a conduit over the aperture, the conduit extending from an outer surface of the body portion and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The article is arranged and disposed for insertion within a hot gas path component.

  10. Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

    DEFF Research Database (Denmark)

    Larsen, Peter Wilgaard

    2017-01-01

    The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

  11. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: carrasco@mpifr-bonn.mpg.de [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)

    2012-02-10

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  12. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.

    2012-01-01

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  13. Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

    International Nuclear Information System (INIS)

    Gyulbudaghian, A.L.; May, J.

    2008-01-01

    An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

  14. Atomic hydrogen in the Orion star-forming region

    International Nuclear Information System (INIS)

    Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.

    1989-01-01

    A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

  15. Regional planning without means - search for regional leadership

    DEFF Research Database (Denmark)

    Groth, Niels Boje; Fertner, Christian

    and stakeholders, not least due to its polycentric urban structure with several medium-sized towns. Besides the regional authority and the regions 22 municipalities, sub-regional collaboration is gaining momentum. Furthermore, different fora, councils and associations are engaging in regional issues. However......, collaboration is often focused on specific sectors or sub-regions, while the joint development of the region is left behind. The regional authority has changed its focus from planning to the provision of knowledge, suitable to kick-off joint action with regional stakeholders, while municipalities keep focus...... on their own territories, eventually in the context of one of the new sub-regional collaborations. Based on an empirical analysis of the regional interplay in Southern Denmark and results from the ESPON ReSSI project, we go through these new settings of regional collaboration in the search for new forms...

  16. Andromeda

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    (abbrev. And, gen. Andromedae; area 722 sq. deg.) A northern constellation that lies between Perseus and Pegasus, and culminates at midnight in early October. It is named after the daughter of King Cepheus and Queen Cassiopeia in Greek mythology, who was rescued by Perseus from being sacrificed to the sea monster Cetus, and is usually shown on early celestial charts as a chained maiden. Its brigh...

  17. Draco

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    (the Dragon; abbrev. Dra, gen. Draconis; area 1083 sq. deg.) A northern constellation which lies between Ursa Major and Cepheus, and encloses Ursa Minor on three sides. The center of the constellation culminates at midnight in May, though part of it is on the meridian from mid-February to late July. Draco represents the dragon Ladon in Greek mythology, which guarded the golden apple tree that was...

  18. STAR-FORMING OR STARBURSTING? THE ULTRAVIOLET CONUNDRUM

    International Nuclear Information System (INIS)

    Boquien, M.; Calzetti, D.; Hong, S.; Kennicutt, R.; Dale, D.; Engelbracht, C.; Portouw, J.; Gordon, K. D.; Lee, J. C.

    2009-01-01

    Compared to starburst galaxies, normal star-forming galaxies have been shown to display a much larger dispersion of the dust attenuation at fixed reddening through studies of the IRX-β diagram (the IR/UV ratio 'IRX' versus the UV color 'β'). To investigate the causes of this larger dispersion and attempt to isolate second parameters, we have used GALEX UV, ground-based optical, and Spitzer infrared imaging of eight nearby galaxies, and examined the properties of individual UV and 24 μm selected star-forming regions. We concentrated on star-forming regions, in order to isolate simpler star formation histories than those that characterize whole galaxies. We find that (1) the dispersion is not correlated with the mean age of the stellar populations; (2) a range of dust geometries and dust extinction curves are the most likely causes for the observed dispersion in the IRX-β diagram, (3) together with some potential dilution of the most recent star-forming population by older unrelated bursts, at least in the case of star-forming regions within galaxies; and (4) we also recover some general characteristics of the regions, including a tight positive correlation between the amount of dust attenuation and the metal content. Although generalizing our results to whole galaxies may not be immediate, the possibility of a range of dust extinction laws and geometries should be accounted for in the latter systems as well.

  19. Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

    Science.gov (United States)

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

    2018-03-01

    We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

  20. Radio continuum interferometry of dark clouds: A search for newly formed HII regions

    International Nuclear Information System (INIS)

    Gilmore, W.S.

    1978-01-01

    A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

  1. Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

    International Nuclear Information System (INIS)

    Quenzer, A.

    1977-01-01

    The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

  2. Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

    DEFF Research Database (Denmark)

    Coutens, Audrey; Vastel, C.; Hincelin, U.

    2014-01-01

    Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

  3. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    International Nuclear Information System (INIS)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel

    2015-01-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions

  4. A GALEX-BASED SEARCH FOR THE SPARSE YOUNG STELLAR POPULATION IN THE TAURUS-AURIGAE STAR FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)

    2015-02-01

    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

  5. Asymptotics of Heavy-Meson Form Factors

    CERN Document Server

    Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias

    1997-01-01

    Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

  6. Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

    Directory of Open Access Journals (Sweden)

    Mahesh Anantha Narayanan

    2014-01-01

    Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.

  7. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Dispersive analysis of the pion transition form factor

    Science.gov (United States)

    Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

    2014-11-01

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

  9. VizieR Online Data Catalog: SOFIA Massive (SOMA) Star Formation Survey. I. (De Buizer+, 2017)

    Science.gov (United States)

    De Buizer, J. M.; Liu, M.; Tan, J. C.; Zhang, Y.; Beltran, M. T.; Shuping, R.; Staff, J. E.; Tanaka, K. E. I.; Whitney, B.

    2018-02-01

    The following eight sources, AFGL 4029, AFGL 437, IRAS 07299-1651, G35.20-0.74, G45.45+0.05, IRAS 20126+4104, Cepheus A, and NGC 7538 IRS9, were observed by SOFIA with the FORCAST instrument (see Table 1). Data were taken on multiple flights spanning the Early Science period, Cycle 1, and Cycle 2 SOFIA observing cycles (spanning 2011 May to 2014 June). (4 data files).

  10. YOUNG STELLAR OBJECTS IN THE LARGE MAGELLANIC CLOUD STAR-FORMING REGION N206

    International Nuclear Information System (INIS)

    Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.

    2010-01-01

    We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.

  11. Proton electromagnetic form factors: present status and future perspectives at PANDA

    Directory of Open Access Journals (Sweden)

    Tomasi-Gustafsson E.

    2015-01-01

    Full Text Available Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt. Measurements of the reaction p̅ + p → e+ + e− by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold, through the reaction p̅ + p → e+ + e− + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  12. Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

    International Nuclear Information System (INIS)

    Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.

    1995-01-01

    A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

  13. Regional and non-regional cults of affliction in Western Zambia

    NARCIS (Netherlands)

    Binsbergen, W.M.J.; Werbner, R.P.

    1977-01-01

    A generic relation holds between two types of cult of affliction in formerly Barotseland. Cults of one type, the non-regional, form a substratum out of which cults of the other type, the regional, may spring forth under certain conditions, and into which they submerge again under different

  14. Dynamic positional fate map of the primary heart-forming region.

    Science.gov (United States)

    Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J

    2009-08-15

    Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

  15. Diode having trenches in a semiconductor region

    Energy Technology Data Exchange (ETDEWEB)

    Palacios, Tomas Apostol; Lu, Bin; Matioli, Elison de Nazareth

    2016-03-22

    An electrode structure is described in which conductive regions are recessed into a semiconductor region. Trenches may be formed in a semiconductor region, such that conductive regions can be formed in the trenches. The electrode structure may be used in semiconductor devices such as field effect transistors or diodes. Nitride-based power semiconductor devices are described including such an electrode structure, which can reduce leakage current and otherwise improve performance.

  16. 17 CFR 259.0-1 - Availability of forms.

    Science.gov (United States)

    2010-04-01

    ... may inspect the forms at this address and at the Commission's regional and district offices. (See... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Availability of forms. 259.0-1 Section 259.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS...

  17. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N

    1973-01-01

    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  18. Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey

    Science.gov (United States)

    Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.

    2015-05-01

    Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

  19. Water deuteration in star-forming regions: Contribution of Herschel/HIFI spectroscopic data

    International Nuclear Information System (INIS)

    Coutens, Audrey

    2012-01-01

    cloud. The HDO/H_2O ratios as well as the D_2O/HDO ratios determined in IRAS 16293-2422 enable to constrain the conditions of water formation in this kind of objects and in particular suggest that water would be formed before the gravitational collapse of the cloud. This study was then extended to other solar-type protostars NGC1333 IRAS4A and NGC1333 IRAS4B, for which I estimated the abundances of deuterated water and noticed that an extended absorbing layer also surrounds these sources. The high HDO/H_2O ratios determined in IRAS 16293-2422 suggest that mechanisms are required between the Class 0 stage and the comets formation to decrease these isotopic ratios. It is however necessary to study a larger sample of protostars to know if this trend is observed in most of the sources. The HDO abundances obtained in NGC1333 IRAS4A and NGC1333 IRAS4B will consequently be useful to estimate their HDO/H_2O ratios. Finally, I also studied deuterated water in protostellar objects more massive and more luminous than solar-type protostars and show here the case of the ultra-compact HII region G34.26+0.15. (author) [fr

  20. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: rbeaton@virginia.edu [Department of Physics, New York University, New York, NY 10003 (United States)

    2014-08-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  1. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    International Nuclear Information System (INIS)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael

    2014-01-01

    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  2. TADPOL: A 1.3 mm SURVEY OF DUST POLARIZATION IN STAR-FORMING CORES AND REGIONS

    International Nuclear Information System (INIS)

    Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran

    2014-01-01

    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article

  3. Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars

    Science.gov (United States)

    Hargitai, H. I.; Gulick, V. C.; Glines, N. H.

    2017-09-01

    The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

  4. 17 CFR 209.0-1 - Availability of forms.

    Science.gov (United States)

    2010-04-01

    ... may inspect the forms at this address and at the Commission's regional offices. (See § 200.11 of this... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Availability of forms. 209.0-1 Section 209.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED...

  5. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    International Nuclear Information System (INIS)

    Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus

    2015-01-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively

  6. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: daemgen@astro.utoronto.ca [Department of Astronomy, Stockholm University, Stockholm (Sweden)

    2015-02-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

  7. Problems forming innovative-technological image of russian regions

    Directory of Open Access Journals (Sweden)

    Irina Markovna Golova

    2012-06-01

    Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

  8. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.

    2014-01-01

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

  9. SPITZER IRAC COLOR DIAGNOSTICS FOR EXTENDED EMISSION IN STAR-FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: jybarra@astro.unam.mx [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)

    2014-10-20

    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.

  10. MODEL EVALUATION OF THE SPATIAL DEVELOPMENT OF THE REGION THROUGH THE DEVELOPMENT OF REGIONAL ECONOMIC CLUSTERS

    Directory of Open Access Journals (Sweden)

    Чингис Дашидалаевич Дашицыренов

    2013-12-01

    Full Text Available The article describes a model of evaluation of effectiveness of spatial development of a region. Main approaches and criteria to assess effectiveness of socio-economic development of a region based on use of regional economic cluster are identified.The author believes that clusterization allows to eliminate or localize mentioned above restrictions which are characteristic of specific activity of entities. Effect in this case can be measured by increase in productivity obtained from cluster’s resources use  in regard to specific form of enterprises’ existence.The article also focused on definition of idea of synergic effect and the model of effectiveness of clusters. Cluster integration’s essence is considered – it is pointed out that a new structure is formed, which has emergent characteristics.Thus, main approach to spatial socio-economic development of a region proposed by the author is diversification of organizational and economic forms into regional economic clusters.Proposed by the author model allows to assess effectiveness of clusterization for spatial socio-economic development of any region. DOI: http://dx.doi.org/10.12731/2218-7405-2013-10-14

  11. Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

    Directory of Open Access Journals (Sweden)

    Elena Leonidovna Andreeva

    2017-09-01

    Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

  12. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

  13. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

    Science.gov (United States)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

  14. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: koepferl@usm.lmu.de [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)

    2017-11-01

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

  15. Current correlators and form factors in the resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

    2009-01-15

    Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

  16. "Mature Regionalism" and the Genesis of "Functional Projects": "Educational Regionalism" in Small (and Micro-States)

    Science.gov (United States)

    Jules, Tavis D.

    2017-01-01

    This article advances that the movement towards "deeper" Caribbean integration has generated a shift from "immature" regionalism to a "mature" form of regionalism. Thus, mature regionalism, a new governance mechanism, in regulating the institutional and legal framework of Caribbean Single Market and Economy is…

  17. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  18. Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

    Science.gov (United States)

    Banabic, D.; Vos, M.; Paraianu, L.; Jurco, P.

    2007-05-01

    The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy.

  19. Increasing the Robustness of the Sheet Metal Forming Simulation by the Prediction of the Forming Limit Band

    International Nuclear Information System (INIS)

    Banabic, D.; Paraianu, L.; Vos, M.; Jurco, P.

    2007-01-01

    The experimental research on the formability of metal sheets has shown that there is a significant dispersion of the limit strains in an area delimited by two curves: a lower curve (LFLC) and an upper one (UFLC). The region between the two curves defines the so-called Forming Limit Band (FLB). So far, this forming band has only been determined experimentally. In this paper the authors suggested a method to predict the Forming Limit Band. The proposed method is illustrated on the AA6111-T43 aluminium alloy

  20. MODERN FORMS OF PARTNERSHIP IN BUSINESS

    OpenAIRE

    Markova V. D.; Trapeznikov I. S.

    2016-01-01

    The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining comp...

  1. Regionalisation in Serbia: Between centralism and regionalism

    Directory of Open Access Journals (Sweden)

    Tripković Milan B.

    2003-01-01

    Full Text Available This paper is one of the results of the empirical research of the problem of regionalisation and multiculturality on the territory of Vojvodina. Only the part of gathered data, which concerns the regionalisation of Serbia and the status of Vojvodina, is used. Claiming that a regional state is not only a special form of the complex organization of state authorities, but also a special form of the whole social life, the author tries to define clear and reliable criteria of "good" or "desirable" regionalisation, which would avoid extreme centralism and extreme regionalism. Following the statistical territorial units, according to the standards of the European Union (NUTS the author recommends the a regional structure, understood as a special form of division of authorities: Serbia as a state or federal unit (NUTS 1 Vojvodina and Kosovo and Metohija as provinces (NUTS 2, regions (NUTS 3 sub-regions (NUTS 4 and municipalities (NUTS 5. In this context, it is suggested that the future Constitution of the Republic of Serbia should define only provinces and municipalities (NUTS 2 and NUTS 5, while for the forming of regions and sub-regions (NUTS 3 and NUTS 4 only the procedure and principles should be given - the rest would be left to spontaneous initiative of potential regional or sub-regional units. Two undesirable things would be avoided: A regionalisation imposed from "above", which could be understood as uncovered centralism, and a regionalism from "bellow" which tries to hide separatism under the mask of regionalisation and which leads not to better functioning and faster development of Serbia, but to disintegration.

  2. Conformal symmetry and pion form factor: Soft and hard contributions

    International Nuclear Information System (INIS)

    Choi, Ho-Meoyng; Ji, Chueng-Ryong

    2006-01-01

    We discuss a constraint of conformal symmetry in the analysis of the pion form factor. The usual power-law behavior of the form factor obtained in the perturbative QCD analysis can also be attained by taking negligible quark masses in the nonperturbative quark model analysis, confirming the recent AdS/CFT correspondence. We analyze the transition from soft to hard contributions in the pion form factor considering a momentum-dependent dynamical quark mass from an appreciable constituent quark mass at low momentum region to a negligible current quark mass at high momentum region. We find a correlation between the shape of nonperturbative quark distribution amplitude and the amount of soft and hard contributions to the pion form factor

  3. Dispersive analysis of the pion transition form factor

    Energy Technology Data Exchange (ETDEWEB)

    Hoferichter, M. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, ExtreMe Matter Institute EMMI, Darmstadt (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics, Bern (Switzerland); Kubis, B.; Niecknig, F.; Schneider, S.P. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany); Leupold, S. [Uppsala Universitet, Institutionen foer fysik och astronomi, Box 516, Uppsala (Sweden)

    2014-11-15

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the e{sup +}e{sup -} → 3π cross section, generalizing previous studies on ω, φ → 3π decays and γπ → ππ scattering, and verify our result by comparing to e{sup +}e{sup -} → π{sup 0}γ data. We perform the analytic continuation to the space-like region, predicting the poorlyconstrained space-like transition form factor below 1 GeV, and extract the slope of the form factor at vanishing momentum transfer a{sub π} = (30.7 ± 0.6) x 10{sup -3}. We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon. (orig.)

  4. Measurement of the Charged Pion Electromagnetic Form Factor

    International Nuclear Information System (INIS)

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

    2001-01-01

    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data

  5. Medial prefrontal cortex subserves diverse forms of self-reflection.

    Science.gov (United States)

    Jenkins, Adrianna C; Mitchell, Jason P

    2011-01-01

    The ability to think about oneself--to self--reflect--is one of the defining features of the human mind. Recent research has suggested that this ability may be subserved by a particular brain region: the medial prefrontal cortex (MPFC). However, although humans can contemplate a variety of different aspects of themselves, including their stable personality traits, current feelings, and physical attributes, no research has directly examined the extent to which these different forms of self-reflection are subserved by common mechanisms. To address this question, participants were scanned using functional magnetic resonance imaging (fMRI) while making judgments about their own personality traits, current mental states, and physical attributes as well as those of another person. Whereas some brain regions responded preferentially during only one form of self-reflection, a robust region of MPFC was engaged preferentially during self-reflection across all three types of judgment. These results suggest that--although dissociable--diverse forms of self-referential thought draw on a shared cognitive process subserved by MPFC.

  6. Geographical baselines of sustainable planning of the regional development of Zasavje region

    Directory of Open Access Journals (Sweden)

    Dušan Plut

    2002-12-01

    Full Text Available Geographical baselines of planning the regional development and interventions into the geographical environment derive from the premises of the concept of permanent adjusting the anthropogenic changes in the landscape to specific capacities and limitations of landscape-forming components. In the landscape-degraded region of Zasavje the improvement of environmental quality (curative measures and regional economic progress within the scope of carrying capacities and space (preventative measures are the primary, developmentaly-environmentally devised goal of developmental strategy.

  7. The Star Formation in Radio Survey: Jansky Very Large Array 33 GHz Observations of Nearby Galaxy Nuclei and Extranuclear Star-forming Regions

    Science.gov (United States)

    Murphy, E. J.; Dong, D.; Momjian, E.; Linden, S.; Kennicutt, R. C., Jr.; Meier, D. S.; Schinnerer, E.; Turner, J. L.

    2018-02-01

    We present 33 GHz imaging for 112 pointings toward galaxy nuclei and extranuclear star-forming regions at ≈2″ resolution using the Karl G. Jansky Very Large Array (VLA) as part of the Star Formation in Radio Survey. A comparison with 33 GHz Robert C. Byrd Green Bank Telescope single-dish observations indicates that the interferometric VLA observations recover 78% ± 4% of the total flux density over 25″ regions (≈kpc scales) among all fields. On these scales, the emission being resolved out is most likely diffuse non-thermal synchrotron emission. Consequently, on the ≈30–300 pc scales sampled by our VLA observations, the bulk of the 33 GHz emission is recovered and primarily powered by free–free emission from discrete H II regions, making it an excellent tracer of massive star formation. Of the 225 discrete regions used for aperture photometry, 162 are extranuclear (i.e., having galactocentric radii r G ≥ 250 pc) and detected at >3σ significance at 33 GHz and in Hα. Assuming a typical 33 GHz thermal fraction of 90%, the ratio of optically-thin 33 GHz to uncorrected Hα star formation rates indicates a median extinction value on ≈30–300 pc scales of A Hα ≈ 1.26 ± 0.09 mag, with an associated median absolute deviation of 0.87 mag. We find that 10% of these sources are “highly embedded” (i.e., A Hα ≳ 3.3 mag), suggesting that on average, H II regions remain embedded for ≲1 Myr. Finally, we find the median 33 GHz continuum-to-Hα line flux ratio to be statistically larger within r G < 250 pc relative to the outer disk regions by a factor of 1.82 ± 0.39, while the ratio of 33 GHz to 24 μm flux densities is lower by a factor of 0.45 ± 0.08, which may suggest increased extinction in the central regions.

  8. U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization?

    Science.gov (United States)

    Bustamante, Arturo Vargas

    2016-01-01

    For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. PMID:27694684

  9. On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security

    Science.gov (United States)

    Filimonova, L. A.; Skvortsova, N. K.

    2017-11-01

    The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

  10. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    Energy Technology Data Exchange (ETDEWEB)

    Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)

    2014-03-10

    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  11. The Tarantula Nebula as a template for extragalactic star forming regions from VLT/MUSE and HST/STIS

    Science.gov (United States)

    Crowther, Paul A.; Caballero-Nieves, Saida M.; Castro, Norberto; Evans, Christopher J.

    2017-11-01

    We present VLT/MUSE observations of NGC 2070, the dominant ionizing nebula of 30 Doradus in the LMC, plus HST/STIS spectroscopy of its central star cluster R136. Integral Field Spectroscopy (MUSE) and pseudo IFS (STIS) together provides a complete census of all massive stars within the central 30×30 parsec2 of the Tarantula. We discuss the integrated far-UV spectrum of R136, of particular interest for UV studies of young extragalactic star clusters. Strong He iiλ1640 emission at very early ages (1-2 Myr) from very massive stars cannot be reproduced by current population synthesis models, even those incorporating binary evolution and very massive stars. A nebular analysis of the integrated MUSE dataset implies an age of ~4.5 Myr for NGC 2070. Wolf-Rayet features provide alternative age diagnostics, with the primary contribution to the integrated Wolf-Rayet bumps arising from R140 rather than the more numerous H-rich WN stars in R136. Caution should be used when interpreting spatially extended observations of extragalactic star-forming regions.

  12. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Esplin, T. L.; Luhman, K. L., E-mail: taran.esplin@psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States)

    2017-10-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K{sub s}, which should have masses as low as ∼4–5 M {sub Jup} according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M{sub Jup}).

  13. Citizenship and the Forms of Political Support: A Case-Study of the Croatian Adriatic Regions

    Directory of Open Access Journals (Sweden)

    Zoran Radman

    2010-01-01

    Full Text Available The article is dealing with the issue of political support in Croatia, related to the issues of trust and legitimacy towards authority and institutions, as the elements of the political system. Previous research conducted in Croatia evidences a relatively low level of trust in the political authorities and institutions. In this paper we go by Easton’s dimensions of political support: authority support, support to institutions, support to democracy and support to community. All these forms of political support represent the subjective orientations of citizens towards the units of the political system. On the other hand, orientation and relationship of citizens towards the units of the political systems poses the question of citizenship. The paper is exploring the relation of subjective orientations of citizens towards the political systems units and different dimensions of political support in the specific context of Adriatic regions of Croatia, on the basis of the established models of citizenship developed by various authors. The results point out that the level of support rises as we go from the lower, specific types of support (support to authorities and support to institutions towards higher, diffuse modes of support (support to community. In the background of the political support, especially “support to democracy”, there are performances of the political system. In other words, political support is more instrumentally then intrinsically founded.

  14. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    International Nuclear Information System (INIS)

    Esplin, T. L.; Luhman, K. L.

    2017-01-01

    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K s , which should have masses as low as ∼4–5 M Jup according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M Jup ).

  15. Siberian Regional Identity in the Context of Historical Consciousness (Content Analysis of Tomsk Regional Media

    Directory of Open Access Journals (Sweden)

    A V Bocharov

    2011-12-01

    Full Text Available The article presents a model to study the Siberian regional identity in the context of historical consciousness, as well as the results of its practical application in the content analysis of the publications by the Tomsk regional media. On the basis of the content analysis procedures the author demonstrates how, through historical memory, the regional identity is formed and manifested in the regional media in various spheres of society.

  16. A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Sung-Ju; Choi, Minho; Kang, Miju [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 34055 (Korea, Republic of); Kerton, C. R., E-mail: sjkang@kasi.re.kr, E-mail: kerton@iastate.edu [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)

    2017-08-10

    We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential products of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.

  17. The role of personality in the transmission of cultural forms an example of the bearer of regional traditions in central Moravia (the ethnographic area of Haná

    Directory of Open Access Journals (Sweden)

    Válka Miroslav

    2017-01-01

    Full Text Available The ethnographic area of Haná in Central Moravia (Czech Republic has been among distinctive ethnographic regions since the 16th century. Even though traditional regional forms had gradually disappeared as a consequence of the modernization of village life, these returned alongside new functions in terms of national consciousness from the late 19th century. It was the intelligentsia, mainly teachers, priests, physicians and artists, who contributed to the spread of these forms. The personalities´ activities did not stop even in the 20th century. The teacher Marie Pachtová (born 1932 is an example of one such person (in study by Miroslav Válka. She not only led a children´s folklore ensemble, moderated programmes aimed at presentation of folklore, and worked as a lector, but she also tries to involve older folk traditions of Haná in the present cultural calendar of the town where she lives. Among other things, she was instrumental in the preservation of the production of Easter eggs from Haná which are decorated with stuck-on straw. She paid similar attention to the ceremonial pastries. With the focus of this example, it is possible to prove the transformations of regional culture´s expression into the contemporary social life as well as the mechanism of the creation of a new tradition.

  18. Measurement of the pion form factor in the time-like region for q2 values between 0.1 (GeV/c)2 and 0.18 (GeV/c)2

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.

    1984-01-01

    The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)

  19. Urban form and energy use for transport. A Nordic experience

    Energy Technology Data Exchange (ETDEWEB)

    Naess, P

    1995-02-10

    The main research problem addressed in this thesis is the possible influence of several urban form variables on the amount of transportation, on the modal split between different means of transport, and on energy use for transportation. This problem is elucidated through five empirical investigations covering different geographic levels in a Nordic context, from individual employees and households to commuting regions. A main feature of the study is the combination of socioeconomic and urban form variables in empirical investigations, employing techniques of multivariate analysis. The investigations of residential areas and job sites have been based on travel surveys, while the investigations where the units of analysis are towns or regions have been based on fuel sales. The socioeconomic data have been collected from official statistics and from questionnaires. It is found that urban form variables exert important influences on transportation energy use. Urban density affects energy use for transportation. A central location of residences as well as workplaces is favourable with respect to energy conservation on an intra-urban scale, but not in a wider geographical context, where decentralization into several dense, relatively self-contained local communities distributed over the region is the most energy-saving pattern of regional development. Urban form characteristics favourable for minimizing transport energy requirements also seem favourable for energy conservation in buildings. 160 refs., 39 figs., 46 tabs.

  20. Single-Spin Polarization Effects and the Determination of Timelike Proton Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, S

    2003-10-24

    We show that measurements of the proton's polarization in e{sup +}e{sup -} {yields} p{bar p} strongly discriminate between analytic forms of models which fit the proton form factors in the spacelike region. In particular, the single-spin asymmetry normal to the scattering plane measures the relative phase difference between the timelike G{sub E} and G{sub M} form factors. The expected proton polarization in the timelike region is large, of order of several tens of percent.

  1. {sup 13}C-METHYL FORMATE: OBSERVATIONS OF A SAMPLE OF HIGH-MASS STAR-FORMING REGIONS INCLUDING ORION-KL AND SPECTROSCOPIC CHARACTERIZATION

    Energy Technology Data Exchange (ETDEWEB)

    Favre, Cécile; Bergin, Edwin A.; Crockett, Nathan R.; Neill, Justin L. [Department of Astronomy, University of Michigan, 500 Church Street, Ann Arbor, MI 48109 (United States); Carvajal, Miguel [Dpto. Física Aplicada, Unidad Asociada CSIC, Facultad de Ciencias Experimentales, Universidad de Huelva, E-21071 Huelva (Spain); Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Brouillet, Nathalie; Despois, Didier; Baudry, Alain [Univ. Bordeaux, LAB, UMR 5804, F-33270, Floirac (France); Kleiner, Isabelle [Laboratoire Interuniversitaire des Systèmes Atmosphériques (LISA), CNRS, UMR 7583, Université de Paris-Est et Paris Diderot, 61, Av. du Général de Gaulle, F-94010 Créteil Cedex (France); Margulès, Laurent; Huet, Thérèse R.; Demaison, Jean, E-mail: cfavre@umich.edu, E-mail: miguel.carvajal@dfa.uhu.es [Laboratoire de Physique des Lasers, Atomes et Molécules, UMR CNRS 8523, Université Lille I, F-59655 Villeneuve d' Ascq Cedex (France)

    2015-01-01

    We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH{sub 3}, and its isotopologues H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the {sup 13}C-methyl formate isotopologue HCOO{sup 13}CH{sub 3} toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection of the {sup 13}C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the {sup 12}C/{sup 13}C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the {sup 13}C-methyl formate isotopologues, commensurate with the average {sup 12}C/{sup 13}C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the {sup 12}C/{sup 13}C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3} species. New spectroscopic data for both isotopomers H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time.

  2. Robustness Regions for Dichotomous Decisions.

    Science.gov (United States)

    Vijn, Pieter; Molenaar, Ivo W.

    1981-01-01

    In the case of dichotomous decisions, the total set of all assumptions/specifications for which the decision would have been the same is the robustness region. Inspection of this (data-dependent) region is a form of sensitivity analysis which may lead to improved decision making. (Author/BW)

  3. Substitutions in conserved regions preceding and within the linker affect activity and flexibility of tRNase ZL, the long form of tRNase Z.

    Directory of Open Access Journals (Sweden)

    Makenzie Saoura

    Full Text Available The enzyme tRNase Z, a member of the metallo-β-lactamase family, endonucleolytically removes 3' trailers from precursor tRNAs, preparing them for CCA addition and aminoacylation. The short form of tRNase Z, tRNase ZS, functions as a homodimer and is found in all prokaryotes and some eukaryotes. The long form, tRNase ZL, related to tRNase ZS through tandem duplication and found only in eukaryotes, possesses ~2,000-fold greater catalytic efficiency than tRNase ZS. tRNase ZL consists of related but diverged amino and carboxy domains connected by a flexible linker (also referred to as a flexible tether and functions as a monomer. The amino domain retains the flexible arm responsible for substrate recognition and binding while the carboxy domain retains the active site. The linker region was explored by Ala-scanning through two conserved regions of D. melanogaster tRNase Z: NdomTprox, located at the carboxy end of the amino domain proximal to the linker, and Tflex, a flexible site in the linker. Periodic substitutions in a hydrophobic patch (F329 and L332 at the carboxy end of NdomTprox show 2,700 and 670-fold impairment relative to wild type, respectively, accompanied by reduced linker flexibility at N-T inside the Ndom- linker boundary. The Ala substitution for N378 in the Tflex region has 10-fold higher catalytic efficiency than wild type and locally decreased flexibility, while the Ala substitution at R382 reduces catalytic efficiency ~50-fold. These changes in pre-tRNA processing kinetics and protein flexibility are interpreted in light of a recent crystal structure for S. cerevisiae tRNase Z, suggesting transmission of local changes in hydrophobicity into the skeleton of the amino domain.

  4. Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenic forms of Burkitt lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Neri, A.; Barriga, F.; Knowles, D.M.; Magrath, I.T.; Dalla-Favera, R.

    1988-04-01

    The authors show that endemic (eBL), sporadic (sBL), and acquired immunodeficiency syndrome-associated (AIDS-BL) forms of Burkitt lymphoma (BL) carrying t(8; 14) chromosomal translocations display different breakpoints within the immunoglobulin heavy-chain locus (IGH) on chromosome 14. In sBL (7 out of 11) and AIDS-BL (5 out of 6), the breakpoints occurred within or near the IGH ..mu.. switch (S/sub mu/) region on chromosome 14 and within the c-myc locus (MYC) on chromosome 8. In most eBL (13 out of 16) the breakpoints were mapped within or 5' to the IGH joining J/sub H/ region on chromosome 14 and outside the MYC locus on chromosome 8. Cloning and sequencing of the (8; 14) chromosomal junctions from two eBL cell lines and one eBL biopsy sample show that the recombination do not involve IGH-specific recombination signals on chromosome 14 or homologous sequences on chromosome 8, suggesting that these events are not likely to be mediated by the same mechanisms or enzymes as in IGH rearrangements. In general, these data have implications for the timing of occurrence of chromosomal translocations during B-cell differentiation in different BL types.

  5. Intern Perceptions of Dialect and Regionalism

    Science.gov (United States)

    O'Hara, Hunter

    2005-01-01

    Interns at The University of Tampa investigate how perceptions of dialect and regionalism may impact the learning environment and more precisely, the learner. Regionalism is defined as a belief that one's region of origin is a primary determinant of the quality of one's standards of living, social forms, customary beliefs, levels of…

  6. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  7. The regional approach and regional studies method in the process of geography teaching

    Science.gov (United States)

    Dermendzhieva, Stela; Doikov, Martin

    2017-03-01

    We define the regional approach as a manner of relations among the global trends of development of the "Society-man-nature" system and the local differentiating level of knowledge. Conditionally, interactions interlace under the influence of the character of Geography as a science, education, approaches, goals and teaching methods. Global, national and local development differentiates in three concentric circles at the level of knowledge. It is determined as a conception of modern, complex and effective mechanism for young people, through which knowledge develops in regional historical and cultural perspective; self-consciousness for socio-economic and cultural integration is formed as a part of the. historical-geographical image of the native land. This way an attitude to the. native land is formed as a connecting construct between patriotism to the motherland and the same in global aspect. The possibility for integration and cooperation of the educative geographical content with all the local historical-geographical, regional, profession orientating, artistic, municipal and district institutions, is outlined. Contemporary geographical education appears to be a powerful and indispensable mechanism for organization of human sciences, while the regional approach and the application of the regional studies method stimulate and motivate the development and realization of optimal capacities for direct connection with the local structures and environments.

  8. Turbine component casting core with high resolution region

    Science.gov (United States)

    Kamel, Ahmed; Merrill, Gary B.

    2014-08-26

    A hollow turbine engine component with complex internal features can include a first region and a second, high resolution region. The first region can be defined by a first ceramic core piece formed by any conventional process, such as by injection molding or transfer molding. The second region can be defined by a second ceramic core piece formed separately by a method effective to produce high resolution features, such as tomo lithographic molding. The first core piece and the second core piece can be joined by interlocking engagement that once subjected to an intermediate thermal heat treatment process thermally deform to form a three dimensional interlocking joint between the first and second core pieces by allowing thermal creep to irreversibly interlock the first and second core pieces together such that the joint becomes physically locked together providing joint stability through thermal processing.

  9. Molecular Diagnostics of the Interstellar Medium and Star Forming Regions

    Science.gov (United States)

    Hartquist, T. W.; Dalgarno, A.

    1996-03-01

    Selected examples of the use of observationally inferred molecular level populations and chemical compositions in the diagnosis of interstellar sources and processes important in them (and in other diffuse astrophysical sources) are given. The sources considered include the interclump medium of a giant molecular cloud, dark cores which are the progenitors of star formation, material responding to recent star formation and which may form further stars, and stellar ejecta (including those of supernovae) about to merge with the interstellar medium. The measurement of the microwave background, mixing of material between different nuclear burning zones in evolved stars and turbulent boundary layers (which are present in and influence the structures and evolution of all diffuse astrophysical sources) are treated.

  10. Modeling the Spray Forming of H13 Steel Tooling

    Science.gov (United States)

    Lin, Yaojun; McHugh, Kevin M.; Zhou, Yizhang; Lavernia, Enrique J.

    2007-07-01

    On the basis of a numerical model, the temperature and liquid fraction of spray-formed H13 tool steel are calculated as a function of time. Results show that a preheated substrate at the appropriate temperature can lead to very low porosity by increasing the liquid fraction in the deposited steel. The calculated cooling rate can lead to a microstructure consisting of martensite, lower bainite, retained austenite, and proeutectoid carbides in as-spray-formed material. In the temperature range between the solidus and liquidus temperatures, the calculated temperature of the spray-formed material increases with increasing substrate preheat temperature, resulting in a very low porosity by increasing the liquid fraction of the deposited steel. In the temperature region where austenite decomposition occurs, the substrate preheat temperature has a negligible influence on the cooling rate of the spray-formed material. On the basis of the calculated results, it is possible to generate sufficient liquid fraction during spray forming by using a high growth rate of the deposit without preheating the substrate, and the growth rate of the deposit has almost no influence on the cooling rate in the temperature region of austenite decomposition.

  11. Community Psychology, Diversity, and the Many Forms of Culture

    Science.gov (United States)

    Tebes, Jacob Kraemer

    2010-01-01

    Comments on the original article, "Many forms of culture," by A. B. Cohen. Cohen argued that psychology must broaden its conceptualization of culture to consider its many forms, such as religion, socioeconomic status, and region. The current author could not agree more with Cohen's proposed conceptualization of culture and its potential impact on…

  12. Process and structures for fabrication of solar cells with laser ablation steps to form contact holes

    Science.gov (United States)

    Harley, Gabriel; Smith, David D; Dennis, Tim; Waldhauer, Ann; Kim, Taeseok; Cousins, Peter John

    2013-11-19

    Contact holes of solar cells are formed by laser ablation to accomodate various solar cell designs. Use of a laser to form the contact holes is facilitated by replacing films formed on the diffusion regions with a film that has substantially uniform thickness. Contact holes may be formed to deep diffusion regions to increase the laser ablation process margins. The laser configuration may be tailored to form contact holes through dielectric films of varying thickness.

  13. Radiative transfer modelling of W33A MM1: 3-D structure and dynamics of a complex massive star forming region

    Science.gov (United States)

    Izquierdo, Andrés F.; Galván-Madrid, Roberto; Maud, Luke T.; Hoare, Melvin G.; Johnston, Katharine G.; Keto, Eric R.; Zhang, Qizhou; de Wit, Willem-Jan

    2018-05-01

    We present a composite model and radiative transfer simulations of the massive star forming core W33A MM1. The model was tailored to reproduce the complex features observed with ALMA at ≈0.2 arcsec resolution in CH3CN and dust emission. The MM1 core is fragmented into six compact sources coexisting within ˜1000 au. In our models, three of these compact sources are better represented as disc-envelope systems around a central (proto)star, two as envelopes with a central object, and one as a pure envelope. The model of the most prominent object (Main) contains the most massive (proto)star (M⋆ ≈ 7 M⊙) and disc+envelope (Mgas ≈ 0.4 M⊙), and is the most luminous (LMain ˜ 104 L⊙). The model discs are small (a few hundred au) for all sources. The composite model shows that the elongated spiral-like feature converging to the MM1 core can be convincingly interpreted as a filamentary accretion flow that feeds the rising stellar system. The kinematics of this filament is reproduced by a parabolic trajectory with focus at the center of mass of the region. Radial collapse and fragmentation within this filament, as well as smaller filamentary flows between pairs of sources are proposed to exist. Our modelling supports an interpretation where what was once considered as a single massive star with a ˜103 au disc and envelope, is instead a forming stellar association which appears to be virialized and to form several low-mass stars per high-mass object.

  14. Young Star May Be Belching Spheres of Gas, Astronomers Say

    Science.gov (United States)

    2001-05-01

    A young star more than 2,000 light-years away in the constellation Cepheus may be belching out spheres of gas, say astronomers who observed it with the National Science Foundation's Very Long Baseline Array (VLBA) radio telescope. Not only is the star ejecting spheres of gas, the researchers say, but it also may be ejecting them repeatedly, phenomena not predicted by current theories of how young stars shed matter. Cepheus A star-forming region with blowups of detail In order to remain stable while accumulating matter, young stars have to throw off some of the infalling material to avoid "spinning up" so fast they would break apart, according to current theories. Infalling matter forms a thin spinning disk around the core of the new star, and material is ejected in twin "jets" perpendicular to the plane of the disk. "Twin jets have been seen emerging from many young stars, so we are quite surprised to see evidence that this object may be ejecting not jets, but spheres of gas," said Paul T.P. Ho, an astronomer at the Harvard-Smithsonian Center for Astrophysics. The research is reported in the May 17 edition of the scientific journal Nature. The astronomers observed a complex star-forming region in Cepheus and found an arc of water molecules that act like giant celestial amplifiers to boost the strength of radio signals at a frequency of 22 GHz. Such radio-wave amplifiers, called masers, show up as bright spots readily observed with radio telescopes. "With the great ability of the VLBA to show fine detail, we could track the motions of these maser spots over a period of weeks, and saw that this arc of water molecules is expanding at nearly 20,000 miles per hour," said Ho. "This was possible because we could detect detail equivalent to seeing Lincoln's nose on a penny in Los Angeles from the distance of New York," Ho added. "These observations pushed the tremendous capabilities of the VLBA and of modern computing power to their limits. This is an extremely complex

  15. Far-infrared to Millimeter Data of Protoplanetary Disks: Dust Growth in the Taurus, Ophiuchus, and Chamaeleon I Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Ribas, Álvaro; Espaillat, Catherine C.; Macías, Enrique [Department of Astronomy, Boston University, Boston, MA 02215 (United States); Bouy, Hervé [Laboratoire d’Astrophysique de Bordeaux, Univ. Bordeaux, CNRS, F-33615 Pessac (France); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Calvet, Nuria [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Naylor, David A.; Van der Wiel, Matthijs H. D. [Institute for Space Imaging Science, Department of Physics and Astronomy, University of Lethbridge (Canada); Riviere-Marichalar, Pablo, E-mail: aribas@bu.edu [Instituto de Ciencia de Materiales de Madrid (CSIC). Calle Sor Juana Inés de la Cruz 3, E-28049 Cantoblanco, Madrid (Spain)

    2017-11-01

    Far-infrared and (sub)millimeter fluxes can be used to study dust in protoplanetary disks, the building blocks of planets. Here, we combine observations from the Herschel Space Observatory with ancillary data of 284 protoplanetary disks in the Taurus, Chamaeleon I, and Ophiuchus star-forming regions, covering from the optical to mm/cm wavelengths. We analyze their spectral indices as a function of wavelength and determine their (sub)millimeter slopes when possible. Most disks display observational evidence of grain growth, in agreement with previous studies. No correlation is found between other tracers of disk evolution and the millimeter spectral indices. A simple disk model is used to fit these sources, and we derive posterior distributions for the optical depth at 1.3 mm and 10 au, the disk temperature at this same radius, and the dust opacity spectral index β . We find the fluxes at 70 μ m to correlate strongly with disk temperatures at 10 au, as derived from these simple models. We find tentative evidence for spectral indices in Chamaeleon I being steeper than those of disks in Taurus/Ophiuchus, although more millimeter observations are needed to confirm this trend and identify its possible origin. Additionally, we determine the median spectral energy distribution of each region and find them to be similar across the entire wavelength range studied, possibly due to the large scatter in disk properties and morphologies.

  16. DECONVOLUTION OF IMAGES FROM BLAST 2005: INSIGHT INTO THE K3-50 AND IC 5146 STAR-FORMING REGIONS

    International Nuclear Information System (INIS)

    Roy, Arabindo; Netterfield, Calvin B.; Ade, Peter A. R.; Griffin, Matthew; Hargrave, Peter C.; Mauskopf, Philip; Bock, James J.; Brunt, Christopher M.; Chapin, Edward L.; Gibb, Andrew G.; Halpern, Mark; Marsden, Gaelen; Devlin, Mark J.; Dicker, Simon R.; Klein, Jeff; France, Kevin; Gundersen, Joshua O.; Hughes, David H.; Martin, Peter G.; Olmi, Luca

    2011-01-01

    We present an implementation of the iterative flux-conserving Lucy-Richardson (L-R) deconvolution method of image restoration for maps produced by the Balloon-borne Large Aperture Submillimeter Telescope (BLAST). Compared to the direct Fourier transform method of deconvolution, the L-R operation restores images with better-controlled background noise and increases source detectability. Intermediate iterated images are useful for studying extended diffuse structures, while the later iterations truly enhance point sources to near the designed diffraction limit of the telescope. The L-R method of deconvolution is efficient in resolving compact sources in crowded regions while simultaneously conserving their respective flux densities. We have analyzed its performance and convergence extensively through simulations and cross-correlations of the deconvolved images with available high-resolution maps. We present new science results from two BLAST surveys, in the Galactic regions K3-50 and IC 5146, further demonstrating the benefits of performing this deconvolution. We have resolved three clumps within a radius of 4.'5 inside the star-forming molecular cloud containing K3-50. Combining the well-resolved dust emission map with available multi-wavelength data, we have constrained the spectral energy distributions (SEDs) of five clumps to obtain masses (M), bolometric luminosities (L), and dust temperatures (T). The L-M diagram has been used as a diagnostic tool to estimate the evolutionary stages of the clumps. There are close relationships between dust continuum emission and both 21 cm radio continuum and 12 CO molecular line emission. The restored extended large-scale structures in the Northern Streamer of IC 5146 have a strong spatial correlation with both SCUBA and high-resolution extinction images. A dust temperature of 12 K has been obtained for the central filament. We report physical properties of ten compact sources, including six associated protostars, by fitting

  17. VLBA DETERMINATION OF THE DISTANCE TO NEARBY STAR-FORMING REGIONS. III. HP TAU/G2 AND THE THREE-DIMENSIONAL STRUCTURE OF TAURUS

    International Nuclear Information System (INIS)

    Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.

    2009-01-01

    Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

  18. Solare Cell Roof Tile And Method Of Forming Same

    Science.gov (United States)

    Hanoka, Jack I.; Real, Markus

    1999-11-16

    A solar cell roof tile includes a front support layer, a transparent encapsulant layer, a plurality of interconnected solar cells and a backskin layer. The front support layer is formed of light transmitting material and has first and second surfaces. The transparent encapsulant layer is disposed adjacent the second surface of the front support layer. The interconnected solar cells has a first surface disposed adjacent the transparent encapsulant layer. The backskin layer has a first surface disposed adjacent a second surface of the interconnected solar cells, wherein a portion of the backskin layer wraps around and contacts the first surface of the front support layer to form the border region. A portion of the border region has an extended width. The solar cell roof tile may have stand-offs disposed on the extended width border region for providing vertical spacing with respect to an adjacent solar cell roof tile.

  19. Ellipsoidal prediction regions for multivariate uncertainty characterization

    DEFF Research Database (Denmark)

    Golestaneh, Faranak; Pinson, Pierre; Azizipanah-Abarghooee, Rasoul

    2018-01-01

    , for classes of decision-making problems based on robust, interval chance-constrained optimization, necessary inputs take the form of multivariate prediction regions rather than scenarios. The current literature is at very primitive stage of characterizing multivariate prediction regions to be employed...... in these classes of optimization problems. To address this issue, we introduce a new class of multivariate forecasts which form as multivariate ellipsoids for non-Gaussian variables. We propose a data-driven systematic framework to readily generate and evaluate ellipsoidal prediction regions, with predefined...... probability guarantees and minimum conservativeness. A skill score is proposed for quantitative assessment of the quality of prediction ellipsoids. A set of experiments is used to illustrate the discrimination ability of the proposed scoring rule for potential misspecification of ellipsoidal prediction regions...

  20. Venus - Phoebe Region

    Science.gov (United States)

    1990-01-01

    This Magellan radar image is of part of the Phoebe region of Venus. It is a mosaic of parts of revolutions 146 and 147 acquired in the first radar test on Aug. 16, 1990. The area in the image is located at 291 degrees east longitude, 19 degrees south latitude. The image shows an area 30 kilometers (19.6 miles) wide and 76 km (47 miles) long. On the basis of Pioneer Venus and Arecibo data, it is known that two major rift zones occur in southern Phoebe Regio and that they terminate at about 20 to 25 degrees south latitude, about 2,000 km (1,240 miles) apart. This image is of an area just north of the southern end of the western rift zone. The region is characterized by a complex geologic history involving both volcanism and faulting. Several of the geologic units show distinctive overlapping or cross cutting relationships that permit identification and separation of geologic events and construction of the geologic history of the region. The oldest rocks in this image form the complexly deformed and faulted, radar bright, hilly terrain in the northern half. Faults of a variety of orientations are observed. A narrow fault trough (about one-half to one km (three tenths to six tenths of a mile) wide is seen crossing the bright hills near the lower part in the middle of the image. This is one of the youngest faults in the faulted, hilly unit as it is seen to cut across many other structures. The fault trough in turn appears to be embayed and flooded by the darker plains that appear in the south half of the image. These plains are interpreted to be of volcanic origin. The dark plains may be formed of a complex of overlapping volcanic flows. For example, the somewhat darker region of plains in the lower left (southwest) corner of the image may be a different age series of plains forming volcanic lava flows. Finally, the narrow bright line crossing the image in its lower part is interpreted to be a fault which cross cuts both plains units and is thus the youngest event in

  1. Innovative Model of Practice-Oriented Training of Employees of the Town-Forming Enterprise in the Mining Region (by the Example of JSC "SUEK-Kuzbass")

    Science.gov (United States)

    Kulay, Svetlana; Kayachev, Gennady

    2017-11-01

    The article proposes to improve the system of training of employees of joint-stock company SUEK-Kuzbass in the educational institutions of the Kemerovo region according to the requirements of the company using practice-oriented training technology. The aim of the work is to substantiate the effectiveness of implementing practice-oriented training, identify priority directions and ways of its development. The main objectives of the study are: to identify the main advantages for the company and students; determine the criteria for the success and practical value of applying practice-oriented training for the company; conduct a comparative analysis of the target and practice-oriented model of training for the company. The real needs of the employer through the dual form of training were taking into account. The expansion of positive experience in training engineering personnel in higher education in technology-based training with the involvement of specialists from other regions of the company and expanding training in mining was also included.

  2. Form factors and structure functions of hadrons in parton model

    International Nuclear Information System (INIS)

    Volkonskij, N.Yu.

    1979-01-01

    The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained

  3. Constraints on the ωπ form factor from analyticity and unitarity

    International Nuclear Information System (INIS)

    Ananthanarayan, B.; Caprini, I.; Kubis, B.

    2014-01-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  4. Constraints on the ωπ form factor from analyticity and unitarity

    Energy Technology Data Exchange (ETDEWEB)

    Ananthanarayan, B. [Indian Institute of Science, Centre for High Energy Physics, Bangalore (India); Caprini, I. [Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O.B. MG-6, Magurele (Romania); Kubis, B. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen-und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany)

    2014-12-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  5. WEAK AND COMPACT RADIO EMISSION IN EARLY HIGH-MASS STAR-FORMING REGIONS. I. VLA OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Rosero, V.; Hofner, P. [Physics Department, New Mexico Tech, 801 Leroy Pl., Socorro, NM 87801 (United States); Claussen, M. [National Radio Astronomy Observatory, 1003 Lopezville Rd., Socorro, NM 87801 (United States); Kurtz, S.; Carrasco-González, C.; Rodríguez, L. F.; Loinard, L. [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, Morelia 58090, México (Mexico); Cesaroni, R. [INAF, Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy); Araya, E. D. [Physics Department, Western Illinois University, 1 University Circle, Macomb, IL 61455 (United States); Menten, K. M.; Wyrowski, F. [Max-Planck-Institute für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Ellingsen, S. P. [School of Physical Sciences, University of Tasmania, Private Bag 37, Hobart, Tasmania 7001 (Australia)

    2016-12-01

    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sources associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.

  6. Thermodynamic model for the elastic form factor in diffraction scattering of protons

    International Nuclear Information System (INIS)

    Grashin, A.F.; Evstratenko, A.S.; Lepeshkin, M.V.

    1988-01-01

    An explicit expression is obtained for the differential pp(p-bar)-scattering cross section in the diffraction-cone region by employing the thermodynamic model for the elastic form factor previously proposed in Ref. 4. Data for the energy region 16.3≤(s)/sup 1/2/ ≤546 GeV have been analyzed and significant deviations have been discovered from the commonly used approximations in the form of linear or quadratic exponentials

  7. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  8. EVALUATION OF ECONOMIC SECURITY NOVOSIBIRSK REGION (FOR EXAMPLE, A REGIONAL ENGINEERING

    Directory of Open Access Journals (Sweden)

    Lugacheva L. I.

    2014-12-01

    Full Text Available The article shows the importance of regional engineering for the Russian economy, it clarifies the factors of economic security of the Novosibirsk region (NSO. Analyzed the characteristics prevailing in the engineering industry, its competitive advantages. The research results of the export orientation of the regional engineering VAT: its direction and priorities; discusses the trends that influence the growth during the recovery has formed a new profile of its foreign economic relations. Threats identified in the development of engineering and to propose measures to overcome them to ensure the economic security of the region. The article deals with the problem-tional institutes provide for the sustainable development of regional engineering, discusses the possibility of using pub-lic-private partnerships. Sharing of risks and responsibilities between the subject of the Russian Federation, municipalities and entrepreneurs - one of the priorities in the creation of the necessary conditions for the economic security of the NSO.

  9. Mapping the Extinction Curve in 3D: Structure on Kiloparsec Scales

    Energy Technology Data Exchange (ETDEWEB)

    Schlafly, E. F. [Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley, CA 94720 (United States); Peek, J. E. G. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Finkbeiner, D. P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Green, G. M. [Kavli Institute for Particle Astrophysics and Cosmology, Physics and Astrophysics Building, 452 Lomita Mall, Stanford, CA 94305 (United States)

    2017-03-20

    Near-infrared spectroscopy from APOGEE and wide-field optical photometry from Pan-STARRS1 have recently made precise measurements of the shape of the extinction curve possible for tens of thousands of stars, parameterized by R ( V ). These measurements revealed structures in R ( V ) with large angular scales, which are challenging to explain in existing dust paradigms. In this work, we combine three-dimensional maps of dust column density with R ( V ) measurements to constrain the three-dimensional distribution of R ( V ) in the Milky Way. We find that the variations in R ( V ) are correlated on kiloparsec scales. In particular, most of the dust within one kiloparsec in the outer Galaxy, including many local molecular clouds (Orion, Taurus, Perseus, California, and Cepheus), has a significantly lower R ( V ) than more distant dust in the Milky Way. These results provide new input to models of dust evolution and processing, and complicate the application of locally derived extinction curves to more distant regions of the Milky Way and to other galaxies.

  10. The role of regional networks in regional policy: European experience and perspectives for Russia

    OpenAIRE

    Arzhenovsky, Igor; Solodkova, Natalia

    2003-01-01

    The processes of globalization and localization as frame conditions of regional development cause some radical changes of spatial organization of economy and regional policy. One of such alteration is a widespread horizontal method (in addition to traditional hierarchical form) of relationship between different firms, organizations and other partners through informal contacts, intensive informational flows and cooperation skills. The report concerns theoretical substantiation, essence, differ...

  11. Parametric form of QCD travelling waves

    OpenAIRE

    Peschanski, R.

    2005-01-01

    We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.

  12. Metropolitan region of Copenhagen, Denmark

    DEFF Research Database (Denmark)

    Fertner, Christian

    the boundaries of the city further out. With the opening of the suburban train lines in 1934, the until today known finger structure was consolidated. A regional strategy, the “Fingerplan”, incorporating this structure was elaborated in 1947, but individual motorisation eroded some of the principles. Still...... in Sweden, forming a cross-border region with around 3.5 mio. inhabitants....

  13. Design in the planning arena : how regional designing influences strategic spatial planning

    NARCIS (Netherlands)

    Kempenaar, Annet

    2017-01-01

    Regional designing is a form of spatial design that engages with the future physical form and arrangement of regions, including its aesthetic appearances and how it can come about. As such it is closely entangled with spatial planning. This thesis studies the influence of regional designing on

  14. The Regional-Matrix Approach to the Training of Highly Qualified Personnel for the Sustainable Development of the Mining Region

    Science.gov (United States)

    Zhernov, Evgeny; Nehoda, Evgenia

    2017-11-01

    The state, regional and industry approaches to the problem of personnel training for building an innovative knowledge economy at all levels that ensures sustainable development of the region are analyzed in the article using the cases of the Kemerovo region and the coal industry. A new regional-matrix approach to the training of highly qualified personnel is proposed, which allows to link the training systems with the regional economic matrix "natural resources - cognitive resources" developed by the author. A special feature of the new approach is the consideration of objective conditions and contradictions of regional systems of personnel training, which have formed as part of economic systems of regions differ-entiated in the matrix. The methodology of the research is based on the statement about the interconnectivity of general and local knowledge, from which the understanding of the need for a combination of regional, indus-try and state approaches to personnel training is derived. A new form of representing such a combination is the proposed approach, which is based on matrix analysis. The results of the research can be implemented in the practice of modernization of professional education of workers in the coal industry of the natural resources extractive region.

  15. THE MASSIVE STAR-FORMING REGION CYGNUS OB2. II. INTEGRATED STELLAR PROPERTIES AND THE STAR FORMATION HISTORY

    International Nuclear Information System (INIS)

    Wright, N. J.; Drake, J. J.; Drew, J. E.; Vink, J. S.

    2010-01-01

    Cygnus OB2 is the nearest example of a massive star-forming region (SFR), containing over 50 O-type stars and hundreds of B-type stars. We have analyzed the properties of young stars in two fields in Cyg OB2 using the recently published deep catalog of Chandra X-ray point sources with complementary optical and near-IR photometry. Our sample is complete to ∼1 M sun (excluding A- and B-type stars that do not emit X-rays), making this the deepest study of the stellar properties and star formation history in Cyg OB2 to date. From Siess et al. isochrone fits to the near-IR color-magnitude diagram, we derive ages of 3.5 +0.75 -1.0 and 5.25 +1.5 -1.0 Myr for sources in the two fields, both with considerable spreads around the pre-main-sequence isochrones. The presence of a stellar population somewhat older than the present-day O-type stars, also fits in with the low fraction of sources with inner circumstellar disks (as traced by the K-band excess) that we find to be very low, but appropriate for a population of age ∼5 Myr. We also find that the region lacks a population of highly embedded sources that is often observed in young SFRs, suggesting star formation in the vicinity has declined. We measure the stellar mass functions (MFs) in this limit and find a power-law slope of Γ = -1.09 ± 0.13, in good agreement with the global mean value estimated by Kroupa. A steepening of the slope at higher masses is observed and suggested as due to the presence of the previous generation of stars that have lost their most massive members. Finally, combining our MF and an estimate of the radial density profile of the association suggests a total mass of Cyg OB2 of ∼3 x 10 4 M sun , similar to that of many of our Galaxy's most massive SFRs.

  16. From Theory to Experiment: Hadron Electromagnetic Form Factors in Space-like and Time-like Regions

    International Nuclear Information System (INIS)

    Tomasi-Gustafsson, E.; Gakh, G.I.; Rekalo, A.P.

    2007-01-01

    Hadron electromagnetic form factors contain information on the intrinsic structure of the hadrons. The pioneering work developed at the Kharkov Physical-Technical Institute in the 60's on the relation between the polarized cross section and the proton form factors triggered a number of experiments. Such experiments could be performed only recently due to the progress in accelerator and polarimetry techniques. The principle of these measurements is recalled and surprise and very precise results obtained on proton are presented. The actual status of nucleon electromagnetic form factors is reviewed, with special attention to the basic work done in Kharkov Physical-Technical Institute. This Paper is devoted to the memory of Prof. M.P. Rekalo

  17. Silica-forming articles having engineered surfaces to enhance resistance to creep sliding under high-temperature loading

    Science.gov (United States)

    Lipkin, Don Mark; Johnson, Curtis Alan; Meschter, Peter Joel; Sundaram, Sairam; Wan, Julin

    2017-02-07

    An article includes a silicon-containing region; at least one outer layer overlying a surface of the silicon-containing region; and a constituent layer on the surface of the silicon-containing region and between and contacting the silicon-containing region and the at least one outer layer, the constituent layer being formed by constituents of the silicon-containing region and being susceptible to creep within an operating environment of the article, wherein the silicon-containing region defines a plurality of channels and a plurality of ridges that interlock within the plurality of channels are formed in the silicon-containing region to physically interlock the at least one outer layer with the silicon-containing region through the constituent layer.

  18. I-motif DNA structures are formed in the nuclei of human cells

    Science.gov (United States)

    Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

    2018-06-01

    Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

  19. Inter-municipal communities as semi-regional (quasi governments

    Directory of Open Access Journals (Sweden)

    Golić Darko

    2014-01-01

    Full Text Available In this paper, the author discusses specific forms of integrated inter-municipal cooperation in some European countries which have certain characteristics of regional governments. Relying on the analysis of different forms of this inter-municipal cooperation, the author elaborates on some common features underlying these communities, with specific reference to their functional aspects. Bearing in mind that the imminent needs for regional planning, coordination of local policies and operation of regional offices are exercised through different institutional solutions, we point out that it is possible to provide an appropriate institutional and decentralized framework for accomplishing these goals even without changing the existing territorial organization system. Although the entities that are created through these specific forms of inter-municipal cooperation cannot be designated as territorial-political units in institutional terms, this is what they are from a functional point of view.

  20. Data on the electromagnetic pion form factor and p-wave

    International Nuclear Information System (INIS)

    Dubnicka, S.; Meshcheryakov, V.A.; Milko, J.

    1980-01-01

    The pion form factor absolute value data (free of the omega meson contribution) are unified with the P-wave isovector ππ phase shift. The resultant real and imaginary parts of the pion form factor are described by means of the Pade approximation. All the data, which involve the pion form factor experimental points from the range of momenta - 0.8432 GeV 2 2 , the pion charge radius, and the P-wave isovector ππ phase shift in the elastic region (including also the generally accepted value of the scattering length) are mutually consistent. The data themselves through the Pade approximation reveal that the aforementioned consistency can be achieved only if the pion form factor left-hand cut from the second Riemann sheet is taken into account. Almost in all of the considered Pade approximations one stable pion form factor zero is found in the space-like region, which might indicate the existence of a diffraction minimum in the differential cross section for elastic e - π scattering as a consequence of the constituent structure of the pion like in the case of the electron elastic scattering on nuclei

  1. Forms of memory in Andean queros

    Directory of Open Access Journals (Sweden)

    Alfredo Cordiviola

    2017-12-01

    Full Text Available In colonial times, queros were used to drink chicha and to formalize pacts in ritual ceremonies by the indigenous Andean elites. They had been manufactured for centuries, long before the Incas dominated the region, and continued to be made after Spanish domination and compulsory evangelization had been established. During the Inca empire, the surface of the queros was covered just with incisions and geometric forms; in the viceroyalty of Peru they were covered instead with figurative images. In this work we analyze the evolution of these forms and the different ways in which these ceremonial vessels were used to evoke the Andean pasts.

  2. Spatial distribution of the chromosomal forms of anopheles gambiae in Mali

    Directory of Open Access Journals (Sweden)

    Traoré Sékou F

    2008-10-01

    Full Text Available Abstract Background Maps of the distribution of malaria vectors are useful tools for stratification of malaria risk and for selective vector control strategies. Although the distribution of members of the Anopheles gambiae complex is well documented in Africa, a continuous map of the spatial distribution of the chromosomal forms of An. gambiae s.s. is not yet available at country level to support control efforts. Methods Bayesian geostatistical methods were used to produce continuous maps of the spatial distribution of the chromosomal forms of An. gambiae s.s. (Mopti, Bamako, Savanna and their hybrids/recombinants based on their relative frequencies in relation to climatic and environmental factors in Mali. Results The maps clearly show that each chromosomal form favours a particular defined eco-climatic zone. The Mopti form prefers the dryer northern Savanna and Sahel and the flooded/irrigated areas of the inner delta of the Niger River. The Savanna form favours the Sudan savanna areas, particularly the South and South-Eastern parts of the country (Kayes and Sikasso regions. The Bamako form has a strong preference for specific environmental conditions and it is confined to the Sudan savanna areas around urban Bamako and the Western part of Sikasso region. The hybrids/recombinants favour the Western part of the country (Kayes region bordering the Republic of Guinea Conakry. Conclusion The maps provide valuable information for selective vector control in Mali (insecticide resistance management and may serve as a decision support tool for the basis for future malaria control strategies including genetically manipulated mosquitoes.

  3. Modelling the impact of urban form on household energy demand and related CO2 emissions in the Greater Dublin Region

    International Nuclear Information System (INIS)

    Liu Xiaochen; Sweeney, John

    2012-01-01

    This study aims to investigate the relationship between household space heating energy use and urban form (land use characteristics) for the Greater Dublin Region. The geographical distributions of household energy use are evaluated at the Enumeration Districts (ED) level based on the building thermal balance model. Moreover, it estimates the impact of possible factors on the household space heating consumption. Results illustrate that the distribution profile of dwellings is a significant factor related to overall heating energy demand and individual dwelling energy consumption for space heating. Residents living in compact dwellings with small floor areas consume less energy for space heating than residents living in dwellings with big floor areas. Moreover, domestic heating energy demand per household was also estimated for two extreme urban development scenarios: the compact city scenario and the dispersed scenario. The results illustrate that the compact city scenario is likely to decrease the domestic heating energy consumption per household by 16.2% compared with the dispersed city scenario. Correspondingly, the energy-related CO 2 emissions could be significantly decreased by compact city scenario compared with the dispersed city scenario. - Highlights: ► A method was developed to investigate urban form impacts on energy demand. ► This study estimates impacts of possible factors on the household energy consumption. ► Household heating energy demand is sensitive to dwelling distribution profile. ► The compact case could reduce domestic energy demand compared with the dispersed case.

  4. Characterizing filaments in regions of high-mass star formation: High-resolution submilimeter imaging of the massive star-forming complex NGC 6334 with ArTéMiS

    Science.gov (United States)

    André, Ph.; Revéret, V.; Könyves, V.; Arzoumanian, D.; Tigé, J.; Gallais, P.; Roussel, H.; Le Pennec, J.; Rodriguez, L.; Doumayrou, E.; Dubreuil, D.; Lortholary, M.; Martignac, J.; Talvard, M.; Delisle, C.; Visticot, F.; Dumaye, L.; De Breuck, C.; Shimajiri, Y.; Motte, F.; Bontemps, S.; Hennemann, M.; Zavagno, A.; Russeil, D.; Schneider, N.; Palmeirim, P.; Peretto, N.; Hill, T.; Minier, V.; Roy, A.; Rygl, K. L. J.

    2016-07-01

    Context. Herschel observations of nearby molecular clouds suggest that interstellar filaments and prestellar cores represent two fundamental steps in the star formation process. The observations support a picture of low-mass star formation according to which filaments of ~0.1 pc width form first in the cold interstellar medium, probably as a result of large-scale compression of interstellar matter by supersonic turbulent flows, and then prestellar cores arise from gravitational fragmentation of the densest filaments. Whether this scenario also applies to regions of high-mass star formation is an open question, in part because the resolution of Herschel is insufficient to resolve the inner width of filaments in the nearest regions of massive star formation. Aims: In an effort to characterize the inner width of filaments in high-mass star-forming regions, we imaged the central part of the NGC 6334 complex at a resolution higher by a factor of >3 than Herschel at 350 μm. Methods: We used the large-format bolometer camera ArTéMiS on the APEX telescope and combined the high-resolution ArTéMiS data at 350 μm with Herschel/HOBYS data at 70-500 μm to ensure good sensitivity to a broad range of spatial scales. This allowed us to study the structure of the main narrow filament of the complex with a resolution of 8″ or Radioastronomie, the European Southern Observatory, and the Onsala Space Observatory.The final ArTéMiS+SPIRE 350 μm map (Fig. 1b) is available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/592/A54

  5. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory

    2009-01-01

    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  6. Community-led local development approach principles implementation when forming a regional local development projects support system in Ukraine

    Directory of Open Access Journals (Sweden)

    Y. G. Udod

    2017-03-01

    Full Text Available The article contains a brief description of the Community-led local development approach (local development under the leadership of the community, CLLD and the main purpose of its use in the European Union. The study indicated periods of the major initiatives to support local development in EU. Moreover the article posted CLLD approach principles’ evolution and the basic principles of the LEADER method and its application in CLLD, which can be applied in Ukraine. Subject to the provisions of the European Economic and Social Committee (EESC for further CLLD-approach distribution the five trends were identified that must be considered when forming a Regional local development projects support system in Ukraine: Multi-fund financing; Unification; Networking and collaboration; Extending the approach; Simplifying the process. The characteristic of the present phase of CLLD-approach, in particular, of the European Network for Rural Development (ENRD, which attaches great importance to the dissemination of the most effective CLLD practices and establish partnerships between communities and territories where the approach is implemented. The study found out the relationship between Community-led local development and Community-driven development (CDD supported by the World Bank.

  7. Sundhedsprofil for region og kommuner 2008

    DEFF Research Database (Denmark)

    Glümer, Charlotte; Hilding-Nørkjær, Helle; Jensen, Helene Nordahl

    2008-01-01

    Denne første sundhedsprofil for Region Hovedstaden dækker samtlige 29 kommuner i regionen og bidrager med detaljeret viden om de voksne borgeres sundhed, sygelighed og sundhedsadfærd. Formålet med sundhedsprofilen er at fungere som et planlægningsredskab både for kommuner og region. Sundhedsprofi...

  8. THE STRUCTURAL EVOLUTION OF FORMING AND EARLY STAGE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Jaehnig, Karl O.; Da Rio, Nicola; Tan, Jonathan C.

    2015-01-01

    We study the degree of angular substructure in the stellar position distribution of young members of Galactic star-forming regions, looking for correlations with distance from cluster center, surface number density of stars, and local dynamical age. To this end we adopt the catalog of members in 18 young (∼1-3 Myr) clusters from the Massive Young Star-Forming Complex Study in Infrared and X-ray Survey and the statistical analysis of the angular dispersion parameter, δ ADP, N . We find statistically significant correlation between δ ADP, N and physical projected distance from the center of the clusters, with the centers appearing smoother than the outskirts, consistent with more rapid dynamical processing on local dynamical, free-fall or orbital timescales. Similarly, smoother distributions are seen in regions of higher surface density, or older dynamical ages. These results indicate that dynamical processing that erases substructure is already well-advanced in young, sometimes still-forming, clusters. Such observations of the dissipation of substructure have the potential to constrain theoretical models of the dynamical evolution of young and forming clusters

  9. Changes to urban form and commuting patterns: trends in two Danish city regions

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    2015-01-01

    This paper compares indicators of polycentricity in a monocentric (MUR) and a polycentric urban region (PUR) in Denmark at two points in time (1982 and 2002). It describes how population, jobs and commuting indicators of polycentricity develop and interact over time. Both the MUR and the PUR tend...

  10. NEAR-INFRARED PERIODIC AND OTHER VARIABLE FIELD STARS IN THE FIELD OF THE CYGNUS OB7 STAR-FORMING REGION

    Energy Technology Data Exchange (ETDEWEB)

    Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin A. [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)

    2013-04-15

    We present a subset of the results of a three-season, 124 night, near-infrared monitoring campaign of the dark clouds Lynds 1003 and Lynds 1004 in the Cygnus OB7 star-forming region. In this paper, we focus on the field star population. Using three seasons of UKIRT J, H, and K-band observations spanning 1.5 years, we obtained high-quality photometry on 9200 stars down to J = 17 mag, with photometric uncertainty better than 0.04 mag. After excluding known disk-bearing stars we identify 149 variables-1.6% of the sample. Of these, about 60 are strictly periodic, with periods predominantly <2 days. We conclude this group is dominated by eclipsing binaries. A few stars have long period signals of between 20 and 60 days. About 25 stars have weak modulated signals, but it was not clear if these were periodic. Some of the stars in this group may be diskless young stellar objects with relatively large variability due to cool starspots. The remaining {approx}60 stars showed variations which appear to be purely stochastic.

  11. COMBINATION OF GOALS STRATEGY REGION

    Directory of Open Access Journals (Sweden)

    Denys Yu. Lapigin

    2015-01-01

    Full Text Available Currently the tools to identify strategicallyimportant objectives of regional development is not enough to build a developmentperspective, relying on something special,what distinguishes each region from therest. The article discusses approaches to the formation of the regional developmentstrategy, which is based on goals set by the results of the analysis of the main factors inthe development of the region. The study is based on the methodology of systems theoryand methods of strategic management. The most important results should include tools tobuild the tree of strategic objectives resultingfrom the implementation of the algorithm forconstructing planes of analysis and development of the region. The results can be used to develop a strategy for the developmentof socio-economic systems of various typesand forms.

  12. REGIONALIZATION OF MANAGEMENT PROCESS BY INNOVATIVE ACTIVITY

    Directory of Open Access Journals (Sweden)

    E. V. Sibirskaia

    2014-01-01

    Full Text Available Summary. In current market conditions, the economy and Russia's accession to international trade scholars and experts from various fields of knowledge paying special attention to a huge set of regional problems. The growing role of regional research determines the level of establishing effective mechanisms for the implementation of the economic interests of actors as well as economic development and improving the quality of human life is the priority objectives of federal, regional and local authorities. Today, the Russian economic science faces a global goal - to develop ways and means of transformation of the Russian economy and bring it to a path of sustainable, innovative development, providing new quality of life. Achieving this goal must surely be a central task of the Russian economics and politics, as in the near future and the long term In article authors opened the maintenance of determinants of innovative development of the territory, mediated by strengthening of regionalization of management by innovative activity: condition of resource and innovative potential; the developed forms and nature of interaction between public authorities of regional level, local community and business; applied forms of integration of subjects of managing for realization of their innovative potential due to expansion of opportunities of participation in the perspective directions of scientific and technical, economic and social development; system of the incentives developing favorable conditions for introduction and development of innovative technologies, and also increases in the enterprise activity, formed by the external institutional environment; regional economic policy as instrument of increase of efficiency of innovative activity.

  13. Constraints on the [Formula: see text] form factor from analyticity and unitarity.

    Science.gov (United States)

    Ananthanarayan, B; Caprini, I; Kubis, B

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic [Formula: see text] form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the [Formula: see text] form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around [Formula: see text].

  14. HotRegion: a database of predicted hot spot clusters.

    Science.gov (United States)

    Cukuroglu, Engin; Gursoy, Attila; Keskin, Ozlem

    2012-01-01

    Hot spots are energetically important residues at protein interfaces and they are not randomly distributed across the interface but rather clustered. These clustered hot spots form hot regions. Hot regions are important for the stability of protein complexes, as well as providing specificity to binding sites. We propose a database called HotRegion, which provides the hot region information of the interfaces by using predicted hot spot residues, and structural properties of these interface residues such as pair potentials of interface residues, accessible surface area (ASA) and relative ASA values of interface residues of both monomer and complex forms of proteins. Also, the 3D visualization of the interface and interactions among hot spot residues are provided. HotRegion is accessible at http://prism.ccbb.ku.edu.tr/hotregion.

  15. Effects of Velocity-Dependent Force on the Magnetic Form Factors of Odd-Z Nuclei

    International Nuclear Information System (INIS)

    Tie-Kuang, Dong; Zhong-Zhou, Ren

    2008-01-01

    We investigate the effects of the velocity-dependent force on the magnetic form factors and magnetic moments of odd-Z nuclei. The form factors are calculated with the harmonic-oscillator wavefunctions. It is found that the contributions of the velocity-dependent force manifest themselves in the very large momentum transfer region (q ≥ 4fm- 1 ). In the low and medium q region the contributions of the velocity-dependent force are very small compared with those without this force. However, in the high-q region the contributions of the velocity-dependent force are larger than the normal form factors. The diffraction structures beyond the existing experimental data are found after the contributions of the velocity-dependent force are included. The formula of the correction to the single particle magnetic moment due to the velocity-dependent force is reproduced exactly in the long-wavelength limit (q = 0) of the M1 form factor

  16. Urban Form, Air Pollution, and Health.

    Science.gov (United States)

    Hankey, Steve; Marshall, Julian D

    2017-12-01

    Urban form can impact air pollution and public health. We reviewed health-related articles that assessed (1) the relationships among urban form, air pollution, and health as well as (2) aspects of the urban environment (i.e., green space, noise, physical activity) that may modify those relationships. Simulation and empirical studies demonstrate an association between compact growth, improved regional air quality, and health. Most studies are cross-sectional and focus on connections between transportation emissions and land use. The physical and mental health impacts of green space, public spaces that promote physical activity, and noise are well-studied aspects of the urban environment and there is evidence that these factors may modify the relationship between air pollution and health. Urban form can support efforts to design clean, health-promoting cities. More work is needed to operationalize specific strategies and to elucidate the causal pathways connecting various aspects of health.

  17. Users guide to REGIONAL-1: a regional assessment model

    International Nuclear Information System (INIS)

    Davis, W.E.; Eadie, W.J.; Powell, D.C.

    1979-09-01

    A guide was prepared to allow a user to run the PNL long-range transport model, REGIONAL 1. REGIONAL 1 is a computer model set up to run atmospheric assessments on a regional basis. The model has the capability of being run in three modes for a single time period. The three modes are: (1) no deposition, (2) dry deposition, (3) wet and dry deposition. The guide provides the physical and mathematical basis used in the model for calculating transport, diffusion, and deposition for all three modes. Also the guide includes a program listing with an explanation of the listings and an example in the form of a short-term assessment for 48 hours. The purpose of the example is to allow a person who has past experience with programming and meteorology to operate the assessment model and compare his results with the guide results. This comparison will assure the user that the program is operating in a proper fashion

  18. Characterization of microchannel anechoic corners formed by surface acoustic waves

    Science.gov (United States)

    Destgeer, Ghulam; Alam, Ashar; Ahmed, Husnain; Park, Jinsoo; Jung, Jin Ho; Park, Kwangseok; Sung, Hyung Jin

    2018-02-01

    Surface acoustic waves (SAWs) generated in a piezoelectric substrate couple with a liquid according to Snell's law such that a compressional acoustic wave propagates obliquely at a Rayleigh angle ( θ t) inside the microchannel to form a region devoid of a direct acoustic field, which is termed a microchannel anechoic corner (MAC). In the present study, we used microchannels with various heights and widths to characterize the width of the MAC region formed by a single travelling SAW. The attenuation of high-frequency SAWs produced a strong acoustic streaming flow that moved the particles in and out of the MAC region, whereas reflections of the acoustic waves within the microchannel resulted in standing acoustic waves that trapped particles at acoustic pressure nodes located within or outside of the MAC region. A range of actuation frequencies and particle diameters were used to investigate the effects of the acoustic streaming flow and the direct acoustic radiation forces by the travelling as well as standing waves on the particle motion with respect to the MAC region. The width of the MAC ( w c), measured experimentally by tracing the particles, increased with the height of the microchannel ( h m) according to a simple trigonometric equation w c = h m × tan ( θ t ).

  19. A structural model of the pore-forming region of the skeletal muscle ryanodine receptor (RyR1.

    Directory of Open Access Journals (Sweden)

    Srinivas Ramachandran

    2009-04-01

    Full Text Available Ryanodine receptors (RyRs are ion channels that regulate muscle contraction by releasing calcium ions from intracellular stores into the cytoplasm. Mutations in skeletal muscle RyR (RyR1 give rise to congenital diseases such as central core disease. The absence of high-resolution structures of RyR1 has limited our understanding of channel function and disease mechanisms at the molecular level. Here, we report a structural model of the pore-forming region of RyR1. Molecular dynamics simulations show high ion binding to putative pore residues D4899, E4900, D4938, and D4945, which are experimentally known to be critical for channel conductance and selectivity. We also observe preferential localization of Ca(2+ over K(+ in the selectivity filter of RyR1. Simulations of RyR1-D4899Q mutant show a loss of preference to Ca(2+ in the selectivity filter as seen experimentally. Electrophysiological experiments on a central core disease mutant, RyR1-G4898R, show constitutively open channels that conduct K(+ but not Ca(2+. Our simulations with G4898R likewise show a decrease in the preference of Ca(2+ over K(+ in the selectivity filter. Together, the computational and experimental results shed light on ion conductance and selectivity of RyR1 at an atomistic level.

  20. A measurement of the space-like pion electromagnetic form factor

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Batignani, G.; Bedeschi, F.; Bertolucci, E.; Bettoni, D.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tonelli, G.; Triggiani, G.; Codino, A.; Enorini, M.; Fabbri, F.L.; Laurelli, P.; Satta, L.; Spillantini, P.; Zallo, A.

    1986-01-01

    The pion form factor has been measured in the space-like q 2 region 0.014 to 0.26 (GeV/c) 2 by scattering 300 GeV pions from the electrons of a liquid hydrogen target. A detailed description is given of the apparatus, data analysis and corrections to the data. The mean square charge radius extracted from the data is model-dependent. We find that a form which includes a realistic description of the form factor phase gives a similar result to the naive pole form, and conclude π 2 >=0.439±0.008 fm 2 . (orig.)

  1. Urban form and greenhouse gas emissions in Finland

    International Nuclear Information System (INIS)

    Harmaajaervi, Irmeli

    2003-01-01

    Finland's regional form is becoming more concentrated, while urban sprawl is causing growth centres to become fragmented. The effects caused by these changes on greenhouse gas emissions were studied up to the year 2010, when, in accordance with the Kyoto protocol, Finland's greenhouse gas emissions should be reduced to the 1990 level. The urban form affects especially transportation inside regions, the potential to utilise district heating and the need for infrastructure. By preventing urban sprawl and by encouraging teleworking and some lifestyle changes, it would be possible to reduce annual transportation emissions by the year 2010 by 1.1 million tonnes CO 2 eq., i.e. 27%, the emissions from residential and service buildings by 1.1 million tonnes CO 2 eq., i.e. 5%, and the emissions from municipal infrastructure by 0.1 million tonnes CO 2 eq., i.e. 6%. Altogether, it is possible to reduce the greenhouse gas emissions by 2.3 million tonnes, which amounts to 15% of Finland's target for emissions reductions in 2010. If the target-oriented scenario is realised, the subsequent decrease of emissions would accelerate. To stop urban sprawl, measures are required in planning, land use and housing policy as well as in transportation and tax policies. Additionally, more needs to be done in regard to co-operation, interaction and information dissemination. This paper introduces a report which estimates, for the first time, the effects caused by changes in the regional and urban forms on the levels of greenhouse gas emissions in Finland

  2. The pion-nucleon form factor in space- and time-like regions

    International Nuclear Information System (INIS)

    Speth, J.; Tegen, R.

    1990-01-01

    We investigate the pion-nucleon vertex function in space- and time-like regions; these vertex functions appear as internal vertices in nucleon-antinucleon annihilations into n pions (n=2, 3, ..., 6). It is emphasised that only relativistic quark models can account for these vertices where one of the baryons/antibaryons is far off-shell with total energy close to zero. Using a novel 4-momentum projection technique we obtain results which generalize the usual (Breit frame) calculation of G πNN (k 2 ) (space-like) thereby removing completely the discrepancy in the Goldberger-Treiman relation. Our relativistic quark model calculation also explains the empirical suppression of antibaryonic contributions to the vertex functions Gsub(πNanti B) and Gsub(πBanti N) which enter in processes like Nanti N→ππ. (orig.)

  3. Why are Trade Agreements Regional?

    OpenAIRE

    Zissimos, Ben

    2007-01-01

    This paper shows how distance may be used to coordinate on a unique equilibrium in which trade agreements are regional. Trade agreement formation is modeled as coalition formation. In a standard trade model with no distance between countries, a familiar problem of coordination failure arises giving rise to multiple equilibria; any one of many possible trade agreements can form. With distance between countries, and through strategic interaction in tariff setting, regional trade agreements gene...

  4. Where are the stars of the bar of NGC 1530 forming?

    NARCIS (Netherlands)

    Zurita, A.; Perez, I.

    Aims. NGC 1530 has one of the strongest bars ever observed and recent star formation sites are distributed across its bar. Our aim is to study the photometric properties of the bar and its H II regions, to elucidate the conditions under which H II regions form and their spatial relation to the

  5. ABOUT FORMS, EFFICIENCY AND ASSESSMENT OF ENVIRONMENTAL MANAGEMENT

    Directory of Open Access Journals (Sweden)

    H. Bachev

    2015-03-01

    Full Text Available We suggest a holistic framework for analyzing, assessment and improvement of environmental management using “agrariansector” as an example. It incorporates an interdisciplinary approach (Economics, Organization, Law, Sociology, Ecology, Technology, Behavioral and Political Sciences and includes: specification of managerial actors, needs and spectrum of governing modes (institutional environment; private, collective, market, public modes at different level of decision-making (individual, farm, eco-system, local, regional, national, transnational, global; specification of critical socio-economic, natural, technological, behavioral etc. factors of managerial choice, and feasible spectrum of managerial forms; defining and assessing comparative and absolute efficiency of eco-management forms and system; improvement of forms of public intervention in eco-management.

  6. Challenges from variation across regions in cost effectiveness analysis in multi-regional clinical trials

    Directory of Open Access Journals (Sweden)

    Yunbo Chu

    2016-10-01

    Full Text Available Economic evaluation in the form of cost-effectiveness analysis has become a popular means to inform decisions in healthcare. With multi-regional clinical trials in a global development program becoming a new venue for drug efficacy testing in recent decades, questions in methods for cost-effectiveness analysis in the multi-regional clinical trials setting also emerge. This paper addresses some challenges from variation across regions in cost effectiveness analysis in multi-regional clinical trials. Several discussion points are raised for further attention and a multi-regional clinical trial example is presented to illustrate the implications in industrial application. A general message is delivered to call for a depth discussion by all stakeholders to reach an agreement on a good practice in cost-effectiveness analysis in the multi-regional clinical trials. Meanwhile, we recommend an additional consideration of cost-effectiveness analysis results based on the clinical evidence from a certain homogeneous population as sensitivity or scenario analysis upon data availability.

  7. Rapid intranasal delivery of chloramphenicol acetyltransferase in the active form to different brain regions as a model for enzyme therapy in the CNS.

    Science.gov (United States)

    Appu, Abhilash P; Arun, Peethambaran; Krishnan, Jishnu K S; Moffett, John R; Namboodiri, Aryan M A

    2016-02-01

    The blood brain barrier (BBB) is critical for maintaining central nervous system (CNS) homeostasis by restricting entry of potentially toxic substances. However, the BBB is a major obstacle in the treatment of neurotoxicity and neurological disorders due to the restrictive nature of the barrier to many medications. Intranasal delivery of active enzymes to the brain has therapeutic potential for the treatment of numerous CNS enzyme deficiency disorders and CNS toxicity caused by chemical threat agents. The aim of this work is to provide a sensitive model system for analyzing the rapid delivery of active enzymes into various regions of the brain with therapeutic bioavailability. We tested intranasal delivery of chloramphenicol acetyltransferase (CAT), a relatively large (75kD) enzyme, in its active form into different regions of the brain. CAT was delivered intranasally to anaesthetized rats and enzyme activity was measured in different regions using a highly specific High Performance Thin Layer Chromatography (HP-TLC)-radiometry coupled assay. Active enzyme reached all examined areas of the brain within 15min (the earliest time point tested). In addition, the yield of enzyme activity in the brain was almost doubled in the brains of rats pre-treated with matrix metalloproteinase-9 (MMP-9). Intranasal administration of active enzymes in conjunction with MMP-9 to the CNS is both rapid and effective. The present results suggest that intranasal enzyme therapy is a promising method for counteracting CNS chemical threat poisoning, as well as for treating CNS enzyme deficiency disorders. Published by Elsevier B.V.

  8. The Landform Regions of Iowa

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — A landscape is a collection of land shapes or land forms. Landform regions are a grouping of individual landscape features that have a common geomophology. In Iowa,...

  9. Pion form factor within QCD instanton vacuum model

    International Nuclear Information System (INIS)

    Dorokhov, A.E.

    1997-01-01

    Instanton induced pion wave function is constructed. It provides an intrinsic k 1 dependence which suppress soft virtual one-gluon exchanges and thus legitimate the perturbative QCD (pQCD) calculations of the pion electromagnetic form factor in the region of momentum transfers above the scale. (author)

  10. Energy options and regional cooperation on nuclear energy in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Shin, Jae In

    1986-10-01

    This paper reviews the extensive forms of Asia-Pacific regional cooperation in nuclear power to develop and provide economical and reliable energy supply for sound economical growths of developing countries in this region, which has seen rapid growth of energy consumption more than anywhere else in recent years. Nuclear power has received keen attention from DCs because it can provide a self-reliable energy supply and promote development of high technology in the associated engineering and manufacturing industries locally. However, due to the particular characteristics in nuclear power technology, a close cooperation is required between the seller(industrialized) and buyer(developing) countries. The Asia-Pacific regional cooperation in nuclear power is a step toward providing mutual benefits to the countries involved in this region, and this paper explores potential ways in formulating basic and systematic approaches and areas of full scope cooperation. (author)

  11. Evolution of the snake body form reveals homoplasy in amniote Hox gene function.

    Science.gov (United States)

    Head, Jason J; Polly, P David

    2015-04-02

    Hox genes regulate regionalization of the axial skeleton in vertebrates, and changes in their expression have been proposed to be a fundamental mechanism driving the evolution of new body forms. The origin of the snake-like body form, with its deregionalized pre-cloacal axial skeleton, has been explained as either homogenization of Hox gene expression domains, or retention of standard vertebrate Hox domains with alteration of downstream expression that suppresses development of distinct regions. Both models assume a highly regionalized ancestor, but the extent of deregionalization of the primaxial domain (vertebrae, dorsal ribs) of the skeleton in snake-like body forms has never been analysed. Here we combine geometric morphometrics and maximum-likelihood analysis to show that the pre-cloacal primaxial domain of elongate, limb-reduced lizards and snakes is not deregionalized compared with limbed taxa, and that the phylogenetic structure of primaxial morphology in reptiles does not support a loss of regionalization in the evolution of snakes. We demonstrate that morphometric regional boundaries correspond to mapped gene expression domains in snakes, suggesting that their primaxial domain is patterned by a normally functional Hox code. Comparison of primaxial osteology in fossil and modern amniotes with Hox gene distributions within Amniota indicates that a functional, sequentially expressed Hox code patterned a subtle morphological gradient along the anterior-posterior axis in stem members of amniote clades and extant lizards, including snakes. The highly regionalized skeletons of extant archosaurs and mammals result from independent evolution in the Hox code and do not represent ancestral conditions for clades with snake-like body forms. The developmental origin of snakes is best explained by decoupling of the primaxial and abaxial domains and by increases in somite number, not by changes in the function of primaxial Hox genes.

  12. The Current Status of the Economic Security of Poltava Region

    Directory of Open Access Journals (Sweden)

    Bondarevska Olha M.

    2017-12-01

    Full Text Available The status of economic security of Poltava region in 2012–2016 was analyzed, the analysis was conducted using the developed methodology for assessing economic security of region, which is based on the joint use of indicative and functional methods. In order to assess the status of economic security of region, a system of indicators, divided by economic security components, has been formed using functional approach. The information-analytical provision of assessment has been formed using statistical information on the socio-economic development of the region. The influence of factors of destabilizing and destimulative nature on the status of economic security of the region has been researched. It has been concluded that the economic security of Poltava region is unsatisfactory, despite the existence of some positive tendencies, which at present are not sustainable.

  13. Acoustic holograms of active regions

    International Nuclear Information System (INIS)

    Chou, Dean-Yi

    2008-01-01

    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  14. Acoustic holograms of active regions

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Dean-Yi [Physics Department, National Tsing Hua University, Hsinchu, 30013, Taiwan (China)], E-mail: chou@phys.nthu.edu.tw

    2008-10-15

    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  15. GRTgaz and the regions

    International Nuclear Information System (INIS)

    2017-01-01

    GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the regional activities of GRTgaz in France in the form of 12 regional fact sheets summarizing the key data by the end of 2016: network structure, financial indicators (investments, orders), public and industrial gas consumptions, 2017 projects, institutional and environmental partnerships

  16. A new crystal form of human tear lipocalin reveals high flexibility in the loop region and induced fit in the ligand cavity

    International Nuclear Information System (INIS)

    Breustedt, Daniel A.; Chatwell, Lorenz; Skerra, Arne

    2009-01-01

    The crystal structure of tear lipocalin determined in space group P2 1 revealed large structural deviations from the previously solved X-ray structure in space group C2, especially in the loop region and adjoining parts of the β-barrel which give rise to the ligand-binding site. These findings illustrate a novel mechanism for promiscuity in ligand recognition by the lipocalin protein family. Tear lipocalin (TLC) with the bound artificial ligand 1,4-butanediol has been crystallized in space group P2 1 with four protein molecules in the asymmetric unit and its X-ray structure has been solved at 2.6 Å resolution. TLC is a member of the lipocalin family that binds ligands with diverse chemical structures, such as fatty acids, phospholipids and cholesterol as well as microbial siderophores and the antibiotic rifampin. Previous X-ray structural analysis of apo TLC crystallized in space group C2 revealed a rather large bifurcated ligand pocket and a partially disordered loop region at the entrace to the cavity. Analysis of the P2 1 crystal form uncovered major conformational changes (i) in β-strands B, C and D, (ii) in loops 1, 2 and 4 at the open end of the β-barrel and (iii) in the extended C-terminal segment, which is attached to the β-barrel via a disulfide bridge. The structural comparison indicates high conformational plasticity of the loop region as well as of deeper parts of the ligand pocket, thus allowing adaptation to ligands that differ vastly in size and shape. This illustrates a mechanism for promiscuity in ligand recognition which may also be relevant for some other physiologically important members of the lipocalin protein family

  17. A PHOTON-DOMINATED REGION MODEL FOR THE FIR MID-J CO LADDER WITH UNIVERSAL ROTATIONAL TEMPERATURE IN STAR FORMING REGIONS

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seokho; Park, Yong-Sun [Astronomy Program, Department of Physics and Astronomy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Lee, Jeong-Eun [Department of Astronomy and Space Science, Kyung Hee University, Yongin-shi, Kyungki-do 449-701 (Korea, Republic of); Bergin, Edwin A., E-mail: shlee@astro.snu.ac.kr [Department of Astronomy, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States)

    2014-08-01

    A photon-dominated region (PDR) is one of the leading candidate mechanisms for the origin of warm CO gas with near universal ∼300 K rotational temperature inferred from the CO emission detected toward embedded protostars by Herschel/PACS. We have developed a PDR model in general coordinates, where we can use the most adequate coordinate system for an embedded protostar having outflow cavity walls, to solve chemistry and gas energetics self-consistently for given UV radiation fields with different spectral shapes. Simple one-dimensional tests and applications show that FIR mid-J (14 ≤ J ≤ 24) CO lines are emitted from close to the surface of a dense region exposed to high UV fluxes. We apply our model to HH46 and find that the UV-heated outflow cavity wall can reproduce the mid-J CO transitions observed by Herschel/PACS. A model with UV radiation corresponding to a blackbody of 10,000 K results in a rotational temperature lower than 300 K, while models with the Draine interstellar radiation field and the 15,000 K blackbody radiation field predict a rotational temperature similar to the observed one.

  18. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    International Nuclear Information System (INIS)

    Luhman, K. L.; Mamajek, E. E.; Shukla, S. J.; Loutrel, N. P.

    2017-01-01

    Previous studies have found that ∼1 deg 2 fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg 2 ) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  19. A SURVEY FOR NEW MEMBERS OF THE TAURUS STAR-FORMING REGION WITH THE SLOAN DIGITAL SKY SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Mamajek, E. E. [Department of Physics and Astronomy, The University of Rochester, Rochester, NY 14627 (United States); Shukla, S. J. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Loutrel, N. P., E-mail: kluhman@astro.psu.edu [eXtreme Gravity Institute, Department of Physics, Montana State University, Bozeman, MT 59715 (United States)

    2017-01-01

    Previous studies have found that ∼1 deg{sup 2} fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg{sup 2}) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  20. PARALLAXES FOR W49N AND G048.60+0.02: DISTANT STAR FORMING REGIONS IN THE PERSEUS SPIRAL ARM

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, B.; Menten, K. M.; Brunthaler, A. [Max-Plank-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Zheng, X. W. [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2013-09-20

    We report trigonometric parallax measurements of 22 GHz H{sub 2}O masers in two massive star-forming regions from Very Long Baseline Array observations as part of the Bar and Spiral Structure Legacy Survey. The distances of 11.11{sup +0.79}{sub -0.69} kpc to W49N (G043.16+0.01) and 10.75{sup +0.61}{sub -0.55} kpc to G048.60+0.02 locate them in a distant section of the Perseus arm near the solar circle in the first Galactic quadrant. This allows us to locate accurately the inner portion of the Perseus arm for the first time. Combining the present results with sources measured in the outer portion of the arm in the second and third quadrants yields a global pitch angle of 9.°5 ± 1.°3 for the Perseus arm. We have found almost no H{sub 2}O maser sources in the Perseus arm for 50°

  1. On the origin of phosphorus nitride in star-forming regions

    Science.gov (United States)

    Mininni, C.; Fontani, F.; Rivilla, V. M.; Beltrán, M. T.; Caselli, P.; Vasyunin, A.

    2018-05-01

    We present multitransition observations of phosphorus nitride (PN) towards a sample of nine massive dense cores in different evolutionary stages. Using transitions with different excitation conditions, we have found for the first time that the excitation temperatures of PN are in the range ˜5-30 K. To investigate the main chemical route for the PN formation (surface-chemistry versus gas-phase chemistry), and the dominant desorption mechanism (thermal versus shock), we have compared our results with those obtained from molecules tracing different chemical and physical conditions (SiO, SO, CH3OH, and N2H+). We have found that the PN line profiles are very well correlated with those of SiO and SO in six out of the nine targets, which indicate that PN may be released by sputtering of dust grains due to shocks. This finding is corroborated by a faint but statistically significant positive trend between the PN abundance and those of SiO and SO. However, in three objects the PN lines have no hints of high-velocity wings, which indicates an alternative origin of PN. Overall, our results indicate that the origin of PN is not unique, as it can be formed not only in protostellar shocks, but also in colder and more quiescent gas through alternative pathways.

  2. Region Sjællands Økologiprofil

    DEFF Research Database (Denmark)

    Holm, Jesper; Lund Sørensen, Runa Cecilie

    Nærværende rapport bygger på erfaringer foretaget gennem en kortlægning af Region Sjællands økologiske sektor, som blev lavet i forbindelse med Region Sjællands store fødevareprojekt Grønne Regionale Madoplevelser (GRO) under delprojektet Økologisk Oplevelsesinnovation. Formålet med undersøgelsen...... har været at generere et overblik over Region Sjællands økologiske sektor, både hvad angår antallet og udbredelsen af økologiske landbrugsbedrifter, forarbejdningsvirksomheder, engrosvirksomheder og detailforretninger....

  3. Transient regional osteoporosis.

    Science.gov (United States)

    Cano-Marquina, Antonio; Tarín, Juan J; García-Pérez, Miguel-Ángel; Cano, Antonio

    2014-04-01

    Transient regional osteoporosis (TRO) is a disease that predisposes to fragility fracture in weight bearing joints of mid-life women and men. Pregnant women may also suffer the process, usually at the hip. The prevalence of TRO is lower than the systemic form, associated with postmenopause and advanced age, but may be falsely diminished by under-diagnosis. The disease may be uni- or bilateral, and may migrate to distinct joints. One main feature of TRO is spontaneous recovery. Pain and progressive limitation in the functionality of the affected joint(s) are key symptoms. In the case of the form associated with pregnancy, difficulties in diagnosis derive from the relatively young age at presentation and from the clinical overlapping with the frequent aches during gestation. Densitometric osteoporosis in the affected region is not always present, but bone marrow edema, with or without joint effusion, is detected by magnetic resonance. There are not treatment guidelines, but the association of antiresorptives to symptomatic treatment seems to be beneficial. Surgery or other orthopedic interventions can be required for specific indications, like hip fracture, intra-medullary decompression, or other. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. QCD constraints for the electromagnetic form factor of the pion

    International Nuclear Information System (INIS)

    Machet, B.

    1980-07-01

    Using the modulus representation, we derive constraints for the behaviour of the electromagnetic form factor of the pion in the time like region [1 GeV 2 , + infinity[, from information given by perturbative QCD in the space like region [-μ 2 , - infinity[. A phenomenological μ dependent upper bound for the exponent of the first non leading logarithmic correction is deduced. Restrictions and problems of the method are discussed

  5. Dynamic spatial organization of the occipito-temporal word form area for second language processing.

    Science.gov (United States)

    Gao, Yue; Sun, Yafeng; Lu, Chunming; Ding, Guosheng; Guo, Taomei; Malins, Jeffrey G; Booth, James R; Peng, Danling; Liu, Li

    2017-08-01

    Despite the left occipito-temporal region having shown consistent activation in visual word form processing across numerous studies in different languages, the mechanisms by which word forms of second languages are processed in this region remain unclear. To examine this more closely, 16 Chinese-English and 14 English-Chinese late bilinguals were recruited to perform lexical decision tasks to visually presented words in both their native and second languages (L1 and L2) during functional magnetic resonance imaging scanning. Here we demonstrate that visual word form processing for L1 versus L2 engaged different spatial areas of the left occipito-temporal region. Namely, the spatial organization of the visual word form processing in the left occipito-temporal region is more medial and posterior for L2 than L1 processing in Chinese-English bilinguals, whereas activation is more lateral and anterior for L2 in English-Chinese bilinguals. In addition, for Chinese-English bilinguals, more lateral recruitment of the occipito-temporal region was correlated with higher L2 proficiency, suggesting higher L2 proficiency is associated with greater involvement of L1-preferred mechanisms. For English-Chinese bilinguals, higher L2 proficiency was correlated with more lateral and anterior activation of the occipito-temporal region, suggesting higher L2 proficiency is associated with greater involvement of L2-preferred mechanisms. Taken together, our results indicate that L1 and L2 recruit spatially different areas of the occipito-temporal region in visual word processing when the two scripts belong to different writing systems, and that the spatial organization of this region for L2 visual word processing is dynamically modulated by L2 proficiency. Specifically, proficiency in L2 in Chinese-English is associated with assimilation to the native language mechanisms, whereas L2 in English-Chinese is associated with accommodation to second language mechanisms. Copyright © 2017

  6. Dissociating Visual Form from Lexical Frequency Using Japanese

    Science.gov (United States)

    Twomey, Tae; Duncan, Keith J. Kawabata; Hogan, John S.; Morita, Kenji; Umeda, Kazumasa; Sakai, Katsuyuki; Devlin, Joseph T.

    2013-01-01

    In Japanese, the same word can be written in either morphographic Kanji or syllabographic Hiragana and this provides a unique opportunity to disentangle a word's lexical frequency from the frequency of its visual form--an important distinction for understanding the neural information processing in regions engaged by reading. Behaviorally,…

  7. STAR-FORMING ACTIVITY IN THE H ii REGIONS ASSOCIATED WITH THE IRAS 17160–3707 COMPLEX

    Energy Technology Data Exchange (ETDEWEB)

    Nandakumar, G.; Veena, V. S.; Vig, S.; Tej, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695 547 (India); Ghosh, S. K.; Ojha, D. K. [Tata Institute of Fundamental Research, Mumbai (Bombay) 400 005 (India)

    2016-11-01

    We present a multiwavelength investigation of star formation activity toward the southern H ii regions associated with IRAS 17160–3707, located at a distance of 6.2 kpc with a bolometric luminosity of 8.3 × 10{sup 5} L {sub ⊙}. The ionized gas distribution and dust clumps in the parental molecular cloud are examined in detail using measurements at infrared, submillimeter and radio wavelengths. The radio continuum images at 1280 and 610 MHz obtained using the Giant Metrewave Radio Telescope reveal the presence of multiple compact sources as well as nebulous emission. At submillimeter wavelengths, we identify seven dust clumps and estimate their physical properties such as temperature: 24–30 K, mass: 300–4800 M {sub ⊙} and luminosity: 9–317 × 10{sup 2} L {sub ⊙} using modified blackbody fits to the spectral energy distributions (SEDs) between 70 and 870 μ m. We find 24 young stellar objects (YSOs) in the mid-infrared, with a few of them coincident with the compact radio sources. The SEDs of the YSOs have been fitted by the Robitaille models and the results indicate that those having radio compact sources as counterparts host massive objects in early evolutionary stages with best fit age ≤0.2 Myr. We compare the relative evolutionary stages of clumps using various signposts such as masers, ionized gas, presence of YSOs and infrared nebulosity, and find six massive star-forming clumps and one quiescent clump. Of the former, five are in a relatively advanced stage and one in an earlier stage.

  8. Where are the massive stars of the bar of NGC 1530 forming?

    NARCIS (Netherlands)

    Zurita, A.

    2008-01-01

    NGC 1530 has one of the strongest bars ever observed and recent star formation sites are distributed across its bar. Our aim is to study the photometric properties of the bar and its Hii regions, to elucidate the conditions under which Hii regions form and their spatial relation to the principal

  9. THEORETICAL AND METHODOLOGICAL APPROACHES TO REGIONAL COMPETITION INVESTIGATION

    Directory of Open Access Journals (Sweden)

    A.I. Tatarkin

    2006-03-01

    Full Text Available The article is dedicated to theoretical-methodological issues of regional economy competitiveness investigation. Economic essence of regional competitiveness is analyzed, its definition is given. The factors that determine relations of competition on medium and macrolevels are proved. The basic differences between world-economical and inter-regional communications are formulated. The specific features of globalization processes as form of competitive struggle are considered.

  10. The Institutional Models of Participants Interaction as Instrument for Regional Development

    Directory of Open Access Journals (Sweden)

    Bogdan Nataliia M.

    2017-11-01

    Full Text Available The article is aimed at studying the processes of interaction of participants at the regional level. The necessity of search and development of directions of cooperation of participants in process of realization of tasks of both sectoral and regional development has been proved. A peculiar philosophy of cooperation has been formulated, it has been proved that it should not appear as some legal formality. The objectives of cooperation within in terms its broad understanding have been defined, taking into consideration the conception of classical marketing complex (4P. The basic theories of cooperation have been reviewed, on the basis of analyzing these it has been found that an intensifying precisely the non-economic conditions of cooperation at regional level is necessary, and also that cooperation and interaction in region should be considered with understanding of function of different parties to the discussed forms of cooperation. A characterization of forms of both intra- and inter-sectoral cooperation of the participants, operating at the regional level, has been developed. The importance of the institutional forms of cooperation in relation to the processes of solving common problems of both the sectoral and the regional development has been substantiated.

  11. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    Parera, María Delia

    2011-01-01

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [es

  12. Estimation of extreme risk regions under multivariate regular variation

    NARCIS (Netherlands)

    Cai, J.; Einmahl, J.H.J.; de Haan, L.F.M.

    2011-01-01

    When considering d possibly dependent random variables, one is often interested in extreme risk regions, with very small probability p. We consider risk regions of the form {z ∈ Rd : f (z) ≤ β}, where f is the joint density and β a small number. Estimation of such an extreme risk region is difficult

  13. ENTREPRENEURIAL ECO-SYSTEMS & REGIONAL ALLIANCES

    Directory of Open Access Journals (Sweden)

    Joe ENGLISH

    2015-05-01

    Full Text Available The study of universities and their role in enterprise development, support and education is very mature. However when Isenberg coined the term ‘entrepreneurial ecosystem’ and suggested that higher education was one of the key foundation blocks of a regional eco-system it threw open the concept of the university having a wider role in the overall business, economic and civic life of a region. What is this wider role, and how do the universities themselves view their place in this evolving entrepreneurial eco-system? How do they fit into Regional Alliances set up to build regional economic development? This paper introduces two pilot Alliances that have been recently formed using both the education institutes and the wider eco-system to drive Innovation and Graduate Employability (The SHIP and REAL Alliances.

  14. THOUGHTS ON THE REGIONALIZATION PROCESS IN COMPARATIVE LAW

    Directory of Open Access Journals (Sweden)

    CLAUDIA GILIA

    2013-05-01

    Full Text Available Regionalization is a complex and smooth process in terms of territorial organization of the states which chose this form of organization, but also from the perspective of how the regional systems understood to exercise their competences. The regionalization process did not only yield profit for the inhabitants of those administrative entities, but it also caused problems to national governors (e.g. demands for the federalization of the state in question, proposals to gain independence from the state they are part of, issues related to state security – terrorists attacks etc.. Our paper shall conduct an assessment over two states which chose this form of regionalization: The United Kingdom of Great Britain and North Ireland and Spain. Given the context of the upcoming constitutional and legislative changes envisaged by the Romanian government, we consider that our research can be regarded as a useful tool, designed to develop certain constitutional directives, which are intended to acquire the best solutions from European experiences.

  15. Life forms of endemic carabid beetles (Coleoptera, Carabidae in the forest eco-systems of gorgany mountains

    Directory of Open Access Journals (Sweden)

    V. S. Pushkar

    2010-09-01

    Full Text Available In the forest ecosystems of Gorgany Mountains 11 endemic carabids are found. It is about 12.2 % of all ground-beetles fauna of the investigated region. As a result of the morphometric analysis the life forms of endemic carabids are determined. The system of ground beetles’ life forms developed by I. Sharova (1981 is supplemented. All endemics we have rated among 1 class (Zoophages, 2 subclasses (Epigeobionts, Stratobionts and 5 life forms. The analysis of the carabid beetles’ life form spectrum in the forest ecosystems of Gorgany mountains attests to their broad settlement of ecological niches in the investigated region.

  16. Densified waste form and method for forming

    Science.gov (United States)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    2015-08-25

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  17. New tetrameric forms of the rotavirus NSP4 with antiparallel helices.

    Science.gov (United States)

    Kumar, Sushant; Ramappa, Raghavendra; Pamidimukkala, Kiranmayee; Rao, C D; Suguna, K

    2018-06-01

    Rotavirus nonstructural protein 4, the first viral enterotoxin to be identified, is a multidomain, multifunctional glycoprotein. Earlier, we reported a Ca 2+ -bound coiled-coil tetrameric structure of the diarrhea-inducing region of NSP4 from the rotavirus strains SA11 and I321 and a Ca 2+ -free pentameric structure from the rotavirus strain ST3, all with a parallel arrangement of α-helices. pH was found to determine the oligomeric state: a basic pH favoured a tetramer, whereas an acidic pH favoured a pentamer. Here, we report two novel forms of the coiled-coil region of NSP4 from the bovine rotavirus strains MF66 and NCDV. These crystallized at acidic pH, forming antiparallel coiled-coil tetrameric structures without any bound Ca 2+ ion. Structural and mutational studies of the coiled-coil regions of NSP4 revealed that the nature of the residue at position 131 (Tyr/His) plays an important role in the observed structural diversity.

  18. Crustal structure and tectonic model of the Arctic region

    DEFF Research Database (Denmark)

    Petrov, Oleg; Morozov, Andrey; Shokalsky, Sergey

    2016-01-01

    We present a new model of the crustal and tectonic structure of the Arctic region north of 60° N latitude, constrained as a part of the international Atlas of Geological Maps of the Circumpolar Arctic under the aegis of the Commission for the Geological Map of the World. The region is largely...... formed by (i) Archean-Paleoproterozoic shields and platforms, (ii) orogenic belts of the Neoproterozoic to the Late Mesozoic ages overlain by platform and basin sediments, (iii) Cenozoic rift structures formed in part as a consequence of seafloor spreading in the North East Atlantic Ocean...... and thickness of the sedimentary cover and presents tectonic regionalization based on 18 major crustal types (oceanic, transitional, and continental) recognized in the Arctic. A 7600. km-long crustal geotransect across the region illustrates the details of its crustal and tectonic structure. We discuss...

  19. OUTCOMES OF TICK-BORNE ENCEPHALITIS IN THE TOMSK REGION

    Directory of Open Access Journals (Sweden)

    T. S. Pinegina

    2013-01-01

    Full Text Available The results of the study outcomes of tick-borne encephalitis in adults in the Tomsk Region. Patients conducted a comprehensive clinical and laboratory examination. Revealed the prevalence of autonomic disorders in individuals who have had at different periods of tick-borne encephalitis, which is regarded as the effects of tick-borne infection. Residual effects of tick-borne encephalitis occurs mainly in the form of light paresis after suffering a focal forms. Among the chronic (progredient forms of tick-borne encephalitis often formed hyperkinetic options. Most of the study revealed the presence of precipitating factors that could have an influence on the outcome. Fundamental diffe rences in all-clinical and immunological analyses at patients with various outcomes of tick-borne encephalitis it wasn't noted. KEY WORDS: tick-borne encephalitis, Tomsk Region, the outcomes.

  20. Regional analysis of the nuclear-electricity; Analisis regional de la nucleoelectricidad

    Energy Technology Data Exchange (ETDEWEB)

    Parera, M. D., E-mail: dparera@cnea.gov.ar [CNEA, Gerencia de Planificacion, Coordinacion y Control, Subgerencia de Planificacion Estrategica, Av. Gral. Paz 1499, B1650KNA San Martin, Buenos Aires (Argentina)

    2011-11-15

    In this study was realized a regional analysis of the Argentinean electric market contemplating the effects of regional cooperation, the internal and international interconnections; and the possibilities of insert of new nuclear power stations were evaluated in different regions of the country, indicating the most appropriate areas to carry out these facilities to increase the penetration of the nuclear energy in the national energy matrix. Also was studied the interconnection of the electricity and natural gas markets, due to the existent linking among both energy forms. With this purpose the program Message (Model for energy supply strategy alternatives and their general environmental impacts) was used, promoted by the International Atomic Energy Agency. This model carries out an economic optimization level country, obtaining the minimum cost as a result for the modeling system. The division for regions realized by the Compania Administradora del Mercado Mayorista Electrico (CAMMESA) was used, which divides to the country in eight regions. They were considered the characteristics and necessities of each one of them, their respective demands and offers of electric power and natural gas, as well as their existent and projected interconnections, composed by the electric lines and gas pipes. According to the results obtained through the model, the nuclear-electricity is a competitive option. (Author)

  1. Bedforms formed by experimental supercritical density flows

    Science.gov (United States)

    Naruse, Hajime; Izumi, Norihiro; Yokokawa, Miwa; Muto, Tetsuji

    2014-05-01

    This study reveals characteristics and formative conditions of bedforms produced by saline density flows in supercritical flow conditions, especially focusing on the mechanism of the formation of plane bed. The motion of sediment particles forming bedforms was resolved by high-speed cameras (1/1000 frame/seconds). Experimental density flows were produced by mixtures of salt water (1.01-1.04 in density) and plastic particles (1.5 in specific density, 140 or 240 mm in diameter). Salt water and plastic particles are analogue materials of muddy water and sand particles in turbidity currents respectively. Acrylic flume (4.0 m long, 2.0 cm wide and 0.5 m deep) was submerged in an experimental tank (6.0 m long, 1.8 m wide and 1.2 m deep) that was filled by clear water. Features of bedforms were observed when the bed state in the flume reached equilibrium condition. The experimental conditions range 1.5-4.2 in densimetric Froude number and 0.2-0.8 in Shields dimensionless stress. We report the two major discoveries as a result of the flume experiments: (1) Plane bed under Froude-supercritical flows and (2) Geometrical characteristics of cyclic steps formed by density flows. (1) Plane bed was formed under the condition of supercritical flow regime. In previous studies, plane bed has been known to be formed by subcritical unidirectional flows (ca. 0.8 in Froude number). However, this study implies that plane bed can also be formed by supercritical conditions with high Shields dimensionless stress (>0.4) and very high Froude number (> 4.0). This discovery may suggest that previous estimations of paleo-hydraulic conditions of parallel lamination in turbidites should be reconsidered. The previous experimental studies and data from high-speed camera suggest that the region of plane bed formation coincides with the region of the sheet flow developments. The particle transport in sheet flow (thick bedload layer) induces transform of profile of flow shear stress, which may be

  2. Indium antimonide crystal defects formed by fast neutron irradiation

    International Nuclear Information System (INIS)

    Vitovskij, N.A.; Dolgolenko, A.P.; Mashovets, T.V.; Oganesyan, O.V.

    1979-01-01

    It is shown, that indium antimonide irradiation with fast neutrons of reactor results in the formation of disorded regions with a mean radius of approximately 130 A surrounded with space charge regions forming barriers for main carriers. But the found values of defect cluster depolarization coefficient (Lsub(x)sup(n)=0.18 and Lsub(x)sup(p)=0.29) show, that the clusters have marked conductivity for main charge carriers. The found position of the Fermi level in the disorded regions Esub(F)=Esub(c)-0.085 eV does not depend on the impurity type and its concentration in an initial material. The disorded regions play the main part in charge carrier scattering at low temperatures and markedly contribute to the change of mobility at 80 K. It is found, that irradiation temperature change in the range from 77 to 300 K does not effect practically on the disorded region parameters

  3. Interaction for Innovation: Comparing Norwegian Regions

    Directory of Open Access Journals (Sweden)

    Marina Solesvik

    2014-01-01

    Full Text Available Building upon insights from earlier investigations of innovation collaboration from a regional perspective as well as the triple helix perspective, local/regional innovation systems and open innovation approaches, this study explores whether cooperation between firms, universities and government increases the intensity of innovation equally for the capital city and peripheral regions. We investigate whether firms located in the capital region benefit more from public support, cooperation with universities, and cooperation with different stakeholders than firms located in peripheral regions. Using logistic binary regressions, we find that capital region firms are generally not more innovative than those located elsewhere. We also find no effect on innovation from cooperation with universities, although public support is related to engagement in product and process innovations. Our results warn against simple applications of triple helix and open innovation approaches, as many forms of collaboration seem to have little impact on innovation, regardless of regional context.

  4. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    Science.gov (United States)

    Goswami, A.

    2016-11-01

    In this work we present a study of the Dalitz decay η → γe+e-. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it's decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  5. Electromagnetic Transition Form Factor of the η meson with WASA-at-COSY

    Directory of Open Access Journals (Sweden)

    Goswami A.

    2016-01-01

    Full Text Available In this work we present a study of the Dalitz decay η → γe+e−. The aim of this work is to measure the transition form factor of the η meson. The transition form factor of the η meson describes the electromagnetic structure of the meson. The study of the Dalitz decay helps to calculate the transition form factor of the η meson. When a particle is point-like it’s decay rate can be calculated within QED. However, the complex structure of the meson modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. For this study data on proton-proton reaction at a beam energy of 1.4 GeV has been collected with WASA-at-COSY detector at Forschungszentrum Juelich, Germany. In the higher invariant mass region recent theoretical calculations slightly deviate from the fit to the data. We expect better results in the higher invariant mass region than previous measurements. The preliminary results of the analysis will be presented.

  6. Electromagnetic transition form factor of the η meson with WASA-at-COSY

    Energy Technology Data Exchange (ETDEWEB)

    Goswami, Ankita [Indian Institute of Technology Indore, Indore (India); Collaboration: WASA-at-COSY-Collaboration

    2015-07-01

    The aim of this work is to measure the transition form factor of the η meson. The transition form factor describes the internal structure of a particle. The precise determination of the transition form factor of the η meson is possible through the η→γe{sup +} e{sup -} Dalitz decay. When a particle is point-like then its decay rate can be calculated within QED. However, the complex structure of the particle modifies its decay rate. The transition form factor is determined by comparing the lepton-antilepton invariant mass distribution with QED. η mesons are produced using the reaction pp→ppη at a beam kinetic energy of 1.4 GeV at the COSY accelerator of Forschungszentrum Juelich and decay particles of the η meson are detected with the WASA detector. In the higher invariant mass region recent theoretical calculations slightly deviate from the the data. With the high statistics dataset we expect precise results in the higher invariant mass region. The status of the analysis is reported.

  7. Pathok Negoro mosque as the form of territorial defense region of Mataram Kingdom of Islam Java in Jogjakarta

    Science.gov (United States)

    Setyowati, E.; Hardiman, G.; Murtini, T. W.

    2018-01-01

    Territory is the space boundary of ownership. Defense concepts of an area also include territory. The defense concept of a territory of power or ownership is usually in the form of fortress, ditch, river, road, alley or gate. Many of these are seen in the forms of old city of Dutch’s inheritances. Javanese Islamic Kingdom in Yogyakarta has territory in the form of mosque. The mosque is called the Pathok Negoro as consists of 4 mosques. This territorial not same with another Islamic kingdoms. The research problem is why mosque used as a form of defense? What is the uniqueness?The purpose of the research is to reveal the form of territory of Javanese Islamic Kingdom. The benefit of this research is to get the characteristic form of territory of Javanese Islamic Kingdom in Yogyakarta. Their located in Ploso Kuning, Mlangi, babadan, Dongkelan, and Wonokromo. The research method that was used was qualitative method with grounded research, by using history and map search.In the analysis was carried out identification and comparison between mosques.The results show that there are characteristics on the location, the building orientation, the landscape, the area pattern and the shape of the building.

  8. Clustering potential of agriculture in Lviv region

    Directory of Open Access Journals (Sweden)

    N.A. Tsymbalista

    2015-03-01

    Full Text Available The paper emphasizes the need to stimulate the development of integration processes in agro-industrial complex of Ukraine. The advantages of the cluster model of integration are shown: along with the growth of competitiveness of agricultural products, it helps to increase the efficiency of inventory management of material flows, as well as to expand opportunities to attract investment and to implement innovation in agricultural production. Clusters also help to reduce transaction costs by establishing an optimal cooperation between the contracting parties. The theoretical essentiality of agro-industrial clusters is studied and a conceptual model of that kind of clusters is shown. The preconditions of clustering of agriculture in Lviv region are analyzed and feasibility of specific methods of statistical analysis to identify localization areas of the potential members of cluster-forming blocks of regional food clusters is verified. Cluster analysis is carried out to identify potential cluster-forming areas in the region in various sectors of agricultural production.

  9. Study of clumping in the Cepheus OB 3 molecular cloud

    International Nuclear Information System (INIS)

    Carr, J.S.

    1987-01-01

    A portion of the Cep OB 3 molecular cloud has been mapped in the (C-13)O (1-0) line on a completely sampled grid with a 1.5-arcmin spacing. A total of 45 individual clouds, or clumps, have been identified in the map, with masses from 3 to 300 solar mass, sizes 3 pc or smaller, and mean densities of a few hundred/cu cm. Power-law correlations are found among the clump properties, namely, M proportional to R exp 2.5 and Delta(v) exp 0.24. These exponents differ somewhat from those found for similar correlations for molecular clouds in previous studies. Determination of the virial masses for the clumps shows that the clumps are not gravitationally bound and must be expanding on a time scale of about 1 Myr. Measurements of the (C-13)O (2-1) line give volume densities of 2000-5000. Comparisons of these densities with the mean volume densities from the (C-13)O (1-0) data suggest that the gas is clumped on a small scale with a volume filling factor of 0.04-0.10. 31 references

  10. On the Formation of the C{sub 2}H{sub 6}O Isomers Ethanol (C{sub 2}H{sub 5}OH) and Dimethyl Ether (CH{sub 3}OCH{sub 3}) in Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Bergantini, Alexandre; Maksyutenko, Pavlo; Kaiser, Ralf I., E-mail: ralfk@hawaii.edu [Department of Chemistry, University of Hawaii at Mānoa, Honolulu, HI 96822 (United States)

    2017-06-01

    The structural isomers ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}) were detected in several low-, intermediate-, and high-mass star-forming regions, including Sgr B2, Orion, and W33A, with the relative abundance ratios of ethanol/dimethyl ether varying from about 0.03 to 3.4. Until now, no experimental data regarding the formation mechanisms and branching ratios of these two species in laboratory simulation experiments could be provided. Here, we exploit tunable photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS) to detect and analyze the production of complex organic molecules (COMs) resulting from the exposure of water/methane (H{sub 2}O/CH{sub 4}) ices to energetic electrons. The main goal is to understand the formation mechanisms in star-forming regions of two C{sub 2}H{sub 6}O isomers: ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}). The results show that the experimental branching ratios favor the synthesis of ethanol versus dimethyl ether (31 ± 11:1). This finding diverges from the abundances observed toward most star-forming regions, suggesting that production routes on interstellar grains to form dimethyl ether might be missing; alternatively, ethanol can be overproduced in the present simulation experiments, such as via radical–radical recombination pathways involving ethyl and hydroxyl radicals. Finally, the PI-ReTOF-MS data suggest the formation of methylacetylene (C{sub 3}H{sub 4}), ketene (CH{sub 2}CO), propene (C{sub 3}H{sub 6}), vinyl alcohol (CH{sub 2}CHOH), acetaldehyde (CH{sub 3}CHO), and methyl hydroperoxide (CH{sub 3}OOH), in addition to ethane (C{sub 2}H{sub 6}), methanol (CH{sub 3}OH), and CO{sub 2} detected from infrared spectroscopy. The yield of all the confirmed species is also determined.

  11. Transformation of environmental conditions in large former Soviet countries: regional analysis

    Science.gov (United States)

    Bityukova, V. R.; Borovikov, M. S.

    2018-01-01

    The article studies changes in the structure of environmental conditions of regions in the large former Soviet countries (case study of Russia and Kazakhstan) that have formed considerable contrasts in the placement of industrial complex and population settlement during the previous development stages. The changes related to the transition to market economy have led to essential transformation of environmental conditions. A complex index allowing to assess changes at the regional level in Kazakhstan and Russia and to reveal main similarities and differences between those changes is applied to studying the transformation of regional and industry structure. The article examines both industry-specific and spatial patterns forming environmental conditions at the regional level.

  12. East Asian Regionalisms and Korea in the 1940’s

    Directory of Open Access Journals (Sweden)

    Byong Kwon Song

    2014-02-01

    Full Text Available This paper seeks to consider the various types of regionalisms in East Asia during the 1940’s, and Korea’s position in the United States’ “Great China Policy” and demilitarization and democratization plans for Japan. After World War II, although aspects of regionalism were formed by the Cold War in East Asia, the regional structure of Northeast Asia was originally formed from the ‘turn of the century’ through the Asian Pacific War. From the beginning of the 1940’s, Japan promoted the idea of a “Greater East Asia Co-prosperity Sphere” in order to justify its hegemonic position in the East Asian regional order. In addition, the United States and Japan’s readjustment plans appeared to be related to strategies regarding the regional order of East Asia. During World War II, the victorious U.S. had already become one of the world’s superpowers and by principle, collaboration between the superpowers (United States, Great Britain, China, and the Soviet Union revealed an initiative for a four country police state. Japan devised a survival strategy in the case of its defeat. During the war in the early 1940’s, these policies and plans were used to recognize Großraum around the East Asian region. This paper points out the significance of the 1940’s and the continuity between the awareness of the wartime situation and the prospective situation during the postwar period. During the 1940’s, three forms of regionalism in East Asia appeared. The first was Japan’s regional hegemony over the East Asian regional order. In order to preserve regional hegemony, Imperial Japan gave specific meaning to Korea as an extension of its own economy. The second is based on the United States as an offshore hegemonic power, which chose China as a subordinate partner within East Asia and used the division of labor through sub-horizontal industry based on an initiative to suppress Japan. In order to weaken the economic dominance of Japanese Empire

  13. Geometry of the solar wind transition region during the 11-year solar cycle

    International Nuclear Information System (INIS)

    Lotova, N.A.; Blums, D.F.

    1986-01-01

    Geometry of the solar wind transition region and its dynamics during the 11-year solar cycle is investigated. It is shown that the space geometry of the transition region suffers considerable changes. In the years of minimum of solar activity (1975-1977) the transition region has a form close to elliptical, shifts nearer to the Sun, while its width decreases. During the years of maximum of Solar activity (1979-1981) the form of the transition region becomes close to spherically symmetric, is located further from the Sun and its width is increased

  14. Structure of massive star forming clumps from the Red MSX Source Survey

    Science.gov (United States)

    Figura, Charles C.; Urquhart, J. S.; Morgan, L.

    2014-01-01

    We present ammonia (1,1) and (2,2) emission maps of 61 high-mass star forming regions drawn from the Red MSX Source (RMS) Survey and observed with the Green Bank Telescope's K-Band Focal Plane Array. We use these observations to investigate the spatial distribution of the environmental conditions associated with this sample of embedded massive young stellar objects (MYSOs). Ammonia is an excellent high-density tracer of star-forming regions as its hyperfine structure allows relatively simple characterisation of the molecular environment. These maps are used to measure the column density, kinetic gas temperature distributions and velocity structure across these regions. We compare the distribution of these properties to that of the associated dust and mid-infrared emission traced by the ATLASGAL 870 micron emission maps and the Spitzer GLIMPSE IRAC images. We present a summary of these results and highlight some of more interesting finds.

  15. CLUSTER ANALYSIS UKRAINIAN REGIONAL DISTRIBUTION BY LEVEL OF INNOVATION

    Directory of Open Access Journals (Sweden)

    Roman Shchur

    2016-07-01

    Full Text Available   SWOT-analysis of the threats and benefits of innovation development strategy of Ivano-Frankivsk region in the context of financial support was сonducted. Methodical approach to determine of public-private partnerships potential that is tool of innovative economic development financing was identified. Cluster analysis of possibilities of forming public-private partnership in a particular region was carried out. Optimal set of problem areas that require urgent solutions and financial security is defined on the basis of cluster approach. It will help to form practical recommendations for the formation of an effective financial mechanism in the regions of Ukraine. Key words: the mechanism of innovation development financial provision, innovation development, public-private partnerships, cluster analysis, innovative development strategy.

  16. Epidemiological and clinical characteristics of myasthenia in the Krasnoyarsk region

    Directory of Open Access Journals (Sweden)

    E. D. Gasymly

    2017-01-01

    Full Text Available Aim. To study the epidemiological features of myasthenia gravis in the Krasnoyarsk region.Materials and methods. 314 cases of myasthenia gravis, registered by the Krasnoyarsk regional health information analytical center, 87 of these patients were under constant monitoring.Results. Mean age of the patients was 45.4 (SD 4.5 years. The number of women in the observed group – 66 (75.86 %, which was 3 times more than men – 21 (24.14 %. The prevalence was 10.98 per 100.000 population, the primary incidence – 0.01 by 1000.Conclusion. Clinical features of the disease in the region were established, the register of patients with myasthenia was formed. From September 2016 a department of the neuromuscular pathology on the basis of advice Regional Hospital was formed.

  17. Nanocomposites formed by ion implantation: Recent developments and future opportunities

    International Nuclear Information System (INIS)

    Meldrum, A.; Boatner, L.A.; White, C.W.

    2001-01-01

    Ion implantation is a versatile and powerful technique for forming many types of nanocrystalline precipitates embedded in the near-surface region of a wide variety of crystalline and amorphous host materials. The unique optical, electronic and magnetic properties of these nanocomposites has stimulated considerable recent research interest. In this review, we discuss recent developments in the field as well as some of the problems that currently hinder the potential applications of nanocomposites formed by ion implantation

  18. [Mortality among able-bodied population in industrial cities in accordance with specific enterprise forming a company city].

    Science.gov (United States)

    Tikhonova, G I; Gorchakova, T Iu; Churanova, A N

    2013-01-01

    The article covers comparative analysis of mortality causes and levels among male able-bodied population in small and medium industrial cities of Murmansk region in accordance with specific enterprise forming a company city. Findings are that, if compared to Murmansk having no enterprise forming a company, other industrial cities in the region, situated in the same climate area, demonstrated higher levels of mortality among the male able-bodied population with the death causes associated etiologically to occupational hazards on the enterprises forming a company city.

  19. Skyrme-model πNN form factor and nucleon-nucleon interaction

    International Nuclear Information System (INIS)

    Holzwarth, G.; Machleidt, R.

    1997-01-01

    We apply the strong πNN form factor, which emerges from the Skyrme model, in the two-nucleon system using a one-boson-exchange (OBE) model for the nucleon-nucleon (NN) interaction. Deuteron properties and phase parameters of NN scattering are reproduced well. In contrast to the form factor of monopole shape that is traditionally used in OBE models, the Skyrme form factor leaves low-momentum transfers essentially unaffected while it suppresses the high-momentum region strongly. It turns out that this behavior is very appropriate for models of the NN interaction and makes it possible to use a soft pion form factor in the NN system. As a consequence, the πN and the NN systems can be described using the same πNN form factor, which is impossible with the monopole. copyright 1997 The American Physical Society

  20. MODERN FORMS OF PARTNERSHIP IN BUSINESS

    Directory of Open Access Journals (Sweden)

    Markova V. D.

    2016-12-01

    Full Text Available The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining competitive advantage through the sharing of assets and expertise. Two groups of strategic partnership initiatives in the business were emphasized: some initiatives are shown by the state, while some come from the companies. It has been shown that the development of digital technologies, which allows to establish connection between geographically separated participants, promotes the formation of new partnership tools, such as the technology platforms and business ecosystems built on their basis.

  1. The Southern HII Region Discovery Survey

    Science.gov (United States)

    Wenger, Trey; Miller Dickey, John; Jordan, Christopher; Bania, Thomas M.; Balser, Dana S.; Dawson, Joanne; Anderson, Loren D.; Armentrout, William P.; McClure-Griffiths, Naomi

    2016-01-01

    HII regions are zones of ionized gas surrounding recently formed high-mass (OB-type) stars. They are among the brightest objects in the sky at radio wavelengths. HII regions provide a useful tool in constraining the Galactic morphological structure, chemical structure, and star formation rate. We describe the Southern HII Region Discovery Survey (SHRDS), an Australia Telescope Compact Array (ATCA) survey that discovered ~80 new HII regions (so far) in the Galactic longitude range 230 degrees to 360 degrees. This project is an extension of the Green Bank Telescope HII Region Discovery Survey (GBT HRDS), Arecibo HRDS, and GBT Widefield Infrared Survey Explorer (WISE) HRDS, which together discovered ~800 new HII regions in the Galactic longitude range -20 degrees to 270 degrees. Similar to those surveys, candidate HII regions were chosen from 20 micron emission (from WISE) coincident with 10 micron (WISE) and 20 cm (SGPS) emission. By using the ATCA to detect radio continuum and radio recombination line emission from a subset of these candidates, we have added to the population of known Galactic HII regions.

  2. Are There Cultural Regions in Hungary?

    Directory of Open Access Journals (Sweden)

    PÉTER BENKŐ

    2011-01-01

    Full Text Available Drawing up cultural macro-regions in Hungary is hardly possible as not even two of the highly developed mezo-regions are contacting, not speaking about forming a bloc; they rather constitute a mosaic on the country map. Those on medium cultural level make up two groups, while, though the ones with a low standard are mostly found along the Danube as a single bloc, they are isolated by Pest county, statistically grouped in one region with them, with a genuine cultural level far exceeding the low cluster. Consequently, it is only justified to speak about cultural regions in the sense that, on the whole, Dunántúl is on a higher standard than the eastern half of the country.

  3. Sacral landscape and its influence on the tourism space development in the region (based on the example of Western Pomerania region NW Poland

    Directory of Open Access Journals (Sweden)

    Tomasz Duda

    2014-12-01

    Full Text Available Formed through the centuries, cultural landscape of the region includes not only the material realm in the form of numerous historical buildings, monuments and other evidences of local society’s development, but also significant immaterial realm, which manifests itself in the form of spiritual heritage, faith, tradition, customs and language. Interesting, often unique in terms of religious and historical point of view, religious buildings, as well as traditional pilgrimage routes and local shrines are now undeniable qualities, shaping the touristic space of the region. The study of the tourism movement and a detailed valuation analysis of sacred objects showed that the wide ranging cultural tourism (with the significant participation of religious tourism is a great alternative to still popular, although in many places it is already too saturated, leisure tourism. The historical values and a multitude of interesting, often unique objects with proper promotional activity may contribute to the tourist interest of places that often have been overlooked. The main aim of this article is to show the spatial diversity of the phenomenon of religious tourism and valuation of the landscape in terms of its usefulness as an area of cultural tourism in the region, so far perceived through the prism of seaside leisure tourism. Valuation of facilities and pilgrim routes by way of grading point while enhancing statistical information on tourism, led to create an image (a map of the spatial diversity of the religious tourism phenomenon and its juxtaposition with other forms of tourism in the region. Thanks to this type of observations, in the future it will be possible to create a model showing the possibilities of alternative forms of tourism (including religious and cultural tourism to formulate the touristic space. This, for example, will allow to eliminate the problems associated with the seasonality of coastal and leisure tourism, offering a new, often

  4. Nucleon form factors. Probing the chiral limit

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Physik-Dept.; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2006-10-15

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  5. Nucleon form factors. Probing the chiral limit

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2006-10-01

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  6. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  7. Contemporary forms of international movement of capital

    Directory of Open Access Journals (Sweden)

    Sanja Šovran

    2016-11-01

    Full Text Available International movement of capital is one of the most important forms of international economic cooperation and achievement of strategic goals of enterprises. It leads to international diversification of business activities, strengthening of competitive advantage, changes in economic structures, employment rates and economic stability of participating countries. The present research addresses the contemporary forms of international movement of capital, with an emphasis on the public-private partnerships and concessions. The creation of different forms of public-private partnerships (PPPs in Serbia gained in importance in the early ‘90s of the 20th century. PPP implies joint activities within the framework of which the public and private sector pool resources, especially financial capital and expertise in order to meet the public needs of local, regional or national significance for adequate resource allocation. This type of partnership between the public and private sector has become an effective way towards a more rational use of limited resources and development of business entities from different sectors. The partnership of the public and private sector is particularly important in the construction and maintenance of transportation and other infrastructure facilities. Concessions represent a special form of public-private partnerships.

  8. «Resource type» regions in the modern Russian economy

    Directory of Open Access Journals (Sweden)

    Levin Sergey, N.

    2015-06-01

    Full Text Available Despite the officially declared intention to form universal rules of the liberal type, development was based on the formation of a "hybrid" institutional environment in the "post-Soviet" transformation of the Russian economy. "Hybrid" institutional environment is characterized, firstly, with the prevalence of forms of interaction between authorities and business that are uncharacteristic for liberal market economy, and their "merging" with each other, secondly, with sustainable regional fragmentation. As a result regional institutional systems, based on different configurations of network linkages between business and authorities, appeared and embedded into unified «power vertical». «Resource type» regions occupy special position in the modern Russian economy. Their economies are based on the export-oriented industries as well as raw resources extracting and mining industries. We distinguish the following discrete structural alternatives of their development in a globalizing economy: "enclave dual economy" and integrated regional economy. The first option is institutionally reinforces the social and economic gap from developed countries. The second one provides diversification and development of regional and national economies. We use comparative characteristic of Kemerovo region and Krasnoyarsk region to carry out analysis of options of "resource type" regions development. We selected indicators and elaborated estimation algorithm to figure out the type of regional economic development.

  9. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia.

    Science.gov (United States)

    Gilaie-Dotan, Sharon

    2016-03-01

    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Nano-multiplication region avalanche photodiodes and arrays

    Science.gov (United States)

    Zheng, Xinyu (Inventor); Pain, Bedabrata (Inventor); Cunningham, Thomas J. (Inventor)

    2011-01-01

    An avalanche photodiode with a nano-scale reach-through structure comprising n-doped and p-doped regions, formed on a silicon island on an insulator, so that the avalanche photodiode may be electrically isolated from other circuitry on other silicon islands on the same silicon chip as the avalanche photodiode. For some embodiments, multiplied holes generated by an avalanche reduces the electric field in the depletion region of the n-doped and p-doped regions to bring about self-quenching of the avalanche photodiode. Other embodiments are described and claimed.

  11. PROSPECTS OF REGIONAL NETWORK STRUCTURES IN THE SOUTHERN FEDERAL DISTRICT

    Directory of Open Access Journals (Sweden)

    I. V. Morozov

    2014-01-01

    Full Text Available The article reveals the possibility of the Southern Federal District to form regional network structures. The prospects for the formation of networks in the region in relation to the Olympic Winter Games Sochi 2014.

  12. Comprehensive review on additives of topical dosage forms for drug delivery.

    Science.gov (United States)

    Garg, Tarun; Rath, Goutam; Goyal, Amit K

    2015-12-01

    Skin is the largest organ of the human body and plays the most important role in protecting against pathogen and foreign matter. Three important modes such as topical, regional and transdermal are widely used for delivery of various dosage forms. Among these modes, the topical dosage forms are preferred because it provides local therapeutic activity when applied to the skin or mucous membranes. Additives or pharmaceutical excipients (non-drug component of dosage form) are used as inactive ingredients in dosage form or tools for structuring dosage forms. The main use of topical dosage form additives are controling the extent of absorption, maintaining the viscosity, improving the stability as well as organoleptic property and increasing the bulk of the formulation. The overall goal of this article is to provide the clinician with information related to the topical dosage form additives and their current major applications against various diseases.

  13. Regional cooperation prospects in Korea

    International Nuclear Information System (INIS)

    Yoon, Wan Ki

    2006-01-01

    The Republic of Korea follows a well-established nuclear nonproliferation policy and could consider regional cooperation as proposed by many nuclear experts over the years. Real problems exist in establishing cooperation, but as the nuclear industry continues to grow, the motivation increases. The US should be a partner in the regional cooperation also. This paper summarizes significant advances made by the NNCA in applying remote monitoring technologies to support international safeguards in the ROK, providing the technical foundation for the use of these technologies for transparency between partner countries. Concrete steps are proposed to form an institutional and then a governmental approach for transparency in the use of nuclear material and even, eventual establishment of a regional safeguards inspection regime. (author)

  14. Security assurances and regional stability

    International Nuclear Information System (INIS)

    Sanders, B.

    1995-01-01

    This paper discusses whether and how security assurances affect political stability in geographic regions. Before embarking on what is necessarily a limited analysis of a complex subject, I point out that the subject is by no means new. For centuries, vast areas of the world have been affected by forces used against them by more powerful States, which at one time or another incorporated large parts of them into overseas colonies or contiguous empires. The new factors are the emancipation of those areas into independent regions, made up of States that play their own parts in international affairs, and the possession by a handful of Powers, outside or on the edge of those regions, of a specific form of superior force: nuclear weapons. (author)

  15. Origin of spinel lamella and/or inclusions in olivine of harzburgite form the Pauza ultramafic rocks from the Kurdistan region, northeastern Iraq

    Science.gov (United States)

    Mohammad, Y.; Maekawa, H.; Karim, K.

    2009-04-01

    Exsolution lamellae and octahedral inclusions of chromian spinel occur in olivine of harzburgite of the Pauza ultramafic rocks, Kurdistan region, northeastern Iraq. The lamella is up to 80μm long and up to 50 μm wide. The lamellae and octahedral inclusions of chromian spinel are distributed heterogeneously in the host olivine crystal. They are depleted in Al2O3 relative to the subhedral spinel grains in the matrix and spinel lamella in orthopyroxene. Olivine (Fo92 - 93) with spinel lamellae occurs as fine-grained crystals around orthopyroxene, whereas olivine (Fo90-91) free from spinel is found in matrix. Based on back-scattered images analyses, enrichments of both Cr # and Fe+3 in the chromian spinel lamella in olivine (replacive olivine) relative to that in adjacent orthopyroxene. As well as the compositions of chromian spinel lamellae host olivine are more Mg-rich than the matrix olivine. Furthermore the restriction of olivine with spinel lamellae and octahedral inclusions on around orthopyroxene, and the similarity of spinel lamella orientations in both olivine and adjacent orthopyroxene. This study concludes that the spinel inclusions in olivine are remnant (inherited from former orthopyroxene) spinel exsolution lamella in orthopyroxene, that has been formed in upper mantle conditions ( T = 1200 °C, P = 2.5 GPa ). Replacive olivine are formed by reaction of ascending silica poor melt and orthopyroxene in harzburgite as pressure decrease the solubility of silica-rich phase (orthopyroxene) in the system increase, therefore ascending melt dissolve pyroxene with spinel exsolution lamella and precipitate replacive olivine with spinel inclusions. We can conclude that the olivines with spinel lamella are not necessary to be original and presenting ultrahigh-pressure and/or ultra deep-mantle conditions as previously concluded. It has been formed by melting of orthopyroxene (orthopyroxene with spinel exsolution lamella = olivine with spinel lamellae and octahedral

  16. IMAGE - REPUTATION - BRAND: STRATEGY OF FORMING OF VALUE OF THE POWER

    Directory of Open Access Journals (Sweden)

    Н Н Розанова

    2017-12-01

    Full Text Available Article is devoted to consideration of process of forming of valuable symbolical space of the Russian power in the context of forming of the new model of development of society determined as one of the priority directions of the Concept of long-term social and economic development of the Russian Federation for the period till 2020. This vector of development of the relations of the state and society is determined by the author as strategy of forming of the valuable relation to the power - the purposeful, system, jointly performed activities of the power and society for creation of valuable space of the Russian power through transformation and consecutive transition each other of the following symbolical categories of the power: “identity” - “image” - “reputation” - “brand”. Content of the specified categories is opened, interpretation of measurements of the valuable field of a brand of the power on the basis of model of a four-dimensional brand of T. Ged is offered. The special attention is paid to process of forming of reputation of the power as to a subject of independent author research, on the example of studying of reputation of the regional power of the Smolensk region.

  17. THE FRAGMENTATION OF MAGNETIZED, MASSIVE STAR-FORMING CORES WITH RADIATIVE FEEDBACK

    Energy Technology Data Exchange (ETDEWEB)

    Myers, Andrew T.; McKee, Christopher F. [Department of Physics, University of California, Berkeley, Berkeley, CA 94720 (United States); Cunningham, Andrew J. [Lawrence Livermore National Laboratory, P.O. Box 808, L-23, Livermore, CA 94550 (United States); Klein, Richard I. [Department of Astronomy, University of California, Berkeley, Berkeley, CA 94720 (United States); Krumholz, Mark R., E-mail: atmyers@berkeley.edu [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States)

    2013-04-01

    We present a set of three-dimensional, radiation-magnetohydrodynamic calculations of the gravitational collapse of massive (300 M{sub Sun }), star-forming molecular cloud cores. We show that the combined effects of magnetic fields and radiative feedback strongly suppress core fragmentation, leading to the production of single-star systems rather than small clusters. We find that the two processes are efficient at suppressing fragmentation in different regimes, with the feedback most effective in the dense, central region and the magnetic field most effective in more diffuse, outer regions. Thus, the combination of the two is much more effective at suppressing fragmentation than either one considered in isolation. Our work suggests that typical massive cores, which have mass-to-flux ratios of about 2 relative to critical, likely form a single-star system, but that cores with weaker fields may form a small star cluster. This result helps us understand why the observed relationship between the core mass function and the stellar initial mass function holds even for {approx}100 M{sub Sun} cores with many thermal Jeans masses of material. We also demonstrate that a {approx}40 AU Keplerian disk is able to form in our simulations, despite the braking effect caused by the strong magnetic field.

  18. IMPORTANCE OF REGIONAL DEVELOPMENT PROGRAMS FOR THE ECONOMIC GROWTH OF RURAL AREAS

    Directory of Open Access Journals (Sweden)

    Dorosh A.

    2017-05-01

    Full Text Available Article determine the essence of the definition of "region", defined types of regions. In general, we can distinguish four types of regions, formed to implement the tasks under different direction: a homogeneous regions (formed on the basis of common characteristics – mountain region, economically developed / underdeveloped region and so on.. b functional regions (formed by determining the basic type of economic activity – touristic region, agricultural region, etc.. c administrative regions (formed by pre-defined criteria for performing administrative functions in a particular area – district, local council, etc.. d personal perception regions (based on personal values – Homeland and so on.. The focus of this publication focuses on the study of rural regions. As a result of studies is found that the population of Ukraine decreased by about 7 million Inhabitants. In 1993 there was 52.2 million of people, and in 2016 dropped to 42.7 million (temporary occupied territories excluded. Determined that the most influential factors are the degradation of rural region’s economic and demographic crisis (can be both a cause and consequence of each other. In this regard, the worsening of demographic situation is the biggest problem, because without human resources economic growth can’t be achieved. For more profound understanding of the problem we used the spiral of negative developed of communities/regions proposed by Austrian scientists G. Weber and T. Fisher. It indicates the relationship between adverse events and their sequence. This choice is not accidental, because the spiral indicates that this is a progressive movement that eventually accelerated and the difficulty of stopping the negative processes increases not arithmetically but geometrically. Therefore, developing regional programs of rural development moderators (selected and trained specialists who work in the region cooperate with the heads of communities and local residents

  19. The structure environment, rock-magma system, mineral-forming series and pattern of volcanic mineral-forming of uranium deposit in southeast of China

    International Nuclear Information System (INIS)

    Yu Dagan

    1992-01-01

    The Volcanic uranium deposit of rock-magma belt-the Mid-Cz Volcano in the Southeast of China mainly formed around 120 ∼ 130 Ma and 90 ∼ 100 Ma Which is in harmony with the two rock magma activities of k within the region. The rock-magma system of this period formed around the turning period from pressure to tension in the continent margin of southeast China, which is mainly characterized by the appearance of A-type granite and alkaline, sub-alkaline rocks (trachyte, trachyandensite, trachybasalt, basic rock alkaline basalt). The uranium deposit is controlled by the base rift of dissection to the mantle, the volcanic basin is of the double characteristics of transversal rift valley basin (early period) ad tension rift valley basin (laster period). The leading role of the deep source is stressed in terms of internal-forming series of volcanic uranium deposits is considered to exist; and also in terms of internal-forming series of volcanic uranium deposits is considered to exist; and also in terms of mineral-forming patterns, the multi-pattern led by the deep-source is stressed, including the mineral-forming pattern of uranium deposit of continental thermos, repeated periphery mineral-forming pattern of uranium deposit and the mineral-forming pattern of uranium deposit of rising pole-like thermos. Ten suggestions are put forward to the next mineral-search according to the above thoughts

  20. THE COMPLEX NORTH TRANSITION REGION OF CENTAURUS A: RADIO STRUCTURE

    Energy Technology Data Exchange (ETDEWEB)

    Neff, Susan G. [NASA' s Goddard Space Flight Center, Laboratory for Observational Cosmology, Mail Code 665, Greenbelt, MD 20771 (United States); Eilek, Jean A. [Physics Department, New Mexico Tech, Socorro, NM 87801 (United States); Owen, Frazer N., E-mail: susan.g.neff@nasa.gov [National Radio Astronomy Observatory, P.O. Box O,  Socorro, NM 87801 (United States)

    2015-04-01

    We present deep radio images of the inner ∼50 kpc of Centaurus A, taken with the Karl G. Jansky Very Large Array at 90 cm. We focus on the Transition Regions between the inner galaxy—including the active nucleus, inner radio lobes, and star-forming disk—and the outer radio lobes. We detect previously unknown extended emission around the Inner Lobes, including radio emission from the star-forming disk. We find that the radio-loud part of the North Transition Region (NTR), known as the North Middle Lobe, is significantly overpressured relative to the surrounding interstellar medium. We see no evidence for a collimated flow from the active galactic nucleus through this region. Our images show that the structure identified by Morganti et al. as a possible large-scale jet appears to be part of a narrow ridge of emission within the broader, diffuse, radio-loud region. This knotty radio ridge is coincident with other striking phenomena: compact X-ray knots, ionized gas filaments, and streams of young stars. Several short-lived phenomena in the NTR, as well as the frequent re-energization required by the Outer Lobes, suggest that energy must be flowing through both Transition Regions at the present epoch. We suggest that the energy flow is in the form of a galactic wind.

  1. Predicting glass-forming compositions in the Al-La and Al-La-Ni systems

    International Nuclear Information System (INIS)

    Gargarella, P.; de Oliveira, M.F.; Kiminami, C.S.; Pauly, S.; Kuehn, U.; Bolfarini, C.; Botta, W.J.; Eckert, J.

    2011-01-01

    Research highlights: → The glass-forming ability of the Al-La and Al-La-Ni systems was studied using the λ* and the λ.Δe criteria. → Both criteria predicted with just 1% at. of error the best glass-former verified so far in the Al-La system. → Four new glass-former compositions could be predicted in the Al-La-Ni system using the λ.Δe criterion. → The best glass-former reported so far in the Al-La-Ni system was found. - Abstract: In this work, a criterion considering the topological instability (λ) and the differences in the electronegativity of the constituent elements (Δe) was applied to the Al-La and Al-Ni-La systems in order to predict the best glass-forming compositions. The results were compared with literature data and with our own experimental data for the Al-La-Ni system. The alloy described in the literature as the best glass former in the Al-La system is located near the point with local maximum for the λ.Δe criterion. A good agreement was found between the predictions of the λ.Δe criterion and literature data in the Al-La-Ni system, with the region of the best glass-forming ability (GFA) and largest supercooled liquid region (ΔT x ) coinciding with the best compositional region for amorphization indicated by the λ.Δe criterion. Four new glassy compositions were found in the Al-La-Ni system, with the best predicted composition presenting the best glass-forming ability observed so far for this system. Although the λ.Δe criterion needs further refinements for completely describe the glass-forming ability in the Al-La and Al-La-Ni systems, the results demonstrated that this criterion is a good tool to predict new glass-forming compositions.

  2. Midwest regional management plan

    International Nuclear Information System (INIS)

    Paton, R.F.

    1986-01-01

    In response to the Low-Level Radioactive Waste Policy Act of 1980, the States of Indiana, Iowa, Michigan, Minnesota, Missouri, Ohio and Wisconsin formed the Midwest Interstate Low-Level Radioactive Waste Compact. One of the top priorities of the Compact Commission is the development of a comprehensive regional waste management plan. The plan consists of five major elements: (1) waste inventory; (2) waste stream projections; (3) analysis of waste management and disposal options; (4) development of a regional waste management system; and (5) selection of a host state(s) for future low-level waste facilities. When completed, the Midwest Management Plan will serve as the framework for future low-level radioactive waste management and disposal decisions

  3. Aspects of the ecology of mat-forming lichens

    Directory of Open Access Journals (Sweden)

    P. D. Crittenden

    2000-03-01

    Full Text Available Lichen species in the genera Cladonia (subgenus Cladina, Cetraria, Stereocaulon and Alectoria are important vegetation components on well-drained terrain and on elevated micro-sites in peatlands in boreal-Arctic regions. These lichens often form closed mats, the component thalli in which grow vertically upwards at the apices and die off in the older basal regions; they are therefore only loosely attached to the underlying soil. This growth habit is relatively unusual in lichens being found in <0.5% of known species. It might facilitate internal nutrienr recycling and higher growth rates and, together with the production of allelochemicals, it might underlie the considerable ecological success of mat-forming lichens; experiments to critically assess the importance of these processes are required. Mat-forming lichens can constitute in excess of 60% of the winter food intake of caribou and reindeer. Accordingly there is a pressing need for data on lichen growth rates, measured as mass increment, in order to help determine the carrying capacity of winter ranges for rhese herbivores and to better predict recovery rates following grazing. Trampling during the snow-free season fragments lichen thalli; mat-forming lichens regenerate very successfully from thallus fragments provided trampling does nor re-occur. Frequent recurrence of trampling creates disturbed habitats from which lichens will rapidly become eliminated consistent with J.P. Grime's CSR strategy theory. Such damage to lichen ground cover has occurred where reindeer or caribou are unable to migrate away from their winter range such as on small islands or where political boundaries have been fenced; it can also occur on summer range that contains a significant lichen component and on winter range where numbers of migrarory animals become excessive. Species of Stereocaulon, and other genera that contain cyanobacteria (most notably Peltigera and Nephroma, are among the principal agents of

  4. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei

    2016-03-01

    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  5. Model-based automatic generation of grasping regions

    Science.gov (United States)

    Bloss, David A.

    1993-01-01

    The problem of automatically generating stable regions for a robotic end effector on a target object, given a model of the end effector and the object is discussed. In order to generate grasping regions, an initial valid grasp transformation from the end effector to the object is obtained based on form closure requirements, and appropriate rotational and translational symmetries are associated with that transformation in order to construct a valid, continuous grasping region. The main result of this algorithm is a list of specific, valid grasp transformations of the end effector to the target object, and the appropriate combinations of translational and rotational symmetries associated with each specific transformation in order to produce a continuous grasp region.

  6. Social Facilitation: the Kaliningrad Region and Russian Mainland Regions

    Directory of Open Access Journals (Sweden)

    Toropov Pavel

    2015-03-01

    Full Text Available The authors look at the concept of social facilitation as a possible component of Russian social consolidation in the course of social reforms. The article focuses on the results of an empirical study of the levels and characteristics of competence in social facilitation, which is here understood as the ability to apply certain knowledge and systems of skills and as a success rate of actions based on experience in improving the conditions of social development. The study was conducted in the Kaliningrad region in 2012—2013. The data was obtained through a survey of 400 respondents using the authors’ methodology encompassing eight basic elements of competence and a structured interview aimed at a better understanding of the subject of the study and attitudes towards it. The data is compared against the results of a similar study in two regions of central Russia with similar conditions. The results suggest a disharmonic and inconsistent structure of competence in social facilitation, low motivation for social activity in youth, and a narrow range of ideas about possible areas of personal activities in the current conditions. Gender differences are identified in the level and structure of competence. The authors believe that certain differences in competence components identified through mathematical methods are determined by the geographical characteristics of the Kaliningrad region — its exclave nature, a relatively small territory, and proximity to the EU countries. It is stressed that the regional conditions affecting motivation, forms and areas of activities, and structure of experience should be taken into account in selecting means and methods of organising youth activities. They can also serve as a basis for the regional youth policy.

  7. REGIONAL CLIMATE MODELING STUDY FOR THE CARPATHIAN REGION USING REGCM4 EXPERIMENTS

    Directory of Open Access Journals (Sweden)

    PIECZKA I.

    2015-03-01

    Full Text Available The newest model version of RegCM is adapted with the ultimate aim of providing climate projection for the Carpathian region with 10 km horizontal resolution. For this purpose, first, coarse resolution reanalysis data and global climate model outputs are used to drive 50 km resolution model experiments, from which the outputs are used to provide necessary boundary conditions for the fine scale model runs. Besides the historical runs (for the period 1981-2010, RCP4.5 scenario is also analyzed in this paper for the 21st century. These experiments are essential since they form the basis of national climate and adaptation strategies by providing detailed regional scale climatic projections and enabling specific impact studies for various sectors.

  8. Form factors and radiation widths of the giant multipole resonances

    International Nuclear Information System (INIS)

    Denisov, V.Yu.

    1990-01-01

    Simple analytic relations for the form factors of inelastic electron scattering in the Born approximation and radiation widths of the isovector and isoscalar giant multipole resonances are derived. The dynamic relationship between the volume and surface density vibrations were taken into account in this calculation. The form factors in the Born approximation were found to be in satisfactory agreement with experimental data in the region of small transferred momenta. The radiation widths of isoscalar multipole resonances increase when the number of nucleons increase as A 1/3 , and for isovector resonances this dependence has the form f(A)A 1/3 , where f(A) is a slowly increasing function of A. Radiation widths well fit the experimental data

  9. Nucleon form factors, generalized parton distributions and quark angular momentum

    International Nuclear Information System (INIS)

    Diehl, Markus; Kroll, Peter; Regensburg Univ.

    2013-02-01

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale μ=2 GeV to be J u v =0.230 +0.009 -0.024 and J d v =-0.004 +0.010 -0.016 .

  10. Using mixture experiments to develop cementitious waste forms

    International Nuclear Information System (INIS)

    Spence, R.D.; Anderson, C.M.; Piepel, G.F.

    1993-01-01

    Mixture experiments are presented as a means to develop cementitious waste forms. The steps of a mixture experiment are (1) identifying the waste form ingredients; (2) determining the compositional constraints of these ingredients; (3) determining the extreme vertices, edge midpoints, and face centroids of the constrained multidimensional volume (these points along with some interior points represent the set of possible compositions for testing); (4) picking a subset of these points for the experimental design; (5) measuring the properties of the selected subset; and (6) generating the response surface models. The models provide a means for predicting the properties within the constrained region. This article presents an example of this process for one property: unconfined compressive strength

  11. Birth and development of active region and chromospheric network

    Energy Technology Data Exchange (ETDEWEB)

    Kartashova, L G

    1975-01-01

    Formation and development of 15 active regions of a simple bipolar configuration with small-sized spots and without noticeable penumbras have been studied by the data of observations with a coronograph CA n the centre and wings of the Hsub(a) line. Resolution on the photographs is 2''. The following conclusions have been drawn: first bright details of the active region formed are generated through brightening of bright points of the chromosphere grid; intensification and stretching of dark points of the chromosphere grid results in the formation of fibrous structure in the vicinity of active region; spots appear either between the flocculi points, or near them closer to the centre of the corresponding cell of the chromosphere grid, among dark points of the chromosphere grid no spots are usually formed; in the process of growing of a simple bipolar group the leader and tail spots draw apart together with the chromosphere grid cells, in which they are formed; at the stage of fast growth in the neighbourhood of most large of the groups under studies a formation of arcs or of almost closed contours of the chromosphere grid is observed in the wings of the line. This rearrangement of the chromosphere grid is apparently closely connected with the formation of a fibrous structure around the active region.

  12. Modeling of hydrogen storage in hydride-forming materials : statistical thermodynamics

    NARCIS (Netherlands)

    Ledovskikh, A.; Danilov, D.; Rey, W.J.J.; Notten, P.H.L.

    2006-01-01

    A new lattice gas model has been developed, describing the hydrogen storage in hydride-forming materials. This model is based on the mean-field theory and Bragg-Williams approximation. To describe first-order phase transitions and two-phase coexistence regions, a binary alloy approach has been

  13. Effects of the d-state quarks on the nucleon electric form factors

    International Nuclear Information System (INIS)

    Oh, Y.J.; Kong, K.J.; Cheon, I.T.

    1987-11-01

    Considering the d-orbital excitation of a quark in the bag, we calculate the nucleon electric form factors in the cloudy bag model. In these calculations, we have taken into account the πNN, πΔN and πγ form factors though neglecting the c.m. correction. It turns out that the neutron charge form factor is very sensitive to the d-state quark admixture in the overall region of the momentum transfer but the proton charge form factor remains unchanged. Taking the d-state quark admixture in the intermediate state baryons, we can obtain the nucleon rms radii in remarkable agreement with the experimental values. We also investigate the roles of Δ particles in the nucleon charge form factors. (author). 20 refs, 10 figs

  14. Metal Compression Forming of aluminum alloys and metal matrix composites

    Energy Technology Data Exchange (ETDEWEB)

    Viswanathan, S.; Ren, W.; Porter, W.D.; Brinkman, C.R.; Sabau, A.S.; Purgert, R.M.

    2000-02-01

    Metal Compression Forming (MCF) is a variant of the squeeze casting process, in which molten metal is allowed to solidify under pressure in order to close porosity and form a sound part. However, the MCF process applies pressure on the entire mold face, thereby directing pressure on all regions of the casting and producing a uniformly sound part. The process is capable of producing parts with properties close to those of forgings, while retaining the near net shape, complexity in geometry, and relatively low cost of the casting process.

  15. Constraints on the ωπ Form Factor from Analyticity and Unitarity

    Science.gov (United States)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discre-pancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ*. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0:6 GeV, including those from NA60 published in 2016.

  16. Regional variability among nonlinear chlorophyll-phosphorus relationships in lakes

    Science.gov (United States)

    Filstrup, Christopher T.; Wagner, Tyler; Soranno, Patricia A.; Stanley, Emily H.; Stow, Craig A.; Webster, Katherine E.; Downing, John A.

    2014-01-01

    The relationship between chlorophyll a (Chl a) and total phosphorus (TP) is a fundamental relationship in lakes that reflects multiple aspects of ecosystem function and is also used in the regulation and management of inland waters. The exact form of this relationship has substantial implications on its meaning and its use. We assembled a spatially extensive data set to examine whether nonlinear models are a better fit for Chl a—TP relationships than traditional log-linear models, whether there were regional differences in the form of the relationships, and, if so, which regional factors were related to these differences. We analyzed a data set from 2105 temperate lakes across 35 ecoregions by fitting and comparing two different nonlinear models and one log-linear model. The two nonlinear models fit the data better than the log-linear model. In addition, the parameters for the best-fitting model varied among regions: the maximum and lower Chl aasymptotes were positively and negatively related to percent regional pasture land use, respectively, and the rate at which chlorophyll increased with TP was negatively related to percent regional wetland cover. Lakes in regions with more pasture fields had higher maximum chlorophyll concentrations at high TP concentrations but lower minimum chlorophyll concentrations at low TP concentrations. Lakes in regions with less wetland cover showed a steeper Chl a—TP relationship than wetland-rich regions. Interpretation of Chl a—TP relationships depends on regional differences, and theory and management based on a monolithic relationship may be inaccurate.

  17. Urban Form and Extreme Heat Events: Are Sprawling Cities More Vulnerable to Climate Change Than Compact Cities?

    Science.gov (United States)

    Stone, Brian; Hess, Jeremy J.; Frumkin, Howard

    2010-01-01

    Background Extreme heat events (EHEs) are increasing in frequency in large U.S. cities and are responsible for a greater annual number of climate-related fatalities, on average, than any other form of extreme weather. In addition, low-density, sprawling patterns of urban development have been associated with enhanced surface temperatures in urbanized areas. Objectives In this study. we examined the association between urban form at the level of the metropolitan region and the frequency of EHEs over a five-decade period. Methods We employed a widely published sprawl index to measure the association between urban form in 2000 and the mean annual rate of change in EHEs between 1956 and 2005. Results We found that the rate of increase in the annual number of EHEs between 1956 and 2005 in the most sprawling metropolitan regions was more than double the rate of increase observed in the most compact metropolitan regions. Conclusions The design and management of land use in metropolitan regions may offer an important tool for adapting to the heat-related health effects associated with ongoing climate change. PMID:21114000

  18. Constraints on the Kl3 form factors from analyticity and unitarity

    Indian Academy of Sciences (India)

    2012-10-05

    in. Abstract. The Kπ form factors are investigated at low energies by the method of unitarity bounds adapted so as to include information on the phase and modulus along the elastic region of the unitarity cut. Using as input the ...

  19. Detection of the water reservoir in a forming planetary system

    NARCIS (Netherlands)

    Hogerheijde, M.R.; Bergin, E.A.; Brinch, C.; Cleeves, L.I.; Fogel, J. K.J.; Blake, G.A.; Dominik, C.; Lis, D.C.; Melnick, G.; Neufeld, D.; Panić, O.; Pearson, J.C.; Kristensen, L.; Yıldız, U.A.; van Dishoeck, E.F.

    2011-01-01

    Icy bodies may have delivered the oceans to the early Earth, yet little is known about water in the ice-dominated regions of extrasolar planet-forming disks. The Heterodyne Instrument for the Far-Infrared on board the Herschel Space Observatory has detected emission lines from both spin isomers of

  20. New forms of public-private partnership for sustainable development of the fuel and energy sector

    Science.gov (United States)

    Pakhomova, E. O.; Goosen, E. V.; Nikitenko, S. M.

    2017-09-01

    Public-private partnership (PPP) as a form of interaction between the public and private sectors contributes to the improvement of social and economic situation in the country. PPP is viewed in a broad context and is presented as a system of financial and non-financial relations between government and business. A number of legislative initiatives contributed to the emergence of a new form of PPP that is a special investment contract (SPIC). In the Russian regions there are legislative initiatives that provide differences in terms of contracting. In a number of regions a federal-specific volume of mandatory investment has been reduced to attract investors, while there are regions where this volume is higher than at the federal level. Monitoring of regional legislation showed that the authorities of the constituent entities of the Russian Federation are striving to obtain guarantee obligations to create jobs and receive salaries above the average in the region. Measures to encourage investors have been determined, and the benefits to the government and business from the implementation of a SPIC have been shown.

  1. EMERGING TRENDS IN TOURISM: NEED FOR ALTERNATIVE FORMS IN MACEDONIAN TOURISM

    Directory of Open Access Journals (Sweden)

    Nikola Cuculeski

    2015-11-01

    Full Text Available The purpose of this paper is to research the development of tourism, taking into consideration the growing competition and new consumer intentions. The aim of this research is to analyze the alternative forms of tourism as a crucial factor for long term sustainability. As a basic research method used is an interview with tourist providers in Macedonia (travel agencies – DMC companies and tourist guides, regarding their experience for alternative tourism forms. Results are showing growing trend of alternative forms of tourism considering different tourist nationalities. These results are valuable for further scientific research in consumer analyzes, and presents an input for the national tourism in this region.

  2. Selective laser pyrolysis of metallo-organics as a method of forming patterned thin film superconductors

    International Nuclear Information System (INIS)

    Mantese, J.V.; Catalan, A.B.; Sell, J.A.; Meyer, M.S.; Mance, A.M.

    1990-01-01

    This patent describes a method for forming patterned films of superconductive materials forming a solution from the neodecanoates of yttrium, barium and copper. The neodecanoates forming an oxide mixture exhibiting superconductive properties upon subsequent thermal decompositions wherein the oxide mixture is characterized by a ratio of yttrium:barium:copper of approximately 1:2:4, the solution comprising an organic solvent such as xylene; adding to the solution an appropriate dye, depositing a film of the solution having the dye onto a strontium titanate substrate; exposing selective regions of the film with an Argon laser emitting the wavelength of light, such that the exposed regions of the film become insoluble in the xylene; immersing the film into the xylene so that the soluble; unexposed regions of the film are removed from the substrate; heating the film to thermally decompose the neodecanoates into a film containing yttrium, barium and copper oxides; to promote recrystallization and grain growth of the metal oxides within the film and induce a change therein by which the film exhibits superconducting properties

  3. Nucleon form factors, generalized parton distributions and quark angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Kroll, Peter [Bergische Univ., Wuppertal (Germany). Fachbereich Physik; Regensburg Univ. (Germany). Institut fuer Theoretische Physik

    2013-02-15

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale {mu}=2 GeV to be J{sup u}{sub v}=0.230{sup +0.009}{sub -0.024} and J{sup d}{sub v}=-0.004{sup +0.010}{sub -0.016}.

  4. Atypical form of cat scratch disease in immunocompetent patient

    Directory of Open Access Journals (Sweden)

    Kojić Miroslav

    2013-01-01

    Full Text Available Introduction. Cat scratch disease (CSD is an acute infectious disease with benign course caused by the bacteria Bartonella henselae. Clinically, it is usually manifested as regional lymphadenopathy and mild infective syndrome. Rare forms of the disease which usually occur in immunocompromised presons are: encephalitis, transverse myelitis, neuroretinitis, granulomatosus conjunctivitis, arthritis, hepatitis etc. Case report. We presented an atypical form of cat scratch disease in a young immunocompetent female person. The disease was manifested with prolonged fever, rash, purulent lymphadenitis and hepatitis. The diagnosis was based on characteristic patohystological finding and exclusion of the other causes of lymphadenopathy. The patient was treated by antibiotics for a few weeks, with surgical incision and drainage of the purulent lymphadenitis. Conclusion. Atypical forms of CSD could be an important differential-diagnostic problem, especially if there is no opportunity for serological confirmation of the disease.

  5. Indocyanine Green Angiographic and Multifocal Electroretinographic Features in the Diffuse and Regional Form of Bietti′s Crystalline Retinopathy

    Institute of Scientific and Technical Information of China (English)

    Libin Jiang; Feng Wen; Lezheng Wu; Hong Yan; Shixing Hu

    2002-01-01

    Prpose: To observe different features of indocyanine green angiography(ICGA) andtifocal electroretinography (ERG) in the diffuse and regional type of Bieti′sc stalline retinopathy (BCR). Thods: ICGA and the multifocal ERG were performed in two cases of the diffuse andregional type of BCR respectively. These data were compared with fluoresceinangiography (FA), standard Ganzfeld ERG, and visual field testing. Results: In the regional case, ICGA revealed reduced perfusion of the choroidalcirculation in the early phase and multiple hypofluorescent spots in the posterior pole in the late phase, due to choriocapillaris filling defect; the extent of choroiocapillaris losswas shown in early phase of ICGA and there were multifocal hyperfluorescent dotssurrounding hypofluorescent spots in late phase in the diffuse case. The multifocal ERGshowed that the central responses were markedly depressed, corresponding to the visualfield defects, while the findings of Ganzfeld ERG were normal in the regional BCR;however, both the multifocal ERG and Ganzfeld ERG were severely subnormal in thediffuse case.Conclusions: The features of ICGA and multifocal ERG are different between the diffuseand regional BCR. In the meantime, the two tools are also useful to differentiate the typeand assess the extentof evolution in BCR.

  6. The Cygnus region of the galaxy: A VERITAS perspective

    Directory of Open Access Journals (Sweden)

    Weinstein A.

    2015-01-01

    Full Text Available The Cygnus-X star-forming region (“Cygnus” is the richest star-forming region within 2 kpc of Earth and is home to a wealth of potential cosmic ray accelerators, including supernova remnants, massive star clusters, and pulsar wind nebulae. Over the past five years, discoveries by several gamma-ray observatories sensitive in different energy bands, including the identification by Fermi-LAT of a potential cocoon of freshly accelerated cosmic rays, have pinpointed this region as a unique laboratory for studying the early phases of the cosmic ray life cycle. From 2007 to 2009 VERITAS, a very high energy (VHE; E > 100 GeV observatory in southern Arizona, undertook an extensive survey of the Cygnus region from 67 to 82 degrees Galactic longitude and from −1 to 4 degrees in Galactic latitude. In the years since, VERITAS has continued to accumulate data at specific locations within the survey region. We will review the discoveries and insights that this rich dataset has already provided. We will also consider the key role that we expect these data to play in interpreting the complex multiwavelength picture we have of the Cygnus region, particularly in the vicinity of the Cygnus cocoon. As part of this discussion we will summarize ongoing studies of VERITAS data in the Cygnus region, including the development of new data analysis techniques that dramatically increase VERITAS' sensitivity to sources on scales larger than a square degree.

  7. Cathodic reduction of the duplex oxide films formed on copper in air with high relative humidity at 60 deg C

    International Nuclear Information System (INIS)

    Seo, M.; Ishikawa, Y.; Kodaira, M.; Sugimoto, A.; Nakayama, S.; Watanabe, M.; Furuya, S.; Minamitani, R.; Miyata, Y.; Nishikata, A.; Notoya, T.

    2005-01-01

    The cathodic reduction of duplex air-formed oxide film on copper was performed at a constant current density of i c = -50 μA cm -2 in deaerated 0.1 M KCl solution to investigate the sequence of cathodic reduction of each oxide layer and its mechanism. The single-phase thick CuO film on copper was also cathodically reduced at i c = -50 μA cm -2 or -2.5 mA cm -2 . The surface characterizations of the air-formed oxide film and single-phase CuO film before cathodic reduction and after partial or complete cathodic reduction were performed by XPS and X-ray diffraction, respectively. The two plateau regions appeared in the potential vs. time curve during cathodic reduction of the duplex air-formed oxide film on copper, while one plateau region was observed in the potential-time curve during cathodic reduction of the single-phase CuO film on copper. The potential in the first plateau region for the air-formed film coincided with that in the plateau region for the CuO film. The results of XPS and X-ray diffraction suggested that in the first plateau region, the outer CuO layer is directly reduced to metallic Cu, while in the second plateau region, the inner Cu 2 O layer is reduced to metallic Cu

  8. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    Energy Technology Data Exchange (ETDEWEB)

    Belushkin, M.

    2007-09-29

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the {pi}{pi}, K anti K and the {rho}{pi} continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  9. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Belushkin, M.

    2007-01-01

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the ππ, K anti K and the ρπ continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  10. Epidemiological characteristics of diabetes mellitus and its complications in the Omsk region

    Directory of Open Access Journals (Sweden)

    Marina Lukmanovna Sayfullina

    2010-06-01

    Full Text Available Aim. To evaluate epidemiological situation with respect to diabetes morbidity in the Omsk region during 2002-2008. Materials and methods. This prospective cohort study used official statistical reporting forms № 12. A total of 1398 Acts of medical and social assessment,Statistical cards (form № 25, Minute books of medico-social examination commissions, and Collected information-statistical materials ondisability situation in the Omsk region were available for analysis. Results. A stable trend toward reduction of unfavourable outcomes of diabetes mellitus (DM (complications, physical disability and mortality hasbeen documented despite overall enhancement of DM morbidity in the region. Conclusion. The study revealed improved rehabilitation records among disabled diabetics.

  11. A statistical method (cross-validation) for bone loss region detection after spaceflight

    Science.gov (United States)

    Zhao, Qian; Li, Wenjun; Li, Caixia; Chu, Philip W.; Kornak, John; Lang, Thomas F.

    2010-01-01

    Astronauts experience bone loss after the long spaceflight missions. Identifying specific regions that undergo the greatest losses (e.g. the proximal femur) could reveal information about the processes of bone loss in disuse and disease. Methods for detecting such regions, however, remains an open problem. This paper focuses on statistical methods to detect such regions. We perform statistical parametric mapping to get t-maps of changes in images, and propose a new cross-validation method to select an optimum suprathreshold for forming clusters of pixels. Once these candidate clusters are formed, we use permutation testing of longitudinal labels to derive significant changes. PMID:20632144

  12. Generation of truncated recombinant form of tumor necrosis factor ...

    African Journals Online (AJOL)

    Purpose: To produce truncated recombinant form of tumor necrosis factor receptor 1 (TNFR1), cysteine-rich domain 2 (CRD2) and CRD3 regions of the receptor were generated using pET28a and E. coli/BL21. Methods: DNA coding sequence of CRD2 and CRD3 was cloned into pET28a vector and the corresponding ...

  13. The structure and institutions: a regional aspect of interaction in the economic system

    Directory of Open Access Journals (Sweden)

    Leonid Stepanovich Tarasevich

    2014-09-01

    Full Text Available In the article with the help of two-sector model of the economic system, the interaction of national and regional economy is investigated. This interaction is observed from the position of development of material structure and institutions. As the key structural parameter of an economy, the proportion between sector of excess resources and sector of scarce resources is taken. The situation when sector of excess resources prevails over sector of scarce resources forms structural conditions for the creation of the market institutions. If a sector of excess resources is smaller than a sector of scarce resources, the conditions for the emergence of institutions of government regulation are formed. Two cases are analyzed: the first one concerns the situation of a simple national economy consisting of 2 provisory regions. The second is the case of the national economy consisting of many regions. The authors show that material structure of a total combination of regions defines institutions of the market or state regulation for the national economy as a whole. The institutions formed at the level of the national economy, can support or resist the development of structure of the region. The conditions are observed under which united institutions of the national economy contradict a development of structure of the individual region.

  14. Modern Integration Processes in the Asia-Pacific Region: the Formation of Trans-Regional Mega-Agreements

    Directory of Open Access Journals (Sweden)

    Maliuta Iryna A.

    2017-12-01

    Full Text Available In the 21st century, especially in the last decade, new intercontinental integration projects appear on the global stage with a high potential for influencing the regional economic structure and at the same time bearing certain challenges for the international geo-economic and geo-political map of the world. Comprehensive new-generation inter-regional agreements are being formed, such as the TTP, the TTIP, the RCEP, the Comprehensive Economic and Trade Agreement between Canada and the EU (CETA, the Japan-EU Economic Partnership. The Asia-Pacific region has been an active participant in the creation and promotion of mega-regional trade agreements. Mega-regional trade agreements in the Asia-Pacific region, namely the TTP and the RCEP, are analyzed as mega-projects with an unprecedented scale of liberalization within the framework of the agreement that include provisions complementing the WTO framework or extending beyond it. There identified reasons for the emergence of mega-regional trade agreements and prospects for the implementation of these projects, as well as possible consequences for the international economic system. It is established that new trans-regional projects, providing certain advantages to the participating countries, simultaneously carry both opportunities and challenges for the world economy. The latter are associated with the threats of crowding the countries that do not take an active part in the integration processes out of the global chains of value creation as well as of the processes of international trade.

  15. Regional Partnerships. At a Glance. Revised

    Science.gov (United States)

    Griffin, Tabatha; Curtin, Penelope

    2007-01-01

    Vocational education and training (VET) has a key role in facilitating regional economic development. One way that VET can do this is by forming partnerships with other organisations, such as other training providers, business/industry, schools and local government. This "At a Glance" publication gives an overview of recent research…

  16. Heterogeneous composite bodies with isolated lenticular shaped cermet regions

    Science.gov (United States)

    Sherman, Andrew J [Cirtland Hills, OH

    2009-12-22

    A heterogeneous body having ceramic rich cermet regions in a more ductile metal matrix. The heterogeneous bodies are formed by thermal spray operations on metal substrates. The thermal spray operations apply heat to a cermet powder and project it onto a solid substrate. The cermet powder is composed of complex composite particles in which a complex ceramic-metallic core particle is coated with a matrix precursor. The cermet regions are generally comprised of complex ceramic-metallic composites that correspond approximately to the core particles. The cermet regions are approximately lenticular shaped with an average width that is at least approximately twice the average thickness. The cermet regions are imbedded within the matrix phase and generally isolated from one another. They have obverse and reverse surfaces. The matrix phase is formed from the matrix precursor coating on the core particles. The amount of heat applied during the formation of the heterogeneous body is controlled so that the core particles soften but do not become so fluid that they disperse throughout the matrix phase. The force of the impact on the surface of the substrate tends to flatten them. The flattened cermet regions tend to be approximately aligned with one another in the body.

  17. Effectively semi-relativistic Hamiltonians of nonrelativistic form

    International Nuclear Information System (INIS)

    Lucha, W.; Schoeberl, F.F.; Moser, M.

    1993-12-01

    We construct effective Hamiltonians which despite their apparently nonrelativistic form incorporate relativistic effects by involving parameters which depend on the relevant momentum. For some potentials the corresponding energy eigenvalues may be determined analytically. Applied to two-particle bound states, it turns out that in this way a nonrelativistic treatment may indeed be able to simulate relativistic effects. Within the framework of hadron spectroscopy, this lucky circumstance may be an explanation for the sometimes extremely good predictions of nonrelativistic potential models even in relativistic regions. (authors)

  18. Nucleon electromagnetic structure studies in the spacelike and timelike regions

    International Nuclear Information System (INIS)

    Guttmann, Julia

    2013-01-01

    The thesis investigates the nucleon structure probed by the electromagnetic interaction. One of the most basic observables, reflecting the electromagnetic structure of the nucleon, are the form factors, which have been studied by means of elastic electron-proton scattering with ever increasing precision for several decades. In the timelike region, corresponding with the proton-antiproton annihilation into a electron-positron pair, the present experimental information is much less accurate. However, in the near future high-precision form factor measurements are planned. About 50 years after the first pioneering measurements of the electromagnetic form factors, polarization experiments stirred up the field since the results were found to be in striking contradiction to the findings of previous form factor investigations from unpolarized measurements. Triggered by the conflicting results, a whole new field studying the influence of two-photon exchange corrections to elastic electron-proton scattering emerged, which appeared as the most likely explanation of the discrepancy. The main part of this thesis deals with theoretical studies of two-photon exchange, which is investigated particularly with regard to form factor measurements in the spacelike as well as in the timelike region. An extraction of the two-photon amplitudes in the spacelike region through a combined analysis using the results of unpolarized cross section measurements and polarization experiments is presented. Furthermore, predictions of the two-photon exchange effects on the e + p/e - p cross section ratio are given for several new experiments, which are currently ongoing. The two-photon exchange corrections are also investigated in the timelike region in the process p anti p → e + e - by means of two factorization approaches. These corrections are found to be smaller than those obtained for the spacelike scattering process. The influence of the two-photon exchange corrections on cross section

  19. Comprehensive Assessment of Industries Economic Security: Regional Aspect

    Directory of Open Access Journals (Sweden)

    Viktoriya Viktorovna Akberdina

    2017-12-01

    Full Text Available The article investigates the interaction of the forms of network integration and the development of complimentary production networks in terms of economic security. Currently, the most developed countries are occurring a transition from the industrial society to the information society. The industry 4.0 as the continuous communication at all levels and characterizes the production processes, in which technologies and devices interact automatically in the value-added chain. Under these new conditions, the former types of organizational structures of economic entities are not sufficiently effective. Therefore, there is a need to create new, modern types of organizational structures. One of these types is network structures. Currently, they are becoming characteristic features of the new economy. Regional economic security depends on internal and external threats, which lead to unstable situations. Regional crisis situations are influenced by both macroeconomic crisis processes and local features of economic and social development, as well as the resource potential, geographical location, national and other peculiarities. The article defines the specific characteristics of the regions of the Ural Federal District, as well as the current situation of the regional economy and threats to the region. The authors have evaluated the economic security of complimentary production networks at the regional level. This evaluation has revealed the interconnection between complimentary production networks and the construction industry in the national economy. We have defined the economic security of complimentary production networks and specified the concept of complimentary production networks. The research findings may be applied by organizations as a new perspective of industry using network forms related to economic security

  20. PSEUDOTUMORAL FORM OF MULTIPLE SCLEROSIS WITH SYMPTOMATIC CONVULSIVE SEIZURES (A CLINICAL CASE

    Directory of Open Access Journals (Sweden)

    Yu. A. Belova

    2015-01-01

    Full Text Available Multiple sclerosis (MS is prominent among central nervous system diseases. It affects chiefly young people and almost inevitably results in disability. In the past decade, there has been an upward trend for the prevalence of MS worldwide; in particular, the higher prevalence of this disease has been registered in the Moscow Region, which is associated with both an objective increase in its morbidity and improvement of specialized care to the population in the region. MS is characterized by a variety of clinical manifestations. However, paroxysmal disturbances are referred to as the rare symptoms of MS: the incidence of epileptic seizures in this condition is 0.89 to 7.5% according to the literature data. In addition to the clinical form of MS, there are its rare malignant atypical forms that also include its pseudotumoral form characterized by intrinsic neuroimaging and clinical signs that are different from the classical form of MS and another abnormality of the central nervous system. The pseudotumoral form of MS is characterized by the development of acute focal demyelination that appears as a large focus of an increased magnetic resonance signal with perifocal edema as evidenced by magnetic resonance imaging. A pseudotumoral focus of demyelination can occur both at the onset of MS and during its recurrent course. The atypical onset of MS is a special challenge because of diagnostic problems, which may lead to erroneous therapeutic policy and have a negative impact on the late prognosis of the disease. The authors provide a clinical case of the pseudotumoral form of MS with convulsive seizures at the onset of demyelinating disease. The problems of diagnosis and therapeutic approaches are discussed.

  1. Is regional planning dead or just coping?

    DEFF Research Database (Denmark)

    Galland, Daniel

    2012-01-01

    and welfarist state project towards being a domain characterised by growth-oriented strategies that stand for neoliberal political agendas. In analysing this process I show that hierarchical forms of governance and statutory mechanisms embedded within them have been largely substituted by emerging soft spaces......How is regional planning transformed in increasingly changing socioeconomic and political contexts? How are regional planning policies and practices ultimately shaped and why? With this paper I propose and apply an analytical model based on notions of state theory, state spatial selectivity, new...

  2. Glass binder development for a glass-bonded sodalite ceramic waste form

    International Nuclear Information System (INIS)

    Riley, Brian J.; Vienna, John D.; Frank, Steven M.; Kroll, Jared O.; Peterson, Jacob A.

    2017-01-01

    This paper discusses work to develop Na_2O-B_2O_3-SiO_2 glass binders for immobilizing LiCl-KCl eutectic salt waste in a glass-bonded sodalite waste form following electrochemical reprocessing of used metallic nuclear fuel. In this paper, five new glasses with ~20 mass% Na_2O were designed to generate waste forms with high sodalite. The glasses were then used to produce ceramic waste forms with a surrogate salt waste. The waste forms made using these new glasses were formulated to generate more sodalite than those made with previous baseline glasses for this type of waste. The coefficients of thermal expansion for the glass phase in the glass-bonded sodalite waste forms made with the new binder glasses were closer to the sodalite phase in the critical temperature region near and below the glass transition temperature than previous binder glasses used. Finally, these improvements should result in lower probability of cracking in the full-scale monolithic ceramic waste form, leading to better long-term chemical durability.

  3. Regional Courts as Judicial Brakes?

    Directory of Open Access Journals (Sweden)

    Metcalf Katrin Nyman

    2017-12-01

    Full Text Available The article examines how regional integration courts can act as judicial brakes, at a time when “constitutional coups” – leaders staying in power past constitutional time limits or other forms of actions against the spirit if not always the letter of the constitution – are alarmingly common. The article discusses how regional courts can be used to modify or protect national rule of law and the constitutional order from the outside (i.e. from the regional integration aspect and the extent to which this can be valid particularly to promote a uniform interpretation and application of human rights. Although this trend is visible in Europe, it is more striking, because less expected, on other continents, in particular Africa and the Americas, where the developments take place in less than perfect democratic environments. The article contains evidence from cases dealt with in the various regional courts, supporting that a system of political and judicial oversight, especially in regions with weak or fragile democratic systems, can be a useful addition to national judicial or other mechanisms of protection of rule of law and control of the executive. Action by regional courts helps defeat perceptions of majoritarian politics, which in many countries allow for the winner to take all. Under a system of regional oversight, states become aware of the limits they themselves have set and citizens become aware of their possibilities to challenge political power.

  4. Proton and neutron charge form factors in soliton model with dilaton-quarkonium fields

    International Nuclear Information System (INIS)

    Magar, E.N.; Nikolaev, V.A.; Tkachev, O.G.; Novozhilov, V.Yu.

    1997-01-01

    Nucleon electromagnetic form factors are considered in the framework of the generalized Skyrme model with dilaton-quarkonium fields. In our first publication we got big discrepancy between calculated form factors and dipole approximation formula. Here we have reasonably good accordance between them in finite impulse region after vector meson dominance has been taken into account. Omega- and rho-mesons have been included only into hadron structure of the photon

  5. Research on Structure Innovation of Agricultural Organization in China’s Southwestern Mountainous Regions

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Taking agricultural organization in China’s southwestern mountainous regions as research object,on the basis of analysis of the status quo of agricultural organization development in China’s southwestern mountainous regions,we use related theoretical knowledge on economics and organization science,we probe into the process of innovation and mechanism of action concerning the structure of agricultural organization in China’s southwestern mountainous regions over the past 30 years.Finally we draw several general conclusions regarding structure innovation of agricultural organization in China’s southwestern mountainous regions as follows:first,the structure innovation of agricultural organization,a gradual process,proceeds ceaselessly along with ongoing progress and development of agriculture,and in this process,farmers always play a fundamental role;second,the structure innovation of agricultural organization is affected by many factors,and government institutional arrangement and change in market conditions is undoubtedly the most critical factor;third,the probable evolving direction of structure innovation of agricultural organization includes internal differentiation of the same form of agricultural organization,association of different forms of agricultural organization,and emergence of other forms of agricultural organization.

  6. Social Compacts in Regional and Global Perspective

    DEFF Research Database (Denmark)

    Schmidt, Johannes Dragsbæk

    2009-01-01

    the impact of global restructuring on labour and social conditions. Examples of the distributional consequences and resulting inequality, poverty, and unemployment are provided. This process has had an important impact on the emergence of reactive regional social compacts based on various forms of negotiated...

  7. Regional Management Plan: Summary report

    International Nuclear Information System (INIS)

    Drobny, N.L.

    1986-01-01

    This summary report describes the results of a 16-month project to develop a Regional Management Plan for low-level radioactive waste management in a seven-state area. The seven states are Indiana, Iowa, Michigan, Minnesota, Missouri, Ohio, and Wisconsin. These states have formed the Midwest Interstate Low-Level Radioactive Waste Commission in accord with Congressional requirements established in 1980. 14 refs., 13 figs., 9 tabs

  8. METHODOLOGY FOR FORMING MUTUALLY BENEFICIAL NETWORK INTERACTION BETWEEN SMALL CITIES AND DISTRICT CENTRES

    Directory of Open Access Journals (Sweden)

    Nikolay A. Ivanov

    2017-01-01

    Full Text Available Abstract. Objectives The aim of the study is to develop a methodology for networking between small towns and regional centres on the basis of developing areas of mutual benefit. It is important to assess the possibility of cooperation between small towns and regional centres and local selfgovernment bodies on the example of individual territorial entities of Russia in the context of the formation and strengthening of networks and support for territorial development. Methods Systemic and functional methodical approaches were taken. The modelling of socio-economic processes provides a visual representation of the direction of positive changes for small towns and regional centres of selected Subjects of the Russian Federation. Results Specific examples of cooperation between small towns and district centres are revealed in some areas; these include education, trade and public catering, tourist and recreational activities. The supporting role of subsystems, including management, regulatory activity, transport and logistics, is described. Schemes, by to which mutually beneficial network interaction is formed, are characterised in terms of the specific advantages accruing to each network subject. Economic benefits of realising interaction between small cities and regional centres are discussed. The methodology is based on assessing the access of cities to commutation, on which basis contemporary regional and city networks are formed. Conclusion On the basis of the conducted study, a list of areas for mutually beneficial networking between small towns and district centres has been identified, allowing the appropriate changes in regional economic policies to be effected in terms of programmes aimed at the development of regions and small towns, including those suffering from economic depression.

  9. Rocks and geology in the San Francisco Bay region

    Science.gov (United States)

    Stoffer, Philip W.

    2002-01-01

    The landscape of the San Francisco Bay region is host to a greater variety of rocks than most other regions in the United States. This introductory guide provides illustrated descriptions of 46 common and important varieties of igneous, sedimentary, and metamorphic rock found in the region. Rock types are described in context of their identification qualities, how they form, and where they occur in the region. The guide also provides discussion about of regional geology, plate tectonics, the rock cycle, the significance of the selected rock types in relation to both earth history and the impact of mineral resources on the development in the region. Maps and text also provide information where rocks, fossils, and geologic features can be visited on public lands or in association with public displays in regional museums, park visitor centers, and other public facilities.

  10. Regional Entrepreneurship Culture and the Business Lifecycle: Patterns from the Moravian-Silesian Region

    Directory of Open Access Journals (Sweden)

    Jarmila Šebestová

    2015-01-01

    Full Text Available The main goal of the paper is to focus on relationship between business cycle under regional entrepreneurial culture. Many of the trends found were less than positive, although there were some new positive trends that could be identified as a source of sustainability in the area of the connection between the sector of small and medium sized enterprises and the local entrepreneurship environment as well as a source of entrepreneurial culture. Moreover, the frequency of co-operational activities with local government was investigated. Questionnaire-based research was undertaken within 194 organizations of various legal forms operating in the area of the Moravian-Silesian Region. The main factors, which had an influence on their current business stage (49.5% in the growth stage, 9.8% in stagnation, 31.96% in decline and the other 0.52% in crisis, were the locality in the region, the quality of the labour force, cooperation with local public bodies and the business relationships between suppliers. Finally, we have defined the current stage of the entrepreneurial culture as the “Sandbox”.

  11. Improving the forming capability of laser dynamic forming by using rubber as a forming medium

    Science.gov (United States)

    Shen, Zongbao; Liu, Huixia; Wang, Xiao; Wang, Cuntang

    2016-04-01

    Laser dynamic forming (LDF) is a novel high velocity forming technique, which employs laser-generated shock wave to load the sample. The forming velocity induced by the high energy laser pulse may exceed the critical forming velocity, resulting in the occurrence of premature fracture. To avoid the above premature fracture, rubber is introduced in LDF as a forming medium to prolong the loading duration in this paper. Laser induced shock wave energy is transferred to the sample in different forming stages, so the forming velocity can be kept below the critical forming velocity when the initial laser energy is high for fracture. Bulge forming experiments with and without rubber were performed to study the effect of rubber on loading duration. The experimental results show that, the shock wave energy attenuates during the propagation through the rubber layer, the rubber can avoid the premature fracture. So the plastic deformation can continue, the forming capability of LDF is improved. Due to the severe plastic deformation under rubber compression, adiabatic shear bands (ASB) occur in LDF with rubber. The material softening in ASB leads to the irregular fracture, which is different from the premature fracture pattern (regular fracture) in LDF without rubber. To better understand this deformation behavior, Johnson-Cook model is used to simulate the dynamic response and the evolution of ASB of copper sample. The simulation results also indicate the rubber can prolong the loading duration.

  12. Agreement in the determination of preformed wire shape templates on plaster models and customized digital arch form diagrams on digital models.

    Science.gov (United States)

    Camardella, Leonardo Tavares; Sá, Maiara da Silva Bezerra; Guimarães, Luciana Campos; Vilella, Beatriz de Souza; Vilella, Oswaldo de Vasconcellos

    2018-03-01

    The aim of this study was to verify the accuracy of preformed wire shape templates on plaster models and those of customized digital arch form diagrams on digital models. Twenty pairs of dental plaster models were randomly selected from the archives of the Department of Orthodontics of Federal Fluminense University, Niterói, Rio de Janeiro, Brazil. All plaster model samples were scanned in a plaster model scanner to create the respective digital models. Three examiners defined the arch form on the mandibular arch of these models by selecting the ideal preformed wire shape template on each plaster model or by making a customized digital arch form on the digital models using a digital arch form customization tool. These 2 arch forms were superimposed by the best-fit method. The greatest differences in the 6 regions on the superimposed arches were evaluated. Each examiner presented a descriptive analysis with the means, standard deviation, and minimum and maximum intervals of the differences on the superimpositions. Intraclass correlation coefficient and paired t tests were used to evaluate the accuracy of the superimpositions. Among the 6 regions analyzed in the superimpositions, the largest differences in the anterior and premolar regions were considered clinically insignificant, whereas the largest differences in the right molar region, especially the second molar area, were considered clinically significant by all 3 examiners. The intraclass correlation coefficients showed a weak correlation in the premolar region and moderate correlations in the anterior and molar regions. The paired t test showed statistically significant differences in the left anterior and premolar regions. The superimpositions between the arch forms on plaster and digital models were considered accurate, and the differences were not clinically significant, with the exception of the second molar area. Despite the favorable results, the requirement of correcting some software problems may

  13. Views on the Anisotropic Nature of Ilva Valley Region

    Directory of Open Access Journals (Sweden)

    GABRIELA-ALINA MUREŞAN

    2012-01-01

    Full Text Available There are two concepts important for the authors of this article: anisotropic region and anisotropic space. Anisotropic region is defined by A. Dauphiné, the geographer (-mathematician, as a territorial unit whose structure results from the organisation of space along one or more axes. From the point of view of a territorial system, this type of region has some characteristics which differentiate it both from the homogeneous region and from the polarised one. These specificities have been analysed for Ilva Valley. The region of Ilva Valley is formed along the morphological axis represented by the Ilva River. The aim is to identify these specificities or their absence within this region. In this way we can determine whether this region is an anisotropic one or just an anisotropic space, namely whether it can be considered as evolving towards an anisotropic region, not yet complying with all characteristics of anisotropic regions.

  14. A dearth of short-period massive binaries in the young massive star forming region M 17. Evidence for a large orbital separation at birth?

    Science.gov (United States)

    Sana, H.; Ramírez-Tannus, M. C.; de Koter, A.; Kaper, L.; Tramper, F.; Bik, A.

    2017-03-01

    Aims: The formation of massive stars remains poorly understood and little is known about their birth multiplicity properties. Here, we aim to quantitatively investigate the strikingly low radial-velocity dispersion measured for a sample of 11 massive pre- and near-main-sequence stars (σ1D= 5.6 ± 0.2 km s-1) in the very young massive star forming region M 17, in order to obtain first constraints on the multiplicity properties of young massive stellar objects. Methods: We compute the radial-velocity dispersion of synthetic populations of massive stars for various multiplicity properties and we compare the obtained σ1D distributions to the observed value. We specifically investigate two scenarios: a low binary fraction and a dearth of short-period binary systems. Results: Simulated populations with low binary fractions () or with truncated period distributions (Pcutoff > 9 months) are able to reproduce the low σ1D observed within their 68%-confidence intervals. Furthermore, parent populations with fbin > 0.42 or Pcutoff < 47 d can be rejected at the 5%-significance level. Both constraints are in stark contrast with the high binary fraction and plethora of short-period systems in few Myr-old, well characterized OB-type populations. To explain the difference in the context of the first scenario would require a variation of the outcome of the massive star formation process. In the context of the second scenario, compact binaries must form later on, and the cut-off period may be related to physical length-scales representative of the bloated pre-main-sequence stellar radii or of their accretion disks. Conclusions: If the obtained constraints for the M 17's massive-star population are representative of the multiplicity properties of massive young stellar objects, our results may provide support to a massive star formation process in which binaries are initially formed at larger separations, then harden or migrate to produce the typical (untruncated) power-law period

  15. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods

    OpenAIRE

    Marina ZHURAVSKAYA; Vladimir TARASYAN

    2014-01-01

    In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the ...

  16. THE TOURISM IN THE OLTENIA REGION – STRATEGIES OF DEVELOPMENT

    OpenAIRE

    GHEORGHE GABRIEL SANDA

    2017-01-01

    Oltenia is one of the nine regions of Romania. Its tourism potential refers to an ensemble of components like geographical ones, historical, folkloric, religious and cultural, which create the premise for the development of diversified forms of tourism. Taking into consideration the fact that the region is not one of the most developed regions of Romania it is necessary to attract funds from the European Union to create an image of the destination so that more tourists will co...

  17. Regionalism and Economic Processes with Global Impact

    Directory of Open Access Journals (Sweden)

    Marina TABAC

    2016-06-01

    Full Text Available Regionalism has become one of the most discussed topics at the moment, in recent years and become one of the central challenges of the future in the modern system of international relations. Finally, in the XIX-XX centuries, scientists have expressed it a worldwide phenomenon through a process of radical change "external environment" and significant internal changes. It can be expressed in the world in one way or another, even if it has not been shown modest form until recently. Currently, regionalism and regional integration are considered as key indicators of international developments in the research of foreign policy and international relations. Theory followed the end of the era of "Cold War" and entered the post-bipolar world, multi-faceted development stage. The attention of researchers has grown to regionalization and regional integration by increasing the role and activities of regional organizations such as the EU, ASEAN, APEC and NAFTA, which coordinates the process of decision-making at supranational level, as well as issues of international regulation.

  18. [CII] dynamics in the S140 region

    International Nuclear Information System (INIS)

    Dedes, C.; Röllig, M.; Okada, Y.; Ossenkopf, V.; Mookerjea, B.

    2015-01-01

    We report the observation of [C II] emission in a cut through the S140 region together with single pointing observations of several molecular tracers, including hydrides, in key regions of the photon-dominated region (PDR) and molecular cloud [1]. At a distance of 910 pc, a BOV star ionizes the edge of the molecular cloud L1204, creating S140. In addition, the dense molecular cloud hosts a cluster of embedded massive young stellar objects only 75' from the H II region [e.g. 2, 3]. We used HIFI on Herschel to observe [CII] in a strip following the direction of the impinging radiation across the ionisation front and through the cluster of embedded YSOs. With [C II], we can trace the ionising radiation and, together with the molecular tracers such as CO isotopologues and HCO + , study the dynamical processes in the region. Combining HIFIs high spectral resolution data with ground based molecular data allows us to study the dynamics and excitation conditions both in the ionization front and the dense molecular star forming region and model their physical conditions [4

  19. Perturbative corrections to B → D form factors in QCD

    Science.gov (United States)

    Wang, Yu-Ming; Wei, Yan-Bing; Shen, Yue-Long; Lü, Cai-Dian

    2017-06-01

    We compute perturbative QCD corrections to B → D form factors at leading power in Λ/ m b , at large hadronic recoil, from the light-cone sum rules (LCSR) with B-meson distribution amplitudes in HQET. QCD factorization for the vacuum-to- B-meson correlation function with an interpolating current for the D-meson is demonstrated explicitly at one loop with the power counting scheme {m}_c˜ O(√{Λ {m}_b}) . The jet functions encoding information of the hard-collinear dynamics in the above-mentioned correlation function are complicated by the appearance of an additional hard-collinear scale m c , compared to the counterparts entering the factorization formula of the vacuum-to- B-meson correction function for the construction of B → π from factors. Inspecting the next-to-leading-logarithmic sum rules for the form factors of B → Dℓν indicates that perturbative corrections to the hard-collinear functions are more profound than that for the hard functions, with the default theory inputs, in the physical kinematic region. We further compute the subleading power correction induced by the three-particle quark-gluon distribution amplitudes of the B-meson at tree level employing the background gluon field approach. The LCSR predictions for the semileptonic B → Dℓν form factors are then extrapolated to the entire kinematic region with the z-series parametrization. Phenomenological implications of our determinations for the form factors f BD +,0 ( q 2) are explored by investigating the (differential) branching fractions and the R( D) ratio of B → Dℓν and by determining the CKM matrix element |V cb | from the total decay rate of B → Dμν μ .

  20. Two distinct forms of functional lateralization in the human brain

    Science.gov (United States)

    Gotts, Stephen J.; Jo, Hang Joon; Wallace, Gregory L.; Saad, Ziad S.; Cox, Robert W.; Martin, Alex

    2013-01-01

    The hemispheric lateralization of certain faculties in the human brain has long been held to be beneficial for functioning. However, quantitative relationships between the degree of lateralization in particular brain regions and the level of functioning have yet to be established. Here we demonstrate that two distinct forms of functional lateralization are present in the left vs. the right cerebral hemisphere, with the left hemisphere showing a preference to interact more exclusively with itself, particularly for cortical regions involved in language and fine motor coordination. In contrast, right-hemisphere cortical regions involved in visuospatial and attentional processing interact in a more integrative fashion with both hemispheres. The degree of lateralization present in these distinct systems selectively predicted behavioral measures of verbal and visuospatial ability, providing direct evidence that lateralization is associated with enhanced cognitive ability. PMID:23959883

  1. Social Movement of Mandar People as a Struggle in Processof Forming West Sulawesi Province

    Directory of Open Access Journals (Sweden)

    Gustiana A.Kambo

    2014-02-01

    Full Text Available This paper examines the dynamics of ethnicity in South Sulawesi. Mandar is a tribe (ethnic that lives in the area. This region consists of three regencies (before expansion which challenged from Mandar kingdoms, ethnic try again confirmed its glory by extending political rights to form an autonomous region through the establishment of a new province in South Sulawesi. This paper focuses on problem, how is the struggle order of forming new province in the former Mandar section and why does formation movement appear in the former Mandar section. By using descriptive qualitative approach which determines informant chosen focus on what is suggested by Patton (1994 where determining informant by using purposive way. The conceptual framework used from Fakih (2000; Nordliger (1994; Suzane Keller (1984; and Ryass Rasyid (2000.the finding of the research describes that struggle movement of forming new province in the former Mandar section is a form of social movement to the positive phenomenon as a constructive means to social struggle where this movement is coordinated by an institution as a historical flame product refers to a number of activities to ease the movement pioneered by intellectual and traditional elite.

  2. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  3. An empirical application of regional security complex theory on eastern partnership region

    Directory of Open Access Journals (Sweden)

    Ludmila STUPARU

    2015-12-01

    Full Text Available Eastern Partnership (EaP is a very dynamic region. If a year ago the EaP was seen as an authentic and vibrant „laboratory” of democracy building, overcoming the remains of the totalitarian state and putting the basis of a free and pluralist society, nowadays the Eastern Partnership is seen as an „out-dated” approach of the EU. However, Eastern Partnership is visible on European political arena and the big powers (USA, Russia and the EU pay attention more and more to the evolution of EaP countries. Moreover, it seems to be a confrontation between Russia and Western powers regarding the political and geopolitical orientation of EaP countries. Kremlin tries actively to stop the efforts of the EaP to close to the EU and on the other side, the EU as well as the USA encourage EaP countries to implement reforms in order to build their democracy. This paper aims to analyse the Eastern Partnership in terms of security complex, trying to argue that Eastern Partnership countries at this phase don’t form a Regional Security Complex and the EU and USA should rethink its approach towards this region.

  4. The mitochondrial genomes of sponges provide evidence for multiple invasions by Repetitive Hairpin-forming Elements (RHE

    Directory of Open Access Journals (Sweden)

    Lavrov Dennis V

    2009-12-01

    Full Text Available Abstract Background The mitochondrial (mt genomes of sponges possess a variety of features, which appear to be intermediate between those of Eumetazoa and non-metazoan opisthokonts. Among these features is the presence of long intergenic regions, which are common in other eukaryotes, but generally absent in Eumetazoa. Here we analyse poriferan mitochondrial intergenic regions, paying particular attention to repetitive sequences within them. In this context we introduce the mitochondrial genome of Ircinia strobilina (Lamarck, 1816; Demospongiae: Dictyoceratida and compare it with mtDNA of other sponges. Results Mt genomes of dictyoceratid sponges are identical in gene order and content but display major differences in size and organization of intergenic regions. An even higher degree of diversity in the structure of intergenic regions was found among different orders of demosponges. One interesting observation made from such comparisons was of what appears to be recurrent invasions of sponge mitochondrial genomes by repetitive hairpin-forming elements, which cause large genome size differences even among closely related taxa. These repetitive hairpin-forming elements are structurally and compositionally divergent and display a scattered distribution throughout various groups of demosponges. Conclusion Large intergenic regions of poriferan mt genomes are targets for insertions of repetitive hairpin- forming elements, similar to the ones found in non-metazoan opisthokonts. Such elements were likely present in some lineages early in animal mitochondrial genome evolution but were subsequently lost during the reduction of intergenic regions, which occurred in the Eumetazoa lineage after the split of Porifera. Porifera acquired their elements in several independent events. Patterns of their intra-genomic dispersal can be seen in the mt genome of Vaceletia sp.

  5. Regional Innovation Strategies in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Hájek Oldřich

    2011-06-01

    Full Text Available Lately, the concept of innovation has become a development mantra in the fierce global competition. Competition is not limited to firms; it is also relevant for territories. An observed trend which is not surprising is the number of support tools that have been developed to reinforce the position of territories and their actors in the innovation processes. Clusters and regional innovation systems are the most important of them. However, both are rather underdeveloped in the CEE countries, including the Czech Republic. Faced with this situation, a number of Czech regional authorities (Regions took measures to stimulate the process of creating cluster and regional innovation system (RISs. Hence, strategic planning in the form of regional innovation strategies has become an overarching concept. So far, eleven Czech Regions have elaborated on RISs and analysis of these documents was the main focus of this article. The main finding of this paper is that, there is an increasing quality of RISs in the Czech Republic. Moreover, some common and some differentiated features of RISs were also identified. Consequently, the paper emphasizes numerous problems of RISs that is perceived as a key barrier towards real regional innovation system.

  6. Innovative Forms of Regional Structural Policy in Europe: the Role of Dominant Concepts and Knowledge Flows

    NARCIS (Netherlands)

    Lagendijk, A.

    1999-01-01

    The last decade has witnessed a revival of regional structural policy in the Western world. The new style of policy-making which has emerged differs markedly from the top-down distributional models that dominated the post-war period, but is also more pro-active than the hands-off approach of the

  7. Growth behavior of anodic porous alumina formed in malic acid solution

    Science.gov (United States)

    Kikuchi, Tatsuya; Yamamoto, Tsuyoshi; Suzuki, Ryosuke O.

    2013-11-01

    The growth behavior of anodic porous alumina formed on aluminum by anodizing in malic acid solutions was investigated. High-purity aluminum plates were electropolished in CH3COOH/HClO4 solutions and then anodized in 0.5 M malic acid solutions at 293 K and constant cell voltages of 200-350 V. The anodic porous alumina grew on the aluminum substrate at voltages of 200-250 V, and a black, burned oxide film was formed at higher voltages. The nanopores of the anodic oxide were only formed at grain boundaries of the aluminum substrate during the initial stage of anodizing, and then the growth region extended to the entire aluminum surface as the anodizing time increased. The anodic porous alumina with several defects was formed by anodizing in malic acid solution at 250 V, and oxide cells were approximately 300-800 nm in diameter.

  8. Nucleon structure functions, resonance form factors, and duality

    International Nuclear Information System (INIS)

    Davidovsky, V.V.; Struminsky, B.V.

    2003-01-01

    The behavior of nucleon structure functions in the resonance region is explored. For form factors that describe resonance production, expressions are obtained that are dependent on the photon virtuality Q 2 , which have a correct threshold behavior, and which take into account available experimental data on resonance decay. Resonance contributions to nucleon structure functions are calculated. The resulting expressions are used to investigate quark-hadron duality in electron-nucleon scattering by taking the example of the structure function F 2

  9. 75 FR 51093 - Agency Information Collection Activities: Form I-864, Form I-864A, Form I-864EZ, and Form I-864W...

    Science.gov (United States)

    2010-08-18

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... of Homeland Security, U.S. Citizenship and Immigration Services (USCIS) will be submitting the...: Form I-864, Form I-864A, Form I-864EZ, and Form I-864W; U.S. Citizenship and Immigration Services...

  10. THE STUDY FOR REGIONAL RETAIL PHARMACEUTICAL MARKET

    Directory of Open Access Journals (Sweden)

    O. V. Sokolova

    2015-01-01

    Full Text Available Pharmacy organizations are an element of regional pharmaceutical market infrastructure formation. They have different character and activity type, organizational and legal forms, types of properties. The revelation of the features of retail pharmaceutical market of Yaroslavl oblast was the purpose of the study. The analysis of the data of regional department of Federal Service on Surveillance in Healthcare and Social Development of Russian Federation  n Yaroslavl oblast in the beginning of 2014 showed that there are 137 acting commercial entities, which have licenses for pharmaceutical activity. The region has 487  pharmacy organizations which implement pharmaceutical activity of state (14.6%, municipal (7.4%, and private (78.0% forms of ownership. Some companies function in Yaroslavl (43.9% and Rybinsk (22.4% municipal district. The analysis of organization and legal forms revealed that 48.9% of pharmacy organizations are registered as ltd, 14.6% are state, and 14.2% are private entrepreneurs, public limited companies amount to 10.9%, the rest pharmacy organizations are included into municipal unitary enterprises and private limited companies – 7.39% and 4.1% correspondingly. The structure of retail market is represented by single pharmacy organizations (51.1% as well as organizations joined into pharmacy chains from two and more PO (48.9%. The share of commercial entities which include one PO amounted to 14.4% of all PO. Share of pharmacy chains (42.3% which include from 2 to 9 PO are 46.8% of all PO. Pharmacy chains, which have more than 9 retails spots amount to 6.6% of the total number of commercial entities. 38.8% of PO function within them. Pharmacy chains prevalence (42.3%, joined into 9 PO; pharmacy chains, which have more than 9 PO, and include state sector PO (14.6% are the features of the regional market.

  11. The practice of electronic petitions to regional political agenda-setting

    Directory of Open Access Journals (Sweden)

    O. M. Kuzhman

    2016-05-01

    Proved that electronic petitions as a special form of collective appeals, in fact, represent electronic (national, regional, local – depending on the level of government initiatives which the conditions of collecting the required number of signatures in his support are urgently considered relevant authority. For it must necessarily be made or decision given in a public way motivated refusal. It was determined that the regional feeder electronic petitions is very effective because it allows you to identify the pressing issues of interest to residents of a region, and respond to them. Thus, through electronic petition very quickly established regional political agenda.

  12. Form finding in elastic gridshells

    Science.gov (United States)

    Baek, Changyeob; Sageman-Furnas, Andrew O.; Jawed, Mohammad K.; Reis, Pedro M.

    2018-01-01

    Elastic gridshells comprise an initially planar network of elastic rods that are actuated into a shell-like structure by loading their extremities. The resulting actuated form derives from the elastic buckling of the rods subjected to inextensibility. We study elastic gridshells with a focus on the rational design of the final shapes. Our precision desktop experiments exhibit complex geometries, even from seemingly simple initial configurations and actuation processes. The numerical simulations capture this nonintuitive behavior with excellent quantitative agreement, allowing for an exploration of parameter space that reveals multistable states. We then turn to the theory of smooth Chebyshev nets to address the inverse design of hemispherical elastic gridshells. The results suggest that rod inextensibility, not elastic response, dictates the zeroth-order shape of an actuated elastic gridshell. As it turns out, this is the shape of a common household strainer. Therefore, the geometry of Chebyshev nets can be further used to understand elastic gridshells. In particular, we introduce a way to quantify the intrinsic shape of the empty, but enclosed regions, which we then use to rationalize the nonlocal deformation of elastic gridshells to point loading. This justifies the observed difficulty in form finding. Nevertheless, we close with an exploration of concatenating multiple elastic gridshell building blocks.

  13. Creating Collaborative Advantages Through Coordination of Regional Development Activities

    OpenAIRE

    Sumpor, Marijana

    2006-01-01

    Through the increasing importance of networking and use of participatory strategic planning approaches in the regional development practice, it seems that local and regional development theory moves from the concept of competitive advantages towards collaborative advantages. This conceptual move implies a redefinition of inter- and intra-institutional relations of the public and private sector, and therefore, calls for defining new forms of governance. The exploration of the concept of collab...

  14. CCR Certification Form for Wyoming or EPA R8 Tribal Community Water Systems

    Science.gov (United States)

    The CCR Certification Form can be used to certify that community water systems in Wyoming or on Tribal Lands in EPA Region 8 have completed and distributed their annual Consumer Confidence Report (CCR) or water quality report.

  15. A Pan-STARRS1 Proper-Motion Survey for Young Brown Dwarfs in the Nearest Star-Forming Regions and a Reddening-Free Classification Method for Ultracool Dwarfs

    Science.gov (United States)

    Zhang, Zhoujian; Liu, Michael C.; Best, William M. J.; Magnier, Eugene; Aller, Kimberly

    2018-01-01

    Young brown dwarfs are of prime importance to investigate the universality of the initial mass function (IMF). Based on photometry and proper motions from the Pan-STARRS1 (PS1) 3π survey, we are conducting the widest and deepest brown dwarf survey in the nearby star-forming regions, Taurus–Auriga (Taurus) and Upper Scorpius (USco). Our work is the first to measure proper motions, a robust proxy of membership, for brown dwarf candidates in Taurus and USco over such a large area and long time baseline (≈ 15 year) with such high precision (≈ 4 mas yr-1). Since extinction complicates spectral classification, we have developed a new approach to quantitatively determine reddening-free spectral types, extinctions, and gravity classifications for mid-M to late-L ultracool dwarfs (≈ 100–5 MJup), using low-resolution near-infrared spectra. So far, our IRTF/SpeX spectroscopic follow-up has increased the substellar and planetary-mass census of Taurus by ≈ 50% and almost doubled the substellar census of USco, constituting the largest single increases of brown dwarfs and free-floating planets found in both regions to date. Most notably, our new discoveries reveal an older (> 10 Myr) low-mass population in Taurus, in accord with recent studies of the higher-mass stellar members. In addition, the mass function appears to differ between the younger and older Taurus populations, possibly due to incompleteness of the older stellar members or different star formation processes. Upon completion, our survey will establish the most complete substellar and planetary-mass census in both Taurus and USco associations, make a significant addition to the low-mass IMF in both regions, and deliver more comprehensive pictures of star formation histories.

  16. Franchising as an Integrated Form of Business Organization

    Directory of Open Access Journals (Sweden)

    Goncharenko Margaryta L.

    2018-03-01

    Full Text Available The article is aimed at substantiating the possibilities of using franchising for effective integration of enterprises in the market economy. A study on the essence of franchising relations with consideration of their historical formation and the current legal representation was carried out. Features of such relationships for franchisor and franchisees in the form of two business models of franchising together with different types of payments for franchise have been provided. It has been identified that franchising allows for integrative relations, which are established between the representatives of big and small business over a certain period of time, forming for each party some positive and negative moments of interaction. It is proposed to carry out an analysis of economic problems leading to delays in the formation of franchising schemes at both the State and regional levels.

  17. The multi region molten-salt reactor concept

    International Nuclear Information System (INIS)

    Gyula, Csom; Sandor, Feher; Szieberth, M.; Szabolcs, Czifrus

    2003-01-01

    The molten-salt reactor (MSR) concept is one of the most promising systems for the realisation of transmutation. The objective is the development of a transmutation technique along with a device implementing it, which yield higher transmutation efficiencies than that of the known procedures. The procedure is the multi-step transmutation, in which the transformation is carried out in several consecutive steps of different neutron flux and spectrum. In order to implement this, a multi-region transmutation device, i.e. nuclear reactor or sub-critical system is proposed, in which several separate flow-through irradiation rooms are formed with various neutron spectra and fluxes. The paper presents calculations that were performed for a special 5-region version of the multi-region molten-salt reactor. (author)

  18. Overview of Qatecalovo-Kulaming uranium metallogenic region

    International Nuclear Information System (INIS)

    Zhao Fengmin

    2011-01-01

    Qatecalovo-Kulaming uranium metallogenic region is the earliest discovered volcanic-type uranium metallogenic region in the world, which which is located in the Kulaming uplift of Middle Tianshan Variscan orogenic belt. Ten deposits have been discovered in the mine area, over 20000 t metallic uranium has been mined out. Uranium deposits mainly occurred in Late Palaeozoic volcanic depression, and the volcanic rocks are characterized by the great lithologic change from andesite to rhyolite. Mineralization age is from 260 to 270 Ma. The tectonic unit in which the metallogenic region is located can extend eastward into China. Therefore, the ore-forming condition study on this tectonic unit can be used to guide the prospection for Palaeozoic volcanics uranium deposit in northwestern China. (author)

  19. Nucleon electromagnetic structure studies in the spacelike and timelike regions

    Energy Technology Data Exchange (ETDEWEB)

    Guttmann, Julia

    2013-07-23

    The thesis investigates the nucleon structure probed by the electromagnetic interaction. One of the most basic observables, reflecting the electromagnetic structure of the nucleon, are the form factors, which have been studied by means of elastic electron-proton scattering with ever increasing precision for several decades. In the timelike region, corresponding with the proton-antiproton annihilation into a electron-positron pair, the present experimental information is much less accurate. However, in the near future high-precision form factor measurements are planned. About 50 years after the first pioneering measurements of the electromagnetic form factors, polarization experiments stirred up the field since the results were found to be in striking contradiction to the findings of previous form factor investigations from unpolarized measurements. Triggered by the conflicting results, a whole new field studying the influence of two-photon exchange corrections to elastic electron-proton scattering emerged, which appeared as the most likely explanation of the discrepancy. The main part of this thesis deals with theoretical studies of two-photon exchange, which is investigated particularly with regard to form factor measurements in the spacelike as well as in the timelike region. An extraction of the two-photon amplitudes in the spacelike region through a combined analysis using the results of unpolarized cross section measurements and polarization experiments is presented. Furthermore, predictions of the two-photon exchange effects on the e{sup +}p/e{sup -}p cross section ratio are given for several new experiments, which are currently ongoing. The two-photon exchange corrections are also investigated in the timelike region in the process p anti p → e{sup +}e{sup -} by means of two factorization approaches. These corrections are found to be smaller than those obtained for the spacelike scattering process. The influence of the two-photon exchange corrections on

  20. The carbonate mineralogy and distribution of habitat-forming deep-sea corals in the southwest pacific region

    Science.gov (United States)

    Bostock, Helen C.; Tracey, Dianne M.; Currie, Kim I.; Dunbar, Gavin B.; Handler, Monica R.; Mikaloff Fletcher, Sara E.; Smith, Abigail M.; Williams, Michael J. M.

    2015-06-01

    Habitat-forming deep-sea scleractinian and alcyonacean corals from around the southwest Pacific were analysed for their calcium carbonate mineralogy. Scleractinian coral species Solenosmilia variabilis, Enallopsammia rostrata, Goniocorella dumosa, Madrepora oculata and Oculina virgosa were all found to be 100% aragonitic, while some members of the alcyonacean taxa Keratoisis spp., Lepidisis spp., and Paragorgia spp. were determined to be high magnesium (Mg) calcite (with 8-11 mol% MgCO3) and Primnoa sp. is bimineralic with both aragonite and Mg calcite. The majority of these habitat-forming deep-sea corals are found at intermediate depths (800-1200 m) in the Antarctic Intermediate Waters (AAIW) with low salinities (~34.5), temperatures of 4-8 °C and high oxygen concentrations (>180 μmol/kg) and currently sitting above the aragonite saturation horizon (ASH). However, habitat-forming corals have been recorded from greater depths, in cooler waters (2-4 °C) that are undersaturated with respect to aragonite (Ωaragonite160 μmol/kg. To address the sampling depth bias the coral records were normalised by the number of benthic stations (sampling effort) in the same depth range. This shows that the highest number of corals per sampling effort is between 1000 and 1400 m with corals present in over 5% of the stations at these depths. The normalised records and Boot Strap analyses suggests that scleractinian corals, especially S. variabilis should be present in >1% of stations down to 1800 m water depth, with E. rostrata, M. oculata and G. dumosa slightly shallower. While alcyonacean corals are found in >1% down to 2600 m, with Keratoisis spp. the deepest down to 2600 m, while Lepidisis spp. and Paragorgia spp. found down to 1800 m. This suggests that most species can probably tolerate some undersaturation of aragonite (Ωaragonite=0.8-0.9), with several species/genera (S. variabilis; Keratoisis spp.) even more tolerant of lower carbonate concentrations ([CO3 2 -]), down

  1. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A*

    Science.gov (United States)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.

    2018-05-01

    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  2. X-ray photoelectron spectroscopy study of the passive films formed on thermally sprayed and wrought Inconel 625

    Energy Technology Data Exchange (ETDEWEB)

    Bakare, M.S. [Materials, Mechanics and Structures Research Division, Faculty of Engineering, University of Nottingham, University Park, Nottingham, NG7 2RD (United Kingdom); Voisey, K.T., E-mail: Katy.voisey@nottingham.ac.uk [Materials, Mechanics and Structures Research Division, Faculty of Engineering, University of Nottingham, University Park, Nottingham, NG7 2RD (United Kingdom); Roe, M.J.; McCartney, D.G. [Materials, Mechanics and Structures Research Division, Faculty of Engineering, University of Nottingham, University Park, Nottingham, NG7 2RD (United Kingdom)

    2010-11-15

    There is a well known performance gap in corrosion resistance between thermally sprayed corrosion resistant coatings and the equivalent bulk materials. Interconnected porosity has an important and well known effect, however there are additional relevant microstructural effects. Previous work has shown that a compositional difference exists between the regions of resolidified and non-melted material that exist in the as-sprayed coatings. The resolidified regions are depleted in oxide forming elements due to formation of oxides during coating deposition. Formation of galvanic cells between these different regions is believed to decrease the corrosion resistance of the coating. In order to increase understanding of the details of this effect, this work uses X-ray photoelectron spectroscopy (XPS) to study the passive films formed on thermally sprayed coatings (HVOF) and bulk Inconel 625, a commercially available corrosion resistant Ni-Cr-Mo-Nb alloy. Passive films produced by potentiodynamic scanning to 400 mV in 0.5 M sulphuric acid were compared with air-formed films. The poorer corrosion performance of the thermally sprayed coatings was attributed to Ni(OH){sub 2}, which forms a loose, non-adherent and therefore non-protective film. The good corrosion resistance of wrought Inconel 625 is due to formation of Cr, Mo and Nb oxides.

  3. Public information - Northwest region of Russian Federation

    International Nuclear Information System (INIS)

    Saiapina, A.

    2001-01-01

    Regional Center of Public Information in Northwest region of Russian Federation is a part of the State Regional Educational Center of Ministry of the Russian Federation for atomic energy in St.-Petersburg, Russia (http://graph.runnet.ru/). This Center of Public Information (CPI) provides a wide range of information dealing with the nuclear power. The objectives of the CPI are: to conduct informational and educational activities so as to form a positive attitude toward atomic energy and nuclear technologies; to provide the population with a means reliable information about objects of potential risk; to organize an active exchange of the information with enterprises using nuclear technologies in the region. The main topics of informational support are these: electricity production, the ground of nuclear power, new Russian nuclear reactors, nuclear safety, nuclear power and environment, radioactivity, Leningrad nuclear power plant, responsibilities in nuclear engineering. (author)

  4. Northeast Asian Energy Corridor Initiative for Regional Collaboration

    Directory of Open Access Journals (Sweden)

    Paik Hoon

    2012-12-01

    Full Text Available For historical and political reasons, South Korea (hereafter Korea, Japan and China have not achieved much progress in regional energy cooperation for decades. However, the rising importance of Northeast Asia (NEA in the world energy sphere, especially in the global oil market, is providing an opportunity to create an integrated oil market in the region. This study suggests the Northeast Asian Energy Corridor (NEAEC Initiative as an effective conduit for raising the possibility of the Northeast Asian oil hub project. The NEAEC Initiative combines the model of Europe's Amsterdam-Rotterdam-Antwerp (ARA with Singapore's AsiaClear as a form of financial collaboration. The study suggests that an elFor historical and political reasons, South Korea (hereafter Korea, Japan and China have not achieved much progress in regional energy cooperation for decades. However, the rising importance of Northeast Asia (NEA in the world energy sphere, especially in the global oil market, is providing an opportunity to create an integrated oil market in the region. This study suggests the Northeast Asian Energy Corridor (NEAEC Initiative as an effective conduit for raising the possibility of the Northeast Asian oil hub project. The NEAEC Initiative combines the model of Europe's Amsterdam-Rotterdam-Antwerp (ARA with Singapore’s AsiaClear as a form of financial collaboration. The study suggests that an electronically integrated Over-the-Counter (OTC market clearing mechanism accompanied by other key financial instruments among Korea, Japan and China can be an effective means for promoting financial collaboration in the region.

  5. Advances in metal forming expert system for metal forming

    CERN Document Server

    Hingole, Rahulkumar Shivajirao

    2015-01-01

    This comprehensive book offers a clear account of the theory and applications of advanced metal forming. It provides a detailed discussion of specific forming processes, such as deep drawing, rolling, bending extrusion and stamping. The author highlights recent developments of metal forming technologies and explains sound, new and powerful expert system techniques for solving advanced engineering problems in metal forming. In addition, the basics of expert systems, their importance and applications to metal forming processes, computer-aided analysis of metalworking processes, formability analysis, mathematical modeling and case studies of individual processes are presented.

  6. SHOCKED SUPERWINDS FROM THE z {approx} 2 CLUMPY STAR-FORMING GALAXY, ZC406690

    Energy Technology Data Exchange (ETDEWEB)

    Newman, Sarah F.; Genzel, Reinhard [Department of Astronomy, Campbell Hall, University of California, Berkeley, CA 94720 (United States); Shapiro Griffin, Kristen [Aerospace Research Laboratories, Northrop Grumman Aerospace Systems, Redondo Beach, CA 90278 (United States); Davies, Ric; Foerster-Schreiber, Natascha M.; Tacconi, Linda J.; Kurk, Jaron; Wuyts, Stijn; Genel, Shy; Buschkamp, Peter; Eisenhauer, Frank; Lutz, Dieter [Max-Planck-Institut fuer extraterrestrische Physik (MPE), Giessenbachstr.1, D-85748 Garching (Germany); Lilly, Simon J.; Carollo, C. Marcella [Institute of Astronomy, Department of Physics, Eidgenoessische Technische Hochschule, ETH Zuerich CH-8093 (Switzerland); Renzini, Alvio; Mancini, Chiara [Osservatorio Astronomico di Padova, Vicolo dellOsservatorio 5, Padova I-35122 (Italy); Bouche, Nicolas [Department of Physics and Astronomy, University of California, Santa Barbara, Santa Barbara, CA 93106 (United States); Burkert, Andreas [Department fuer Physik, Universitaets-Sternwarte Ludwig-Maximilians-Universitaet (USM), Scheinerstr. 1, Muenchen, D-81679 (Germany); Cresci, Giovanni [Istituto Nazionale di AstrofisicaOsservatorio Astronomico di Arcetri, Largo Enrico Fermi 5, I 50125 Firenze (Italy); Hicks, Erin, E-mail: sfnewman@berkeley.edu [Department of Astronomy, University of Washington, Box 351580, U.W., Seattle, WA 98195-1580 (United States); and others

    2012-06-20

    We have obtained high-resolution data of the z {approx} 2 ring-like, clumpy star-forming galaxy (SFG) ZC406690 using the VLT/SINFONI with adaptive optics (in K band) and in seeing-limited mode (in H and J bands). Our data include all of the main strong optical emission lines: [O II], [O III], H{alpha}, H{beta}, [N II], and [S II]. We find broad, blueshifted H{alpha} and [O III] emission line wings in the spectra of the galaxy's massive, star-forming clumps ({sigma} {approx} 85 km s{sup -1}) and even broader wings (up to 70% of the total H{alpha} flux, with {sigma} {approx} 290 km s{sup -1}) in regions spatially offset from the clumps by {approx}2 kpc. The broad emission likely originates from large-scale outflows with mass outflow rates from individual clumps that are 1-8 Multiplication-Sign the star formation rate (SFR) of the clumps. Based on emission line ratio diagnostics ([N II]/H{alpha} and [S II]/H{alpha}) and photoionization and shock models, we find that the emission from the clumps is due to a combination of photoionization from the star-forming regions and shocks generated in the outflowing component, with 5%-30% of the emission deriving from shocks. In terms of the ionization parameter (6 Multiplication-Sign 10{sup 7} to 10{sup 8} cm s{sup -1}, based on both the SFR and the O{sub 32} ratio), density (local electron densities of 300-1800 cm{sup -3} in and around the clumps, and ionized gas column densities of 1200-8000 M{sub Sun }pc{sup -2}), and SFR (10-40 M{sub Sun} yr{sup -1}), these clumps more closely resemble nuclear starburst regions of local ultraluminous infrared galaxies and dwarf irregulars than H II regions in local galaxies. However, the star-forming clumps are not located in the nucleus as in local starburst galaxies but instead are situated in a ring several kpc from the center of their high-redshift host galaxy, and have an overall disk-like morphology. The two brightest clumps are quite different in terms of their internal

  7. U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization? Comment on "Decentralisation of Health Services in Fiji: A Decision Space Analysis".

    Science.gov (United States)

    Bustamante, Arturo Vargas

    2016-06-07

    For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. © 2016 by Kerman University of Medical Sciences.

  8. A 31-residue peptide induces aggregation of tau's microtubule-binding region in cells

    Science.gov (United States)

    Stöhr, Jan; Wu, Haifan; Nick, Mimi; Wu, Yibing; Bhate, Manasi; Condello, Carlo; Johnson, Noah; Rodgers, Jeffrey; Lemmin, Thomas; Acharya, Srabasti; Becker, Julia; Robinson, Kathleen; Kelly, Mark J. S.; Gai, Feng; Stubbs, Gerald; Prusiner, Stanley B.; Degrado, William F.

    2017-09-01

    The self-propagation of misfolded conformations of tau underlies neurodegenerative diseases, including Alzheimer's. There is considerable interest in discovering the minimal sequence and active conformational nucleus that defines this self-propagating event. The microtubule-binding region, spanning residues 244-372, reproduces much of the aggregation behaviour of tau in cells and animal models. Further dissection of the amyloid-forming region to a hexapeptide from the third microtubule-binding repeat resulted in a peptide that rapidly forms fibrils in vitro. We show that this peptide lacks the ability to seed aggregation of tau244-372 in cells. However, as the hexapeptide is gradually extended to 31 residues, the peptides aggregate more slowly and gain potent activity to induce aggregation of tau244-372 in cells. X-ray fibre diffraction, hydrogen-deuterium exchange and solid-state NMR studies map the beta-forming region to a 25-residue sequence. Thus, the nucleus for self-propagating aggregation of tau244-372 in cells is packaged in a remarkably small peptide.

  9. Assessment of the Tourism Function in Region Development

    Directory of Open Access Journals (Sweden)

    Nataliia Zigern-Korn

    2014-07-01

    Full Text Available This article represents methodical approaches to estimation of tourism value and function in Russian regions development and contains some results of the carried-out assessment. The reasons about tourism mission for different types of territory exploitation and level of social and economic development, the idea of methods of tourist development of regions space are the core lines of the assessment framework. Selection of model regions due to their development types formed information basis for assessment. We determined specific Indicators and algorithm of an assessment to each model region. Results of the carried-out assessment allow rethinking the category of tourist and recreational potential of the territory from the standpoint of prospects and principles of a sustainable development. The technique of such impact assessment of tourism on regional development opens opportunity for public authorities to adopt correct strategic decisions according to the principles of Smart Development.

  10. Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.

    Science.gov (United States)

    Feng, Y X; Fu, W; Winter, A J; Levin, J G; Rein, A

    1995-04-01

    Retroviruses contain a dimeric RNA consisting of two identical molecules of plus-strand genomic RNA. The structure of the linkage between the two monomers is not known, but they are believed to be joined near their 5' ends. Darlix and coworkers have reported that transcripts of retroviral RNA sequences can dimerize spontaneously in vitro (see, for example, E. Bieth, C. Gabus, and J. L. Darlix, Nucleic Acids Res. 18:119-127, 1990). As one approach to identification of sequences which might participate in the linkage, we have mapped sequences derived from the 5' 378 bases of Harvey sarcoma virus (HaSV) RNA which can dimerize in vitro. We found that at least three distinct regions, consisting of nucleotides 37 to 229, 205 to 272, and 271 to 378, can form these dimers. Two of these regions contain nucleotides 205 to 226; computer analysis suggests that this region can form a stem-loop with an inverted repeat in the loop. We propose that this hypothetical structure is involved in dimer formation by these two transcripts. We also compared the thermal stabilities of each of these dimers with that of HaSV viral RNA. Dimers of nucleotides 37 to 229 and 205 to 272 both exhibited melting temperatures near that of viral RNA, while dimers of nucleotides 271 to 378 are quite unstable. We also found that dimers of nucleotides 37 to 378 formed at 37 degrees C are less thermostable than dimers of the same RNA formed at 55 degrees C. It seems possible that bases from all of these regions participate in the dimer linkage present in viral RNA.

  11. Telomere maintenance through recruitment of internal genomic regions.

    Science.gov (United States)

    Seo, Beomseok; Kim, Chuna; Hills, Mark; Sung, Sanghyun; Kim, Hyesook; Kim, Eunkyeong; Lim, Daisy S; Oh, Hyun-Seok; Choi, Rachael Mi Jung; Chun, Jongsik; Shim, Jaegal; Lee, Junho

    2015-09-18

    Cells surviving crisis are often tumorigenic and their telomeres are commonly maintained through the reactivation of telomerase. However, surviving cells occasionally activate a recombination-based mechanism called alternative lengthening of telomeres (ALT). Here we establish stably maintained survivors in telomerase-deleted Caenorhabditis elegans that escape from sterility by activating ALT. ALT survivors trans-duplicate an internal genomic region, which is already cis-duplicated to chromosome ends, across the telomeres of all chromosomes. These 'Template for ALT' (TALT) regions consist of a block of genomic DNA flanked by telomere-like sequences, and are different between two genetic background. We establish a model that an ancestral duplication of a donor TALT region to a proximal telomere region forms a genomic reservoir ready to be incorporated into telomeres on ALT activation.

  12. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  13. Feasibility studies of time-like proton electromagnetic form factors at PANDA-FAIR

    Energy Technology Data Exchange (ETDEWEB)

    Dbeyssi, Alaa; Capozza, Luigi; Deiseroth, Malte; Froehlich, Bertold; Khaneft, Dmitry; Mora Espi, Maria Carmen; Noll, Oliver; Rodriguez Pineiro, David; Valente, Roserio; Zambrana, Manuel; Zimmermann, Iris [Helmholtz-Institut Mainz, Mainz (Germany); Maas, Frank [Helmholtz-Institut Mainz, Mainz (Germany); Institute of Nuclear Physics, Mainz (Germany); PRISMA Cluster of Excellence, Mainz (Germany); Marchand, Dominique; Tomasi-Gustafsson, Egle; Wang, Ying [Institut de Physique Nucleaire, Orsay (France); Collaboration: PANDA-Collaboration

    2015-07-01

    Electromagnetic form factors are fundamental quantities which describe the intrinsic electric and magnetic distributions of hadrons. Time-like proton form factors are experimentally accessible through the annihilation processes anti p+p <-> e{sup +}+e{sup -}. Their measurement in the time-like region had been limited by the low statistics achieved by the experiments. This contribution reports on the results of Monte Carlo simulations for future measurements of electromagnetic proton form factors at PANDA (antiProton ANnihilation at DArmstadt). In frame of the PANDARoot software, the statistical precision at which the proton form factors will be determined is estimated. The signal (anti p+p → e{sup +}+e{sup -}) identification and the suppression of the main background process (anti p+p → π{sup +}+π{sup -}) are studied. Different methods have been used and/or developed to generate and analyse the processes of interest. The results show that time-like proton form factors will be measured at PANDA with unprecedented statistical accuracy.

  14. Receptor tyrosine kinase-like orphan receptor 2 (ROR2) and Indian hedgehog regulate digit outgrowth mediated by the phalanx-forming region.

    Science.gov (United States)

    Witte, Florian; Chan, Danny; Economides, Aris N; Mundlos, Stefan; Stricker, Sigmar

    2010-08-10

    Elongation of the digit rays resulting in the formation of a defined number of phalanges is a process poorly understood in mammals, whereas in the chicken distal mesenchymal bone morphogenetic protein (BMP) signaling in the so-called phalanx-forming region (PFR) or digit crescent (DC) seems to be involved. The human brachydactylies (BDs) are inheritable conditions characterized by variable degrees of digit shortening, thus providing an ideal model to analyze the development and elongation of phalanges. We used a mouse model for BDB1 (Ror2(W749X/W749X)) lacking middle phalanges and show that a signaling center corresponding to the chick PFR exists in the mouse, which is diminished in BDB1 mice. This resulted in a strongly impaired elongation of the digit condensations due to reduced chondrogenic commitment of undifferentiated distal mesenchymal cells. We further show that a similar BMP-based mechanism accounts for digit shortening in a mouse model for the closely related condition BDA1 (Ihh(E95K/E95K)), altogether indicating the functional significance of the PFR in mammals. Genetic interaction experiments as well as pathway analysis in BDB1 mice suggest that Indian hedgehog and WNT/beta-catenin signaling, which we show is inhibited by receptor tyrosine kinase-like orphan receptor 2 (ROR2) in distal limb mesenchyme, are acting upstream of BMP signaling in the PFR.

  15. Distribution of various forms of Cd, Pb and Cu in the Wadge Bank region (Arabian Sea)

    Digital Repository Service at National Institute of Oceanography (India)

    George, M.D.

    Labile, nonlabile and particulate forms of Cd,Pb and Cu were determined in 29 water samples collected from a depth of 5 m, from the Wadge Bank area. Labile Cd varied from 0.1 to 0.2 mu g.l-1 while nonlabile fraction was in the range 0.1 to 0.3 mu gl...

  16. The Southern HII Region Discovery Survey: The Bright Catalog

    Science.gov (United States)

    Wenger, Trey V.; Dickey, John M.; Jordan, Christopher H.; Balser, Dana; Armentrout, William Paul; Anderson, Loren; Bania, Thomas; Dawson, Joanne; McClure-Griffiths, Naomi M.; Shea, Jeanine

    2018-01-01

    HII regions, the zones of ionized gas surrounding recently formed high-mass stars, are the archetypical tracers of Galactic structure. The census of Galactic HII regions in the Southern sky is vastly incomplete due to a lack of sensitive radio recombination line (RRL) surveys. The Southern HII Region Discovery Survey (SHRDS) is a 900-hour Australia Telescope Compact Array cm-wavelength RRL and continuum emission survey of hundreds of third and fourth quadrant Galactic HII region candidates. These candidates are identified in the Widefield Infrared Survey Explorer (WISE) Catalog of Galactic HII Regions based on coincident 10 micron (WISE) and 20 cm (Southern Galactic Plane Survey) emission. The SHRDS is an extension of HII Region Discovery Surveys in the Northern sky with the Green Bank Telescope and Arecibo Telescope which discovered ~800 new HII regions. In the first 500 hours of the SHRDS, we targeted the 249 brightest HII region candidates and 33 previously known HII regions. We discuss the data reduction, analysis, and preliminary results from this first stage of the survey.

  17. The unexpectedly large proportion of high-mass star-forming cores in a Galactic mini-starburst

    Science.gov (United States)

    Motte, F.; Nony, T.; Louvet, F.; Marsh, K. A.; Bontemps, S.; Whitworth, A. P.; Men'shchikov, A.; Nguyáën Luong, Q.; Csengeri, T.; Maury, A. J.; Gusdorf, A.; Chapillon, E.; Könyves, V.; Schilke, P.; Duarte-Cabral, A.; Didelon, P.; Gaudel, M.

    2018-04-01

    Understanding the processes that determine the stellar initial mass function (IMF) is a critical unsolved problem, with profound implications for many areas of astrophysics1. In molecular clouds, stars are formed in cores—gas condensations sufficiently dense that gravitational collapse converts a large fraction of their mass into a star or small clutch of stars. In nearby star-formation regions, the core mass function (CMF) is strikingly similar to the IMF, suggesting that the shape of the IMF may simply be inherited from the CMF2-5. Here, we present 1.3 mm observations, obtained with the Atacama Large Millimeter/submillimeter Array telescope, of the active star-formation region W43-MM1, which may be more representative of the Galactic-arm regions where most stars form6,7. The unprecedented resolution of these observations reveals a statistically robust CMF at high masses, with a slope that is markedly shallower than the IMF. This seriously challenges our understanding of the origin of the IMF.

  18. The unexpectedly large proportion of high-mass star-forming cores in a Galactic mini-starburst

    Science.gov (United States)

    Motte, F.; Nony, T.; Louvet, F.; Marsh, K. A.; Bontemps, S.; Whitworth, A. P.; Men'shchikov, A.; Nguyen Luong, Q.; Csengeri, T.; Maury, A. J.; Gusdorf, A.; Chapillon, E.; Könyves, V.; Schilke, P.; Duarte-Cabral, A.; Didelon, P.; Gaudel, M.

    2018-06-01

    Understanding the processes that determine the stellar initial mass function (IMF) is a critical unsolved problem, with profound implications for many areas of astrophysics1. In molecular clouds, stars are formed in cores—gas condensations sufficiently dense that gravitational collapse converts a large fraction of their mass into a star or small clutch of stars. In nearby star-formation regions, the core mass function (CMF) is strikingly similar to the IMF, suggesting that the shape of the IMF may simply be inherited from the CMF2-5. Here, we present 1.3 mm observations, obtained with the Atacama Large Millimeter/submillimeter Array telescope, of the active star-formation region W43-MM1, which may be more representative of the Galactic-arm regions where most stars form6,7. The unprecedented resolution of these observations reveals a statistically robust CMF at high masses, with a slope that is markedly shallower than the IMF. This seriously challenges our understanding of the origin of the IMF.

  19. Integration project of regional markets in Europe (European directive)

    International Nuclear Information System (INIS)

    Gonzalez Fernandez-Castaneda, J. J.

    2010-01-01

    The article presents the current situation of the Day-Ahead electricity markets in the different countries and Regions along West Europe. It describes the different possibilities applied to congestion management in the borders between countries and price areas, and the options employed to couple Day-ahead markets to form regional markets in Europe. Finally, it presents the initiative to Price couple Regional markets (PCR) that is being developed by Nord pool spot, EPEX Spot and OMEL with the objective to advance towards the integration of the markets that they operate in the internal Electricity Market. (Author)

  20. A structural study of lamellar phases formed by nucleoside-functionalized lipids

    Energy Technology Data Exchange (ETDEWEB)

    Berti, D.; Fratini, E.; Baglioni, P. [Department of Chemistry and CSGI, University of Florence, Via G. Capponi 9, 50121 Florence (Italy); Dante, S.; Hauss, T. [Berlin Neutron Scattering Center, Hahn Meitner Institut, Glienicker Strasse 100, Wannsee, 14109 Berlin (Germany)

    2002-07-01

    We report a neutron-scattering investigation of lamellar phases formed by novel phospholipids bearing nucleosides at the polar-head-group region. These nucleolipids can interact through stacking and H-bond interactions, following a pattern that resembles base-base coupling in natural nucleic acids (DNA, RNA), i.e. they have similar recognition properties. Bilayer stacks formed of DPP-adenosine, DPP-uridine and their 1:1 mixture were investigated after equilibration in a 98% relative humidity atmosphere. The DPP-adenosine spectrum can be accounted for (in analogy to DPPC) by a lamellar phase with a smectic period of about 60 A. DPP-uridine displays a not so straightforward behavior that we have tentatively ascribed to the coexistence of lamellae with different smectic periods. In the 1:1 mixture the lamellar mesophase of DPP-uridine is retained, suggesting a specific interaction of the uridine polar-head group with the adenosine moiety of DPP-adenosine. It should be stressed that this behavior can be considered as an indication of the recognition process occurring at the polar-head-group region of the mixed phospholiponucleoside membrane. (orig.)

  1. Digitisation Project Planning in the Maribor City Library as a Form of Regional Cross Institutional Cooperation

    Directory of Open Access Journals (Sweden)

    Nina Hriberšek Vuk

    2013-09-01

    Full Text Available EXTENDED ABSTRACT:More and more Slovenian public libraries have been facing the question of selection criteria for digitisation of library materials as well as the issue of financial resources, copyright permission and the promotion of digitised materials. Libraries having long tradition of collecting valuable local history resources are more convinced about the selection criteria. Digitisation is, in spite of being expensive, time consuming and labour intensive, an easy method to enable quick access to library materials, to promote and preserve library collections. The mission of the central regional public library (cofinanced by the Ministry of Culture is not only to coordinate the collection, cataloguing and storage of local history resources but also to coordinate local history digital projects. Due to historical circumstances, the local history resources were first collected by the Maribor University Library. It is only in the recent past that the Maribor City Library has started to systematically collect these materials. Due to this fact, the Maribor City Library does not hold an extensive collection of rare and valuable local history items. It was initially faced with the problem of selection criteria for digitisation. However, it soon succeeded to establish the strategy to promote the local history collections in the region, regardless of their location. Thus the library started to cooperate with different regional institutions and the first partner projects were designed. In the year 2007 the library collaborated with the elementary school at Lovrenc na Pohorju and decided to digitise research papers of ex-pupils of the school. The first part of the project was accomplished in 2007 when 72 research papers were digitised, in the next two years their number was increased as the second part of the project was concluded. The papers were published on the KAMRA portal and the project was promoted at the summer annual meeting at Lovrenc na

  2. [CII] dynamics in the S140 region

    Energy Technology Data Exchange (ETDEWEB)

    Dedes, C. [ETH Zurich, Institute for Astronomy, Zurich (Switzerland); Röllig, M.; Okada, Y.; Ossenkopf, V. [1. Physikalisches Institut Universität Köln (Germany); Mookerjea, B. [Tata Institute of Fundamental Research, Mumbai (India); Collaboration: WADI Team

    2015-01-22

    We report the observation of [C II] emission in a cut through the S140 region together with single pointing observations of several molecular tracers, including hydrides, in key regions of the photon-dominated region (PDR) and molecular cloud [1]. At a distance of 910 pc, a BOV star ionizes the edge of the molecular cloud L1204, creating S140. In addition, the dense molecular cloud hosts a cluster of embedded massive young stellar objects only 75' from the H II region [e.g. 2, 3]. We used HIFI on Herschel to observe [CII] in a strip following the direction of the impinging radiation across the ionisation front and through the cluster of embedded YSOs. With [C II], we can trace the ionising radiation and, together with the molecular tracers such as CO isotopologues and HCO{sup +}, study the dynamical processes in the region. Combining HIFIs high spectral resolution data with ground based molecular data allows us to study the dynamics and excitation conditions both in the ionization front and the dense molecular star forming region and model their physical conditions [4].

  3. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  4. Urban agglomerations in the function of regional integration of Serbia in South-Eastern Europe

    Directory of Open Access Journals (Sweden)

    Tošić Dragutin

    2005-01-01

    Full Text Available In this article is analyzed the importance of urban agglomerations in the regional organization of Serbian space at one side, and on the other side they are taken as carriers of the future integration of the Serbian urban system into the urban of the South-Eastern Europe (SEE. In the regional configuration of Serbia, more different forms of territorial impacts of urbanization, urban areas and urban regions. High level of urban centralization is formed under the influence of the population density and functions of the metropolitan area of Belgrade. The problems of unbalanced disposition of population growth and qualitative transformation of urban centers are stressed and analyzed. Based on the role in integration process in the SEE, the metropolitan region of Belgrade is pointed out as its principal carrier and the metropolitan region of Niš as its secondary carrier, as well as the urban centers of importance for the cross-border regional cooperation. As the most suitable instrument of internal regional integration the model of Functional Urban Regions (FURs or Functional Urban Areas (FUAs is proposed, and for external regional integration is proposed the model of Metropolitan European Growth Areas (MEGAs. The coherent short-term and long-term development strategies for Serbian towns and their regions seem absent.

  5. Search of the Griffiths shield region

    International Nuclear Information System (INIS)

    Wei, I.C.; Scott, R.L.

    1988-01-01

    The van der Walls equation of state for binary mixtures has been used to determine the location and shape of the Griffiths shield region (where three tricritical lines intersect). If one takes the geometric means for a 12 , the arithmetic mean for b 12 , and the configurational free energy as ideal, the center of the Griffiths shield region is found only when the ratio of molecular sizes is infinite. When the Flory equation for the configurational free energy for mixtures of chain molecules is substituted for the ideal form, the results appear to be somewhat different. However, for all the cases studied, with systems which approach geometric mean behavior one finds the shield region only when the ratio of molecular size is very large and when the internal pressure of the small molecule is very much greater than that of the long-chain molecule

  6. Characterizing the Interstellar and Circumgalactic Medium in Star-forming Galaxies

    Science.gov (United States)

    Du, Xinnan; Shapley, Alice; Crystal Martin, Alison Coil, Charles Steidel, Tucker Jones, Daniel Stark, Allison Strom

    2018-01-01

    Rest-frame UV and optical spectroscopy provide valuable information on the physical properties of the neutral and ionized interstellar medium (ISM) in star-forming galaxies, including both the systemic interstellar component originating from HII regions, and the multi-phase outflowing component associated with star-formation feedback. My thesis focuses on both the systemic and outflowing ISM in star-forming galaxies at redshift z ~ 1-4. With an unprecedented sample at z~1 with the rest-frame near-UV coverage, we examined how the kinematics of the warm and cool phrases of gas, probed by the interstellar CIV and low-ionization features, respectively, relate to each other. The spectral properties of CIV strongly correlate with the current star-formation rate, indicating a distinct nature of highly-ionized outflowing gas being driven by massive star formation. Additionally, we used the same set of z~1 galaxies to study the properties of the systemic ISM in HII regions by analyzing the nebular CIII] emission. CIII] emission tends to be stronger in lower-mass, bluer, and fainter galaxies with lower metallicity, suggesting that the strong CIII] emitters at lower redshifts can be ideal analogs of young, bursty galaxies at z > 6, which are possibly responsible for reionizing the universe. We are currently investigating the redshift evolution of the neutral, circumgalactic gas in a sample of ~1100 Lyman Break Galaxies at z ~ 2-4. The negative correlation between Lya emission and low-ionization interstellar absorption line strengths appears to be universal across different redshifts, but the fine-structure line emitting regions are found to be more compact for higher-redshift galaxies. With the detailed observational constraints provided by the rest-UV and rest-optical spectroscopy, our study sheds light on how the interstellar and circumgalactic gas components and different phases of gas connect to each other, and therefore provides a comprehensive picture of the overall

  7. Experimental evidence of a chaotic region in a neural pacemaker

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Hua-Guang, E-mail: guhuaguang@tongji.edu.cn [School of Aerospace Engineering and Applied Mechanics, Tongji University, Shanghai 200092 (China); Department of Electronic Engineering, City University of Hong Kong, Hong Kong SAR (China); Jia, Bing [School of Aerospace Engineering and Applied Mechanics, Tongji University, Shanghai 200092 (China); Chen, Guan-Rong [Department of Electronic Engineering, City University of Hong Kong, Hong Kong SAR (China)

    2013-03-15

    In this Letter, we report the finding of period-adding scenarios with chaos in firing patterns, observed in biological experiments on a neural pacemaker, with fixed extra-cellular potassium concentration at different levels and taken extra-cellular calcium concentration as the bifurcation parameter. The experimental bifurcations in the two-dimensional parameter space demonstrate the existence of a chaotic region interwoven with the periodic region thereby forming a period-adding sequence with chaos. The behavior of the pacemaker in this region is qualitatively similar to that of the Hindmarsh–Rose neuron model in a well-known comb-shaped chaotic region in two-dimensional parameter spaces.

  8. Spatiotemporal patterns formed by deformed adhesive in peeling

    International Nuclear Information System (INIS)

    Yamazaki, Yoshihiro; Toda, Akihiko

    2007-01-01

    Dynamical properties of peeling an adhesive tape are investigated experimentally as an analogy of sliding friction. An adhesive tape is peeled by pulling an elastic spring connected to the tape. Controlling its spring constant k and pulling speed V, peel force is measured and spatiotemporal patterns formed on the peeled tape by deformed adhesive are observed. It is found that there exist two kinds of adhesive state in peeling front. The emergence of multiple states is caused by the stability of a characteristic structure (tunnel structure) formed by deformed adhesive. Tunnel structures are distributed spatiotemporally on adhesive tape after peeling. Based on the spatiotemporal distribution, a morphology-dynamical phase diagram is constructed on k-V space and is divided into the four regions: (A) uniform pattern with tunnel structure, (B) uniform pattern without tunnel structure, (C) striped pattern with oscillatory peeling, and (D) spatiotemporally coexistent pattern

  9. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  10. On the sensitivity of nucleon-nucleon correlations to the form of short-range potential

    International Nuclear Information System (INIS)

    Gmitro, M.; Kvasil, J.; Lednicky, R.; Lyuboshitz, V.L.

    1986-01-01

    Nucleon-nucleon correlation characteristics are calculated for several phenomenological and realistic strong potentials. The results show that a square-well potential reasonably well approximates the nucleon-nucleon interaction if one calculates the correlations between nucleons generated in a region with an r.m.s. radius larger than 1.5-2 fm. Vice versa, the correlations of nucleons emitted from a smaller generation region are sensitive to the form of the assumed nucleon-nucleon potential. (author)

  11. Changes in transport behavior during the financial crisis. An analysis of urban form, location and transport behavior in the greater Copenhagen area 2006-2011

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    2015-01-01

    A multitude of studies have focussed on the connections between urban form, location and transport behavior to inform sustainable and resilient urban planning. However, few have studied the stability of urban form and location effects under changing economic conditions. This paper presents...... an analysis of the changes in urban form and location correlates of travel distances in the Danish Zealand/Copenhagen region from before the financial crisis (2006/07) to some years after the financial downturn (2010/11). Significant changes are found in the socio-economic as well as urban form and location....../destinations. It follows that the location pattern, the geographical configuration of the urban region, is a factor in households' adaptive strategies which partly determine the possibilities for reducing travel and the possibilities for adaption and regional resilience....

  12. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods

    Directory of Open Access Journals (Sweden)

    Marina ZHURAVSKAYA

    2014-12-01

    Full Text Available In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the experience of European and Asian countries and the opportunity to adapt the best foreign experience to Russian conditions. On the basis of artificial intelligence methods for forest industry complex of Sverdlovskaya Oblast the algorithm of problem solution of an optimal logistic infrastructure allocation is offered and some results of a regional transport network are presented. These methods allowed to solve the set task in the conditions of information uncertainty. There are suggestions on the improvement of transport and logistic network in the territory of Sverdlovskaya Oblast. Traditionally the logistics of mineral fuel plays main role in regions development. Actually it is required to develop logistic strategic plans to be able to provide different possibilities of power-supply, flexible enough to change with the population density, transport infrastructure and demographics of different regions. The problem of logistic centers allocation was studied by many authors. The approach, offered by the authors of this paper is to solve the set of tasks by applying artificial intelligence methods, such as fuzzy set theory and genetic algorithms.

  13. THE BOLOCAM GALACTIC PLANE SURVEY. III. CHARACTERIZING PHYSICAL PROPERTIES OF MASSIVE STAR-FORMING REGIONS IN THE GEMINI OB1 MOLECULAR CLOUD

    International Nuclear Information System (INIS)

    Dunham, Miranda K.; Evans, Neal J.; Harvey, Paul; Merello, Manuel; Rosolowsky, Erik; Cyganowski, Claudia J.; Aguirre, James; Bally, John; Battersby, Cara; Ginsburg, Adam; Glenn, Jason; Stringfellow, Guy S.; Bradley, Eric Todd; Dowell, Darren; Drosback, Meredith; Schlingman, Wayne; Shirley, Yancy L.; Walawender, Josh; Williams, Jonathan P.

    2010-01-01

    We present the 1.1 mm Bolocam Galactic Plane Survey (BGPS) observations of the Gemini OB1 molecular cloud complex, and targeted NH 3 observations of the BGPS sources. When paired with molecular spectroscopy of a dense gas tracer, millimeter observations yield physical properties such as masses, radii, mean densities, kinetic temperatures, and line widths. We detect 34 distinct BGPS sources above 5σ = 0.37 Jy beam -1 with corresponding 5σ detections in the NH 3 (1,1) transition. Eight of the objects show water maser emission (20%). We find a mean millimeter source FWHM of 1.12 pc and a mean gas kinetic temperature of 20 K for the sample of 34 BGPS sources with detections in the NH 3 (1,1) line. The observed NH 3 line widths are dominated by non-thermal motions, typically found to be a few times the thermal sound speed expected for the derived kinetic temperature. We calculate the mass for each source from the millimeter flux assuming the sources are isothermal and find a mean isothermal mass within a 120'' aperture of 230 ± 180 M sun . We find a total mass of 8400 M sun for all BGPS sources in the Gemini OB1 molecular cloud, representing 6.5% of the cloud mass. By comparing the millimeter isothermal mass to the virial mass calculated from the NH 3 line widths within a radius equal to the millimeter source size, we find a mean virial parameter (M vir /M iso ) of 1.0 ± 0.9 for the sample. We find mean values for the distributions of column densities of 1.0 x 10 22 cm -2 for H 2 , and 3.0 x 10 14 cm -2 for NH 3 , giving a mean NH 3 abundance of 3.0 x 10 -8 relative to H 2 . We find volume-averaged densities on the order of 10 3 -10 4 cm -3 . The sizes and densities suggest that in the Gem OB1 region the BGPS is detecting the clumps from which stellar clusters form, rather than smaller, higher density cores where single stars or small multiple systems form.

  14. Massive three-loop form factor in the planar limit

    Energy Technology Data Exchange (ETDEWEB)

    Henn, Johannes [PRISMA Cluster of Excellence, Johannes Gutenberg University,Staudingerweg 9, 55099 Mainz (Germany); Smirnov, Alexander V. [Research Computing Center, Moscow State University,119991 Moscow (Russian Federation); Smirnov, Vladimir A. [Skobeltsyn Institute of Nuclear Physics of Moscow State University,119991 Moscow (Russian Federation); Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany); Steinhauser, Matthias [Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany)

    2017-01-17

    We compute the three-loop QCD corrections to the massive quark-anti-quark-photon form factors F{sub 1} and F{sub 2} in the large-N{sub c} limit. The analytic results are expressed in terms of Goncharov polylogarithms. This allows for a straightforward numerical evaluation. We also derive series expansions, including power suppressed terms, for three kinematic regions corresponding to small and large invariant masses of the photon momentum, and small velocities of the heavy quarks.

  15. Proposals for regional cooperation in Africa

    International Nuclear Information System (INIS)

    Kleywegt, R.J.

    1999-01-01

    The CTBTO Prep Com is overseeing the rapid establishment of the verification-related means for the future CTBTO. It encourages support and participation in its development and would like to ensure that ancillary benefits are identified and utilised. One such benefit is to be derived from the global expertise, data and information which are developed and generated through its activities. This is particularly so in the field of seismology where the rapidly developing field of engineering seismology is dependent on quality data over an extended period. A national seismological capability is essential for countries that wish/expect to develop rapidly in the next few decades. Tremendous benefit can be derived by utilizing the verification-related monitoring data and information products of the CTBTO Prep Com, by making the organization (International Cooperation Section) aware of all national seismological needs and by interacting with member states. A regional co-operative programme or structure could be of benefit to countries to link with the CTBTO Prep Com in Vienna or for addressing problems common to a region. There are a number of regional organisations in Africa that can house or provide some form of support to further the cause of envisaged regional co-operative endeavours. The terms of reference and mechanisms by which the regional endeavours will operate should preferably be set up by the participating states within each region

  16. U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization?; Comment on “Decentralisation of Health Services in Fiji: A Decision Space Analysis”

    Directory of Open Access Journals (Sweden)

    Arturo Vargas Bustamante

    2016-09-01

    Full Text Available For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization.

  17. Is liberal independent dental practice in danger? Assessing forms of dental practice in the European Regional Organization (ERO) zone of the FDI World Dental Federation.

    Science.gov (United States)

    Wolf, Thomas Gerhard; Seeberger, Gerhard Konrad; Callaway, Angelika; Briseño-Marroquín, Benjamín; Rusca, Philippe; Frank, Michael; Otterbach, Ernst-Jürgen

    2018-02-26

    A trend towards increasingly new forms of dental practice has been observed in the FDI World Dental Federation. Elementary foundations such as the free dentist and therapy choice, and independent, free, self-responsible professional practice may be undermined. The current study is aimed at analyzing the general training framework, organization, and professional types of dental practice in the European Regional Organization (ERO) zone and at critically discussing selected aspects of changes in the dental profession. A questionnaire was developed by the ERO Working-Group "Liberal Dental Practice." Information about dental schools, professional organizations, dental practice regulations, and ambulatory healthcare centers was analyzed. Self-employed dental practice is the most common type of practice (51.7%). Dentists are allowed to work independently immediately after graduation (72.7%). Approximately one-third are organized as compulsory members in chambers/corporations. The density of dentists has a mean of 1,570 inhabitants per dentist. In most countries, there are no special rules for founding dental ambulatory healthcare centers. In a total of 353 universities of the ERO countries surveyed, 16,619 dentists per year were trained, with a trend toward a higher percentage of female students (63%). Despite modern forms of dental practice, the charter of the individual liberal dental profession (CED et al, 2013) should be respected and taken into account on the basis of ethical principles. The commercialization of the dental profession can be neutralized only by establishing and following well-defined ethical principles; oral healthcare quality can thus be ensured without the influence of third parties.

  18. Investigation of chemical forms of elements in surface waters

    International Nuclear Information System (INIS)

    Varshal, G.M.; Velyukhanova, T.K.; Koshcheeva, I.Ya.; Dorofeeva, V.A.; Buachidze, N.S.; Kasimova, O.G.; Makharadze, G.A.

    1983-01-01

    The main trends in the research of the state of elements in natural waters are examined. The hydrolysis of CU(2), Hg(2), Au(3), Sb(3), Ru(4) over a pH range, specific for natural waters, has been studied by solubility and paper electrophoresis technnques and by filtration through cellulose ionites. The regions of predominating different forms of hydroxo complexes have been found and the thermodynamic constants of hydrolysis equilibria have been calculated. Solubility, filtration through sephadexes and cellulose ionites, paper electrophoresis techniques were used to study the complexation of Cu(2), Hg(2), Au(3), Sb(3), Ru(4) with fulvic acids. Some data have been obtained on the composition, stability and molecular-mass distribution of fulvate complexes of ten elements in different oxidation states. High-molecular anionic fulvate complexes are among main forms of most easily hydrolysed elments in solution. The possibility has been shown of prediction of the ratio of coexisting forms of trace elements in solution by theoretical calculations and experimentally Using fractionation on cellulose ionites and sephadexes

  19. The W40 region in the gould belt: An embedded cluster and H II region at the junction of filaments

    Energy Technology Data Exchange (ETDEWEB)

    Mallick, K. K.; Ojha, D. K. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Homi Bhabha Road, Colaba, Mumbai 400005 (India); Kumar, M. S. N. [Centro de Astrofísica da Universidade do Porto, Rua das Estrelas, 4150-762 s/n Porto (Portugal); Bachiller, Rafael [Observatorio Astronómico Nacional (IGN), Alfonso XII 3, E-28014 Madrid (Spain); Samal, M. R. [Aix Marseille Université, CNRS, LAM (Laboratoire d' Astrophysique de Marseille), UMR 7326, F-13388 Marseille (France); Pirogov, L., E-mail: kshitiz@tifr.res.in [Institute of Applied Physics, Russian Academy of Sciences, 46 Uljanov str., Nizhny Novgorod 603950 (Russian Federation)

    2013-12-20

    We present a multiwavelength study of the W40 star-forming region using infrared (IR) observations in the UKIRT JHK bands, Spitzer Infrared Array Camera bands, and Herschel PACS bands, 2.12 μm H{sub 2} narrowband imaging, and radio continuum observations from GMRT (610 and 1280 MHz), in a field of view (FoV) of ∼34' × 40'. Archival Spitzer observations in conjunction with near-IR observations are used to identify 1162 Class II/III and 40 Class I sources in the FoV. The nearest-neighbor stellar surface density analysis shows that the majority of these young stellar objects (YSOs) constitute the embedded cluster centered on the high-mass source IRS 1A South. Some YSOs, predominantly the younger population, are distributed along and trace the filamentary structures at lower stellar surface density. The cluster radius is measured to be 0.44 pc—matching well with the extent of radio emission—with a peak density of 650 pc{sup –2}. The JHK data are used to map the extinction in the region, which is subsequently used to compute the cloud mass—126 M {sub ☉} and 71 M {sub ☉} for the central cluster and the northern IRS 5 region, respectively. H{sub 2} narrowband imaging shows significant emission, which prominently resembles fluorescent emission arising at the borders of dense regions. Radio continuum analysis shows that this region has a blister morphology, with the radio peak coinciding with a protostellar source. Free-free emission spectral energy distribution analysis is used to obtain physical parameters of the overall photoionized region and the IRS 5 sub-region. This multiwavelength scenario is suggestive of star formation having resulted from the merging of multiple filaments to form a hub. Star formation seems to have taken place in two successive epochs, with the first epoch traced by the central cluster and the high-mass star(s)—followed by a second epoch that is spreading into the filaments as uncovered by the Class I sources and even

  20. FEATURES OF TERRITORIAL INTEGRATION OF MARKETING COMMUNICATIONS IN THE CAUCASIAN MINERAL WATERS REGION

    Directory of Open Access Journals (Sweden)

    Михаил Влидимирович Беляев

    2013-10-01

    Full Text Available The purpose of the work is to describe the situation taken place with integration of marketing communications in the region. The author conducted research aimed at identifying the most popular and effective forms of communication with the consumer, allowing in detail to characterize the state of the advertising market of Caucasian Mineral Waters. Information concluded in article may be used by companies present in the Caucasian Mineral Waters region, to form notion about the effectiveness of the regional channels of communication with customers and building a more efficient model of advertising policy, also its could be useful for specialists, which are working in marketing communication and advertising sphere.DOI: http://dx.doi.org/10.12731/2218-7405-2013-9-34

  1. The Al-rich region of the Al–Fe–Mn alloy system

    International Nuclear Information System (INIS)

    Balanetskyy, S.; Pavlyuchkov, D.; Velikanova, T.; Grushko, B.

    2015-01-01

    Highlights: • Constitution of Al–Fe–Mn was studied above 50 at.% Al at 650–1070 °C. • AlMn (A2) and AlFe (B2) phases form a continuous compositional region. • Al 8 Mn 5 and Al 8 Fe 5 γ-brass type phases form a continuous compositional region. • Al 13 Fe 4 , Al 5 Fe 2 , Al 2 Fe, Al 6 Mn, Al 11 Mn 4 , γ 2 exhibit wide ternary extensions. • Four ternary intermetallics were revealed. - Abstract: Phase equilibria in the Al-rich region of the Al–Fe–Mn alloy system were studied at 1070, 1020, 950, 875, 800, 740, 695 and 650 °C. The continuous region of the bcc solid solution was estimated between the Al–Mn and Al–Fe terminals. Also the isostructural high-temperature Al–Mn and Al–Fe γ 1 -phases (γ-brass type structure) form continuous regions. The Al 6 Mn, high-temperature T-Al 11 Mn 4 and low-temperature γ 2 phases dissolve up to 9.0, 14.5 and 31.0 at.% Fe, respectively, while the M-Al 13 Fe 4 , Al 5 Fe 2 and Al 2 Fe phases dissolve up to 15.5, 11.5 and 10.0 at.% Mn, respectively. The thermodynamically stable decagonal D 3 -phase with periodicity of 1.25 nm in the specific direction and two periodic intermetallics designated φ (P6 3 /mmc; a = 0.7554, c = 0.7872 nm) and κ (P6 3 /m; a = 1.7630, c = 1.2506 nm) were identified. An additional ternary phase of unknown structure was also revealed

  2. Characterization of Nitride Layers Formed by Nitrogen Ion Implantation into Surface Region of Iron

    International Nuclear Information System (INIS)

    Sudjatmoko; Subki, M. Iyos R.

    2000-01-01

    Ion implantation is a convenient means of modifying the physical and chemical properties of the near-surface region of materials. The nitrogen implantation into pure iron has been performed at room temperature with ion dose of 1.310 17 to 1.310 18 ions/cm 2 and ion energy of 20 to 100 keV. The optimum dose of nitrogen ions implanted into pure iron was around 2.2310 17 ions/cm 2 in order to get the maximum wear resistant. SEM micrographs and EDX show that the nitride layers were found on the surface of substrate. The nitrogen concentration profile was measured using EDX in combination with spot technique, and it can be shown that the depth profile of nitrogen implanted into substrate was nearly Gaussian. (author)

  3. Star-forming galaxy models: Blending star formation into TREESPH

    Science.gov (United States)

    Mihos, J. Christopher; Hernquist, Lars

    1994-01-01

    We have incorporated star-formation algorithms into a hybrid N-body/smoothed particle hydrodynamics code (TREESPH) in order to describe the star forming properties of disk galaxies over timescales of a few billion years. The models employ a Schmidt law of index n approximately 1.5 to calculate star-formation rates, and explicitly include the energy and metallicity feedback into the Interstellar Medium (ISM). Modeling the newly formed stellar population is achieved through the use of hybrid SPH/young star particles which gradually convert from gaseous to collisionless particles, avoiding the computational difficulties involved in creating new particles. The models are shown to reproduce well the star-forming properties of disk galaxies, such as the morphology, rate of star formation, and evolution of the global star-formation rate and disk gas content. As an example of the technique, we model an encounter between a disk galaxy and a small companion which gives rise to a ring galaxy reminiscent of the Cartwheel (AM 0035-35). The primary galaxy in this encounter experiences two phases of star forming activity: an initial period during the expansion of the ring, and a delayed phase as shocked material in the ring falls back into the central regions.

  4. Light Cone Sum Rules for gamma*N ->Delta Transition Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    V.M. Braun; A. Lenz; G. Peters; A. Radyushkin

    2006-02-01

    A theoretical framework is suggested for the calculation of {gamma}* N {yields} {Delta} transition form factors using the light-cone sum rule approach. Leading-order sum rules are derived and compared with the existing experimental data. We find that the transition form factors in a several GeV region are dominated by the ''soft'' contributions that can be thought of as overlap integrals of the valence components of the hadron wave functions. The ''minus'' components of the quark fields contribute significantly to the result, which can be reinterpreted as large contributions of the quark orbital angular momentum.

  5. Regional analysis of the nuclear-electricity

    International Nuclear Information System (INIS)

    Parera, M. D.

    2011-11-01

    In this study was realized a regional analysis of the Argentinean electric market contemplating the effects of regional cooperation, the internal and international interconnections; and the possibilities of insert of new nuclear power stations were evaluated in different regions of the country, indicating the most appropriate areas to carry out these facilities to increase the penetration of the nuclear energy in the national energy matrix. Also was studied the interconnection of the electricity and natural gas markets, due to the existent linking among both energy forms. With this purpose the program Message (Model for energy supply strategy alternatives and their general environmental impacts) was used, promoted by the International Atomic Energy Agency. This model carries out an economic optimization level country, obtaining the minimum cost as a result for the modeling system. The division for regions realized by the Compania Administradora del Mercado Mayorista Electrico (CAMMESA) was used, which divides to the country in eight regions. They were considered the characteristics and necessities of each one of them, their respective demands and offers of electric power and natural gas, as well as their existent and projected interconnections, composed by the electric lines and gas pipes. According to the results obtained through the model, the nuclear-electricity is a competitive option. (Author)

  6. Search for OB stars running away from young star clusters. II. The NGC 6357 star-forming region

    Science.gov (United States)

    Gvaramadze, V. V.; Kniazev, A. Y.; Kroupa, P.; Oh, S.

    2011-11-01

    Dynamical few-body encounters in the dense cores of young massive star clusters are responsible for the loss of a significant fraction of their massive stellar content. Some of the escaping (runaway) stars move through the ambient medium supersonically and can be revealed via detection of their bow shocks (visible in the infrared, optical or radio). In this paper, which is the second of a series of papers devoted to the search for OB stars running away from young ( ≲ several Myr) Galactic clusters and OB associations, we present the results of the search for bow shocks around the star-forming region NGC 6357. Using the archival data of the Midcourse Space Experiment (MSX) satellite and the Spitzer Space Telescope, and the preliminary data release of the Wide-Field Infrared Survey Explorer (WISE), we discovered seven bow shocks, whose geometry is consistent with the possibility that they are generated by stars expelled from the young (~1-2 Myr) star clusters, Pismis 24 and AH03 J1725-34.4, associated with NGC 6357. Two of the seven bow shocks are driven by the already known OB stars, HD 319881 and [N78] 34. Follow-up spectroscopy of three other bow-shock-producing stars showed that they are massive (O-type) stars as well, while the 2MASS photometry of the remaining two stars suggests that they could be B0 V stars, provided that both are located at the same distance as NGC 6357. Detection of numerous massive stars ejected from the very young clusters is consistent with the theoretical expectation that star clusters can effectively lose massive stars at the very beginning of their dynamical evolution (long before the second mechanism for production of runaway stars, based on a supernova explosion in a massive tight binary system, begins to operate) and lends strong support to the idea that probably all field OB stars have been dynamically ejected from their birth clusters. A by-product of our search for bow shocks around NGC 6357 is the detection of three circular

  7. Budgetary Function Of Parliament In Implementing The Regional Budget Revenue And Expenditure

    Directory of Open Access Journals (Sweden)

    Idhamsyah

    2015-08-01

    Full Text Available The purpose of this research is to find and analyze the nature of budgetary functions by the House of Representatives. For find and analyze the implementation of budgetary functions by the Regional Representatives Council. The ideal model of future budgetary functions to achieve the objectives of the research methods of research conducted qualitatively analyze qualitative data were processed and analyzed with empirical normative approach regarding the existing problems of this writing. The results showed Regarding the implementation of the rights of the Budget as well as the limitation of the right budget is essentially located at the focus of the regional council to judge the legitimacy or expediency reasons of public towards the Regional Budget than technical assessment. Thus the Regional Representatives Council focusing on local budgetary strategy appropriate to peoples needs not on the technical budget figures. Implementation of budgetary function by the regional council where the implementation of the budget function must begin with the elaboration of various policies set out in the form of law in the form of work programs of government and development. As a suggestion from the author should importance of Central Sulawesi province put through coordination with regions that have implemented e-budgeting for the management of the Regional Budget of Central Sulawesi using e-budgeting system in order to manage the manufacturing budget.

  8. Interactions between motion and form processing in the human visual system.

    Science.gov (United States)

    Mather, George; Pavan, Andrea; Bellacosa Marotti, Rosilari; Campana, Gianluca; Casco, Clara

    2013-01-01

    The predominant view of motion and form processing in the human visual system assumes that these two attributes are handled by separate and independent modules. Motion processing involves filtering by direction-selective sensors, followed by integration to solve the aperture problem. Form processing involves filtering by orientation-selective and size-selective receptive fields, followed by integration to encode object shape. It has long been known that motion signals can influence form processing in the well-known Gestalt principle of common fate; texture elements which share a common motion property are grouped into a single contour or texture region. However, recent research in psychophysics and neuroscience indicates that the influence of form signals on motion processing is more extensive than previously thought. First, the salience and apparent direction of moving lines depends on how the local orientation and direction of motion combine to match the receptive field properties of motion-selective neurons. Second, orientation signals generated by "motion-streaks" influence motion processing; motion sensitivity, apparent direction and adaptation are affected by simultaneously present orientation signals. Third, form signals generated by human body shape influence biological motion processing, as revealed by studies using point-light motion stimuli. Thus, form-motion integration seems to occur at several different levels of cortical processing, from V1 to STS.

  9. Electromagnetic form factors for nucleons and pions at positive and negative q2 in the model of quark-gluon strings

    International Nuclear Information System (INIS)

    Kaidalov, A.B.; Kondratyuk, L.A.; Tchekin, D.V.

    2000-01-01

    The electromagnetic form factors for pions and nucleons are considered within the model of quark-gluon strings, where the momentum-transfer dependence of hadronic form factors is determined by the intercepts of the corresponding Regge trajectories and by the Sudakov form factor. Analytic expressions found for form factors in the timelike region admit an analytic continuation to the spacelike region. The resulting form factors for pions and nucleons comply well with experimental data both for positive and for negative values of the squared momentum transfer q 2 . It is shown that the distinctions between the absolute values of the pion and nucleon form factors F π (q 2 ), G m (q 2 ), and F 2 (q 2 ) at positive values of q 2 and those at negative values of this variable are associated with the analytic properties of the double-logarithmic term in the exponent of the Sudakov form factor. The spin structure of the amplitudes for quark transitions into hadrons that is proposed in the present study makes it possible to describe fairly well available experimental data on the Pauli form factor F 2 and on the ratio G e /G m

  10. Stratigraphy of the Descartes region /Apollo 16/ - Implications for the origin of samples

    Science.gov (United States)

    Head, J. W.

    1974-01-01

    Analysis of terrain in the Apollo 16 Descartes landing region shows a series of features that form a stratigraphic sequence which dominates the history and petrogenesis at the site. An ancient 150-km diam crater centered on the Apollo 16 site is one of the earliest recognizable major structures. Nectaris ejecta was concentrated in a regional low at the base of the back slope of the Nectaris basin to form the Descartes Mountains. Subsequently, a 60-km diam crater formed in the Descartes Mountains centered about 25 km to the west of the site. This crater dominates the geology and petrogenetic history of the site. Stone and Smoky Mountains represent the degraded terraced crater walls, and the dark matrix breccias and metaclastic rocks derived from North and South Ray craters represent floor fallback breccias from this cratering event. The interpretation is developed that the stratigraphy of the Cayley and Descartes, and thus the historical record of the Apollo 16 region, documents the complex interaction of deposits and morphology of local and regional impact cratering events. Large local 60- to 150-km diam craters have had a dramatic and previously unrecognized effect on the history and petrology of the Apollo 16 site.

  11. Genetic control of the radiosensitivity of lymphoid cells for antibody-forming ability in CXS series of recombinant inbred mouse strains

    International Nuclear Information System (INIS)

    Okumoto, M.; Mori, N.; Nishikawa, R.; Imai, S.; Hilgers, J.; Takamori, Y.; Yagasaki, O.

    1992-01-01

    Incidence of radiation-induced lymphomas differs remarkably among various mouse strains. BALB/cHeA (C) mice are highly susceptible to radiation induction of lymphomas, while STS/A (S) mice are resistant. Thus, the induction of the disease is controlled by some genetic factors. To examine an involvement of radiosensitivity of lymphoid cells in lymphomagenesis, we have compared genetic control of the radiosensitivity for antibody-forming ability with that of lymphoma development in BALB/cHeA, STS/A, (CXS)F 1 hybrids and CXS series of recombinant inbred strains. Decrease of number of splenic plaque-forming cell (PFC) in Jerne's method by 3 Gy of X-irradiation for BALB/cHeA mice was larger than that for STS/A mice by more than one order of magnitude. (CXS)F 1 hybrid mice showed small number of decrease of PFC similar to STS/A mice suggesting that phenotype of radioresistance was dominant over sensitivity. The best concordance between genetic markers and radiosensitivities of antibody-forming ability in recombinant inbred strains was observed in a region containing Igh locus on chromosome 12. The results show that one locus controlling the radioresistance of lymphoid cells for antibody-forming ability might exist in the region containing Igh locus, and that this region clearly differ from a region with Ifa locus on chromosome 4 which regulate the susceptibility to radiation-induced lymphomagenesis. (author)

  12. Innovation Forms and Mechanisms of Forming the Conception of Effective Municipal Management

    Directory of Open Access Journals (Sweden)

    Nataliya Aleksandrovna Mikhaylova

    2016-10-01

    Full Text Available A dynamic, uncertain external environment increases the dependence of the objectives of the system of state and municipal government on the conditions and the actions of environmental factors that entail a change in the behavior of the subjects of management, improving the ability of government to carry out strategic management and interaction of bodies of state and municipal authorities with the city-forming enterprises. The article revealed the lack of alternative mechanisms, based on an integrated management system industries and areas of the municipality and to improve the efficiency of the municipal administration in general. The use of innovative methods and mechanisms is important in the municipal administration. The analysis of innovative technologies and concepts of effective management of a municipality, such as: the “smart city” or high-tech city; “open city” or “open municipality”; city corporation or a city as in excess of corporation; city management is based on the model “contract manager”; quality management technology built into the system of municipal management based on the quality management system model. The analysis showed that the state and municipal institutions in many developed countries and in Russia are converted in order to improve its efficiency, ensuring higher service levels and transparency of its operations, giving a positive example for the extrapolation of the municipalities that have not yet using innovative forms and mechanisms management. In general, the application of innovative developments in the formation of the concept of effective municipal administration should be maintained as the regional and municipal authorities, as well as at the federal level, as innovation is the key to the further development of state and municipal management system.

  13. Trench process and structure for backside contact solar cells with polysilicon doped regions

    Science.gov (United States)

    De Ceuster, Denis; Cousins, Peter John; Smith, David D.

    2010-12-14

    A solar cell includes polysilicon P-type and N-type doped regions on a backside of a substrate, such as a silicon wafer. An interrupted trench structure separates the P-type doped region from the N-type doped region in some locations but allows the P-type doped region and the N-type doped region to touch in other locations. Each of the P-type and N-type doped regions may be formed over a thin dielectric layer. Among other advantages, the resulting solar cell structure allows for increased efficiency while having a relatively low reverse breakdown voltage.

  14. Locating regional health policy: Institutions, politics, and practices

    Science.gov (United States)

    Riggirozzi, Pia; Yeates, Nicola

    2015-01-01

    Poverty reduction and health became central in the agendas of Southern regional organisations in the last two decades. Yet, little is known about how these organisations address poverty, inclusion and social inequality, and how Southern regional formations are engaging in power constellations, institutions, processes, interests and ideological positions within different spheres of governance. This article reviews academic literatures spanning global social policy, regional studies and diplomacy studies, and the state of knowledge and understanding of the ‘place’ of regional actors in health governance as a global political practice therein. It identifies theoretical and thematic points of connection between disparate literatures and how these can be bridged through research focusing on the social policies of regional organisations and regional integration processes. This framework hence locates the contributions of each of the research articles of this Special Issue of Global Social Policy on the regional dimension of health policy and diplomacy in relation to Southern Africa and South America. It also highlights the ways in which the articles bring new evidence about how social relations of welfare are being (re)made over larger scales and how regional actors may initiate new norms to improve health rights in international arenas engaging in new forms of ‘regional’ diplomacy. PMID:26635495

  15. Theories and calculation methods for regional objective ET

    Institute of Scientific and Technical Information of China (English)

    QIN DaYong; LO JinYan; LIU JiaHong; WANG MingNa

    2009-01-01

    The regional objective ET (Evapotranspiration) is a new concept in water resources research, which refers to the total amount of water that could be exhausted from a region in the form of vapor per year. The objective-ET based water resources management allocates water to different regions in terms of ET. It controls the water exhausted from a region to meet the objective ET. The regional objective ET must be adapted to fit the region's local available water resources. By improving the water utilization effi-ciency and reducing the unrecoverable water in the social water circle, it is saved so that water related production is maintained or even increased under the same water consumption conditions. Regional water balance is realized by rationally deploying the available water among different industries, adjusting industrial structures, and adopting new water-saving technologies, therefore to meeting the requirements for groundwater conservation, agricultural income stability, and avoiding environmental damages. Furthermore, water competition among various departments and industries (including envi-ronmental and ecological water use) may be avoided. This paper proposes an innovative definition of objective ET, and its principles, sub-index systems. Besides, a computational method for regional ob-jective ET is developed by combining the distributed hydrological model and the soil moisture model.

  16. Efficient DNA barcode regions for classifying Piper species (Piperaceae

    Directory of Open Access Journals (Sweden)

    Arunrat Chaveerach

    2016-09-01

    Full Text Available Piper species are used for spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and insecticides. Here barcode analysis was performed for identification of plant parts, young plants and modified forms of plants. Thirty-six Piper species were collected and the three barcode regions, matK, rbcL and psbA-trnH spacer, were amplified, sequenced and aligned to determine their genetic distances. For intraspecific genetic distances, the most effective values for the species identification ranged from no difference to very low distance values. However, P. betle had the highest values at 0.386 for the matK region. This finding may be due to P. betle being an economic and cultivated species, and thus is supported with growth factors, which may have affected its genetic distance. The interspecific genetic distances that were most effective for identification of different species were from the matK region and ranged from a low of 0.002 in 27 paired species to a high of 0.486. Eight species pairs, P. kraense and P. dominantinervium, P. magnibaccum and P. kraense, P. phuwuaense and P. dominantinervium, P. phuwuaense and P. kraense, P. pilobracteatum and P. dominantinervium, P. pilobracteatum and P. kraense, P. pilobracteatum and P. phuwuaense and P. sylvestre and P. polysyphonum, that presented a genetic distance of 0.000 and were identified by independently using each of the other two regions. Concisely, these three barcode regions are powerful for further efficient identification of the 36 Piper species.

  17. Efficient DNA barcode regions for classifying Piper species (Piperaceae).

    Science.gov (United States)

    Chaveerach, Arunrat; Tanee, Tawatchai; Sanubol, Arisa; Monkheang, Pansa; Sudmoon, Runglawan

    2016-01-01

    Piper species are used for spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and insecticides. Here barcode analysis was performed for identification of plant parts, young plants and modified forms of plants. Thirty-six Piper species were collected and the three barcode regions, matK , rbcL and psbA - trnH spacer, were amplified, sequenced and aligned to determine their genetic distances. For intraspecific genetic distances, the most effective values for the species identification ranged from no difference to very low distance values. However, Piper betle had the highest values at 0.386 for the matK region. This finding may be due to Piper betle being an economic and cultivated species, and thus is supported with growth factors, which may have affected its genetic distance. The interspecific genetic distances that were most effective for identification of different species were from the matK region and ranged from a low of 0.002 in 27 paired species to a high of 0.486. Eight species pairs, Piper kraense and Piper dominantinervium , Piper magnibaccum and Piper kraense , Piper phuwuaense and Piper dominantinervium , Piper phuwuaense and Piper kraense , Piper pilobracteatum and Piper dominantinervium , Piper pilobracteatum and Piper kraense , Piper pilobracteatum and Piper phuwuaense and Piper sylvestre and Piper polysyphonum , that presented a genetic distance of 0.000 and were identified by independently using each of the other two regions. Concisely, these three barcode regions are powerful for further efficient identification of the 36 Piper species.

  18. Efficient DNA barcode regions for classifying Piper species (Piperaceae)

    Science.gov (United States)

    Chaveerach, Arunrat; Tanee, Tawatchai; Sanubol, Arisa; Monkheang, Pansa; Sudmoon, Runglawan

    2016-01-01

    Abstract Piper species are used for spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and insecticides. Here barcode analysis was performed for identification of plant parts, young plants and modified forms of plants. Thirty-six Piper species were collected and the three barcode regions, matK, rbcL and psbA-trnH spacer, were amplified, sequenced and aligned to determine their genetic distances. For intraspecific genetic distances, the most effective values for the species identification ranged from no difference to very low distance values. However, Piper betle had the highest values at 0.386 for the matK region. This finding may be due to Piper betle being an economic and cultivated species, and thus is supported with growth factors, which may have affected its genetic distance. The interspecific genetic distances that were most effective for identification of different species were from the matK region and ranged from a low of 0.002 in 27 paired species to a high of 0.486. Eight species pairs, Piper kraense and Piper dominantinervium, Piper magnibaccum and Piper kraense, Piper phuwuaense and Piper dominantinervium, Piper phuwuaense and Piper kraense, Piper pilobracteatum and Piper dominantinervium, Piper pilobracteatum and Piper kraense, Piper pilobracteatum and Piper phuwuaense and Piper sylvestre and Piper polysyphonum, that presented a genetic distance of 0.000 and were identified by independently using each of the other two regions. Concisely, these three barcode regions are powerful for further efficient identification of the 36 Piper species. PMID:27829794

  19. Nuclear power regional analysis; Análisis regional de la nucleoelectricidad

    Energy Technology Data Exchange (ETDEWEB)

    Parera, María Delia, E-mail: dparera@cnea.gov.ar [Comisión Nacional de Energía Atómica, San Martin (Argentina). Gerencia de Planificación Coordinación y Control, Subgerencia de Planificación Estratégica

    2011-07-01

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [Spanish] En el presente estudio se realizó un análisis regional del mercado eléctrico argentino contemplando los efectos de cooperación regional, las interconexiones internas e internacionales; y se evaluó las posibilidades de inserción de nuevas centrales nucleares en diferentes regiones del país, indicando las zonas más adecuadas para realizar estas instalaciones para aumentar la penetración de la energía nuclear en la matriz energética nacional. Asimismo se estudió la interconexión de los mercados de electricidad y gas natural, debido a la vinculación existente entre ambas formas de energía. Con este fin se utilizó el programa

  20. National and regional economic impacts of electricity production from energy crops in the Netherlands

    NARCIS (Netherlands)

    Vlasblom, J.; Broek, R. van den; Meeusen-van Onna, M.

    1998-01-01

    Besides the known environmental benefits, national and regional economic impacts may form additional arguments for stimulating government measures in favour of electricity production from energy crops in the Netherlands. Therefore, we compared the economic impacts (at both national and regional