WorldWideScience

Sample records for foodborne pathogen listeria

  1. [Prevalence of emerging foodborne pathogens and illness: Campylobacter and Listeria].

    Science.gov (United States)

    Ferriero, Anna Maria; Damiani, Gianfranco; Neve, Caterina Bianca; Bianchi, Aurora; Ronconi, Alessandra; Laurenti, Patrizia

    2011-01-01

    This study evaluated the proportion of food samples, examined by the Italian Istituti Zooprofilattici Sperimentali (Experimental Zooprophylactic Institutes) in the years 2000-2005, positive for Campylobacter and Listeria. A correlation was found between food samples found positive for Listeria in the years 2002-2005 and the number of hospitalisations for Listeria illness in the same years (as reported in hospital discharge abstract forms). This confirms that attention should be given in the evaluation of phenomena known to be under reported and for which data are collected and analysed by different methods.

  2. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  3. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

    Directory of Open Access Journals (Sweden)

    Sonia Lamon

    2015-01-01

    Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

  5. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  6. The use of flagella and motility for plant colonization and fitness by different strains of the foodborne pathogen Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Lisa Gorski

    Full Text Available The role of flagella and motility in the attachment of the foodborne pathogen Listeria monocytogenes to various surfaces is mixed with some systems requiring flagella for an interaction and others needing only motility for cells to get to the surface. In nature this bacterium is a saprophyte and contaminated produce is an avenue for infection. Previous studies have documented the ability of this organism to attach to and colonize plant tissue. Motility mutants were generated in three wild type strains of L. monocytogenes by deleting either flaA, the gene encoding flagellin, or motAB, genes encoding part of the flagellar motor, and tested for both the ability to colonize sprouts and for the fitness of that colonization. The motAB mutants were not affected in the colonization of alfalfa, radish, and broccoli sprouts; however, some of the flaA mutants showed reduced colonization ability. The best colonizing wild type strain was reduced in colonization on all three sprout types as a result of a flaA deletion. A mutant in another background was only affected on alfalfa. The third, a poor alfalfa colonizer was not affected in colonization ability by any of the deletions. Fitness of colonization was measured in experiments of competition between mixtures of mutant and parent strains on sprouts. Here the flaA and motAB mutants of the three strain backgrounds were impaired in fitness of colonization of alfalfa and radish sprouts, and one strain background showed reduced fitness of both mutant types on broccoli sprouts. Together these data indicate a role for flagella for some strains to physically colonize some plants, while the fitness of that colonization is positively affected by motility in almost all cases.

  7. Ralstonia insidiosa serves as bridges in biofilm formation by foodborne pathogens Listeria monocytogenes, Salmonella enterica, and enterohemorrhagic Escherichia coli

    Science.gov (United States)

    Biofilm formation on abiotic surfaces in fresh produce processing facilities might play a role in foodborne outbreaks by providing protective microniches for pathogenic bacteria. Our previous study showed that a strain of Ralstonia insidiosa isolated from a fresh produce processing plant could enhan...

  8. Interaction between Food-borne Pathogens (Campylobacter jejuni, Salmonella Typhimurium and Listeria monocytogenes) and a Common Soil Flagellate (Cercomonas sp.)

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Free-living protozoa may harbor, protect, and disperse bacteria, including those ingested and passed in viable form in feces. The flagellates are very important predators on bacteria in soil, but their role in the survival of food-borne pathogens associated with fruits and vegetables is not well...

  9. Intervention strategies for control of foodborne pathogens

    Science.gov (United States)

    Juneja, Vijay K.

    2004-03-01

    The increasing numbers of illnesses associated with foodborne pathogens such as Listeria monocytogenes and Escherichia coli O157:H7, has renewed concerns about food safety because of consumer preferences for minimally processed foods that offer convenience in availability and preparation. Accordingly, the need for better control of foodborne pathogens has been paramount in recent years. Mechanical removal of microorganisms from food can be accomplished by centrifugation, filtration, trimming and washing. Cleaning and sanitation strategies can be used for minimizing the access of microorganisms in foods from various sources. Other strategies for control of foodborne pathogens include established physical microbiocidal treatments such as ionizing radiation and heating. Research has continued to demonstrate that food irradiation is a suitable process to control and possibly eliminate foodborne pathogens, for example Listeria monocytogenes and Escherichia coli O157:H7, from a number of raw and cooked meat and poultry products. Heat treatment is the most common method in use today for the inactivation of microorganisms. Microorganisms can also be destroyed by nonthermal treatments, such as application of high hydrostatic pressure, pulsed electric fields, oscillating magnetic fields or a combination of physical processes such as heat-irradiation, or heat-high hydrostatic pressure, etc. Each of the non-thermal technologies has specific applications in terms of the types of food that can be processed. Both conventional and newly developed physical treatments can be used in combination for controlling foodborne pathogens and enhancing the safety and shelf life of foods. Recent research has focused on combining traditional preservation factors with emerging intervention technologies. However, many key issues still need to be addressed for combination preservation factors or technologies to be useful in the food industry to meet public demands for foods with enhanced safety

  10. Applied Genomics of Foodborne Pathogens

    DEFF Research Database (Denmark)

    and customized source of information designed for and accessible to microbiologists interested in applying cutting-edge genomics in food safety and public health research. This book fills this void with a well-selected collection of topics, case studies, and bioinformatics tools contributed by experts......This book provides a timely and thorough snapshot into the emerging and fast evolving area of applied genomics of foodborne pathogens. Driven by the drastic advance of whole genome shot gun sequencing (WGS) technologies, genomics applications are becoming increasingly valuable and even essential...... at the forefront of foodborne pathogen genomics research....

  11. Antibiotic Resistance in Foodborne Pathogens

    OpenAIRE

    Walsh, Ciara; Duffy, Geraldine

    2013-01-01

    Wide-spread antibiotic resistance among bacterial pathogens is now a serious public health issue and multi-antibiotic resistance has been reported in many foodborne pathogens including Salmonella and E. coli. A study to determine antibiotic resistance profiles of a range of Salmonella and Verocytotoxigenic E.coli (VTEC) isolated from Irish foods revealed significant levels of antibiotic resistance in the strains. S. typhimurium DT104 were multiantibiotic resistant with 97% resistant to 7 anti...

  12. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  13. Survival of foodborne pathogens (Escherichia coli O157:H7, Salmonella Typhimurium, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus) in raw ready-to-eat crab marinated in soy sauce.

    Science.gov (United States)

    Cho, T J; Kim, N H; Kim, S A; Song, J H; Rhee, M S

    2016-12-05

    Knowing the survival characteristics of foodborne pathogens in raw ready-to-eat (RTE) seafood is the key to predicting whether they pose a microbiological hazard. The present study examined the survival of Escherichia coli O157:H7, Salmonella Typhimurium, Vibrio parahaemoliticus, Listeria monocytogenes, and Staphylococcus aureus in raw RTE crab marinated in soy sauce. Inoculated crabs (initial bacterial population=4.1-4.4logCFU/g) were immersed in soy sauce and then stored at refrigeration (5°C) or room temperature (22°C) for up to 28days. At 5°C, all bacteria (except V. parahaemolyticus) survived in crab samples until Day 28 (counts of 1.4, 1.6, 3.1, 3.2 log CFU/g for E. coli O157:H7, S. Typhimurium, L. monocytogenes, and S. aureus, respectively). However, at 22°C, all tested bacteria were more susceptible to the antimicrobial effects of marination. Regardless of temperature, foodborne pathogens attached to crab samples were more resistant to marination than those suspended in soy sauce samples; however, the survival pattern for each species was different. Gram-positive bacteria were most resistant to marination conditions (high salinity, low pH), whereas V. parahaemolyticus was extremely susceptible. Marination is the only antibacterial step in the manufacturing processes; however, the results presented herein reveal that this is not sufficient to inactivate foodborne pathogens. In particular, the survival of pathogens on crabs at refrigeration temperature may pose a major hazard for the consumption of raw RTE seafood. Thus, appropriate decontamination methods and implementation of safety management practices are needed. This study provides predictive microbiological information of foodborne pathogens in raw RTE seafood with marination. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  15. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  16. Bacterial food-borne pathogens in Indian food

    International Nuclear Information System (INIS)

    Bandekar, J.R.

    2015-01-01

    Food technology and food processing techniques have made tremendous advances in preservation of food and ensuring safety of food by killing food-borne pathogens. In addition to old techniques such as pasteurization, canning, dehydration, fermentation and salting, a number of new techniques such as radiation processing, high pressure technology and pulsed electric field technology are being applied for preservation of food and to ensure food safety. Total Quality Management (TQM) concepts have been developed to take care of food safety from farm to table. Hazard Analysis at Critical Control Points (HACCP) is being applied for mass scale production of food to make food free from pathogens. Despite these advances, food-borne diseases have become one of the most widespread public health problems in the world. About two thirds of all the outbreaks are traced to microbial contaminated food. According to World Health Organization (WHO) estimates, food-borne and waterborne diarrhoeal diseases kill an estimated 2 million people annually, including many children. Food safety is a major concern not only for developing countries but also for the developed countries. A number of factors such as emergence of new food-borne pathogens, development of drug resistance in pathogens, changing life style, globalization of the food supply etc. are responsible for the continuous persistence of food-borne diseases. The food-borne disease outbreaks due to E. coli O157:H7, Listeria monocytogenes, Salmonella and Campylobacter, are responsible for recall of many foods resulting in heavy losses to food industry. Due to consumer demand, a number of Ready-To-Eat (RTE) minimally processed foods are increasingly marketed; however, there is increased risk of foodborne diseases with these products. Food Technology Division of Bhabha Atomic Research Centre, Mumbai, has been working on food-borne bacterial pathogens particularly Salmonella, Campylobacter, Listeria monocytogenes, Vibrio and Aeromonasf

  17. Growth and membrane fluidity of food-borne pathogen Listeria monocytogenes in the presence of weak acid preservatives and hydrochloric acid

    Directory of Open Access Journals (Sweden)

    Ioannis eDiakogiannis

    2013-06-01

    Full Text Available This study addresses a major issue in microbial food safety, the elucidation of correlations between acid stress and changes in membrane fluidity of the pathogen Listeria monocytogenes. In order to assess the possible role that membrane fluidity changes play in L. monocytogenes tolerance to antimicrobial acids (acetic, lactic, hydrochloric acid at low pH or benzoic acid at neutral pH, the growth of the bacterium and the gel-to-liquid crystalline transition temperature point (Tm of cellular lipids of each adapted culture was measured and compared with unexposed cells. The Tm of extracted lipids was measured by Differential Scanning Calorimetry (DSC. A trend of increasing Tm values but not of equal extent was observed upon acid tolerance for all samples and this increase is not directly proportional to each acid antibacterial action. The smallest increase in Tm value was observed in the presence of lactic acid, which presented the highest antibacterial action. In the presence of acids with high antibacterial action such as acetic, hydrochloric acid or low antibacterial action such as benzoic acid, increased Tm values were measured. The Tm changes of lipids were also correlated with our previous data about fatty acid changes to acid adaptation. The results imply that the fatty acid changes are not the sole adaptation mechanism for decreased membrane fluidity (increased Tm. Therefore, this study indicates the importance of conducting an in-depth structural study on how acids commonly used in food systems affect the composition of individual cellular membrane lipid molecules.

  18. Performance and mechanism of standard nano-TiO2(P-25) in photocatalytic disinfection of foodborne microorganisms - salmonella typhimurium and listeria monocytogenes

    Science.gov (United States)

    In this paper, effects of disinfection by nano-TiO2 were studied on the two typical foodborne microorganisms, Gram-negative bacterium Salmonella typhimurium and Gram-positive bacterium-Listeria monocytogenes, in meat products. The performance of nano-TiO2 against the foodborne pathogens was evaluate...

  19. Potential of predatory bacteria as biocontrol agents for foodborne and plant pathogens

    Science.gov (United States)

    Foodborne pathogens such as Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, Shigella are responsible for frequent occurrences of illnesses and mortality in humans and produce losses. Pre-harvest yield losses and post-harvest decay on minimally processed produce (fruits, vegetables...

  20. Foodborne pathogens and their risk exposure factors associated with farm vegetables in Rwanda.

    OpenAIRE

    Ssemanda JN; Reij MW; Middendorp G van; Bouw E; van der Plaats R; Franz E; Mambo Muvunyi C; Bagabe MC; Zwietering MH; Joosten H

    2018-01-01

    In this study, we tested farm vegetables and agricultural water for the presence of foodborne pathogens, and evaluated farming practices of vegetable farms in Rwanda. Farm vegetable samples were found to be contaminated with foodborne pathogens at considerably high rate (overall 15/99 = 15%). Specifically, the prevalence of pathogens in farm vegetables varied from 1.0% (1/99) for Listeria monocytogenes, 3.0% (3/99) for thermo-tolerant Campylobacter spp., 5.1% (5/99) for Salmonella spp. to 6.1...

  1. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  2. Allspice, garlic and oregano plant essential oils in tomato films inactivate the foodborne pathogens, Escherichia coli O157:h7, Salmonella enterica and Listeria monocytogenes

    Science.gov (United States)

    Edible films containing plant essential oils arc gaining importance as potential antibacterial formulations to extend product shelf life and reduce risk of pathogen growth on food surfaces. An evaluation of both antimicrobial and physicochemical properties of edible films is important for applicatio...

  3. Allspice, garlic, and oregano plant essential oils in tomato films inactive the foodborne pathogens Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes

    Science.gov (United States)

    Edible films containing plant essential oils are gaining importance as potential antibacterial formulations to extend product shelf-life and reduce risk of pathogen growth on food surfaces. An evaluation of both antimicrobial and physicochemical properties of edible films is important for applicati...

  4. Removal of Foodborne Pathogen Biofilms by Acidic Electrolyzed Water

    Directory of Open Access Journals (Sweden)

    Qiao Han

    2017-06-01

    Full Text Available Biofilms, which are complex microbial communities embedded in the protective extracellular polymeric substances (EPS, are difficult to remove in food production facilities. In this study, the use of acidic electrolyzed water (AEW to remove foodborne pathogen biofilms was evaluated. We used a green fluorescent protein-tagged Escherichia coli for monitoring the efficiency of AEW for removing biofilms, where under the optimal treatment conditions, the fluorescent signal of cells in the biofilm disappeared rapidly and the population of biofilm cells was reduced by more than 67%. Additionally, AEW triggered EPS disruption, as indicated by the deformation of the carbohydrate C-O-C bond and deformation of the aromatic rings in the amino acids tyrosine and phenylalanine. These deformations were identified by EPS chemical analysis and Raman spectroscopic analysis. Scanning electron microscopy (SEM images confirmed that the breakup and detachment of biofilm were enhanced after AEW treatment. Further, AEW also eradicated biofilms formed by both Gram-negative bacteria (Vibrio parahaemolyticus and Gram-positive bacteria (Listeria monocytogenes and was observed to inactivate the detached cells which are a potential source of secondary pollution. This study demonstrates that AEW could be a reliable foodborne pathogen biofilm disrupter and an eco-friendly alternative to sanitizers traditionally used in the food industry.

  5. Compatible solutes: the key to Listeria's success as a versatile gastrointestinal pathogen?

    LENUS (Irish Health Repository)

    Sleator, Roy D

    2010-12-10

    Abstract Recently we reported a role for compatible solute uptake in mediating bile tolerance and increased gastrointestinal persistence in the foodborne pathogen Listeria monocytogenes 1 . Herein, we review the evolution in our understanding of how these low molecular weight molecules contribute to growth and survival of the pathogen both inside and outside the body, and how this stress survival mechanism may ultimately be used to target and kill the pathogen.

  6. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  7. Disease burden of foodborne pathogens in the Netherlands, 2009

    NARCIS (Netherlands)

    Havelaar, A.H.|info:eu-repo/dai/nl/072306122; Haagsma, J.A.; Mangen, M.J.J.; Kemmeren, J.M.; Verhoef, L.; Vijgen, S.M.; Wilson, M; Friesema, I.H.; Kortbeek, L.M.; van Duynhoven, Y.T.; van Pelt, W.

    2012-01-01

    To inform risk management decisions on control, prevention and surveillance of foodborne disease, the disease burden of foodborne pathogens is estimated using Disability Adjusted Life Years as a summary metric of public health. Fourteen pathogens that can be transmitted by food are included in the

  8. Biocontrol interventions for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

  9. The response of foodborne pathogens to osmotic and desiccation stresses in the food chain

    DEFF Research Database (Denmark)

    Burgess, Catherine M.; Gianotti, Andrea; Gruzdev, Nadia

    2016-01-01

    In combination with other strategies, hyperosmolarity and desiccation are frequently used by the food processing industry as a means to prevent bacterial proliferation, and particularly that of foodborne pathogens, in food products. However, it is increasingly observed that bacteria, including...... human pathogens, encode mechanisms to survive and withstand these stresses. This review provides an overview of the mechanisms employed by Salmonella spp., Shiga toxin producing E. coli, Cronobacter spp., Listeria monocytogenes and Campylobacter spp. to tolerate osmotic and desiccation stresses...... and identifies gaps in knowledge which need to be addressed to ensure the safety of low water activity and desiccated food products....

  10. Monitoring of foodborne pathogens in raw cow milk in Tuscany

    Directory of Open Access Journals (Sweden)

    Laura Gasperetti

    2014-03-01

    Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.

  11. Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

    International Nuclear Information System (INIS)

    Weng, X.; Jiang, H.; Li, D.

    2012-01-01

    We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

  12. Fast and sensitive detection of foodborne pathogen using electrochemical impedance analysis, urease catalysis and microfluidics.

    Science.gov (United States)

    Chen, Qi; Wang, Dan; Cai, Gaozhe; Xiong, Yonghua; Li, Yuntao; Wang, Maohua; Huo, Huiling; Lin, Jianhan

    2016-12-15

    Early screening of pathogenic bacteria is a key to prevent and control of foodborne diseases. In this study, we developed a fast and sensitive bacteria detection method integrating electrochemical impedance analysis, urease catalysis with microfluidics and using Listeria as model. The Listeria cells, the anti-Listeria monoclonal antibodies modified magnetic nanoparticles (MNPs), and the anti-Listeria polyclonal antibodies and urease modified gold nanoparticles (AuNPs) were incubated in a fluidic separation chip with active mixing to form the MNP-Listeria-AuNP-urease sandwich complexes. The complexes were captured in the separation chip by applying a high gradient magnetic field, and the urea was injected to resuspend the complexes and hydrolyzed under the catalysis of the urease on the complexes into ammonium ions and carbonate ions, which were transported into a microfluidic detection chip with an interdigitated microelectrode for impedance measurement to determine the amount of the Listeria cells. The capture efficiency of the Listeria cells in the separation chip was ∼93% with a shorter time of 30min due to the faster immuno-reaction using the active magnetic mixing. The changes on both impedance magnitude and phase angle were demonstrated to be able to detect the Listeria cells as low as 1.6×10(2)CFU/mL. The detection time was reduced from original ∼2h to current ∼1h. The recoveries of the spiked lettuce samples ranged from 82.1% to 89.6%, indicating the applicability of this proposed biosensor. This microfluidic impedance biosensor has shown the potential for online, automatic and sensitive bacteria separation and detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Antibacterial Activities of Endophytic Bacteria Isolated from Taxus brevifolia Against Foodborne Pathogenic Bacteria.

    Science.gov (United States)

    Islam, Nurul; Choi, Jaehyuk; Baek, Kwang-Hyun

    2018-05-01

    Endophytes are a potential source of novel bioactive compounds with medicinal properties. In this study, 41 endophytic bacteria (EB) were isolated from tissues of a medicinally important plant Taxus brevifolia (Pacific yew). The objective was to screen all the EB isolates for their antibacterial effects against five foodborne pathogenic bacteria: Bacillus cereus ATCC10876, Staphylococcus aureus ATCC12600, Listeria monocytogenes ATCC19115, Escherichia coli ATCC43890, and Salmonella Typhimurium ATCC19585. Among the EB isolates, T. brevifolia seed (TbS)-8, T. brevifolia fleshy part of fruit (TbFl)-10, T. brevifolia leaf (TbL)-22, TbS-29, and TbL-34 exerted significant antibacterial activity against the tested foodborne pathogens. Especially TbFl-10 showed the highest antibacterial activity against all the tested bacteria and was identified as Paenibacillus kribbensis (Pk). Furthermore, an ethyl acetate extract of Pk-TbFl-10 possessed antibacterial activities against the tested five foodborne pathogenic bacteria, with zones of inhibition from 15.71 ± 2.85 to 13.01 ± 2.12 mm. Scanning electron microscopy analysis revealed ruptured, lysed, shrunk, and swollen cells of all the tested foodborne pathogens treated with the ethyl acetate extract of Pk-TbFl-10, suggesting that a metabolite(s) of Pk-TbFl-10 penetrates the cell membrane and causes cell lysis leading to cell death. Our results indicate that Pk-TbFl-10 isolated from T. brevifolia can serve as a novel source of natural antibacterial agents against foodborne pathogenic bacteria, with potential applications in the pharmaceutical industry.

  14. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  15. Essential oils from herbs against foodborne pathogens in chicken sausage.

    Science.gov (United States)

    Barbosa, Lidiane Nunes; Probst, Isabella Silva; Murbach Teles Andrade, Bruna Fernanda; Bérgamo Alves, Fernanda Cristina; Albano, Mariana; Mores Rall, Vera Lucia; Júnior, Ary Fernandes

    2015-01-01

    Consumption of chicken meat and its products, especially sausage, have increased in recent years. However, this product is susceptible to microbial contamination during manufacturing, which compromises its shelf life. The flavoring and preservative activities of essential oils (EO) have been recognized and the application of these antimicrobial agents as natural active compounds in food preservation has shown promise. The aim of this study was to evaluate the effect of Ocimum basilicum and Origanum vulgare EO on Listeria monocytogenes and Salmonella Enteritidis strains in artificially inoculated samples of fresh chicken sausage. First, the minimal inhibitory concentration (MIC) of EO in vitro was determined. The sausage was prepared and kept at ± 4°C; then, the inoculation of individual bacteria was carried out. EO were added at 0.3%, 1.0% and 1.5%v/w. After 0, 5, and 24 hours, the most probable number method (MPN) was performed. Transmission electron microscopy (TEM) was used to view the damage caused by these EO on bacterial morphology and/or structure. Only the 1.5% concentration was effective in reducing L. monocytogenes. 0.3% of O. vulgare EO was able to reduce the MPN/g of Salmonella Enteritidis (2 log) after 5 hours trials. O. basilicum EO showed no effect on Salmonella after 5 hours, but decreased by 2 log after 24 hours. O. vulgare EO at 1% gave a greater reduction of S. Enteritidis at 5 hours, increasing or maintaining this effect after 24 hours. The results confirmed the potential benefits of use EO in control of foodborne pathogens.

  16. Priority setting of foodborne pathogens: disease burden and costs of selected enteric pathogens

    NARCIS (Netherlands)

    Kemmeren JM; Mangen MJJ; Duynhoven YTHP van; Havelaar AH; MGB

    2006-01-01

    Toxoplasmosis causes the highest disease burden among seven evaluated foodborne pathogens. This is the preliminary conclusion of a major study of the disease burden and related costs of foodborne pathogens. The other micro-organisms that were studied are Campylobacter spp., Salmonella spp.,

  17. Protozoan Cysts Act as a Survival Niche and Protective Shelter for Foodborne Pathogenic Bacteria

    Science.gov (United States)

    Lambrecht, Ellen; Baré, Julie; Chavatte, Natascha; Bert, Wim; Sabbe, Koen

    2015-01-01

    The production of cysts, an integral part of the life cycle of many free-living protozoa, allows these organisms to survive adverse environmental conditions. Given the prevalence of free-living protozoa in food-related environments, it is hypothesized that these organisms play an important yet currently underinvestigated role in the epidemiology of foodborne pathogenic bacteria. Intracystic bacterial survival is highly relevant, as this would allow bacteria to survive the stringent cleaning and disinfection measures applied in food-related environments. The present study shows that strains of widespread and important foodborne bacteria (Salmonella enterica, Escherichia coli, Yersinia enterocolitica, and Listeria monocytogenes) survive inside cysts of the ubiquitous amoeba Acanthamoeba castellanii, even when exposed to either antibiotic treatment (100 μg/ml gentamicin) or highly acidic conditions (pH 0.2) and resume active growth in broth media following excystment. Strain- and species-specific differences in survival periods were observed, with Salmonella enterica surviving up to 3 weeks inside amoebal cysts. Up to 53% of the cysts were infected with pathogenic bacteria, which were located in the cyst cytosol. Our study suggests that the role of free-living protozoa and especially their cysts in the persistence and epidemiology of foodborne bacterial pathogens in food-related environments may be much more important than hitherto assumed. PMID:26070667

  18. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

    2009-01-01

    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  19. Current pathogenic Escherichia coli foodborne outbreak cases and therapy development.

    Science.gov (United States)

    Yang, Shih-Chun; Lin, Chih-Hung; Aljuffali, Ibrahim A; Fang, Jia-You

    2017-08-01

    Food contamination by pathogenic microorganisms has been a serious public health problem and a cause of huge economic losses worldwide. Foodborne pathogenic Escherichia coli (E. coli) contamination, such as that with E. coli O157 and O104, is very common, even in developed countries. Bacterial contamination may occur during any of the steps in the farm-to-table continuum from environmental, animal, or human sources and cause foodborne illness. To understand the causes of the foodborne outbreaks by E. coli and food-contamination prevention measures, we collected and investigated the past 10 years' worldwide reports of foodborne E. coli contamination cases. In the first half of this review article, we introduce the infection and symptoms of five major foodborne diarrheagenic E. coli pathotypes: enteropathogenic E. coli (EPEC), Shiga toxin-producing E. coli/enterohemorrhagic E. coli (STEC/EHEC), Shigella/enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and enterotoxigenic E. coli (ETEC). In the second half of this review article, we introduce the foodborne outbreak cases caused by E. coli in natural foods and food products. Finally, we discuss current developments that can be applied to control and prevent bacterial food contamination.

  20. Silage review: Foodborne pathogens in silage and their mitigation by silage additives.

    Science.gov (United States)

    Queiroz, O C M; Ogunade, I M; Weinberg, Z; Adesogan, A T

    2018-05-01

    Silage is one of the main ingredients in dairy cattle diets and it is an important source of nutrients, particularly energy and digestible fiber. Unlike properly made and managed silage, poorly made or contaminated silage can also be a source of pathogenic bacteria that may decrease dairy cow performance, reduce the safety and quality dairy products, and compromise animal and human health. Some of the pathogenic bacteria that are frequently or occasionally associated with silage are enterobacteria, Listeria, Bacillus spp., Clostridium spp., and Salmonella. The symptoms caused by these bacteria in dairy cows vary from mild diarrhea and reduced feed intake by Clostridium spp. to death and abortion by Listeria. Contamination of food products with pathogenic bacteria can cause losses of millions of dollars due to recalls of unsafe foods and decreases in the shelf life of dairy products. The presence of pathogenic bacteria in silage is usually due to contamination or poor management during the fermentation, aerobic exposure, or feed-out stages. Silage additives and inoculants can improve the safety of silage as well as the fermentation, nutrient recovery, quality, and shelf life. This review summarizes the literature on the main foodborne pathogens that occasionally infest silage and how additives can improve silage safety. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  2. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  3. Genomes of foodborne and waterborne pathogens

    National Research Council Canada - National Science Library

    Fratamico, Pina M; Liu, Yanhong; Kathariou, Sophia

    2011-01-01

    ... of Pathogenic Vibrio cholerae * 85 Salvador Almagro-Moreno, Ronan A. Murphy, and E. Fidelma Boyd 8. Genomics of the Enteropathogenic Yersiniae * 101 Alan McNally, Nicholas R. Thomson, and Brendan W. ...

  4. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  5. Application of low frequency pulsed ohmic heating for inactivation of foodborne pathogens and MS-2 phage in buffered peptone water and tomato juice.

    Science.gov (United States)

    Kim, Sang-Soon; Choi, Won; Kang, Dong-Hyun

    2017-05-01

    The purpose of this study was to inactivate foodborne pathogens effectively by ohmic heating in buffered peptone water and tomato juice without causing electrode corrosion and quality degradation. Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes were used as representative foodborne pathogens and MS-2 phage was used as a norovirus surrogate. Buffered peptone water and tomato juice inoculated with pathogens were treated with pulsed ohmic heating at different frequencies (0.06-1 kHz). Propidium iodide uptake values of bacterial pathogens were significantly (p heating is applicable to inactivate foodborne pathogens effectively without causing electrode corrosion and quality degradation in tomato juice. Copyright © 2016. Published by Elsevier Ltd.

  6. The role of bioactive substances in controlling foodborne pathogens derived from Metasequoia glyptostroboides Miki ex Hu.

    Science.gov (United States)

    Bajpai, Vivek K; Na, Minkyun; Kang, Sun Chul

    2010-07-01

    In an attempt to isolate bioactive substances, ethyl acetate cone extract of Metasequoia glyptostroboides was subjected to a column chromatographic analysis that resulted in isolation of an abietane type diterpenoid, taxoquinone. Its structure was elucidated by spectroscopic means. In further, taxoquinone showed potential antibacterial effect as diameters of zones of inhibition against foodborne pathogenic bacteria such as Listeria monocytogenes ATCC 19166, Salmonella typhimurium KCTC 2515, Salmonella enteritidis KCTC 2021, Escherichia coli ATCC 8739, E. coli O157:H7 ATCC 43888, Enterobacter aerogenes KCTC2190, Staphylococcus aureus ATCC 6538 and S. aureus KCTC 1916, which were found in the range of 10.6-15.8mm. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of taxoquinone against the employed bacterial pathogens were found in the range of 62.5-250 and 125-500 microg/ml. Also the compound had strong antibacterial effect on the viable counts of the tested bacteria. Further, scanning electron microscopic study demonstrated potential detrimental effect of taxoquinone on the morphology of E. coli ATCC 8739. These findings indicate that bioactive compound taxoquinone present in M. glyptostroboides could be used as a promising antibacterial agent in food industry to inhibit the growth of certain important foodborne pathogens. 2010 Elsevier Ltd. All rights reserved.

  7. Occurrence of Foodborne Pathogens and Molds in Turkish Foods

    OpenAIRE

    Sebnem Ozturkogu-Budak

    2016-01-01

    A survey of the occurrence of food pathogens like Salmonella, Listeria, Escherichia, Clostridium, Bacillus and Staphylococcus analyses were performed on 301 food samples from 8 different food categories such as dry legumes, milk products, meat products, fish, frozen foods, deserts, nuts and vegetables and fruits. Yeast and mold analyses were also performed on 364 food products from 9 main food categories such as dry legumes, milk products, meat products, seasonings, deserts, nuts, bee product...

  8. Vibrio parahaemolyticus- An emerging foodborne pathogen

    Directory of Open Access Journals (Sweden)

    S Nelapati

    2012-02-01

    Full Text Available Vibrio parahaemolyticus is a halophilic gram negative, motile, oxidase positive, straight or curved rod-shaped, facultative anaerobic bacteria that occur naturally in the marine environment. They form part of the indigenous microflora of aquatic habitats of various salinity and are the major causative agents for some of the most serious diseases in fish, shellfish and penacid shrimp. This human pathogen causes acute gastroenteritis characterized by diarrhea, vomiting and abdominal cramps through consumption of contaminated raw fish or shellfish. V. parahaemolyticus is the leading cause of gastroenteritis due to the consumption of seafood worldwide. The incidence of V. parahaemolyticus infection has been increasing in many parts of the world, due to the emergence of O3:K6 serotype carrying the tdh gene which is responsible for most outbreaks worldwide. The pathogenicity of this organism is closely correlated with the Kanagawa phenomenon (KP + due to production of Kanagawa hemolysin or the thermostable direct hemolysin (TDH. The TDH and TRH (TDH-related hemolysin encoded by tdh and trh genes are considered to be important virulence factors. [Vet. World 2012; 5(1.000: 48-63

  9. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

  10. Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

    International Nuclear Information System (INIS)

    Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fátima; Teófilo, Reinaldo F.; Vitor, Débora M.; Reis Coimbra, Jane Sélia dos; Andrade, Nélio José de; Sousa, Frederico B. de; Sinisterra, Rubén D.; Medeiros, Eber Antonio Alves

    2013-01-01

    Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na 4 P 2 O 7 ), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

  11. Effects of climate change on the persistence and dispersal of foodborne bacterial pathogens in the outdoor environment: A review.

    Science.gov (United States)

    Hellberg, Rosalee S; Chu, Eric

    2016-08-01

    According to the Intergovernmental Panel on Climate Change (IPCC), warming of the climate system is unequivocal. Over the coming century, warming trends such as increased duration and frequency of heat waves and hot extremes are expected in some areas, as well as increased intensity of some storm systems. Climate-induced trends will impact the persistence and dispersal of foodborne pathogens in myriad ways, especially for environmentally ubiquitous and/or zoonotic microorganisms. Animal hosts of foodborne pathogens are also expected to be impacted by climate change through the introduction of increased physiological stress and, in some cases, altered geographic ranges and seasonality. This review article examines the effects of climatic factors, such as temperature, rainfall, drought and wind, on the environmental dispersal and persistence of bacterial foodborne pathogens, namely, Bacillus cereus, Brucella, Campylobacter, Clostridium, Escherichia coli, Listeria monocytogenes, Salmonella, Staphylococcus aureus, Vibrio and Yersinia enterocolitica. These relationships are then used to predict how future climatic changes will impact the activity of these microorganisms in the outdoor environment and associated food safety issues. The development of predictive models that quantify these complex relationships will also be discussed, as well as the potential impacts of climate change on transmission of foodborne disease from animal hosts.

  12. Advances and Challenges in Viability Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexin Zeng

    2016-11-01

    Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

  13. Food-borne pathogens, health and role of dietary phytochemicals.

    Science.gov (United States)

    Shetty, K; Labbe, R G

    1998-12-01

    Infectious diseases transmitted by food have become a major public health concern in recent years. In the USA alone, there are an estimated 6-33 million cases each year. The list of responsible agents continues to grow. In the past 20 years some dozen new pathogens that are primarily food-borne have been identified. Fruits and vegetables, often from the global food market, have been added to the traditional vehicles of food-borne illness; that is, undercooked meat, poultry, seafood, or unpasteurized milk. Such products are minimally processed and have fewer barriers to microbial growth such as salt, sugar or preservatives. The evolution of the epidemiology of food-borne illness requires a rethinking of traditional, though still valid, solutions for their prevention. Among various strategies to prevent food-borne pathogens, use of dietary phytochemicals is promising. The major obstacle in the use of dietary phytochemical is the consistency of phytochemicals in different foods due to their natural genetic variation. We have developed a novel tissue-culture-based selection strategy to isolate elite phenolic phytochemical-producing clonal lines of species belonging to the family Lamiaceae. Among several species we have targeted elite clonal lines of thyme (Thymus vulgaris) and oregano (Origanum vulgare) against Escherichia coli and Clostridium perfrigens in fresh and processed meats. We are also evaluating high phenolic profile-containing clonal lines of basil (Ocimum basilicum) to inhibit gastric ulcer-causing Helicobacter pylori. Other elite lines of the members of the family Lamiaceae, rosemary (Rosmarinus officinalis) and salvia (Salvia officinalis) also hold promise against a wide range of food pathogens such as Salmonella species in poultry products and Vibrio species in seafood.

  14. Rapid Screening of Natural Plant Extracts with Calcium Diacetate for Differential Effects Against Foodborne Pathogens and a Probiotic Bacterium.

    Science.gov (United States)

    Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony

    2017-12-01

    This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼10 8 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.

  15. Campylobacteriosis, Salmonellosis, Yersiniosis, and Listeriosis as Zoonotic Foodborne Pathogens: A Review

    Directory of Open Access Journals (Sweden)

    Agnieszka Chlebicz

    2018-04-01

    Full Text Available Zoonoses are diseases transmitted from animals to humans, posing a great threat to the health and life of people all over the world. According to WHO estimations, 600 million cases of diseases caused by contaminated food were noted in 2010, including almost 350 million caused by pathogenic bacteria. Campylobacter, Salmonella, as well as Yersinia enterocolitica and Listeria monocytogenes may dwell in livestock (poultry, cattle, and swine but are also found in wild animals, pets, fish, and rodents. Animals, often being asymptomatic carriers of pathogens, excrete them with faeces, thus delivering them to the environment. Therefore, pathogens may invade new individuals, as well as reside on vegetables and fruits. Pathogenic bacteria also penetrate food production areas and may remain there in the form of a biofilm covering the surfaces of machines and equipment. A common occurrence of microbes in food products, as well as their improper or careless processing, leads to common poisonings. Symptoms of foodborne infections may be mild, sometimes flu-like, but they also may be accompanied by severe complications, some even fatal. The aim of the paper is to summarize and provide information on campylobacteriosis, salmonellosis, yersiniosis, and listeriosis and the aetiological factors of those diseases, along with the general characteristics of pathogens, virulence factors, and reservoirs.

  16. Effect of Temperature and Nutrient Concentration on Survival of Foodborne Pathogens in Deciduous Fruit Processing Environments for Effective Hygiene Management.

    Science.gov (United States)

    Duvenage, Stacey; Korsten, Lise

    2016-11-01

    Temperature and good sanitation practices are important factors for controlling growth of microorganisms. Fresh produce is stored at various temperatures to ensure quality and to prolong shelf life. When foodborne pathogens survive and grow on fresh produce at storage temperatures, then additional control strategies are needed to inactivate these pathogens. The aim of this study was to determine how temperatures associated with deciduous fruit processing and storage facilities (0.5, 4, and 21°C) affect the growth and/or survival of Escherichia coli O157:H7, Listeria monocytogenes , Salmonella enterica subsp. enterica serovar Typhimurium, and Staphylococcus aureus under different nutrient conditions (nutrient rich and nutrient poor) and on simulated contact surfaces (vinyl coupons). Information on the growth and survival of foodborne pathogens at specific deciduous fruit processing and storage temperatures (0.5°C) is not available. All pathogens except E. coli O157:H7 were able to survive on vinyl coupons at all temperatures. L. monocytogenes proliferated under both nutrient conditions independent of temperature. S. aureus was the pathogen least affected by nutrient conditions. The survival of foodborne pathogens on the vinyl coupons, a model system for studying surfaces in fruit preparation and storage environments, indicates the potential for cross-contamination of deciduous fruit products under poor sanitation conditions. Foodborne pathogens that can proliferate and survive at various temperatures under different nutrient conditions could lead to fruit cross-contamination. Temperature mismanagement, which could allow pathogen proliferation in contaminated fruit packing houses and storage environments, is a concern. Therefore, proper hygiene and sanitation practices, removal of possible contaminants, and proper food safety management systems are needed to ensure food safety.

  17. Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation.

    Science.gov (United States)

    Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

    2016-01-01

    In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

  18. Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation

    Science.gov (United States)

    Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

    2016-01-01

    In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

  19. COMPARATIVE RESISTANCE OF BACTERIAL FOODBORNE PATHOGENS TO NON-THERMAL TECHNOLOGIES FOR FOOD PRESERVATION

    Directory of Open Access Journals (Sweden)

    Guillermo eCebrián

    2016-05-01

    Full Text Available In this paper the resistance of bacterial foodborne pathogens to manosonication (MS, pulsed electric fields (PEF, high hydrostatic pressure (HHP and UV-light (UV is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could

  20. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    International Nuclear Information System (INIS)

    Sommers, Christopher H.; Boyd, Glenn

    2006-01-01

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other 'heat and eat' multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a 'frankfurter on a roll', a 'beef cheeseburger on a bun' and a 'vegetarian cheeseburger on a bun' was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log 1 of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat' sandwich products

  1. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    Science.gov (United States)

    Sommers, Christopher H.; Boyd, Glenn

    2006-07-01

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other "heat and eat" multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a "frankfurter on a roll", a "beef cheeseburger on a bun" and a "vegetarian cheeseburger on a bun" was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log 10 of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat" sandwich products.

  2. Microbial Assessment and Prevalence of Foodborne Pathogens in Natural Cheeses in Japan

    Directory of Open Access Journals (Sweden)

    Firew Kassa Esho

    2013-01-01

    Full Text Available The production and consumption of domestic natural cheese in Japan is increasing year by year. More than ninety percent of domestic natural cheese is produced in Hokkaido region of Japan, while information on its quality and safety related to foodborne pathogens is limited. To assess the microbiological safety of domestic natural cheese, a total of 126 natural cheese samples produced in Hokkaido were collected from December, 2012, to July, 2013. In addition to standard plate count (SPC and coliform counts, the prevalence study of three pathogens (Listeria monocytogenes, pathogenic Escherichia coli, and Salmonella spp. was performed on each sample. Real-time PCR and matrix-assisted laser desorption-ionization time-of-flight mass spectrometer methods were employed for identification of presumptive pathogens. Coliform was detected in 25 samples (19.8% with a minimum of 25 cfu/g and a maximum of more than 3.0 × 106 cfu/g. Salmonella spp. and L. monocytogenes were not isolated from any of the samples. Only one sample (0.80% showed positive PCR amplification for ipaH gene suggesting possible contamination of enteroinvasive E. coli or Shigella in this product. Overall results indicate that natural cheeses produced in Hokkaido region were satisfactory microbiological quality according to existing international standards.

  3. Radiation sensitivity of foodborne pathogens in meat byproducts with different packaging

    International Nuclear Information System (INIS)

    Yong, Hae In; Kim, Hyun-Joo; Nam, Ki Chang; Kwon, Joong Ho; Jo, Cheorun

    2015-01-01

    The aim of this study was to determine radiation sensitivity of Escherichia coli O157:H7 and Listeria monocytogenes in edible meat byproducts. Seven beef byproducts (heart, liver, lung, lumen, omasum, large intestine, and small intestine) and four pork byproducts (heart, large intestine, liver, and small intestine) were used. Electron beam irradiation significantly reduced the numbers of pathogenic microorganisms in meat byproducts and no viable cells were detected in both aerobically- and vacuum-packaged samples irradiated at 4 kGy. Meat byproducts packed under vacuum had higher D 10 value than the ones packed aerobically. No significant difference was observed between the D 10 values of E. coli O157:H7 and L. monocytogenes inoculated in either aerobically or vacuum packaged samples. These results suggest that low-dose electron beam irradiation can significantly decrease microbial numbers and reduce the risk of meat byproduct contamination by the foodborne pathogens. - Highlights: • Radiation sensitivities of pathogens in meat byproduct were tested. • Electron beam irradiation of 3 or 4 kGy reduced pathogens by> 9 log • The D 10 values were lower in the aerobic-packaging than under vacuum condition

  4. Resveratrol—Potential Antibacterial Agent against Foodborne Pathogens

    Science.gov (United States)

    Ma, Dexter S. L.; Tan, Loh Teng-Hern; Chan, Kok-Gan; Yap, Wei Hsum; Pusparajah, Priyia; Chuah, Lay-Hong; Ming, Long Chiau; Khan, Tahir Mehmood; Lee, Learn-Han; Goh, Bey-Hing

    2018-01-01

    Bacterial foodborne pathogens are a significant health burden and the recent emergence of pathogenic resistant strains due to the excessive use of antibiotics makes it more difficult to effectively treat infections as a result of contaminated food. Awareness of this impending health crisis has spurred the search for alternative antimicrobials with natural plant antimicrobials being among the more promising candidates as these substances have good acceptability and likely low toxicity levels as they have long been used in traditional medicines. Resveratrol (3,5,4′-trihydroxystilbene) is a naturally occurring stilbenoid which has been gaining considerable attention in medical field due to its diverse biological activities - it has been reported to exhibit antioxidant, cardioprotective, anti-diabetic, anticancer, and antiaging properties. Given that resveratrol is phytoalexin, with increased synthesis in response to infection by phytopathogens, there has been interest in exploring its antimicrobial activity. This review aims to provide an overview of the published data on the antibacterial activity of resveratrol against foodborne pathogens, its mechanisms of action as well as its possible applications in food packing and processing; in addition we also summarize the current data on its potential synergism with known antibacterials and future research and applications. PMID:29515440

  5. Resveratrol—Potential Antibacterial Agent against Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexter S. L. Ma

    2018-02-01

    Full Text Available Bacterial foodborne pathogens are a significant health burden and the recent emergence of pathogenic resistant strains due to the excessive use of antibiotics makes it more difficult to effectively treat infections as a result of contaminated food. Awareness of this impending health crisis has spurred the search for alternative antimicrobials with natural plant antimicrobials being among the more promising candidates as these substances have good acceptability and likely low toxicity levels as they have long been used in traditional medicines. Resveratrol (3,5,4′-trihydroxystilbene is a naturally occurring stilbenoid which has been gaining considerable attention in medical field due to its diverse biological activities - it has been reported to exhibit antioxidant, cardioprotective, anti-diabetic, anticancer, and antiaging properties. Given that resveratrol is phytoalexin, with increased synthesis in response to infection by phytopathogens, there has been interest in exploring its antimicrobial activity. This review aims to provide an overview of the published data on the antibacterial activity of resveratrol against foodborne pathogens, its mechanisms of action as well as its possible applications in food packing and processing; in addition we also summarize the current data on its potential synergism with known antibacterials and future research and applications.

  6. Do leafy green vegetables and their ready-to-eat [RTE] salads carry a risk of foodborne pathogens?

    Science.gov (United States)

    Mercanoglu Taban, Birce; Halkman, A Kadir

    2011-12-01

    Over the past 10 years, there is an increasing demand for leafy green vegetables and their ready-to-eat (RTE) salads since people changed their eating habits because of healthier lifestyle interest. Nevertheless fresh leafy green vegetables and their RTE salads are recognized as a source of food poisoning outbreaks in many parts of the world. However, this increased proportion of outbreaks cannot be completely explained by increased consumption and enhanced surveillance of them. Both in Europe and in the USA, recent foodborne illness outbreaks have revealed links between some pathogens and some leafy green vegetables such as mostly lettuces and spinaches and their RTE salads since fresh leafy green vegetables carry the potential risk of microbiological contamination due to the usage of untreated irrigation water, inappropriate organic fertilizers, wildlife or other sources that can occur anywhere from the farm to the fork such as failure during harvesting, handling, processing and packaging. Among a wide range of pathogens causing foodborne illnesses, Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes are the most common pathogens that contaminate leafy green vegetables. Children, the elderly, pregnant women and immunocompromised people are the most at risk for developing complications from foodborne illness as a result of eating contaminated leafy greens or their RTE salads. These outbreaks are mostly restaurant associated or they sometimes spread across several countries by international trade routes. This review summarizes current observations concerning the contaminated leafy green vegetables and their RTE salads as important vehicles for the transmission of some foodborne pathogens to humans. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Foodborne pathogens and their risk exposure factors associated with farm vegetables in Rwanda

    NARCIS (Netherlands)

    Ssemanda, James Noah; Reij, Martine W.; Middendorp, van Gerrieke; Bouw, El; Plaats, van der Rozemarijn; Franz, Eelco; Muvunyi, Claude Mambo; Bagabe, Mark Cyubahiro; Zwietering, Marcel H.; Joosten, Han

    2018-01-01

    In this study, we tested farm vegetables and agricultural water for the presence of foodborne pathogens, and evaluated farming practices of vegetable farms in Rwanda. Farm vegetable samples were found to be contaminated with foodborne pathogens at considerably high rate (overall 15/99 = 15%).

  8. Optimized dispersion of ZnO nanoparticles and antimicrobial activity against foodborne pathogens and spoilage microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Perez Espitia, Paula Judith; Ferreira Soares, Nilda de Fatima, E-mail: nfsoares1@gmail.com [Department of Food Technology, Federal University of Vicosa (Brazil); Teofilo, Reinaldo F. [Federal University of Vicosa, Department of Chemistry (Brazil); Vitor, Debora M.; Reis Coimbra, Jane Selia dos; Andrade, Nelio Jose de [Department of Food Technology, Federal University of Vicosa (Brazil); Sousa, Frederico B. de; Sinisterra, Ruben D. [Federal University of Minas Gerais, Department of Chemistry (Brazil); Medeiros, Eber Antonio Alves [Department of Food Technology, Federal University of Vicosa (Brazil)

    2013-01-15

    Single primary nanoparticles of zinc oxide (nanoZnO) tend to form particle collectives, resulting in loss of antimicrobial activity. This work studied the effects of probe sonication conditions: power, time, and the presence of a dispersing agent (Na{sub 4}P{sub 2}O{sub 7}), on the size of nanoZnO particles. NanoZnO dispersion was optimized by response surface methodology (RSM) and characterized by the zeta potential (ZP) technique. NanoZnO antimicrobial activity was investigated at different concentrations (1, 5, and 10 % w/w) against four foodborne pathogens and four spoilage microorganisms. The presence of the dispersing agent had a significant effect on the size of dispersed nanoZnO. Minimum size after sonication was 238 nm. An optimal dispersion condition was achieved at 200 W for 45 min of sonication in the presence of the dispersing agent. ZP analysis indicated that the ZnO nanoparticle surface charge was altered by the addition of the dispersing agent and changes in pH. At tested concentrations and optimal dispersion, nanoZnO had no antimicrobial activity against Pseudomonas aeruginosa, Lactobacillus plantarum, and Listeria monocytogenes. However, it did have antimicrobial activity against Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Saccharomyces cerevisiae, and Aspergillus niger. Based on the exhibited antimicrobial activity of optimized nanoZnO against some foodborne pathogens and spoilage microorganisms, nanoZnO is a promising antimicrobial for food preservation with potential application for incorporation in polymers intended as food-contact surfaces.

  9. Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe

    2013-11-01

    Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.

  10. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  11. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

    2009-01-01

    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

  12. Occurrence of Foodborne Pathogens and Molds in Turkish Foods

    Directory of Open Access Journals (Sweden)

    Sebnem Ozturkogu-Budak

    2016-06-01

    Full Text Available A survey of the occurrence of food pathogens like Salmonella, Listeria, Escherichia, Clostridium, Bacillus and Staphylococcus analyses were performed on 301 food samples from 8 different food categories such as dry legumes, milk products, meat products, fish, frozen foods, deserts, nuts and vegetables and fruits. Yeast and mold analyses were also performed on 364 food products from 9 main food categories such as dry legumes, milk products, meat products, seasonings, deserts, nuts, bee products, bakery products and dried fruits produced in Turkey. S. aureus and Salmonella were the most prevalent (1.33% of the six isolated pathogens. The species Cl. perfringens, L. monocytogenes and B. cereus were detected with the ratios of 1.00%, 0.66% and 0.66%, respectively. Total yeast and molds occurrence were 1.65% and 9.06%, respectively. Pathogens were detected in cream cheese, spinach, strawberry and cod fish most prevalently, whereas dried fig, chilli pepper, hazelnut and bakery products were determined as foods prone to the growth of molds. The results of this study suggest that faecal contamination of water needs to be prevented, and the production and storage conditions of food materials should be improved. These findings have implications for the use of these surveillance data in developing evidence-based food policy.

  13. Microbial diversity and prevalence of foodborne pathogens in cheap and junk foods consumed by primary schoolchildren.

    Science.gov (United States)

    Kim, M J; Kim, S A; Kang, Y S; Hwang, I G; Rhee, M S

    2013-07-01

    Aerobic plate counts (APC), coliforms, Bacillus cereus, Escherichia coli and eight foodborne pathogens were tested in 1008 cheap and junk foods, including candies, dried cakes, chewing gum, chocolate, dried and seasoned seafood, ice cream, and sugary foods. APCs were positive for 342 samples (33·9%), and the majority of the counts were 2-3 log CFU g(-1) or ml(-1) (average: 1·10 log CFU g(-1) or ml(-1) ). Most samples (97·3%) contained no coliforms (average: 0·07 log CFU g(-1) or ml(-1) ). Bacillus cereus was detected in 68 samples (average: 0·14 log CFU g(-1) or ml(-1) ). Escherichia coli and Listeria monocytogenes were detected in 6 and 1 samples, respectively, whereas other foodborne pathogens were not isolated. The highest bacterial counts were associated with dried and seasoned seafood products and dried cakes, suggesting that appropriate regulations of these food types should be considered. Cheap and junk foods were produced mainly in developing countries, but there were no significant differences in the bacterial counts among different countries of origin. The presence of foodborne pathogens may pose a risk for children. These results suggest that there is cause for deeper concern about the safety of these foods and that effective countermeasures should be established to improve their microbiological safety. Food safety is especially important for children, but only limited information is available about the microbiological quality of cheap and junk foods that are consumed frequently by primary schoolchildren (e.g. dried cakes, candies and chocolates). The present study investigated the microbial quality of cheap and junk foods, and our results indicate that these foods are a potential health risk for children, therefore, deeper concern about the safety of these foods and effective countermeasures should be established to improve their microbiological safety. The present study may contribute to the development of an appropriate child food

  14. Surface adhesins and exopolymers of selected foodborne pathogens

    DEFF Research Database (Denmark)

    Jaglic, Zoran; Desvaux, Mickaël; Weiss, Agnes

    2014-01-01

    The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety of bacter......The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety...... of bacterial surface structures are involved in this process and these promote bacterial adhesion in a more or less specific manner. In this review, we will focus on those surface adhesins and exopolymers in selected foodborne pathogens that are involved mainly in primary adhesion. Their role in biofilm...

  15. Prevalence of foodborne pathogens in grilled chicken from street vendors and retail outlets in Reynosa, Tamaulipas, Mexico.

    Science.gov (United States)

    Díaz-López, A; Cantú-Ramírez, R C; Garza-González, E; Ruiz-Tolentino, L; Tellez-Luis, S J; Rivera, G; Bocanegra-García, V

    2011-08-01

    We analyzed a total of 70 grilled chicken samples bought randomly from street vendors and retail outlets in the city of Reynosa, Mexico, to determine the prevalence of Escherichia coli (Shiga toxin producing and enterotoxin producing), Salmonella spp., Staphylococcus aureus, Listeria spp., and Campylobacter spp. using microbiological methods and PCR detection of bacterial sequences. Of the 70 samples, 27 (38.5%) were from retail outlets and 43 (61.4%) from street vendors. All specimens were negative by both microbiological and molecular methods for Listeria monocytogenes, Shiga toxin 2 of Shiga toxin-producing E. coli, lt of enterotoxin-producing E. coli, and st enterotoxin, and all were negative for Salmonella spp. and Campylobacter jejuni by PCR. Of the samples studied, 49 (70%) had undetectable levels of the foodborne pathogens studied with the methods used. In the remaining 21 (30%) specimens, at least one pathogen was isolated or detected, with E. coli being the pathogen most frequently isolated and with two samples bearing the hlyA gene. We found no statistical difference in bacterial prevalence between retail and street vendor samples. The presence of pathogens in grilled chicken is an important public health risk because of the great demand for and daily consumption of this product in this region.

  16. High Throughput Sequencing for Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Camilla Sekse

    2017-10-01

    Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.

  17. Antimicrobial Effects of 7,8-Dihydroxy-6-Methoxycoumarin and 7-Hydroxy-6-Methoxycoumarin Analogues against Foodborne Pathogens and the Antimicrobial Mechanisms Associated with Membrane Permeability.

    Science.gov (United States)

    Yang, Ji-Yeon; Park, Jun-Hwan; Lee, Myung-Ji; Lee, Ji-Hoon; Lee, Hoi-Seon

    2017-10-03

    The antimicrobial effects of 7,8-dihydroxy-6-methoxycoumarin and 7-hydroxy-6-methoxycoumarin isolated from Fraxinus rhynchophylla bark and of their structural analogues were determined in an attempt to develop natural antimicrobial agents against the foodborne pathogens Escherichia coli, Bacillus cereus, Staphylococcus intermedius, and Listeria monocytogenes. To elucidate the relationship between structure and antimicrobial activity for the coumarin analogues, isolated constituents and their structural analogues were evaluated against foodborne pathogens. Based on the culture plate inhibition zones and MICs, 6,7-dimethoxycoumarin, 7,8-dihydroxy-6-methoxycoumarin, 7-hydroxy-6-methoxycoumarin, and 7-methoxycoumarin, containing a methoxy functional group on the coumarin skeleton, had the notable antimicrobial activity against foodborne pathogens. However, 7-hydroxycoumarin and 6,7-dihydroxycoumarin, which contained a hydroxyl functional group on the coumarin skeleton, had no antimicrobial activity against these pathogens. An increase in cell membrane permeability was confirmed by electron microscopy observations, and release of extracellular ATP and cell constituents followed treatment with the ethyl acetate fraction of F. rhynchophylla extract. These findings indicate that F. rhynchophylla extract and coumarin analogues have potential for use as antimicrobial agents against foodborne pathogens and that the antimicrobial mechanisms are associated with the loss of cell membrane integrity.

  18. Control of foodborne pathogens on fresh-cut fruit by a novel strain of Pseudomonas graminis.

    Science.gov (United States)

    Alegre, Isabel; Viñas, Inmaculada; Usall, Josep; Teixidó, Neus; Figge, Marian J; Abadias, Maribel

    2013-06-01

    The consumption of fresh-cut fruit has substantially risen over the last few years, leading to an increase in the number of outbreaks associated with fruit. Moreover, consumers are currently demanding wholesome, fresh-like, safe foods without added chemicals. As a response, the aim of this study was to determine if the naturally occurring microorganisms on fruit are "competitive with" or "antagonistic to" potentially encountered pathogens. Of the 97 and 107 isolates tested by co-inoculation with Escherichia coli O157:H7, Salmonella and Listeria innocua on fresh-cut apple and peach, respectively, and stored at 20 °C, seven showed a strong antagonistic capacity (more than 1-log unit reduction). One of the isolates, CPA-7, achieved the best reduction values (from 2.8 to 5.9-log units) and was the only isolate able to inhibit E. coli O157:H7 at refrigeration temperatures on both fruits. Therefore, CPA-7 was selected for further assays. Dose-response assays showed that CPA-7 should be present in at least the same amount as the pathogen to adequately reduce the numbers of the pathogen. From the results obtained in in vitro assays, competition seemed to be CPA-7's mode of action against E. coli O157:H7. The CPA-7 strain was identified as Pseudomonas graminis. Thus, the results support the potential use of CPA-7 as a bioprotective agent against foodborne pathogens in minimally processed fruit. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  20. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  1. Prevalence of foodborne pathogens in food from selected African countries - A meta-analysis.

    Science.gov (United States)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph; Matsheka, Maitshwarelo Ignatius; Sekwati-Monang, Bonno; Amoa-Awua, Wisdom; Atter, Amy; Ackah, Nina Bernice; Mbugua, Samuel; Asagbra, Agnes; Abdelgadir, Warda; Nakavuma, Jesca; Jakobsen, Mogens; Fang, Weihuan

    2017-05-16

    Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews the prevalence of foodborne pathogens in seven African countries (Benin, Botswana, Ghana, Kenya, Nigeria, Sudan and Uganda) from papers in regional or international journals published between January 2000 and December 2015. One hundred and sixteen publications that dealt with food microbiology were reviewed for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78/116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes were the most frequently reported organisms in those studies. Although the data were highly heterogeneous, a striking feature is high prevalence of the major pathogens in RTE foods, almost as high as in raw foods. E. coli averaged at 37.6% in raw foods and 31.6% in RTE foods. The corresponding prevalence for Salmonella was 19.9% vs 21.7%; S. aureus, 27.8% vs 25.1% and L. monocytogenes, 19.5% vs 6.7%. The average prevalence of foodborne pathogens in these countries was 34.2% (29.0-39.3%). Differences in food types as well as non-uniform protocols for sampling and identification might have contributed to high heterogeneity (I 2 >97%) although some high prevalence data could be factual with extensive varieties of raw and RTE foods

  2. Antioxidant and antibacterial activities on foodborne pathogens of Artocarpus heterophyllus Lam. (Moraceae) leaves extracts.

    Science.gov (United States)

    Loizzo, M R; Tundis, R; Chandrika, U G; Abeysekera, A M; Menichini, F; Frega, N G

    2010-06-01

    Total water extract, ethyl acetate, and aqueous fractions from the leaves of Artocarpus heterophyllus were evaluated for phenolic content, antioxidant, and antibacterial activities against some foodborne pathogens such as E. coli, Listeria monocytogenes, Salmonella typhimurium, Salmonella enterica, Bacillus cereus, Enterococcus faecalis, and Staphylococcus aureus. The minimum inhibitory concentration (MICs) of extract and fractions determined by the agar dilution method were ranged from 221.9 microg/mL for ethyl acetate fraction to 488.1 microg/mL for total extract. In the agar diffusion method the diameters of inhibition were 12.2 for the total extract, 10.7 and 11.5 for ethyl acetate and aqueous fractions, respectively. A. heterophyllus showed significant antioxidant activity tested in different in vitro systems (DPPH, ABTS, FRAP, and Fe(2+) chelating activity assay). In particular, in DPPH assay A. heterophyllus total extract exhibited a strong antiradical activity with an IC(50) value of 73.5 microg/mL while aqueous fraction exerted the highest activity in FRAP assay (IC(50) value of 72.0 microg/mL). The total phenols content by Folin-Ciocalteau method was determined with the purpose of testing its relationship with the antioxidant and antibacterial activities.

  3. UV-Heat Treatments for the Control of Foodborne Microbial Pathogens in Chicken Broth

    Directory of Open Access Journals (Sweden)

    M. Gouma

    2015-01-01

    Full Text Available This investigation established the process criteria for using UV-C light and mild heat (UV-H treatment to inactivate 5-Log10 cycles (performance criterion of common foodborne pathogen populations, Escherichia coli, Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus, when inoculated in chicken broth. To define the target microorganism and the proper UV-H treatment conditions (including UV dose, treatment time, and temperature that would achieve the stated performance criterion, mathematical equations based on Geeraerd’s model were developed for each microorganism. For the sake of comparison, inactivation equations for heat treatments were also performed on the same chicken broth and for the same microorganisms. L. monocytogenes was the most UV-H resistant microorganism at all temperatures, requiring a UV dose between 6.10 J/mL (5.6 min and 2.26 J/mL (2.09 min to achieve 5-Log10 reductions. In comparison with UV treatments at room temperatures, the combination of UV and mild heat allowed both the UV dose and treatment time to be reduced by 30% and 63% at 55°C and 60°C, respectively. Compared to heat treatments, the UV-H process reduced the heating time for 5-Log10 reductions of all the investigated microorganisms in chicken broth from 20-fold to 2-fold when the operating temperature varied from 53 to 60°C.

  4. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    Energy Technology Data Exchange (ETDEWEB)

    Sommers, Christopher H. [Food Safety Intervention Technologies Research Unit, Eastern Regional Research Center, Agricultural Research Service, US Department of Agriculture, 600 East Mermaid Lane, Wyndmoor, PA 19038 (United States)]. E-mail: csommers@errc.ars.usda.gov; Boyd, Glenn [Food Safety Intervention Technologies Research Unit, Eastern Regional Research Center, Agricultural Research Service, US Department of Agriculture, 600 East Mermaid Lane, Wyndmoor, PA 19038 (United States)

    2006-07-15

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other 'heat and eat' multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a 'frankfurter on a roll', a 'beef cheeseburger on a bun' and a 'vegetarian cheeseburger on a bun' was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log{sub 1} of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat' sandwich products.

  5. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications

    Directory of Open Access Journals (Sweden)

    Michael J. Rothrock

    2017-08-01

    Full Text Available Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately 20% and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.

  6. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications.

    Science.gov (United States)

    Rothrock, Michael J; Davis, Morgan L; Locatelli, Aude; Bodie, Aaron; McIntosh, Tori G; Donaldson, Janet R; Ricke, Steven C

    2017-01-01

    Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli , and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes , possesses a high mortality rate (approximately 20%) and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.

  7. [Virulent gene prevalence of foodborne Listeria monocytogenes in China in 2005].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yun-Chang; Pei, Xiao-Yan; Liu, Xiu-Mei

    2010-12-01

    To study the virulent gene prevalence of foodborne Listeria monocytogenes (LM) isolated from China. 78 LM isolates derived from raw meat, cooked food, aquatic products and vegetables of 13 provinces and cities.LM isolates were investigated for prevalence of virulence genes (LIPI-1 (prfA, plcA, hly, mpl, actA, plcB); LIPI-2 (inlA, inlB), and iap) by PCR method. 87.2% (68/78) of the isolates were prfA positive, 98.7% (77/78) of the isolates were plcA, actA and plcB positive, 97.4% (76/78) of the isolates were hly positive, 87.2% (68/78) of the isolates were mpl positive, 92.3% (72/78) of the isolates were inlA positive, 100% (78/78) of the isolates were inlB positive, 98.7% (77/78) of the isolates were iap positive. Among 21 virulent gene negative isolates, there was 7 isolates lack of two or more virulence genes. The rate of virulence genes deletion isolates from cooked meat was 31.3% (10/32), the rate of virulence genes deletion isolates from raw meat was 16.1% (5/31), the rate of virulence genes deletion isolates from vegetables was 36.4% (4/11) and rate of virulence genes deletion isolates from seafood was 50% (2/4). No significant difference was found (χ(2) = 3.721, P > 0.05). The virulence gene array-1 strains were dominant among these isolates. Among 78 LM isolates, prevalent of virulent genes were different except inlB, virulence genes of LIP-1 were deleted prevalently among isolates, virulence gene deletion patterns were diverse.

  8. The association between foodborne and orofecal pathogens and allergic sensitisation -- EuroPrevall study

    NARCIS (Netherlands)

    Janse, Jacqueline J.; Wong, Gary W. K.; Potts, James; Ogorodova, Ludmila M.; Fedorova, Olga S.; Mahesh, P. A.; Sakellariou, Alexandros; Papadopoulos, Nikolaos G.; Knulst, André C.; Versteeg, Serge A.; Kroes, Aloys C. M.; Vossen, Ann C. T. M.; Campos Ponce, Maiza; Kummeling, Ischa; Burney, Peter; van Ree, Ronald; Yazdanbakhsh, Maria

    2014-01-01

    An inverse association between markers of exposure to foodborne and orofecal pathogens and allergic sensitization has been reported. However, the findings of epidemiological studies have not been consistent. This study investigated the relationship between antibodies to hepatitis A, Toxoplasma

  9. The association between foodborne and orofecal pathogens and allergic sensitisation - EuroPrevall study

    NARCIS (Netherlands)

    Janse, J.J.; Wong, G.W.K.; Potts, J.; Ogorodova, L.M.; Fedorova, O.S.; Mahesh, P.A.; Sakellariou, A.; Papadopoulos, N.G.; Knulst, A.C.; Versteeg, S.A.; Kroes, A.C.M.; Vossen, A.C.T.M.; Campos Ponce, M.; Kummeling, I.; Burney, P.; van Ree, R.; Yazdanbakhsh, M.

    2014-01-01

    Background: An inverse association between markers of exposure to foodborne and orofecal pathogens and allergic sensitization has been reported. However, the findings of epidemiological studies have not been consistent. This study investigated the relationship between antibodies to hepatitis A,

  10. Survival and High-Hydrostatic Pressure Inactivation of Foodborne Pathogens in Salmorejo, a Traditional Ready-to-Eat Food.

    Science.gov (United States)

    Toledo Del Árbol, Julia; Pérez Pulido, Rubén; Grande, Ma José; Gálvez, Antonio; Lucas, Rosario

    2015-11-01

    Salmorejo is a traditional tomato-based creamy product. Because salmorejo is not heat-processed, there is a risk of contamination with foodborne pathogens from raw materials. Even though bacterial growth in salmorejo is strongly inhibited because of its acidic pH (close to 3.9), the growth and survival of 3 foodborne pathogens in this food has not been studied before. In this study, 3 cocktails consisting of Escherichia coli O157, Salmonella enterica serovar Enteritidis, and Listeria monocytogenes strains were inoculated in freshly prepared salmorejo. The food was treated by high hydrostatic pressure (HHP) at 400, 500, or 600 MPa for 8 min, or left untreated, and stored at 4 °C for 30 d. Viable cell counts were determined on selective media and also by the triple-layer agar method in order to detect sublethally injured cells. In control samples, L. monocytogenes viable cells decreased by 2.4 log cycles at day 7 and were undetectable by day 15. S. enterica cells decreased by 0.5 or 2.4 log cycles at days 7 and 15 respectively, but still were detectable at day 30. E. coli O157 cells survived much better in salmorejo, decreasing only by 1.5 log cycles at day 30. Treatments at pressures of 400 MPa or higher reduced viable counts of L. monocytogenes and S. enterica to undetectable levels. HHP treatments significantly (P food, usually produced on a small scale. HHP treatment at 600 MPa for 8 min can be an efficient nonthermal method for industrial-scale preparation of preservative-free salmorejo with improved safety against transmission of foodborne pathogens L. monocytogenes serotyes 4a and 4b, S. enterica serovar Enteritidis, and E. coli O157. © 2015 Institute of Food Technologists®

  11. Antibacterial Activities of Hibiscus sabdariffa Extracts and Chemical Sanitizers Directly on Green Leaves Contaminated with Foodborne Pathogens.

    Science.gov (United States)

    Gómez-Aldapa, Carlos A; Rangel-Vargas, Esmeralda; Torres-Vitela, Ma Refugio; Villarruel-López, Angélica; Acevedo-Sandoval, Otilio A; Gordillo-Martínez, Alberto J; Godínez-Oviedo, Angélica; Castro-Rosas, Javier

    2018-02-01

    Leafy greens have been associated with foodborne disease outbreaks in different countries. To decrease microbial contamination of leafy greens, chemical agents are commonly used; however, a number of studies have shown these agents to have limited antimicrobial effect against pathogenic bacteria on vegetables. The objective of this study was to compare the antibacterial effect of Hibiscus sabdariffa calyx extracts (water, methanol, acetone, and ethyl acetate), sodium hypochlorite, acetic acid, and colloidal silver against foodborne bacteria on leafy greens. Thirteen foodborne bacteria were used in the study: Listeria monocytogenes, Shigella flexneri, Salmonella serotypes Typhimurium Typhi, and Montevideo, Staphylococcus aureus, Escherichia coli O157:H7, five E. coli pathotypes (Shiga toxin-producing, enteropathogenic, enterotoxigenic, enteroinvasive, and enteroaggregative), and Vibrio cholerae O1. Each foodborne bacterium was separately inoculated on romaine lettuce, spinach, and coriander leaves. Separately, contaminated leafy greens were immersed in four hibiscus extracts and in sanitizers for 5 min. Next, green leaves were washed with sterile tap water. Separately, each green leaf was placed in a bag that contained 0.1% sterile peptone water and was rubbed for 2 min. Counts were done by plate count using appropriate dilutions (in sterile peptone water) of the bacterial suspensions spread on Trypticase soy agar plates and incubated at 35 ± 2°C for 48 h. Statistically significant differences ( P caused a significantly greater reduction ( P contaminated romaine lettuce, spinach, and coriander than did the sodium hypochlorite, colloidal silver, and acetic acid. Dry roselle calyx extracts may potentially be a useful addition to disinfection procedures for romaine lettuce, spinach, and coriander.

  12. Climate Change, Foodborne Pathogens and Illness in Higher-Income Countries.

    Science.gov (United States)

    Lake, I R; Barker, G C

    2018-03-01

    We present a review of the likely consequences of climate change for foodborne pathogens and associated human illness in higher-income countries. The relationships between climate and food are complex and hence the impacts of climate change uncertain. This makes it difficult to know which foodborne pathogens will be most affected, what the specific effects will be, and on what timescales changes might occur. Hence, a focus upon current capacity and adaptation potential against foodborne pathogens is essential. We highlight a number of developments that may enhance preparedness for climate change. These include the following: Adoption of novel surveillance methods, such as syndromic methods, to speed up detection and increase the fidelity of intervention in foodborne outbreaks Genotype-based approaches to surveillance of food pathogens to enhance spatiotemporal resolution in tracing and tracking of illness Ever increasing integration of plant, animal and human surveillance systems, One Health, to maximise potential for identifying threats Increased commitment to cross-border (global) information initiatives (including big data) Improved clarity regarding the governance of complex societal issues such as the conflict between food safety and food waste Strong user-centric (social) communications strategies to engage diverse stakeholder groups The impact of climate change upon foodborne pathogens and associated illness is uncertain. This emphasises the need to enhance current capacity and adaptation potential against foodborne illness. A range of developments are explored in this paper to enhance preparedness.

  13. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. Copyright © 2016 Yang et al.

  14. Anti-adhesion and Anti-biofilm Potential of Organosilane Nanoparticles against Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Eleni N. Gkana

    2017-07-01

    Full Text Available Nowadays, modification of surfaces by nanoparticulate coatings is a simple process that may have applications in reducing the prevalence of bacterial cells both on medical devices and food processing surfaces. To this direction, biofilm biological cycle of Salmonella Typhimurium, Listeria monocytogenes, Escherichia coli O157:H7, Staphylococcus aureus, and Yersinia enterocolitica on stainless steel and glass surfaces, with or without nanocoating was monitored. To achieve this, four different commercial nanoparticle compounds (two for each surface based on organo-functionalized silanes were selected. In total 10 strains of above species (two for each species were selected to form biofilms on modified or not, stainless steel or glass surfaces, incubated at 37°C for 72 h. Biofilm population was enumerated by bead vortexing-plate counting method at four time intervals (3, 24, 48, and 72 h. Organosilane based products seemed to affect bacterial attachment on the inert surfaces and/or subsequent biofilm formation, but it was highly dependent on the species and material of surfaces involved. Specifically, reduced bacterial adhesion (at 3 h of Salmonella and E. coli was observed (P < 0.05 in nanocoating glass surfaces in comparison with the control ones. Moreover, fewer Salmonella and Yersinia biofilm cells were enumerated on stainless steel coupons coated with organosilanes, than on non-coated surfaces at 24 h (P < 0.05. This study gives an insight to the efficacy of organosilanes based coatings against biofilm formation of foodborne pathogens, however, further studies are needed to better understand the impact of surface modification and the underlying mechanisms which are involved in this phenomenon.

  15. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  16. Antibacterial Mode of Action of the Essential Oil Obtained from Chamaecyparis obtusa Sawdust on the Membrane Integrity of Selected Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Vivek K. Bajpai

    2014-01-01

    Full Text Available The present study examines the possible antibacterial mechanism of action of the essential oil obtained from Chamaecyparis obtusa (COEO sawdust against foodborne pathogenic bacteria. The COEO was obtained by microwave-assisted hydrodistillation of C. obtusa sawdust. The minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of COEO against the tested foodborne pathogens including Bacillus cereus ATCC 13061, Listeria monocytogenes ATCC 7644, Staphylococcus aureus ATCC 12600, Salmonella Typhimurium ATCC 43174 and Escherichia coli ATCC 43889 were found in the range from 62.5 to 500 μg/mL and from 125 to 1000 μg/mL, respectively. At the MIC concentrations, the COEO had potential inhibitory effect on the cell viability of the tested bacteria. In addition, the scanning electron microscopic analysis confirmed the inhibitory effect of COEO by revealing significant morphological alterations or rupture of the cell membranes of B. cereus ATCC 13061 and E. coli ATCC 43889. Moreover, the mode of action of COEO on the cell membrane of both Gram-positive B. cereus ATCC 13061 and Gram-negative E. coli ATCC 43889 bacteria was confirmed by marked release of extracellular adenosine 5’-triphosphate (ATP and cellular material that absorbs at 260 nm, and by efflux of potassium ions. These findings suggest that COEO holds a broad-spectrum antibacterial efficacy, confirming its influence on the membrane integrity and morphological characteristics of tested foodborne pathogens.

  17. Efficacy of Peracetic Acid in Inactivating Foodborne Pathogens on Fresh Produce Surface.

    Science.gov (United States)

    Singh, Prashant; Hung, Yen-Con; Qi, Hang

    2018-02-01

    Washing treatment with effective sanitizer is one of the critical steps in ensuring fresh produce safety. This study was to evaluate the efficacy of peracetic acid (PAA; VigorOx® 15 F&V), chlorine-based sanitizers (acidic electrolyzed water [AEO], near neutral electrolyzed water and bleach), lactic acid, and deionized (DI) water to reduce Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium DT104 from fresh produce surfaces. A 5-strain cocktail of E. coli O157:H7, L. monocytogenes, and S. Typhimurium DT104 was separately prepared and used for surface inoculation on produce samples (E. coli O157:H7 on romaine lettuce, lemons, tomatoes, and blueberries; L. monocytogenes on romaine lettuce and cantaloupe; S. Typhimurium DT104 on lemons, tomatoes, cantaloupe, and blueberries). PAA at 45, 85, and 100 mg/L; AEO, NNEO, and bleach at 100 mg/L of free chlorine; lactic acid at 2%; and DI water were used for washing inoculated produce in an automated produce washer for 5 min. In general, PAA at 100 mg/L achieved the highest microbial inactivation of E. coli O157:H7 (lettuce, lemon, tomato, and blueberry at 2.2, 5.7, 5.5, and 6.7 log CFU/g, respectively), S. Typhimurium DT104 (lemon, tomato, cantaloupe, blueberry at 5.4, 6.8, 4.5, and 5.9 log CFU/g, respectively), and L. monocytogenes (lettuce and cantaloupe at 2.4 and 4.4 log CFU/g, respectively). Efficacy of sanitizers on produce with coarse surface (for example, lettuce and cantaloupe) was lower than produce with smooth texture (lemon, tomato, and blueberry). Cross-contamination of E. coli O157:H7 among romaine lettuce heads during simulated retail crisping process was greatly reduced by the application of PAA and NNEO. NNEO and PAA showed high efficacy in foodborne pathogen removal from fresh produce. Produce surface texture plays an important role in pathogen removal. NNEO and PAA effectively prevented cross-contamination during the crisping process. © 2018 Institute of Food Technologists®.

  18. Polyelectrolyte Multicomponent Colloidosomes Loaded with Nisin Z for Enhanced Antimicrobial Activity against Foodborne Resistant Pathogens

    Directory of Open Access Journals (Sweden)

    Taskeen Niaz

    2018-01-01

    Full Text Available Food grade micro- or nano-carrier systems (NCS are being developed to improve the controlled release of antimicrobial agents. To augment the stability of liposomal NCS and to overcome the limitations associated with the use of free bacteriocin (nisin in the food system, multi-component colloidosomes (MCCS were developed by electrostatic interactions between anionic alginate and cationic chitosan (multilayer around phospholipids based liposomes (core. Zeta-sizer results revealed the average diameter of 145 ± 2 nm, 596 ± 3 nm, and 643 ± 5 nm for nano-liposome (NL, chitosomes (chitosan coated NL and MCCS, respectively. Zeta potential values of NCS varied from −4.37 ± 0.16 mV to 33.3 ± 6 mV, thus both chitosomes (CS and MCCS were positively charged. Microstructure analysis by scanning electron microscope (SEM revealed relatively higher size of MCCS with smooth and round morphology. TGA and DSC based experiments revealed that MCCS were thermally more stable than uncoated liposomes. Encapsulation efficiency of nisin in MCCS was observed to be 82.9 ± 4.1%, which was significantly higher than NL (56.5 ± 2.5%. FTIR analyses confirmed the cross-linking between sodium alginate and chitosan layer. Both qualitative (growth kinetics and quantitative (colony forming unit antimicrobial assays revealed that nisin loaded MCCS have superior potential to control resistant foodborne pathogens including Staphylococcus aureus, Listeria monocytogenes, and Enterococcus faecalis, (5.8, 5.4, and 6.1 Log CFUmL−1 reduction, respectively as compared to free nisin, loaded NL or CS. Controlled release kinetics data fitted with Korsmeyer–Peppas model suggested that nisin release from MCCS followed Fickian diffusion. Cytotoxic studies on human blood cells and HepG2 cell lines revealed hemocompatibility and non-toxicity of MCCS. Thus, due to enhanced controlled release, stability and biocompatibility; these multi-component colloidosomes can be useful for

  19. Fundamental Characteristics of Deep-UV Light-Emitting Diodes and Their Application To Control Foodborne Pathogens

    Science.gov (United States)

    Shin, Joo-Yeon; Kim, Soo-Ji; Kim, Do-Kyun

    2015-01-01

    Low-pressure mercury UV (LP-UV) lamps have long been used for bacterial inactivation, but due to certain disadvantages, such as the possibility of mercury leakage, deep-UV-C light-emitting diodes (DUV-LEDs) for disinfection have recently been of great interest as an alternative. Therefore, in this study, we examined the basic spectral properties of DUV-LEDs and the effects of UV-C irradiation for inactivating foodborne pathogens, including Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes, on solid media, as well as in water. As the temperature increased, DUV-LED light intensity decreased slightly, whereas LP-UV lamps showed increasing intensity until they reached a peak at around 30°C. As the irradiation dosage and temperature increased, E. coli O157:H7 and S. Typhimurium experienced 5- to 6-log-unit reductions. L. monocytogenes was reduced by over 5 log units at a dose of 1.67 mJ/cm2. At 90% relative humidity (RH), only E. coli O157:H7 experienced inactivation significantly greater than at 30 and 60% RH. In a water treatment study involving a continuous system, 6.38-, 5.81-, and 3.47-log-unit reductions were achieved in E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively, at 0.5 liter per minute (LPM) and 200 mW output power. The results of this study suggest that the use of DUV-LEDs may compensate for the drawbacks of using LP-UV lamps to inactivate foodborne pathogens. PMID:26162872

  20. Fundamental Characteristics of Deep-UV Light-Emitting Diodes and Their Application To Control Foodborne Pathogens.

    Science.gov (United States)

    Shin, Joo-Yeon; Kim, Soo-Ji; Kim, Do-Kyun; Kang, Dong-Hyun

    2016-01-01

    Low-pressure mercury UV (LP-UV) lamps have long been used for bacterial inactivation, but due to certain disadvantages, such as the possibility of mercury leakage, deep-UV-C light-emitting diodes (DUV-LEDs) for disinfection have recently been of great interest as an alternative. Therefore, in this study, we examined the basic spectral properties of DUV-LEDs and the effects of UV-C irradiation for inactivating foodborne pathogens, including Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes, on solid media, as well as in water. As the temperature increased, DUV-LED light intensity decreased slightly, whereas LP-UV lamps showed increasing intensity until they reached a peak at around 30°C. As the irradiation dosage and temperature increased, E. coli O157:H7 and S. Typhimurium experienced 5- to 6-log-unit reductions. L. monocytogenes was reduced by over 5 log units at a dose of 1.67 mJ/cm(2). At 90% relative humidity (RH), only E. coli O157:H7 experienced inactivation significantly greater than at 30 and 60% RH. In a water treatment study involving a continuous system, 6.38-, 5.81-, and 3.47-log-unit reductions were achieved in E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively, at 0.5 liter per minute (LPM) and 200 mW output power. The results of this study suggest that the use of DUV-LEDs may compensate for the drawbacks of using LP-UV lamps to inactivate foodborne pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Campylobacter spp. as a foodborne pathogen: a review

    Directory of Open Access Journals (Sweden)

    Joana eSilva

    2011-09-01

    Full Text Available Campylobacter is well recognized as the leading cause of bacterial foodborne diarrheal disease worldwide, causing mild to severe symptoms including serious infections of the extremities and permanent neurological symptoms. The organism is a cytochrome oxidase positive, microaerophilic, curved Gram-negative rod exhibiting corkscrew motility and is carried in the intestine of many wild and domestic animals, particularly avian species including poultry, where the intestine is colonized resulting in healthy animals as carriers. This review aims to elucidate and discuss the i genus Campylobacter, growth and survival characteristics; ii detection, isolation and confirmation of Campylobacter; iii campylobacteriosis and presence of virulence factors and iv colonization of poultry and control strategies.

  2. Tracking Foodborne Pathogenic Bacteria in Raw and Ready-to-Eat Food Illegally Sold at the Eastern EU Border.

    Science.gov (United States)

    Ciolacu, Luminita; Stessl, Beatrix; Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Wagner, Martin; Rychli, Kathrin; Nicolau, Anca Ioana

    2016-03-01

    Food illegally brought into the European Union, mainly in the personal luggage of travelers, represents a potential threat to consumers' health. The aim of this study was to investigate the presence of five pathogens in food brought into the European Union by Moldavian citizens as personal goods and illegally sold in Romania in the vicinity of the border. The occurrence of Staphylococcus aureus and Listeria monocytogenes was 7.5% and 8%, while Campylobacter spp., Escherichia coli O157:H7, and Salmonella spp. were absent in all samples. L. monocytogenes sequence type 2, 9, 121, and 155, highly prevalent among foodstuffs worldwide, was also present among isolates from ready-to-eat food illegally sold in Romania, even at the same date of sampling, indicating cross-contamination during food handling. S. aureus spa types t449, t304, and t524 were most often isolated from raw-milk cheeses contaminated with 10(3)-10(5) colony-forming units per gram, evidencing a contamination at herd level or unhygienic conditions during processing. S. aureus t011 and t3625, both included in the livestock-associated CC398, were isolated from pork lard and poultry meat. This study shows that cross-border trade from nonmember states represents a neglected route of transmission of foodborne pathogens into the European Union that could lead to sporadic or family-associated cases of disease.

  3. Hyperspectral microscope imaging methods to classify gram-positive and gram-negative foodborne pathogenic bacteria

    Science.gov (United States)

    An acousto-optic tunable filter-based hyperspectral microscope imaging method has potential for identification of foodborne pathogenic bacteria from microcolony rapidly with a single cell level. We have successfully developed the method to acquire quality hyperspectral microscopic images from variou...

  4. Classification of gram-positive and gram-negative foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Optical method with hyperspectral microscope imaging (HMI) has potential for identification of foodborne pathogenic bacteria from microcolonies rapidly with a cell level. A HMI system that provides both spatial and spectral information could be an effective tool for analyzing spectral characteristic...

  5. Acousto-Optic Tunable Filter Hyperspectral Microscope Imaging Method for Characterizing Spectra from Foodborne Pathogens.

    Science.gov (United States)

    Hyperspectral microscope imaging (HMI) method, which provides both spatial and spectral characteristics of samples, can be effective for foodborne pathogen detection. The acousto-optic tunable filter (AOTF)-based HMI method can be used to characterize spectral properties of biofilms formed by Salmon...

  6. Foodborne Pathogens Recovered from Ready-to-Eat Foods from Roadside Cafeterias and Retail Outlets in Alice, Eastern Cape Province, South Africa: Public Health Implications

    Science.gov (United States)

    Nyenje, Mirriam E.; Odjadjare, Collins E.; Tanih, Nicoline F.; Green, Ezekiel; Ndip, Roland N.

    2012-01-01

    This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24). Organisms isolated included: Listeria spp. (22%), Enterobacter spp. (18%), Aeromonas hydrophila (12%), Klebsiella oxytoca (8%), Proteus mirabilis (6.3%), Staphylococcus aureus (3.2%) and Pseudomonas luteola (2.4%). Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05) in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections. PMID:23066386

  7. Food-borne pathogens. Is there a remedy

    Energy Technology Data Exchange (ETDEWEB)

    Niemand, J G

    1985-03-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process.

  8. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  9. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  10. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  11. Understanding the behavior of foodborne pathogens in the food chain

    DEFF Research Database (Denmark)

    Rantsiou, Kalliopi; Mataragas, Marios; Jespersen, Lene

    2011-01-01

    In recent years and with the significant advancements in instrumentation for molecular biology methods, the focus of food microbiologists, dealing with pathogenic microorganisms in foods, is shifting. Scientists specifically aim at elucidating the effect that the food composition, as well...

  12. Application of Cinnamon oil Nanoemulsion to Control Foodborne Bacteria such as Listeria Sp. and Salmonella Sp. On Melons

    Science.gov (United States)

    Paudel, Sumit Kumar

    Listeria and Salmonella related recalls and outbreaks are of major concern to the melon industry. Cinnamon oil has shown its usefulness in food treatment due to strong antifungal, antiviral, and antibacterial activities. However, its applications are limited due to poor solubility of cinnamon oil in water. Utilization of Cinnamon oil nanoemulsion may offer effective antimicrobial washing treatment to melon industry. The purpose of this study was to test the antimicrobial efficacy of cinnamon oil nanoemulsion on melons against major food borne pathogens such as Listeria monocytogenes and Salmonella enterica. Different formulations of cinnamon oil nanoemulsion were made by ultrasonication using Tween 80 as an emulsifier. Nanoemulsion exhibiting the smallest oil droplets was applied. Oil droplets were characterized for particle size by dynamic light scattering. Microbroth dilution assay was performed on three strains each of Listeria monocytogenes and Salmonella enterica to find out the antimicrobial efficacy of cinnamon oil nanoemulsion. Honeydew and cantaloupe were artificially inoculated with the strains mentioned above followed by treatment in nanoemulsion (control, 0.1%, 0.25%, and 0.5%) for one minute. Samples were dried and enumerated after one hour of treatment on selective media (PALCAM and XLD agar). The average diameter of nanoemulsion was 9.63+/-0.3nm. Minimum inhibitory concentration (MIC) of cinnamon oil nanoemulsion for both Listeria and Salmonella strains was 0.078% v/v and 0.039% v/v, respectively and the minimum bactericidal concentration was 0.078125% v/v for both. Compared to the water control, 0.5% nanoemulsion showed up to 7.7 and 5.5 log CFU/gm reductions in L. monocytogenes and S. enterica, respectively. The data suggests that cinnamon oil nanoemulsion can be used as an effective natural microbial control agent for melons. Keywords: Nanoemulsion, ultrasonication, antimicrobial.

  13. Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins

    Science.gov (United States)

    Poshtiban, Somayyeh

    Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.

  14. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    . The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...

  15. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

    Science.gov (United States)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

    2018-03-10

    Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

  16. Antimicrobial activities of commercial essential oils and their components against food-borne pathogens and food spoilage bacteria

    Science.gov (United States)

    Mith, Hasika; Duré, Rémi; Delcenserie, Véronique; Zhiri, Abdesselam; Daube, Georges; Clinquart, Antoine

    2014-01-01

    This study was undertaken to determine the in vitro antimicrobial activities of 15 commercial essential oils and their main components in order to pre-select candidates for potential application in highly perishable food preservation. The antibacterial effects against food-borne pathogenic bacteria (Listeria monocytogenes, Salmonella Typhimurium, and enterohemorrhagic Escherichia coli O157:H7) and food spoilage bacteria (Brochothrix thermosphacta and Pseudomonas fluorescens) were tested using paper disk diffusion method, followed by determination of minimum inhibitory (MIC) and bactericidal (MBC) concentrations. Most of the tested essential oils exhibited antimicrobial activity against all tested bacteria, except galangal oil. The essential oils of cinnamon, oregano, and thyme showed strong antimicrobial activities with MIC ≥ 0.125 μL/mL and MBC ≥ 0.25 μL/mL. Among tested bacteria, P. fluorescens was the most resistant to selected essential oils with MICs and MBCs of 1 μL/mL. The results suggest that the activity of the essential oils of cinnamon, oregano, thyme, and clove can be attributed to the existence mostly of cinnamaldehyde, carvacrol, thymol, and eugenol, which appear to possess similar activities against all the tested bacteria. These materials could be served as an important natural alternative to prevent bacterial growth in food products. PMID:25473498

  17. Research and identification of pathogenic bacteria 'Salmonella and Listeria' in food

    International Nuclear Information System (INIS)

    Harizi Khalil

    2009-01-01

    The sums propose to evaluate the bacterial contamination of certain food taken randomly by two pathogenic bacteria (Salmonella and Listeria) considering the evolution of the diseases of food oignon. For that 78 food samples of different origins were analysed. 2 stocks of the Listeria kind and 3 stocks of the salmonella kind were insulated and identified by biochemical and molecular tests. The pathogenic isolates were identified by coloration gram, test catalase, insulation on specific culture media and Api (20 E for Salmonella and Api listeria. At the end, the PCR were realized to amplify the gene iap which codes for the protein p60 at listeria as well as a sequence clonee randomly specific of Salmonella.

  18. Statistics of sampling for microbiological testing of foodborne pathogens

    Science.gov (United States)

    Despite the many recent advances in protocols for testing for pathogens in foods, a number of challenges still exist. For example, the microbiological safety of food cannot be completely ensured by testing because microorganisms are not evenly distributed throughout the food. Therefore, since it i...

  19. Segal’s Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project

    Directory of Open Access Journals (Sweden)

    James B. Pettengill

    2017-06-01

    Full Text Available Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella, we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria, respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb. These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species, but it was surprising how often methods differ in classifying reads—even at higher taxonomic ranks (e.g., family. This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal’s Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype.

  20. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    Science.gov (United States)

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  1. Use of Extract of Citrus sinensis as an antimicrobial agent for foodborne zoonotic pathogens and spoilage bacteria

    Science.gov (United States)

    Foodborne pathogens remain global health problems despite concerted efforts to control the transmission of these microorganisms through food. The resurgence of drug resistant bacteria has renewed interest in developing and testing new sources of antimicrobial agents to control foodborne illness. Thi...

  2. Use of Lactobacillus plantarum Strains as a Bio-Control Strategy against Food-Borne Pathogenic Microorganisms

    Science.gov (United States)

    Arena, Mattia Pia; Silvain, Amandine; Normanno, Giovanni; Grieco, Francesco; Drider, Djamel; Spano, Giuseppe; Fiocco, Daniela

    2016-01-01

    Lactobacillus plantarum is one of the most versatile species extensively used in the food industry both as microbial starters and probiotic microorganisms. Several L. plantarum strains have been shown to produce different antimicrobial compounds such as organic acids, hydrogen peroxide, diacetyl, and also bacteriocins and antimicrobial peptides, both denoted by a variable spectrum of action. In recent decades, the selection of microbial molecules and/or bacterial strains able to produce antagonistic molecules to be used as antimicrobials and preservatives has been attracting scientific interest, in order to eliminate or reduce chemical additives, because of the growing attention of consumers for healthy and natural food products. The aim of this work was to investigate the antimicrobial activity of several food-isolated L. plantarum strains, analyzed against the pathogenic bacteria Listeria monocytogenes, Salmonella Enteritidis, Escherichia coli O157:H7 and Staphylococcus aureus. Antagonistic activity was assayed by agar spot test and revealed that strain L. plantarum 105 had the strongest ability to contrast the growth of L. monocytogenes, while strains L. plantarum 106 and 107 were the most active microorganisms against E. coli O157:H7. The antimicrobial ability was also screened by well diffusion assay and broth micro-dilution method using cell-free supernatants (CFS) from each Lactobacillus strain. Moreover, the chemical nature of the molecules released in the CFS, and possibly underlying the antagonistic activity, was preliminary characterized by exposure to different constraints such as pH neutralization, heating, catalase, and proteinase treatments. Our data suggest that the ability of L. plantarum cultures to contrast pathogens growth in vitro depends, at least in part, on a pH-lowering effect of supernatants and/or on the presence of organic acids. Cluster analysis was performed in order to group L. plantarum strains according to their antimicrobial effect

  3. Quantitative risk assessment: an emerging tool for emerging foodborne pathogens.

    OpenAIRE

    Lammerding, A. M.; Paoli, G. M.

    1997-01-01

    New challenges to the safety of the food supply require new strategies for evaluating and managing food safety risks. Changes in pathogens, food preparation, distribution, and consumption, and population immunity have the potential to adversely affect human health. Risk assessment offers a framework for predicting the impact of changes and trends on the provision of safe food. Risk assessment models facilitate the evaluation of active or passive changes in how foods are produced, processed, d...

  4. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in the brain, adrenal glands, spleen, kidney, lungs and the gastrointestinal ..... Cryptogenic liver abscess due to Listeria monocytogenes. .... of foods in sporadic listeriosis I. Case – control study of dietry risk factors. J. Am. Med.

  5. Current Perspectives on Viable but Non-culturable State in Foodborne Pathogens.

    Science.gov (United States)

    Zhao, Xihong; Zhong, Junliang; Wei, Caijiao; Lin, Chii-Wann; Ding, Tian

    2017-01-01

    The viable but non-culturable (VBNC) state, a unique state in which a number of bacteria respond to adverse circumstances, was first discovered in 1982. Unfortunately, it has been reported that many foodborne pathogens can be induced to enter the VBNC state by the limiting environmental conditions during food processing and preservation, such as extreme temperatures, drying, irradiation, pulsed electric field, and high pressure stress, as well as the addition of preservatives and disinfectants. After entering the VBNC state, foodborne pathogens will introduce a serious crisis to food safety and public health because they cannot be detected using conventional plate counting techniques. This review provides an overview of the various features of the VBNC state, including the biological characteristics, induction and resuscitation factors, formation and resuscitation mechanisms, detection methods, and relationship to food safety.

  6. Current Perspectives on Viable but Non-culturable State in Foodborne Pathogens

    OpenAIRE

    Zhao, Xihong; Zhong, Junliang; Wei, Caijiao; Lin, Chii-Wann; Ding, Tian

    2017-01-01

    The viable but non-culturable (VBNC) state, a unique state in which a number of bacteria respond to adverse circumstances, was first discovered in 1982. Unfortunately, it has been reported that many foodborne pathogens can be induced to enter the VBNC state by the limiting environmental conditions during food processing and preservation, such as extreme temperatures, drying, irradiation, pulsed electric field, and high pressure stress, as well as the addition of preservatives and disinfectant...

  7. Antibacterial and efflux pump inhibitors of thymol and carvacrol against food-borne pathogens.

    Science.gov (United States)

    Miladi, Hanene; Zmantar, Tarek; Chaabouni, Yassine; Fedhila, Kais; Bakhrouf, Amina; Mahdouani, Kacem; Chaieb, Kamel

    2016-10-01

    In this study thymol (THY) and carvacrol (CAR), two monoterpenic phenol produced by various aromatic plants, was tested for their antibacterial and efflux pump inhibitors potencies against a panel of clinical and foodborne pathogenes. Our results demonstrated a substantial susceptibility of the tested bacteria toward THY and CAR. Especially, THY displayed a strong inhibitory activity (MIC's values ranged from 32 to 64 μg/mL) against the majority of the tested strains compared to CAR. Moreover, a significant reduction in MIC's of TET and benzalkonium chloride (QAC) were noticed when tested in combinations with THY and CAR. Their synergic effect was more significant in the case of THY which resulted a reduction of MIC's values of TET (2-8 fold) and QAC (2-8 fold). We noted also that THY and CAR inhibited the ethidium bromide (EtBr) cell efflux in a concentration-dependent manner. The rate of EtBr accumulation in food-borne pathogen was enhanced with THY and CAR (0, 250 and 500 μg/mL). The lowest concentration causing 50% of EtBr efflux inhibition (IC 50) was noticed in Salmonella enteritidis (1129) at 150 μg/mL of THY and 190 μg/mL of CAR respectively. These findings indicate that THY and CAR may serve as potential sources of efflux pump inhibitor in food-borne pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

    Science.gov (United States)

    Lu, Chunye; Marjanovic, Olivera; Kiang, David

    2017-01-01

    ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

  9. High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak

    Directory of Open Access Journals (Sweden)

    Trout-Yakel Keri M

    2010-02-01

    Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.

  10. Potential Role of Diploscapter sp. Strain LKC25, a Bacterivorous Nematode from Soil, as a Vector of Food-Borne Pathogenic Bacteria to Preharvest Fruits and Vegetables

    Science.gov (United States)

    Gibbs, Daunte S.; Anderson, Gary L.; Beuchat, Larry R.; Carta, Lynn K.; Williams, Phillip L.

    2005-01-01

    Diploscapter, a thermotolerant, free-living soil bacterial-feeding nematode commonly found in compost, sewage, and agricultural soil in the United States, was studied to determine its potential role as a vehicle of Salmonella enterica serotype Poona, enterohemorrhagic Escherichia coli O157:H7, and Listeria monocytogenes in contaminating preharvest fruits and vegetables. The ability of Diploscapter sp. strain LKC25 to survive on agar media, in cow manure, and in composted turkey manure and to be attracted to, ingest, and disperse food-borne pathogens inoculated into soil or a mixture of soil and composted turkey manure was investigated. Diploscapter sp. strain LKC25 survived and reproduced in lawns of S. enterica serotype Poona, E. coli O157:H7, and L. monocytogenes on agar media and in cow manure and composted turkey manure. Attraction of Diploscapter sp. strain LKC25 to colonies of pathogenic bacteria on tryptic soy agar within 10, 20, 30, and 60 min and 24 h was determined. At least 85% of the worms initially placed 0.5 to 1 cm away from bacterial colonies migrated to the colonies within 1 h. Within 24 h, ≥90% of the worms were embedded in colonies. The potential of Diploscapter sp. strain LKC25 to shed pathogenic bacteria after exposure to bacteria inoculated into soil or a mixture of soil and composted turkey manure was investigated. Results indicate that Diploscapter sp. strain LKC25 can shed pathogenic bacteria after exposure to pathogens in these milieus. They also demonstrate its potential to serve as a vector of food-borne pathogenic bacteria in soil, with or without amendment with compost, to the surface of preharvest fruits and vegetables in contact with soil. PMID:15870330

  11. The sensitivity of bacterial foodborne pathogens to Croton blanchetianus Baill essential oil

    Directory of Open Access Journals (Sweden)

    Geiseanny Fernandes do Amarante Melo

    2013-12-01

    Full Text Available The aim of this study was to assess the activity of essential oil extracted from the leaves of C. blanchetianus Baill, popularly known as "marmeleiro", in inhibiting the growth and survival of pathogenic microorganisms in food by determining their survival in vitro and by observing the behaviour of Listeria monocytogenes inoculated into a food model (meat cubes that was stored at refrigeration temperature (7 ± 1 ºC for 4 days. The results indicated a bactericidal effect against Aeromonas hydrophila and Listeria monocytogenes and bacteriostatic action against Salmonella Enteritidis. A bacteriostatic effect on meat contaminated with L. monocytogenes was found for all concentrations of essential oils tested. These results showed that essential oil from the leaves of C. blanchetianus Baill represents an alternative source of potentially natural antimicrobial agents that may be used as a food preservative.

  12. Recovery Estimation of Dried Foodborne Pathogens Is Directly Related to Rehydration Kinetics

    Science.gov (United States)

    Lang, Emilie; Zoz, Fiona; Iaconelli, Cyril; Guyot, Stéphane; Alvarez-Martin, Pablo; Beney, Laurent; Perrier-Cornet, Jean-Marie; Gervais, Patrick

    2016-01-01

    Drying is a common process which is used to preserve food products and technological microorganisms, but which is deleterious for the cells. The aim of this study is to differentiate the effects of drying alone from the effects of the successive and necessary rehydration. Rehydration of dried bacteria is a critical step already studied in starter culture but not for different kinetics and not for pathogens. In the present study, the influence of rehydration kinetics was investigated for three foodborne pathogens involved in neonatal diseases caused by the consumption of rehydrated milk powder: Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Senftenberg and Cronobacter sakazakii. Bacteria were dried in controlled relative humidity atmospheres and then rehydrated using different methods. Our results showed that the survival of the three pathogens was strongly related to rehydration kinetics. Consequently, rehydration is an important step to consider during food safety assessment or during studies of dried foodborne pathogens. Also, it has to be considered with more attention in consumers’ homes during the preparation of food, like powdered infant formula, to avoid pathogens recovery. PMID:27494169

  13. Recovery Estimation of Dried Foodborne Pathogens Is Directly Related to Rehydration Kinetics.

    Directory of Open Access Journals (Sweden)

    Emilie Lang

    Full Text Available Drying is a common process which is used to preserve food products and technological microorganisms, but which is deleterious for the cells. The aim of this study is to differentiate the effects of drying alone from the effects of the successive and necessary rehydration. Rehydration of dried bacteria is a critical step already studied in starter culture but not for different kinetics and not for pathogens. In the present study, the influence of rehydration kinetics was investigated for three foodborne pathogens involved in neonatal diseases caused by the consumption of rehydrated milk powder: Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Senftenberg and Cronobacter sakazakii. Bacteria were dried in controlled relative humidity atmospheres and then rehydrated using different methods. Our results showed that the survival of the three pathogens was strongly related to rehydration kinetics. Consequently, rehydration is an important step to consider during food safety assessment or during studies of dried foodborne pathogens. Also, it has to be considered with more attention in consumers' homes during the preparation of food, like powdered infant formula, to avoid pathogens recovery.

  14. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

    OpenAIRE

    Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.

    2016-01-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...

  15. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.

  16. Foodborne Pathogens Recovered from Ready-to-Eat Foods from Roadside Cafeterias and Retail Outlets in Alice, Eastern Cape Province, South Africa: Public Health Implications

    Directory of Open Access Journals (Sweden)

    Roland N. Ndip

    2012-07-01

    Full Text Available This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24. Organisms isolated included: Listeria spp. (22%, Enterobacter spp. (18%, Aeromonas hydrophila (12%, Klebsiella oxytoca (8%, Proteus mirabilis (6.3%, Staphylococcus aureus (3.2% and Pseudomonas luteola (2.4%. Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05 in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections.

  17. Combination treatment of chlorine dioxide gas and aerosolized sanitizer for inactivating foodborne pathogens on spinach leaves and tomatoes.

    Science.gov (United States)

    Park, Sang-Hyun; Kang, Dong-Hyun

    2015-08-17

    The objective of this study was to evaluate the antimicrobial effect of chlorine dioxide (ClO2) gas and aerosolized sanitizer, when applied alone or in combination, on the survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes inoculated onto spinach leaves and tomato surfaces. Spinach leaves and tomatoes were inoculated with a cocktail of three strains each of the three foodborne pathogens. ClO2 gas (5 or 10 ppmv) and aerosolized peracetic acid (PAA) (80 ppm) were applied alone or in combination for 20 min. Exposure to 10 ppmv of ClO2 gas for 20 min resulted in 3.4, 3.3, and 3.4 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes on spinach leaves, respectively. Treatment with 80 ppm of aerosolized PAA for 20 min caused 2.3, 1.9, and 0.8 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) for 20 min caused 5.4, 5.1, and 4.1 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. E. coli O157:H7, S. Typhimurium, and L. monocytogenes on tomatoes experienced similar reduction patterns to those on spinach leaves. As treatment time increased, most combinations of ClO2 gas and aerosolized PAA showed additive effects in the inactivation of the three pathogens. Combined treatment of ClO2 gas and aerosolized PAA produced injured cells of three pathogens on spinach leaves while generally did not produce injured cells of these pathogens on tomatoes. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) did not significantly (p>0.05) affect the color and texture of samples during 7 days of storage. Copyright © 2015. Published by Elsevier B.V.

  18. Manipulation of host membranes by the bacterial pathogens Listeria, Francisella, Shigella and Yersinia.

    Science.gov (United States)

    Pizarro-Cerdá, Javier; Charbit, Alain; Enninga, Jost; Lafont, Frank; Cossart, Pascale

    2016-12-01

    Bacterial pathogens display an impressive arsenal of molecular mechanisms that allow survival in diverse host niches. Subversion of plasma membrane and cytoskeletal functions are common themes associated to infection by both extracellular and intracellular pathogens. Moreover, intracellular pathogens modify the structure/stability of their membrane-bound compartments and escape degradation from phagocytic or autophagic pathways. Here, we review the manipulation of host membranes by Listeria monocytogenes, Francisella tularensis, Shigella flexneri and Yersinia spp. These four bacterial model pathogens exemplify generalized strategies as well as specific features observed during bacterial infection processes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Science.gov (United States)

    Wang, Yixian; Ye, Zunzhong; Ying, Yibin

    2012-01-01

    The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review. PMID:22737018

  20. Efficacy of UV-C irradiation for inactivation of food-borne pathogens on sliced cheese packaged with different types and thicknesses of plastic films.

    Science.gov (United States)

    Ha, Jae-Won; Back, Kyeong-Hwan; Kim, Yoon-Hee; Kang, Dong-Hyun

    2016-08-01

    In this study, the efficacy of using UV-C light to inactivate sliced cheese inoculated with Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes and, packaged with 0.07 mm films of polyethylene terephthalate (PET), polyvinylchloride (PVC), polypropylene (PP), and polyethylene (PE) was investigated. The results show that compared with PET and PVC, PP and PE films showed significantly reduced levels of the three pathogens compared to inoculated but non-treated controls. Therefore, PP and PE films of different thicknesses (0.07 mm, 0.10 mm, and 0.13 mm) were then evaluated for pathogen reduction of inoculated sliced cheese samples. Compared with 0.10 and 0.13 mm, 0.07 mm thick PP and PE films did not show statistically significant reductions compared to non-packaged treated samples. Moreover, there were no statistically significant differences between the efficacy of PP and PE films. These results suggest that adjusted PP or PE film packaging in conjunction with UV-C radiation can be applied to control foodborne pathogens in the dairy industry. Copyright © 2016. Published by Elsevier Ltd.

  1. Mild processing applied to the inactivation of the main foodborne bacterial pathogens

    DEFF Research Database (Denmark)

    Barba Orellana, Francisco Jose; Koubaa, Mohamed; do Prado-Silva, Leonardo

    2017-01-01

    shelf-lives, pasteurization and commercial sterilization may result in numerous nutritional and sensory changes in foods. To address these disadvantages, mild processing methods (i.e., processing technologies for food preservation that apply mild temperature; ... contaminants have been developed. Scope and approach This review emphasizes the main applications of mild technologies aiming to the inactivation of the four main pathogenic bacteria of relevance for food safety as well as their mechanisms of action. Key findings and conclusions Mild processing technologies...... such as high pressure processing, ultrasounds, pulsed electric fields, UV-light, and atmospheric cold plasma may serve, in some conditions, as useful alternatives to commercial sterilization and pasteurization aiming to destroy foodborne pathogens. Each of these mild technologies has a specific mode...

  2. ESSENTIAL OILS OF CYMBOPOGON SP. IN THE CONTROL OF FOODBORNE PATHOGENIC BACTERIA

    Directory of Open Access Journals (Sweden)

    Danilo Florisvaldo BRUGNERA

    2011-08-01

    Full Text Available In this study, the agar well diffusion technique was used to determine the antibacterial activity of Cymbopogon nardus (citronella and Cymbopogon citratus (lemongrass essential oils, which were applied at different concentrations. The bacterial species used were the foodborne pathogens Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Both essential oils presented antibacterial activity in most concentrations tested. The Minimum Inhibitory Concentrations (MICs founded were: 7.81μL/mL (S. aureus and 3.90μL/mL (E. coli and P. aeruginosa, for C. nardus essential oil; and 3.90μL/mL (S. aureus, E. coli and P. aeruginosa, for C. citratus essential oil. The essential oils used were shown as promising natural antibacterials for pathogenic bacteria control in the food industry.

  3. Intervention technologies for food safety on minimally processed produce:Perspectives on food-borne and plant pathogens

    Science.gov (United States)

    Produce contamination associated with enteric pathogens such Escherichia coli O157:H7, salmonella spp., Listeria monocytogenes, Shigella and others are significant challenges to food safety. This is due to the illnesses and economic impacts resulting from the outbreaks. Innovative technologies for i...

  4. Inactivation of food-borne pathogens by combined high hydrostatic pressure and irradiation- a model study

    International Nuclear Information System (INIS)

    Kamat, Anu; Thomas, Paul; Kesavan, P.C.; Fotedar, R.

    1997-01-01

    Application of radiation or high pressure as a food processing method is comparatively recent development in food industry. To investigate the response to hydrostatic pressure, cells of pathogens at logarithmic phase were exposed to 200 MPa for various time intervals in saline as model system. The cells of Salmonella were observed to be most sensitive whereas Listeria monocytogenes were most resistant as revealed by 7 and 2 log cycle inactivation respectively in 10 min. The cells of Bacillus cereus and Yersinia enterocolitica showed 3 long cycles reduction by the same treatment. Bacterial spores because of their resistant nature, are inactivated only at high radiation doses, which are technologically unfeasible. Studies carried out to examine the effectiveness of combination of pressure and radiation clearly suggested that combination treatment given in either sequence reduces the bacterial spore load more effectively than the individual treatment per se. (author)

  5. Comprehensive Proteomic Analysis of Lysine Acetylation in the Foodborne Pathogen Trichinella spiralis

    Directory of Open Access Journals (Sweden)

    Yong Yang

    2018-01-01

    Full Text Available Lysine acetylation is a dynamic and highly conserved post-translational modification that plays a critical role in regulating diverse cellular processes. Trichinella spiralis is a foodborne parasite with a considerable socio-economic impact. However, to date, little is known regarding the role of lysine acetylation in this parasitic nematode. In this study, we utilized a proteomic approach involving anti-acetyl lysine-based enrichment and highly sensitive mass spectrometry to identify the global acetylated proteome and investigate lysine acetylation in T. spiralis. In total, 3872 lysine modification sites were identified in 1592 proteins that are involved in a wide variety of biological processes. Consistent with the results of previous studies, a large number of the acetylated proteins appear to be involved in metabolic and biosynthetic processes. Interestingly, according to the functional enrichment analysis, 29 acetylated proteins were associated with phagocytosis, suggesting an important role of lysine acetylation in this process. Among the identified proteins, 15 putative acetylation motifs were detected. The presence of serine downstream of the lysine acetylation site was commonly observed in the regions surrounding the sites. Moreover, protein interaction network analysis revealed that various interactions are regulated by protein acetylation. These data represent the first report of the acetylome of T. spiralis and provide an important resource for further explorations of the role of lysine acetylation in this foodborne pathogen.

  6. Immobilization with Metal Hydroxides as a Means To Concentrate Food-Borne Bacteria for Detection by Cultural and Molecular Methods†

    OpenAIRE

    Lucore, Lisa A.; Cullison, Mark A.; Jaykus, Lee-Ann

    2000-01-01

    The application of nucleic acid amplification methods to the detection of food-borne pathogens could be facilitated by concentrating the organisms from the food matrix before detection. This study evaluated the utility of metal hydroxide immobilization for the concentration of bacterial cells from dairy foods prior to detection by cultural and molecular methods. Using reconstituted nonfat dry milk (NFDM) as a model, two food-borne pathogens (Listeria monocytogenes and Salmonella enterica sero...

  7. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  8. Application of a 222-nm krypton-chlorine excilamp to control foodborne pathogens on sliced cheese surfaces and characterization of the bactericidal mechanisms.

    Science.gov (United States)

    Ha, Jae-Won; Lee, Jae-Ik; Kang, Dong-Hyun

    2017-02-21

    This study was conducted to investigate the basic spectral properties of a 222-nm krypton-chlorine (KrCl) excilamp and its inactivation efficacy against major foodborne pathogens on solid media, as well as on sliced cheese compared to a conventional 254-nm low-pressure mercury (LP Hg) lamp. Selective media and sliced cheese inoculated with Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes were irradiated with a KrCl excilamp and a LP Hg lamp at the same dose. The KrCl excilamp showed full radiant intensity from the outset at a wide range of working temperatures, especially at low temperatures of around 0 to 10°C. Irradiation with 222nm UV-C showed significantly (P<0.05) higher inactivation capacity against all three pathogens than 254-nm radiation on both media and sliced cheese surfaces without generating many sublethally injured cells which potentially could recover. The underlying inactivation mechanisms of 222-nm KrCl excilamp treatment were evaluated by fluorescent staining methods and damage to cellular membranes and intracellular enzyme inactivation were the primary factors contributing to the enhanced bactericidal effect. The results of this study suggest that a 222-nm UV-C surface disinfecting system can be applied as an alternative to conventional LP Hg lamp treatment by the dairy industry. Copyright © 2016. Published by Elsevier B.V.

  9. Antimicrobial Effect of Filipendula ulmaria Plant Extract Against Selected Foodborne Pathogenic and Spoilage Bacteria in Laboratory Media, Fish Flesh and Fish Roe Product

    Directory of Open Access Journals (Sweden)

    Charalampos Proestos

    2011-01-01

    Full Text Available Water-methanol extract from Filipendula ulmaria contains a variety of phenolic compounds, such as caffeic, p-coumaric and vanillic acid, myricetin, etc, which demonstrate antibacterial activity. Monitoring this activity in the broth using absorbance measurements showed that species of the Enterobacteriaceae family were more resistant than other Gram-negative and Gram-positive bacteria tested. Acidic environment enhanced the antibacterial activity of Filipendula ulmaria extract when it was tested against Salmonella Enteritidis PT4 and Listeria monocytogenes Scott A. The efficacy of Filipendula ulmaria extract against selected foodborne psychrotrophic bacteria was also tested using solid laboratory media and low incubation temperatures for better simulation of food preservation conditions. Higher concentrations of the extract, compared to minimum inhibitory concentration determined in the broth, were needed for satisfactory inhibition of spoilage bacteria. Potential use of Filipendula ulmaria extract as natural food preservative was also examined against natural spoilage flora and inoculated pathogenic bacteria on fish flesh and fish roe product (tarama salad. No significant differences of viable populations of spoilage or pathogenic bacteria were found between the treated samples and controls. Further trials of Filipendula ulmaria extract should be carried out in acidic foods with low fat and protein content, supplemented with additional adjuncts, in order to explore its potential as effective natural food antimicrobial agent.

  10. Integrated Approaches for the Public Health Prioritization of Foodborne and Zoonotic Pathogens

    DEFF Research Database (Denmark)

    Mangen, Marie-Josée; Batz, Mike; Kassbohrer, Annemarie

    2010-01-01

    such as cost of illness, willingness to pay, and health-adjusted life years (HALYs). To discuss the similarities and differences in these approaches, to seek consensus on principles, and to improve international collaboration, the E.U. MED-VET-NET and the U.S.-based Food Safety Research Consortium organized......To address the persistent problems of foodborne and zoonotic disease, public health officials worldwide face difficult choices about how to best allocate limited resources and target interventions to reduce morbidity and mortality. Data-driven approaches to informing these decisions have been...... developed in a number of countries. Integrated comparative frameworks generally share three methodological components: estimating incidence of acute illnesses, chronic sequelae, and mortality; attributing pathogen-specific illnesses to foods; and calculating integrated measures of disease burden...

  11. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  12. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  13. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  14. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    Science.gov (United States)

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  15. Complete Genome Sequence of Bacillus velezensis CN026 Exhibiting Antagonistic Activity against Gram-Negative Foodborne Pathogens.

    Science.gov (United States)

    Nannan, Catherine; Gillis, Annika; Caulier, Simon; Mahillon, Jacques

    2018-01-25

    We report here the complete genome sequence of Bacillus velezensis strain CN026, a member of the B. subtilis group, which is known for its many industrial applications. The genome contains 3,995,812 bp and displays six gene clusters potentially involved in strain CN026's activity against Gram-negative foodborne pathogens. Copyright © 2018 Nannan et al.

  16. Complete Genome Sequence of Bacillus velezensis CN026 Exhibiting Antagonistic Activity against Gram-Negative Foodborne Pathogens

    OpenAIRE

    Nannan, Catherine; Gillis, Annika; Caulier, Simon; Mahillon, Jacques

    2018-01-01

    ABSTRACT We report here the complete genome sequence of Bacillus velezensis strain CN026, a member of the B. subtilis group, which is known for its many industrial applications. The genome contains 3,995,812 bp and displays six gene clusters potentially involved in strain CN026’s activity against Gram-negative foodborne pathogens.

  17. Investigation of environmental drivers of antimicrobial resistance in foodborne bacterial pathogens in antibiotic-free, all natural, pastured poultry flocks.

    Science.gov (United States)

    Question: In the absence of antibiotic use within pastured poultry production, what are potential environmental variables that drive the antimicrobial sensitivity patterns of bacterial foodborne pathogens isolated from these flocks? Purpose: The objective of this study is to examine environmental f...

  18. Learning about Foodborne Pathogens: Evaluation of Student Perceptions of Group Project Work in a Food Microbiology Course

    Science.gov (United States)

    Turner, Mark S.

    2009-01-01

    This study examined the experiences of students in an active learning group work exercise in an introductory food microbiology course involving the study of foodborne pathogens. Small groups were required to access, analyze, and present information regarding a single food poisoning bacterium. The presentations contained features and…

  19. Methicillin-resistant Staphylococcus aureus: a controversial food-borne pathogen.

    Science.gov (United States)

    Sergelidis, D; Angelidis, A S

    2017-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a major cause of severe healthcare-associated (HA) infections. Although during the last decade the incidence of HA invasive infections has dropped, the incidence of community-associated MRSA (CA-MRSA) infections has risen among the general population. Moreover, CA-MRSA, livestock-associated MRSA (LA-MRSA) and HA-MRSA (HA-MRSA) can be found in foods intended for human consumption. Several studies from different geographical areas have reported the presence of enterotoxin genes in several MRSA food isolates. Molecular typing studies have revealed genetic relatedness of these enterotoxigenic isolates with isolates incriminated in human infections. The contamination sources for foods, especially animal-origin foods, may be livestock as well as humans involved in animal husbandry and food-processing. Under favourable environmental conditions for growth and enterotoxin production, enterotoxigenic S. aureus isolates present in foods can cause staphylococcal food poisoning (SFP), irrespective of the contamination origin. Owing to the typically moderate clinical manifestations of SFP, the S. aureus strains responsible for SFP (cases or outbreaks) are frequently either not identified or not further characterized. Antimicrobial susceptibility testing is rarely performed, because administration of antimicrobial therapy is not required in the vast majority of cases. Staphylococcal food poisoning is the result of consumption of foods with preformed enterotoxins. Hence, similar to methicillin-sensitive enterotoxigenic S. aureus, enterotoxigenic MRSA can also act as food-borne pathogens upon favourable conditions for growth and enterotoxin production. The severity of the intoxication is not related to the antimicrobial resistance profile of the causative S. aureus strain and therefore MRSA food-borne outbreaks are not expected to be more severe. This review evaluates the potential of methicillin-resistant Staphylococcus

  20. Oxidative Damage Caused by Common Foodborne Pathogenic Bacteria in Egg Yolk

    Directory of Open Access Journals (Sweden)

    Reyhaneh Afshordi

    2016-02-01

    Full Text Available Background: Bacteria in foodstuff are the most important agent of foodborne disease. Aside from their infectious effects, obligate aerobes have a respiratory metabolism with oxygen as the terminal electron acceptor. Therefore, they can produce reactive oxygen species and free radicals in contaminated food. Malondialdehyde (MDA is a product of lipid peroxidation used as an indicator of oxidative stress. Objectives: This study aimed to evaluate the oxidative damage produced by two common food pathogenic bacteria in foodstuff. Materials and Methods: The egg yolks were incubated with different dilutions (105,106, and 107 of Staphylococcus aureus and Salmonella enteritidis at 37°C for 20 hours. The level of MDA in egg yolk was measured by fast and simple enzymatic or colorimetric methods, such as the thiobarbituric acid reactive species method. Results: The high group (107 had a higher MDA level of 1.97 ± 0.11 (μg MDA/g in S. aureus and 1.65 ± 0.27 (mg MDA/L in S. enteritidis than the control (0.90 ± 0.13 mg MDA/L. Conclusions: We concluded that common food pathogenic bacteria can induce oxidative damage in foodstuff aside from other common problems. Heating or sterilization methods cannot protect foodstuff from the damage caused by the presence of pathogenic bacteria.

  1. Antibiotic susceptibility and prevalence of foodborne pathogens in poultry meat in Romania.

    Science.gov (United States)

    Dan, Sorin Daniel; Tăbăran, Alexandra; Mihaiu, Liora; Mihaiu, Marian

    2015-01-15

    The occurrence of pathogenic strains in poultry meat is of growing concern in Romania. Another problem found on a global level is the continuous increase of antimicrobial resistance in bacteria isolated from food. This study aimed to evaluate the prevalence of pathogenic bacteria in poultry carcasses obtained in Romania in 2012-2013 and to reveal the most prevalent patterns of antimicrobial resistance in the isolated strains. A total of 144 broiler chicken carcasses were evaluated according to classical microbiological methods. The DNA was extracted from the bacterial colonies and the resistance genes were identified by PCR. In 2012, 47.2% of the samples revealed at least one of the following bacteria: Campylobacter jejuni (9.72%; n = 7), Salmonella enterica serotype Enteritidis (4.17%; n = 3), Listeria monocytogenes (15.28%; n = 11), and Escherichia coli (16.67%; n = 12). In 2013, the number of positive samples of pathogenic bacteria decreased, although Campylobacter jejuni was isolated in a higher percentage (20.8% vs. 9.72%). The percentage of multidrug-resistant (MDR) bacteria was high (23%); the most prevalent pattern included resistance to tetracycline, sulfonamides, and quinolones/fluoroquinolones. All the resistant Salmonella and E. coli strains were tested for the presence of characteristic resistance genes (Kn, bla(TEM), tetA, tetB, tetG, DfrIa, aadA1a, Sul) and revealed that these isolates represent an important reservoir in the spread of this phenomenon. Our findings suggest that Romania urgently needs an integrated surveillance system within the entire chain, for drug-resistant pathogens isolated from poultry meat.

  2. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Kim, G; Om, A S; Mun, J H

    2007-01-01

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  3. Occurrence of Foodborne Pathogens in Chickens Sandwiches Distributed in Different Supermarkets of Tehran Province, Iran

    Directory of Open Access Journals (Sweden)

    Zohreh Mashak

    2014-07-01

    Full Text Available Background: Increasing urbanization, immigration and tourism has changed the human lifestyle. This modern lifestyle has demanded safety, quality, and fast availability of ready to eat (RTE foods like chicken sandwiches. Objectives: For presentation of proper solutions regarding food safety, identification of pathogens in different foods is necessary. Therefore, the present study was carried out to assess the microbiological quality of chicken sandwiches distributed in Tehran province, Iran. Materials and Methods: A total of 200 chicken sandwich samples (chicken sausage, chicken fillet, minced chicken fillet were purchased from different supermarkets in Tehran city randomly during 2013 and transported to the laboratory of food hygiene of Islamic Azad University, Karaj branch under temperature-controlled conditions for bacteriological examination by American Public Health Association (APHA method. Results: The average count ± standard error (and percent of unacceptable samples of S. aureus, B. cereus and Coliform were 1.6 ± 0.56 (28%, 2.0 ± 0.62 (10%, 4.2 ± 1.12 (50% CFU/g, respectively. Moreover, E. coli and Salmonella spp. were identified in 21% of chicken sandwich samples. Conclusions: The large number of foodborne pathogens detected in this study, represented a potential health hazard to consumers. Thus, it is necessary to employ Good Hygiene Practices (GHP and Hazard Analysis and Critical Control Points (HACCP in order to minimize the risk caused by secondary contamination.

  4. A quantum-dot-based fluoroassay for detection of food-borne pathogens.

    Science.gov (United States)

    Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass

    2017-09-01

    Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  6. Using lytic bacteriophages to eliminate or significantly reduce contamination of food by foodborne bacterial pathogens.

    Science.gov (United States)

    Sulakvelidze, Alexander

    2013-10-01

    Bacteriophages (also called 'phages') are viruses that kill bacteria. They are arguably the oldest (3 billion years old, by some estimates) and most ubiquitous (total number estimated to be 10(30) -10(32) ) known organisms on Earth. Phages play a key role in maintaining microbial balance in every ecosystem where bacteria exist, and they are part of the normal microflora of all fresh, unprocessed foods. Interest in various practical applications of bacteriophages has been gaining momentum recently, with perhaps the most attention focused on using them to improve food safety. That approach, called 'phage biocontrol', typically includes three main types of applications: (i) using phages to treat domesticated livestock in order to reduce their intestinal colonization with, and shedding of, specific bacterial pathogens; (ii) treatments for decontaminating inanimate surfaces in food-processing facilities and other food establishments, so that foods processed on those surfaces are not cross-contaminated with the targeted pathogens; and (iii) post-harvest treatments involving direct applications of phages onto the harvested foods. This mini-review primarily focuses on the last type of intervention, which has been gaining the most momentum recently. Indeed, the results of recent studies dealing with improving food safety, and several recent regulatory approvals of various commercial phage preparations developed for post-harvest food safety applications, strongly support the idea that lytic phages may provide a safe, environmentally-friendly, and effective approach for significantly reducing contamination of various foods with foodborne bacterial pathogens. However, some important technical and nontechnical problems may need to be addressed before phage biocontrol protocols can become an integral part of routine food safety intervention strategies implemented by food industries in the USA. © 2013 Society of Chemical Industry.

  7. Physical and antimicrobial properties of anise oil loaded nanoemulsions on the survival of foodborne pathogens.

    Science.gov (United States)

    Topuz, Osman Kadir; Özvural, Emin Burçin; Zhao, Qin; Huang, Qingrong; Chikindas, Michael; Gölükçü, Muharrem

    2016-07-15

    The purpose of this research was to investigate antimicrobial effects of nano emulsions of anise oil (AO) on the survival of common food borne pathogens, Listeria monocytogenes and Escherichia coli O157:H7. Series of emulsions containing different level of anise oil as potential antimicrobial delivery systems were prepared. Antimicrobial activities of bulk anise oil and its emulsions (coarse and nano) was tested by the minimum inhibitory concentration and time kill assay. Our results showed that bulk anise oil reduced the population of E. coli O157:H7 and L. monocytogenes by 1.48 and 0.47 log cfu/ml respectively after 6 h of contact time. However, under the same condition anise oil nanoemulsion (AO75) reduced E. coli O157:H7 and L. monocytogenes count by 2.51 and 1.64 log cfu/ml, respectively. Physicochemical and microbial analyses indicated that both nano and coarse emulsions of anise oil showed better and long-term physicochemical stability and antimicrobial activity compared to bulk anise oil. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Search and molecular identification of two pathogenic bacteria (Salmonella and Listeria) in different food matrices

    International Nuclear Information System (INIS)

    Wislati, Mohamed Amine

    2010-01-01

    A food is a substance consumed in the natural state or after a cooking. The essential role of food is the apport of essential elements in the growth and in the energy needs as well as in the reserves of the body. Foodstuffs may be contaminated by microorganisms such as the viruses, the parasites, the bacteria at the different steps of production, transformation, transport and manipulation being able to engender food collective toxi-infections (T.I.A.C), infections. This study contains a research directed by two pathogenic germs; Listeria and Salmonella as food contaminants, ending at the man's respectively in two diseases: the Listeriosis and the Salmonellosis and the enumeration of the fecal coliform as indicators of lack of hygiene and a contamination of fecal origin. 90 samples of various types and origins are analyzed in the laboratory of biology and molecular microbiology of the (CNSTN) and are identified by Api (Listeria, 20E) and by PCR. Three origins of Listeria and four origins of Salmonella were isolated. Then, the healthiness of various lots was estimated (dairy products, produced meat-based and produced ready to be eaten) according to the plan of interpretation of the result (plan 2 classes) and (plan 3 classes).The obtained results confirm the contamination of our products taken from the market of public consumption. So the strengthen measures of prevention and health control are very important in the food industry.

  9. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  10. Illuminating the landscape of host–pathogen interactions with the bacterium Listeria monocytogenes

    Science.gov (United States)

    Cossart, Pascale

    2011-01-01

    Listeria monocytogenes has, in 25 y, become a model in infection biology. Through the analysis of both its saprophytic life and infectious process, new concepts in microbiology, cell biology, and pathogenesis have been discovered. This review will update our knowledge on this intracellular pathogen and highlight the most recent breakthroughs. Promising areas of investigation such as the increasingly recognized relevance for the infectious process, of RNA-mediated regulations in the bacterium, and the role of bacterially controlled posttranslational and epigenetic modifications in the host will also be discussed. PMID:22114192

  11. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  12. Contamination of knives and graters by bacterial foodborne pathogens during slicing and grating of produce.

    Science.gov (United States)

    Erickson, Marilyn C; Liao, Jean; Cannon, Jennifer L; Ortega, Ynes R

    2015-12-01

    Poor hygiene and improper food preparation practices in consumers' homes have previously been demonstrated as contributing to foodborne diseases. To address potential cross-contamination by kitchen utensils in the home, a series of studies was conducted to determine the extent to which the use of a knife or grater on fresh produce would lead to the utensil's contamination with Escherichia coli O157:H7 or Salmonella enterica. When shredding inoculated carrots (ca. 5.3 log CFU/carrot), all graters became contaminated and the number of E. coli O157:H7 present on the utensil was significantly greater than Salmonella (p Contamination of knives after slicing inoculated produce (4.9-5.4 log CFU/produce item) could only be detected by enrichment culture. After slicing tomatoes, honeydew melons, strawberries, cucumbers, and cantaloupes, the average prevalence of knife contamination by the two pathogens was 43%, 17%, 15%, 7%, and 3%, respectively. No significant increase in the incidence or level of contamination occurred on the utensils when residues were present (p > 0.05); however, subsequent contamination of 7 produce items processed with the contaminated utensils did occur. These results highlight the necessity of proper sanitization of these utensils when used in preparation of raw produce. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Gallic acid conjugated with gold nanoparticles: antibacterial activity and mechanism of action on foodborne pathogens.

    Science.gov (United States)

    Rattanata, Narintorn; Klaynongsruang, Sompong; Leelayuwat, Chanvit; Limpaiboon, Temduang; Lulitanond, Aroonlug; Boonsiri, Patcharee; Chio-Srichan, Sirinart; Soontaranon, Siriwat; Rugmai, Supagorn; Daduang, Jureerut

    2016-01-01

    Foodborne pathogens, including Plesiomonas shigelloides and Shigella flexneri B, are the major cause of diarrheal endemics worldwide. Antibiotic drug resistance is increasing. Therefore, bioactive compounds with antibacterial activity, such as gallic acid (GA), are needed. Gold nanoparticles (AuNPs) are used as drug delivery agents. This study aimed to conjugate and characterize AuNP-GA and to evaluate the antibacterial activity. AuNP was conjugated with GA, and the core-shell structures were characterized by small-angle X-ray scattering and transmission electron microscopy. Antibacterial activity of AuNP-GA against P. shigelloides and S. flexneri B was evaluated by well diffusion method. AuNP-GA bactericidal mechanism was elucidated by Fourier transform infrared microspectroscopic analysis. The results of small-angle X-ray scattering showed that AuNP-GA conjugation was successful. Antibacterial activity of GA against both bacteria was improved by conjugation with AuNP because the minimum inhibitory concentration value of AuNP-GA was significantly decreased (Pacids at the bacterial cell membrane. Our findings show that AuNP-GA has potential for further application in biomedical sciences.

  14. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  15. Screening food-borne and zoonotic pathogens associated with livestock practices in the Sumapaz region, Cundinamarca, Colombia.

    Science.gov (United States)

    Arenas, Nelson E; Abril, Diego A; Valencia, Paola; Khandige, Surabhi; Soto, Carlos Yesid; Moreno-Melo, Vilma

    2017-04-01

    Hazardous practices regarding antibiotics misuse, unsanitary milking procedures, and the commercial sales of raw milk and unpasteurized dairy products are currently being practiced by livestock farmers in the Sumapaz region (Colombia). The purpose of this study was to screen for food-borne and zoonotic pathogens associated with local livestock practices. We evaluated 1098 cows from 46 livestock farms in the Sumapaz region that were selected by random. Of the total population of cattle, 962 animals (88%) were tested for bovine TB using a caudal-fold tuberculin test and 546 (50%) for brucellosis by a competitive ELISA. In the population tested, 23 cows were positive for Brucella sp. representing a 4.2% seroprevalence and no cases of bovine tuberculosis were found. In addition, food-borne contamination with Escherichia coli and Staphylococcus aureus was assessed together with antibiotic susceptibility for ten different antibiotics in milk samples from 16 livestock farms. We found that 12 of the farms (75%) were contaminated with these food-borne pathogens. Noteworthy, all of the isolated pathogenic strains were resistant to multiple antibiotics, primarily to oxytetracycline and erythromycin. Our findings suggest that livestock products could be a source of exposure to Brucella and multidrug-resistant E. coli and S. aureus strains as a result of unhygienic livestock practices in the Sumapaz region. Training in good farming practices is the key to improving safety in food production.

  16. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization.

    Science.gov (United States)

    Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can

    2009-06-08

    A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.

  17. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  18. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  19. Outbreaks where food workers have been implicated in the spread of foodborne disease. Part 4. Infective doses and pathogen carriage.

    Science.gov (United States)

    Todd, Ewen C D; Greig, Judy D; Bartleson, Charles A; Michaels, Barry S

    2008-11-01

    In this article, the fourth in a series reviewing the role of food workers in foodborne outbreaks, background information on the presence of enteric pathogens in the community, the numbers of organisms required to initiate an infection, and the length of carriage are presented. Although workers have been implicated in outbreaks, they were not always aware of their infections, either because they were in the prodromic phase before symptoms began or because they were asymptomatic carriers. Pathogens of fecal, nose or throat, and skin origin are most likely to be transmitted by the hands, highlighting the need for effective hand hygiene and other barriers to pathogen contamination, such as no bare hand contact with ready-to-eat food. The pathogens most likely to be transmitted by food workers are norovirus, hepatitis A virus, Salmonella, Shigella, and Staphylococcus aureus. However, other pathogens have been implicated in worker-associated outbreaks or have the potential to be implicated. In this study, the likelihood of pathogen involvement in foodborne outbreaks where infected workers have been implicated was examined, based on infectious dose, carriage rate in the community, duration of illness, and length of pathogen excretion. Infectious dose estimates are based on volunteer studies (mostly early experiments) or data from outbreaks. Although there is considerable uncertainty associated with these data, some pathogens appear to be able to infect at doses as low as 1 to 100 units, including viruses, parasites, and some bacteria. Lengthy postsymptomatic shedding periods and excretion by asymptomatic individuals of many enteric pathogens is an important issue for the hygienic management of food workers.

  20. Micro-nano-bio acoustic system for the detection of foodborne pathogens in real samples.

    Science.gov (United States)

    Papadakis, George; Murasova, Pavla; Hamiot, Audrey; Tsougeni, Katerina; Kaprou, Georgia; Eck, Michael; Rabus, David; Bilkova, Zuzana; Dupuy, Bruno; Jobst, Gerhard; Tserepi, Angeliki; Gogolides, Evangelos; Gizeli, Electra

    2018-07-15

    The fast and efficient detection of foodborne pathogens is a societal priority, given the large number of food-poisoning outbreaks, and a scientific and technological challenge, given the need to detect as little as 1 viable cell in 25 gr of food. Here, we present the first approach that achieves the above goal, thanks to the use of a micro/nano-technology and the detection capability of acoustic wave sensors. Starting from 1 Salmonella cell in 25 ml of milk, we employ immuno-magnetic beads to capture cells after only 3 h of pre-enrichment and subsequently demonstrate efficient DNA amplification using the Loop Mediated Isothermal Amplification method (LAMP) and acoustic detection in an integrated platform, within an additional ½ h. The demonstrated 4 h sample-to-analysis time comes as a huge improvement to the current need of few days to obtain the same result. In addition, the work presents the first reported Lab-on-Chip platform that comprises an acoustic device as the sensing element, exhibiting impressive analytical features, namely, an acoustic limit of detection of 2 cells/μl or 3 aM of the DNA target and ability to detect in a label-free manner dsDNA amplicons in impure samples. The use of food samples together with the incorporation of the necessary pre-enrichment step and ability for multiple analysis with an internal control, make the proposed methodology highly relevant to real-world applications. Moreover, the work suggests that acoustic wave devices can be used as an attractive alternative to electrochemical sensors in integrated platforms for applications in food safety and the point-of-care diagnostics. Copyright © 2018. Published by Elsevier B.V.

  1. Antibacterial Activity and Action Mechanism of the Essential Oil from Enteromorpha linza L. against Foodborne Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Jayanta Kumar Patra

    2016-03-01

    Full Text Available Foodborne illness and disease caused by foodborne pathogenic bacteria is continuing to increase day by day and it has become an important topic of concern among various food industries. Many types of synthetic antibacterial agents have been used in food processing and food preservation; however, they are not safe and have resulted in various health-related issues. Therefore, in the present study, essential oil from an edible seaweed, Enteromorpha linza (AEO, was evaluated for its antibacterial activity against foodborne pathogens, along with the mechanism of its antibacterial action. AEO at 25 mg/disc was highly active against Bacillus cereus (12.3–12.7 mm inhibition zone and Staphylococcus aureus (12.7–13.3 mm inhibition zone. The minimum inhibitory concentration and minimum bactericidal concentration values of AEO ranged from 12.5–25 mg/mL. Further investigation of the mechanism of action of AEO revealed its strong impairing effect on the viability of bacterial cells and membrane permeability, as indicated by a significant increase in leakage of 260 nm absorbing materials and K+ ions from the cell membrane and loss of high salt tolerance. Taken together, these data suggest that AEO has the potential for use as an effective antibacterial agent that functions by impairing cell membrane permeability via morphological alternations, resulting in cellular lysis and cell death.

  2. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  3. Systemic Analysis of Foodborne Disease Outbreak in Korea.

    Science.gov (United States)

    Lee, Jong-Kyung; Kwak, No-Seong; Kim, Hyun Jung

    2016-02-01

    This study systemically analyzed data on the prevalence of foodborne pathogens and foodborne disease outbreaks to identify the priorities of foodborne infection risk management in Korea. Multiple correspondence analysis was applied to three variables: origin of food source, phase of food supply chain, and 12 pathogens using 358 cases from 76 original papers and official reports published in 1998-2012. In addition, correspondence analysis of two variables--place and pathogen--was conducted based on epidemiological data of 2357 foodborne outbreaks in 2002-2011 provided by the Korean Ministry of Food and Drug Safety. The results of this study revealed three distinct areas of food monitoring: (1) livestock-derived raw food contaminated with Campylobacter spp., pathogenic Escherichia coli, Salmonella spp., and Listeria monocytogenes; (2) multi-ingredient and ready-to-eat food related to Staphylococcus aureus; and (3) water associated with norovirus. Our findings emphasize the need to track the sources and contamination pathways of foodborne pathogens for more effective risk management.

  4. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  5. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

    2000-01-01

    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  6. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe

    Science.gov (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  7. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2013-01-04

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.  Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/8/2013.

  8. Diversity of Endophytic Bacteria in a Fern Species Dryopteris uniformis (Makino) Makino and Evaluation of Their Antibacterial Potential Against Five Foodborne Pathogenic Bacteria.

    Science.gov (United States)

    Das, Gitishree; Park, Seonjoo; Baek, Kwang-Hyun

    2017-05-01

    The fern plant Dryopteris uniformis has traditionally been used in herbal medicine and possesses many biological activities. This study was conducted to explore the endophytic bacterial diversity associated with D. uniformis and evaluate their antibacterial potential against foodborne pathogenic bacteria (FPB). Among 51 isolated endophytic bacteria (EB), 26 EB were selected based on their morphological characteristics and identified by 16S rRNA gene analysis. The distribution of EB was diverse in the leaf and the stem/root tissues. When the EB were screened for antibacterial activity against five FPB, Listeria monocytogenes, Salmonella Typhimurium, Bacillus cereus, Staphylococcus aureus, and Escherichia coli O157:H7, four EB Bacillus sp. cryopeg, Paenibacillus sp. rif200865, Staphylococcus warneri, and Bacillus psychrodurans had a broad spectrum of antibacterial activity (9.58 ± 0.66 to 21.47 ± 0.27 mm inhibition zone). The butanol solvent extract of B. sp. cryopeg and P. sp. rif200865 displayed effective antibacterial activity against the five FPB, which was evident from the scanning electron microscopy with irregular or burst cell morphology in the EB-treated bacteria compared to smooth and regular cells in case of the control bacteria. The minimum inhibitory concentration and minimum bactericidal concentration values ranged between 250-500 μg/mL and 500-100 μg/mL, respectively. The above outcomes signify the huge prospective of the selected EB in the food industry. Overall, the above results suggested that D. uniformis contains several culturable EB that possess effective antibacterial compounds, and that EB can be utilized as a source of natural antibacterial agents for their practical application in food industry to control the spread of FPB as a natural antibacterial agent.

  9. Completeness of reporting in abstracts from clinical trials of pre-harvest interventions against foodborne pathogens.

    Science.gov (United States)

    Snedeker, Kate G; Canning, Paisley; Totton, Sarah C; Sargeant, Jan M

    2012-04-01

    Abstracts are the most commonly read part of a journal article, and play an important role as summaries of the articles, and search and screening tools. However, research on abstracts in human biomedicine has shown that abstracts often do not report key methodological features and results. Little research has been done to examine reporting of such features in abstracts from papers detailing pre-harvest food safety trials. Thus, the objective of this study was to assess the quality of reporting of key factors in abstracts detailing trials of pre-harvest food safety interventions. A systematic search algorithm was used to identify all in vivo trials of pre-harvest interventions against foodborne pathogens in PubMed and CAB Direct published from 1999 to October 2009. References were screened for relevance, and 150 were randomly chosen for inclusion in the study. A checklist based on the CONSORT abstract extension and the REFLECT Statement was used to assess the reporting of methodological features and results. All screening and assessment was performed by two independent reviewers with disagreements resolved by consensus. The systematic search returned 3554 unique citations; 356 were found to be relevant and 150 were randomly selected for inclusion. The abstracts were from 51 different journals, and 13 out of 150 were structured. Of the 124 abstracts that reported whether the trial design was deliberate disease challenge or natural exposure, 113 were deliberate challenge and 11 natural exposure. 103 abstracts detailed studies involving poultry, 20 cattle and 15 swine. Most abstracts reported the production stage of the animals (135/150), a hypothesis or objective (123/150), and results for all treatment groups (136/150). However, few abstracts reported on how animals were grouped in housing (25/150), the location of the study (5/150), the primary outcome (2/126), level of treatment allocation (15/150), sample size (63/150) or whether study units were lost to follow up

  10. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  11. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain

    Science.gov (United States)

    NicAogáin, Kerrie; O’Byrne, Conor P.

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042

  12. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain.

    Science.gov (United States)

    NicAogáin, Kerrie; O'Byrne, Conor P

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.

  13. Study on contamination of sheep meat in Shahrekord area with Listeria ivanovii and determination its antibiotic resistance pattern

    Directory of Open Access Journals (Sweden)

    Farid Khalili Borujeni

    2013-06-01

    Full Text Available Background and objectives: Listeria monocytogenes and Listeria ivanovii are two pathogenic species of Listeria. The role of Listeria ivanovii is important in abortion, stillbirth, septicemia in animals and this bacterium sometimes is pathogenic in humans. Contamination of ovine carcasses during the slaughter and processing can cause foodborne infections in humans. In this study we examined the contamination of sheep meat in slaughter house of Shahrekord city to Listeria ivanovii and determined its antibiotic resistance pattern.Material and Methods: A total 200 samples of sheep meat were collected from abattoir and processed by use of two enrichment method. After doing specific biochemical tests and PCR, Listeria spp was identified and antibiotic resistance of isolated Listeria were tested by the agar disc diffusion method. Results: The contamination of sheep carcasses with listeria was 2.5% (5 out of 200 samples. All five isolates (2.5% were recognized as Listeria ivanovii and were resistant to four antibiotics, sensitive to six antibiotics and intermediate to other antibiotics.  Conclusion: According to the contamination rate in sheep carcasses with Listeria ivanovii and the relatively high antibiotic resistance specified in this bacteria, the role of red meat in transmission of Listeria spp. and appropriate use of antibiotics against this bacteria should be considered.

  14. Analysis of a food-borne fungal pathogen outbreak: virulence and genome of a Mucor circinelloides isolate from yogurt.

    Science.gov (United States)

    Lee, Soo Chan; Billmyre, R Blake; Li, Alicia; Carson, Sandra; Sykes, Sean M; Huh, Eun Young; Mieczkowski, Piotr; Ko, Dennis C; Cuomo, Christina A; Heitman, Joseph

    2014-07-08

    Food-borne pathogens are ongoing problems, and new pathogens are emerging. The impact of fungi, however, is largely underestimated. Recently, commercial yogurts contaminated with Mucor circinelloides were sold, and >200 consumers became ill with nausea, vomiting, and diarrhea. Mucoralean fungi cause the fatal fungal infection mucormycosis, whose incidence has been continuously increasing. In this study, we isolated an M. circinelloides strain from a yogurt container, and multilocus sequence typing identified the strain as Mucor circinelloides f. circinelloides. M. circinelloides f. circinelloides is the most virulent M. circinelloides subspecies and is commonly associated with human infections, whereas M. circinelloides f. lusitanicus and M. circinelloides f. griseocyanus are less common causes of infection. Whole-genome analysis of the yogurt isolate confirmed it as being close to the M. circinelloides f. circinelloides subgroup, with a higher percentage of divergence with the M. circinelloides f. lusitanicus subgroup. In mating assays, the yogurt isolate formed sexual zygospores with the (-) M. circinelloides f. circinelloides tester strain, which is congruent with its sex locus encoding SexP, the (+) mating type sex determinant. The yogurt isolate was virulent in murine and wax moth larva host systems. In a murine gastromucormycosis model, Mucor was recovered from fecal samples of infected mice for up to 10 days, indicating that Mucor can survive transit through the GI tract. In interactions with human immune cells, M. circinelloides f. lusitanicus induced proinflammatory cytokines but M. circinelloides f. circinelloides did not, which may explain the different levels of virulence in mammalian hosts. This study demonstrates that M. circinelloides can spoil food products and cause gastrointestinal illness in consumers and may pose a particular risk to immunocompromised patients. Importance: The U.S. FDA reported that yogurt products were contaminated with M

  15. Integrated approaches for the public health prioritization of foodborne and zoonotic pathogens.

    NARCIS (Netherlands)

    Mangen, M.J.J.; Batz, M.B.; Kasbohrer, S.; Hald, T.; Morris, J.G.; Taylor, M.; Havelaar, A.H.

    2010-01-01

    To address the persistent problems of foodborne and zoonotic disease, public health officials worldwide face difficult choices about how to best allocate limited resources and target interventions to reduce morbidity and mortality. Data-driven approaches to informing these decisions have been

  16. Chemical Composition, Antioxidant, DNA Damage Protective, Cytotoxic and Antibacterial Activities of Cyperus rotundus Rhizomes Essential Oil against Foodborne Pathogens

    Science.gov (United States)

    Hu, Qing-Ping; Cao, Xin-Ming; Hao, Dong-Lin; Zhang, Liang-Liang

    2017-01-01

    Cyperus rotundus L. (Cyperaceae) is a medicinal herb traditionally used to treat various clinical conditions at home. In this study, chemical composition of Cyperus rotundus rhizomes essential oil, and in vitro antioxidant, DNA damage protective and cytotoxic activities as well as antibacterial activity against foodborne pathogens were investigated. Results showed that α-cyperone (38.46%), cyperene (12.84%) and α-selinene (11.66%) were the major components of the essential oil. The essential oil had an excellent antioxidant activity, the protective effect against DNA damage, and cytotoxic effects on the human neuroblastoma SH-SY5Y cell, as well as antibacterial activity against several foodborne pathogens. These biological activities were dose-dependent, increasing with higher dosage in a certain concentration range. The antibacterial effects of essential oil were greater against Gram-positive bacteria as compared to Gram-negative bacteria, and the antibacterial effects were significantly influenced by incubation time and concentration. These results may provide biological evidence for the practical application of the C. rotundus rhizomes essential oil in food and pharmaceutical industries. PMID:28338066

  17. Analyzing indicator microorganisms, antibiotic resistant Escherichia coli, and regrowth potential of foodborne pathogens in various organic fertilizers.

    Science.gov (United States)

    Miller, Cortney; Heringa, Spencer; Kim, Jinkyung; Jiang, Xiuping

    2013-06-01

    This study analyzed various organic fertilizers for indicator microorganisms, pathogens, and antibiotic-resistant Escherichia coli, and evaluated the growth potential of E. coli O157:H7 and Salmonella in fertilizers. A microbiological survey was conducted on 103 organic fertilizers from across the United States. Moisture content ranged from approximately 1% to 86.4%, and the average pH was 7.77. The total aerobic mesophiles ranged from approximately 3 to 9 log colony-forming units (CFU)/g. Enterobacteriaceae populations were in the range of fertilizer, respectively, whereas E. coli O157:H7 grew approximately 4.6, 4.0, 4.0, and 4.8 log CFU/g, respectively. Our results revealed that the microbiological quality of organic fertilizers varies greatly, with some fertilizers containing antibiotic resistant E. coli and a few supporting the growth of foodborne pathogens after reintroduction into the fertilizer.

  18. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  19. Sequelae of Foodborne Illness Caused by 5 Pathogens, Australia, Circa 2010

    OpenAIRE

    Ford, Laura; Kirk, Martyn; Glass, Kathryn; Hall, Gillian

    2014-01-01

    In Australia circa 2010, 4.1 million (90% credible interval [CrI] 2.3–6.4 million) episodes of foodborne gastroenteritis occurred, many of which might have resulted in sequelae. We estimated the number of illnesses, hospitalizations, and deaths from Guillain-Barré syndrome, hemolytic uremic syndrome, irritable bowel syndrome, and reactive arthritis that were associated with contaminated food in Australia. Data from published studies, hospital records, and mortality reports were combined with ...

  20. Sequelae of foodborne illness caused by 5 pathogens, Australia, circa 2010.

    Science.gov (United States)

    Ford, Laura; Kirk, Martyn; Glass, Kathryn; Hall, Gillian

    2014-11-01

    In Australia circa 2010, 4.1 million (90% credible interval [CrI] 2.3-6.4 million) episodes of foodborne gastroenteritis occurred, many of which might have resulted in sequelae. We estimated the number of illnesses, hospitalizations, and deaths from Guillain-Barré syndrome, hemolytic uremic syndrome, irritable bowel syndrome, and reactive arthritis that were associated with contaminated food in Australia. Data from published studies, hospital records, and mortality reports were combined with multipliers to adjust for different transmission routes. We used Monte Carlo simulation to estimate median estimates and 90% CrIs. In Australia, circa 2010, we estimated that 35,840 (90% CrI 25,000-54,000) illnesses, 1,080 (90% CrI 700-1,600) hospitalizations, and 10 (90% CrI 5-14) deaths occurred from foodborne gastroenteritis-associated sequelae. Campylobacter spp. infection was responsible for 80% of incident cases. Reducing the incidence of campylobacteriosis and other foodborne diseases would minimize the health effects of sequelae.

  1. Enhanced levels of cold shock proteins in Listeria monocytogenes LO28 upon exposure to low temperature and high hydrostatic pressure

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Karatzas, A.K.; Wouters, J.A.; Abee, T.

    2002-01-01

    Listeria monocytogenes is a psychrotrophic food-borne pathogen that is problematic for the food industry because of its ubiquitous distribution in nature and its ability to grow at low temperatures and in the presence of high salt concentrations. Here we demonstrate that the process of adaptation to

  2. Diverse genomic location and sequence content of a Listeria monocytogenes chromosomal island harboring heavy metal resistance and other genes

    Science.gov (United States)

    Listeria monocytogenes remains a major foodborne pathogen with three serotype 4b clonal groups (ECI, ECII, ECIa) repeatedly implicated in human listeriosis. For reasons that are unknown, many of these strains are also resistant to heavy metals, i.e. cadmium and arsenic. The acquisition and fitness i...

  3. Listeria monocytogenes source distribution analysis indicates regional heterogeneity and ecological niche preference among serotype 4b clones

    Science.gov (United States)

    Human illness due to the foodborne bacterial pathogen Listeria monocytogenes frequently involves certain widely disseminated clonal complexes (CCs), primarily of serotype 4b. CC1, CC2 and CC6, previously also designated epidemic clone (EC) I, Ia and II, respectively, have been frequently implicate...

  4. Listeria monocytogenes persistence and transfer to cantaloupes in the packing environment is affected by equipment surface type and cleanliness

    Science.gov (United States)

    Cantaloupes have frequently been contaminated with bacterial pathogens and caused several high profile outbreaks over the years. In 2011, Rocky Ford cantaloupes contaminated with Listeria monocytogenes sickened 147 people and resulted in 33 fatalities, making it the deadliest foodborne outbreak in t...

  5. Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains.

    Science.gov (United States)

    Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

  6. Importance of SigB for Listeria monocytogenes static and continuous flow biofilm formation and disinfectant resistance

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is able to form biofilms in food processing facilities. Biofilms are generally more resistant to antimicrobial agents, making it difficult to eradicate them during cleanup procedures. So far, little is known about the function of stress resistance

  7. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  8. Small molecules targeting LapB protein prevent Listeria attachment to catfish muscle.

    Directory of Open Access Journals (Sweden)

    Ali Akgul

    Full Text Available Listeria monocytogenes is a Gram-positive foodborne pathogen and the causative agent of listeriosis. L. monocytogenes lapB gene encodes a cell wall surface anchor protein, and mutation of this gene causes Listeria attenuation in mice. In this work, the potential role of Listeria LapB protein in catfish fillet attachment was investigated. To achieve this, boron-based small molecules designed to interfere with the active site of the L. monocytogenes LapB protein were developed, and their ability to prevent L. monocytogenes attachment to fish fillet was tested. Results indicated that seven out of nine different small molecules were effective in reducing the Listeria attachment to catfish fillets. Of these, three small molecules (SM3, SM5, and SM7 were highly effective in blocking Listeria attachment to catfish fillets. This study suggests an alternative strategy for reduction of L. monocytogenes contamination in fresh and frozen fish products.

  9. Methods for detecting pathogens in the beef food chain: an overview

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

  10. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-01-01

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128

  11. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

    Science.gov (United States)

    Jahan, M; Holley, R A

    2016-04-01

    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  12. Effects of irradiation dose and O(2) and CO(2) concentrations in packages on foodborne pathogenic bacteria and quality of ready-to-cook seasoned ground beef product (meatball) during refrigerated storage.

    Science.gov (United States)

    Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin

    2012-01-01

    Combined effects of gamma irradiation and concentrations of O(2) (0, 5, 21%) and CO(2) (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O(2) and CO(2) levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O(2), respectively, compared to 21% O(2). Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg(-1), respectively, compared to control. In reduced-O(2) packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO(2) or 5% O(2) + 50% CO(2) maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O(2) + 50% CO(2) combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.

  13. Effects of Irradiation Dose and O2 and CO2 Concentrations in Packages on Foodborne Pathogenic Bacteria and Quality of Ready-to-Cook Seasoned Ground Beef Product (Meatball) during Refrigerated Storage

    Science.gov (United States)

    Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin

    2012-01-01

    Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21%) and CO2 (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality. PMID:22566763

  14. Effects of Irradiation Dose and O2 and CO2 Concentrations in Packages on Foodborne Pathogenic Bacteria and Quality of Ready-to-Cook Seasoned Ground Beef Product (Meatball during Refrigerated Storage

    Directory of Open Access Journals (Sweden)

    Gurbuz Gunes

    2012-01-01

    Full Text Available Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21% and CO2 (0, 50% on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.

  15. Genome sequence of the thermotolerant foodborne pathogen Salmonella enterica serovar Senftenberg ATCC 43845 and phylogenetic analysis of Loci encoding increased protein quality control mechanisms

    Science.gov (United States)

    Salmonella enterica subsp. enterica bacteria are important foodborne pathogens with major economic impact. Some isolates exhibit increased heat tolerance, a concern for food safety. Analysis of a finished-quality genome sequence of an isolate commonly used in heat resistance studies, S. enterica sub...

  16. The β-defensin gallinacin-6 is expressed in the chicken digestive tract and has antimicrobial activity against food-borne pathogens

    NARCIS (Netherlands)

    van Dijk, A.; Veldhuizen, E.J.A.; Kalkhove, S.I.C.; Tjeerdsma-van Bokhoven, J.L.M.; Romijn, R.A.; Haagsman, H.P.

    2007-01-01

    Food-borne pathogens are responsible for most cases of food poisoning in developed countries and are often associated with poultry products, including chicken. Little is known about the role of ß-defensins in the chicken digestive tract and their efficacy. In this study, the expression of chicken

  17. Quantification of Salmonella Survival and Infection in an In vitro Model of the Human Intestinal Tract as Proxy for Foodborne Pathogens.

    NARCIS (Netherlands)

    Wijnands, Lucas M; Teunis, Peter F M; Kuijpers, Angelina F A; Delfgou-Van Asch, Ellen H M; Pielaat, Annemarie

    2017-01-01

    Different techniques are available for assessing differences in virulence of bacterial foodborne pathogens. The use of animal models or human volunteers is not expedient for various reasons; the use of epidemiological data is often hampered by lack of crucial data. In this paper, we describe a

  18. Meat Science and Muscle Biology Symposium: Ecological and dietary impactors of foodborne pathogens and methods to reduce fecal shedding in cattle.

    Science.gov (United States)

    Callaway, T R; Edrington, T S; Nisbet, D J

    2014-04-01

    Pathogenic bacteria can live asymptomatically within and on cattle and can enter the food chain but also can be transmitted to humans by fecal or direct animal contact. Reducing pathogenic bacterial incidence and populations within live cattle represents an important step in improving food safety. A broad range of preslaughter intervention strategies are being developed, which can be loosely classified as 1) directly antipathogen strategies, 2) competitive enhancement strategies (that use the microbiome's competitive nature against pathogens), and 3) animal management strategies. Included within these broad categories are such diverse methods as vaccination against foodborne pathogens, probiotics and prebiotics, bacterial viruses (i.e., bacteriophages), sodium chlorate feeding, and dietary and management changes that specifically alter the microbiome. The simultaneous application of 1 or more preharvest strategies has the potential to reduce human foodborne illnesses by erecting multiple hurdles preventing entry into humans. However, economic factors that govern producer profitability must be kept in mind while improving food safety.

  19. Activity of disinfectants against foodborne pathogens in suspension and adhered to stainless steel surfaces

    Directory of Open Access Journals (Sweden)

    Tatiane Karen Cabeça

    2012-09-01

    Full Text Available The purpose of this study was to investigate and compare the efficacy of various disinfectants on planktonic cells and biofilm cells of Listeria monocytogenes, Staphylococcus aureus and Escherichia coli. Numbers of viable biofilm cells decreased after treatment with all tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against biofilm cells, while biguanide was the least effective. Scanning electron microscopy observations revealed that cells adhered on stainless steel surface after treatment with the disinfectants. No viable planktonic cells were observed after treatment with the same disinfectants. Based on our findings, we concluded that biofilm cells might be more resistant to disinfectants than plancktonic cells.

  20. Prebiotics in food animals, a potential to reduce foodborne pathogens and disease

    Science.gov (United States)

    Animals can be seriously impacted by bacterial pathogens that affect their growth efficiency and overall health, as well as food safety of animal-derived products. Some pathogenic bacteria, such as Salmonella, can be a shared problem for both human and animal health and can be found in many animal ...

  1. Prebiotics in food animals: A potential to reduce foodborne pathogens and disease

    Science.gov (United States)

    Animals can be seriously impacted by bacterial pathogens that affect their growth efficiency and overall health, as well as food safety of animal-derived products. Some pathogenic bacteria, such as Salmonella, can be a shared problem for both human and animal health and can be found in many animal ...

  2. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  3. Efficacy of Combined Sous Vide-Microwave Cooking for Foodborne Pathogen Inactivation in Ready-to-Eat Chicory Stems.

    Science.gov (United States)

    Renna, Massimiliano; Gonnella, Maria; de Candia, Silvia; Serio, Francesco; Baruzzi, Federico

    2017-07-01

    There is a variety of different food processing methods, which can be used to prepare ready-to-eat foods. However, the need to preserve the freshness and nutritional qualities leads to the application of mild technologies which may be insufficient to inactivate microbial pathogens. In this work, fresh chicory stems were packed under a vacuum in films, which were transparent to microwaves. These were then exposed to microwaves for different periods of time. The application of sous vide microwave cooking (SV-MW, 900 W, 2450 MHz), controlled naturally occurring mesophilic aerobic bacteria, yeasts and molds for up to 30 d when vacuum-packed vegetables were stored at 4 °C. In addition, the process lethality of the SV-MW 90 s cooking was experimentally validated. This treatment led to 6.07 ± 0.7 and 4.92 ± 0.65 log cfu/g reduction of Escherichia coli and Listeria monocytogenes inoculated over the chicory stems (100 g), respectively. With an initial load of 9 log cfu/g for both pathogens, less than 10 cfu/g of surviving cells were found after 90 s cooking. This shows that short-time microwave cooking can be used to effectively pasteurize vacuum-packed chicory stems, achieving >5 log cfu/g reduction of E. coli and L. monocytogenes. © 2017 Institute of Food Technologists®.

  4. Occurrence and characterization of food-borne pathogens isolated from fruit, vegetables and sprouts retailed in the Czech Republic.

    Science.gov (United States)

    Vojkovská, Hana; Myšková, Petra; Gelbíčová, Tereza; Skočková, Alena; Koláčková, Ivana; Karpíšková, Renáta

    2017-05-01

    Food of non-animal origin is a major component of the human diet and has been considered to pose a low risk from the point of view of bacteriological safety. However, an increase in the number of outbreaks of illness caused by such pathogens and linked to the consumption of fresh fruit and vegetables have been reported from around the world recently. Salmonella spp., STEC (Shiga toxin producing Escherichia coli) and Listeria monocytogenes are among the most frequently identified agents. Additionally, the transmission of antibiotic resistant strains including also the methicillin resistant S. aureus (MRSA) to humans via the food chain is one of the greatest public health problems being confronted today. Therefore, we focused on the bacterial safety of fruit, vegetables and sprouts on sale in the Czech Republic. One strain (0.3%) of Salmonella Enteritidis phage type PT8, one strain (0.3%) of MRSA and 17 strains (5.0%) of L. monocytogenes were isolated from a total of 339 collected samples. The most problematic commodities were frozen fruit and vegetables (packed and unpacked) and fresh-cut vegetables. Our findings indicate deficiencies in hygiene practices during harvesting, processing and distribution of these commodities. Although sprouts and berries are the most likely to be contaminated by human pathogens, only two samples were positive for the presence of L. monocytogenes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. HrcA and DnaK are important for static and continuous flow biofilm formation and disinfectant resistance in Listeria monocytogenes

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2010-01-01

    The food-borne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Since biofilms are generally difficult to eradicate during clean-up procedures, they pose a major risk for the food industry. Stress resistance mechanisms involved in L. monocytogenes biofilm

  6. Antibacterial characteristics of anthocyanins extracted from wild blueberries against foodborne pathogens

    Science.gov (United States)

    Wild blueberries have rich bioactive compounds, such as polyphenols, phenolics and organic acids. Previous studies demonstrated the antibacterial activity of blueberries against the growth of pathogenic bacteria. The objective of this study was to evaluate the antibacterial characteristics and mech...

  7. SERS based point-of-care detection of food-borne pathogens

    International Nuclear Information System (INIS)

    Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh

    2016-01-01

    The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)

  8. Assay of enterocin AS-48 for inhibition of foodborne pathogens in desserts.

    Science.gov (United States)

    Martinez Viedma, Pilar; Abriouel, Hikmate; Ben Omar, Nabil; Lucas López, Rosario; Valdivia, Eva; Gálvez, Antonio

    2009-08-01

    Enterocin AS-48 was tested against Staphylococcus aureus, Bacillus cereus, and Listeria monocytogenes in different kinds of desserts. The highest activity against S. aureus was detected in baker cream. However, in yogurt-type soy-based desserts and in gelatin pudding, AS-48 (175 arbitrary units [AU]/g) reduced viable cell counts of S. aureus by only 1.5 to 1.8 log units at most. The efficacy of AS-48 in puddings greatly depended on inoculum size, and viable S. aureus counts decreased below detection levels within 24 h for inocula lower than 4 to 5.5 log CFU/g. For L. monocytogenes, bacteriocin concentrations of 52.5 to 87.5 AU/g reduced viable counts below detection levels and avoided regrowth of survivors. The lowest activity was detected in yogurt-type desserts. For B. cereus, viable cell counts were reduced below detection levels for bacteriocin concentrations of 52.5 AU/g in instant pudding without soy or by 175 AU/g in the soy pudding. In gelatin pudding, AS-48 (175 AU/g) reduced viable cell counts of B. cereus below detection levels after 8 h at 10 degrees C or after 48 h at 22 degrees C. Bacteriocin addition also inhibited gelatin liquefaction caused by the proteolytic activity of B. cereus.

  9. Antimicrobial Activity of Individual and Combined Essential Oils against Foodborne Pathogenic Bacteria.

    Science.gov (United States)

    Reyes-Jurado, Fatima; López-Malo, Aurelio; Palou, Enrique

    2016-02-01

    The antimicrobial activities of essential oils from Mexican oregano (Lippia berlandieri Schauer), mustard (Brassica nigra), and thyme (Thymus vulgaris) were evaluated alone and in binary combinations against Listeria monocytogenes, Staphylococcus aureus, or Salmonella Enteritidis. Chemical compositions of the essential oils were analyzed by gas chromatography-mass spectrometry. The MICs of the evaluated essential oils ranged from 0.05 to 0.50% (vol/vol). Mustard essential oil was the most effective, likely due to the presence of allyl isothiocyanate, identified as its major component. Furthermore, mustard essential oil exhibited synergistic effects when combined with either Mexican oregano or thyme essential oils (fractional inhibitory concentration indices of 0.75); an additive effect was obtained by combining thyme and Mexican oregano essential oils (fractional inhibitory concentration index = 1.00). These results suggest the potential of studied essential oil mixtures to inhibit microbial growth and preserve foods; however, their effect on sensory quality in selected foods compatible with their flavor needs to be assessed.

  10. Effect of peppermint essential oil on growth and survival of some foodborne pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    M Boniadian

    2014-08-01

    Full Text Available This study was conducted to determine the effects of peppermint essential oils on Bacillus cereus, Salmonella typhimurium, Listeria monocytogenes and Yersinia enterocolitica. In the first step, Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC of peppermint essential were determined by the tube dilution method in tryptic soy broth (TSB. Then, the growth behavior of each of the aforementioned bacteria was assessed in presence of peppermint essential oil in concentration of less than MIC. The result of first step showed that Y. enterocolitica is more sensitive to peppermint essential oil than other tested bacteria (MIC = 0.1% & MBC = 0.22%, followed by L. monocytogenes (MIC = 0.12% & MBC = 0.15%, S. typhimurium (MIC = 0.22% & MBC = 0.25% and B. cereus (MIC = 0.3% & MBC = 5%, respectively. The results revealed that, the peppermint essential oils in low concentration inhibited the growth rate of bacteria thus may use as a natural preservative and flavoring in foods.

  11. Genomic Insights and Its Comparative Analysis with Yersinia enterocolitica Reveals the Potential Virulence Determinants and Further Pathogenicity for Foodborne Outbreaks.

    Science.gov (United States)

    Gnanasekaran, Gopalsamy; Na, Eun Jung; Chung, Han Young; Kim, Suyeon; Kim, You-Tae; Kwak, Woori; Kim, Heebal; Ryu, Sangryeol; Choi, Sang Ho; Lee, Ju-Hoon

    2017-02-28

    Yersinia enterocolitica is a well-known foodborne pathogen causing gastrointestinal infections worldwide. The strain Y. enterocolitica FORC_002 was isolated from the gill of flatfish (plaice) and its genome was sequenced. The genomic DNA consists of 4,837,317 bp with a GC content of 47.1%, and is predicted to contain 4,221 open reading frames, 81 tRNA genes, and 26 rRNA genes. Interestingly, genomic analysis revealed pathogenesis and host immune evasion-associated genes encoding guanylate cyclase (Yst), invasin (Ail and Inv), outer membrane protein (Yops), autotransporter adhesin A (YadA), RTX-like toxins, and a type III secretion system. In particular, guanylate cyclase is a heat-stable enterotoxin causing Yersinia -associated diarrhea, and RTX-like toxins are responsible for attachment to integrin on the target cell for cytotoxic action. This genome can be used to identify virulence factors that can be applied for the development of novel biomarkers for the rapid detection of this pathogen in foods.

  12. Quantification of Salmonella Survival and Infection in an In vitro Model of the Human Intestinal Tract as Proxy for Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Lucas M. Wijnands

    2017-06-01

    Full Text Available Different techniques are available for assessing differences in virulence of bacterial foodborne pathogens. The use of animal models or human volunteers is not expedient for various reasons; the use of epidemiological data is often hampered by lack of crucial data. In this paper, we describe a static, sequential gastrointestinal tract (GIT model system in which foodborne pathogens are exposed to simulated gastric and intestinal contents of the human digestive tract, including the interaction of pathogens with the intestinal epithelium. The system can be employed with any foodborne bacterial pathogens. Five strains of Salmonella Heidelberg and one strain of Salmonella Typhimurium were used to assess the robustness of the system. Four S. Heidelberg strains originated from an outbreak, the fifth S. Heidelberg strain and the S. Typhimurium strain originated from routine meat inspections. Data from plate counts, collected for determining the numbers of surviving bacteria in each stage, were used to quantify both the experimental uncertainty and biological variability of pathogen survival throughout the system. For this, a hierarchical Bayesian framework using Markov chain Monte Carlo (MCMC was employed. The model system is able to distinguish serovars/strains for in vitro infectivity when accounting for within strain biological variability and experimental uncertainty.

  13. Antagonistic activity of dairy lactobacilli against gram-foodborne pathogens - doi: 10.4025/actascitechnol.v36i1.18776

    Directory of Open Access Journals (Sweden)

    Marco Geria

    2014-01-01

    Full Text Available Thirty-five strains of lactic acid bacteria were isolated from artisanal raw milk cheese, presumptively identified and tested against one dairy Escherichia coli strain. Six lactobacilli, exhibiting antagonistic activity, were identified at the species level and their action was evaluated against four strains of Gram-foodborne pathogens (Escherichia coli O26, Escherichia coli O157:H7, Salmonella spp. 1023, and Salmonella Typhimurium and the control strain Escherichia coli ATCC 45922. The antagonistic activity was determined by spot method and the inhibition zones were measured by Autodesk AutoCAD 2007. Three strains, all Lactobacillus paracasei, were active against all the pathogens; the other strains, all Lactobacillus plantarum, showed antagonistic activity against some pathogens. This study highlights the intense and different antagonistic activity induced by lactobacilli against various foodborne pathogens thus demonstrating that using selected lactic acid bacteria strains as adjunct cultures could be an effective strategy to prevent the development of foodborne pathogens in artisanal raw milk cheeses, and thus improving their safety.

  14. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy

    2018-01-01

    and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...

  15. Antimicrobial potential for the combination of bovine lactoferrin or its hydrolysate with lactoferrin-resistant probiotics against foodborne pathogens.

    Science.gov (United States)

    Chen, P-W; Jheng, T T; Shyu, C-L; Mao, F C

    2013-03-01

    Previous reports have shown that several probiotic strains can resist the antibacterial activity of bovine lactoferrin (bLf), but the results are inconsistent. Moreover, a portion of orally administered apo-bLf is digested in vivo by pepsin to yield bLf hydrolysate, which produces stronger antibacterial activity than that observed with apo-bLf. However, whether bLf hydrolysate affects the growth of probiotic strains is unclear. Therefore, various probiotic strains in Taiwan were collected and evaluated for activity against apo-bLf and bLf hydrolysate in vitro. Thirteen probiotic strains were evaluated, and the growth of Lactobacillus acidophilus ATCC 4356, Lactobacillus salivarius ATCC 11741, Lactobacillus rhamnosus ATCC 53103, Bifidobacterium longum ATCC 15707, and Bifidobacterium lactis BCRC 17394 were inhibited by both apo-bLf and bLf hydrolysate. The growth of 8 strains were not affected by apo-bLf and bLf hydrolysate, including L. rhamnosus ATCC 7469, Lactobacillus reuteri ATCC 23272, Lactobacillus fermentum ATCC 11739, Lactobacillus coryniformis ATCC 25602, L. acidophilus BCRC 14065, Bifidobacterium infantis ATCC 15697, Bifidobacterium bifidum ATCC 29521, and Pediococcus acidilactici ATCC 8081. However, apo-bLf and its hydrolysate inhibited the growth of foodborne pathogens, including Escherichia coli, Salmonella typhimurium, Staphylococcus aureus, and Enterococcus faecalis. Moreover, the supernatants produced by L. fermentum, B. lactis, and B. longum inhibited the growth of most pathogens. Importantly, a combination of apo-bLf or bLf hydrolysate with the supernatants of cultures of the organisms described above showed synergistic or partially synergistic effects against the growth of most of the selected pathogens. In conclusion, several probiotic strains are resistant to apo-bLf and bLf hydrolysate, warranting clinical studies to evaluate the antimicrobial potential for the combination of apo-bLf or its hydrolysate with specific probiotics. Copyright

  16. Piecewise linear approximations to model the dynamics of adaptation to osmotic stress by food-borne pathogens.

    Science.gov (United States)

    Métris, Aline; George, Susie M; Ropers, Delphine

    2017-01-02

    Addition of salt to food is one of the most ancient and most common methods of food preservation. However, little is known of how bacterial cells adapt to such conditions. We propose to use piecewise linear approximations to model the regulatory adaptation of Escherichiacoli to osmotic stress. We apply the method to eight selected genes representing the functions known to be at play during osmotic adaptation. The network is centred on the general stress response factor, sigma S, and also includes a module representing the catabolic repressor CRP-cAMP. Glutamate, potassium and supercoiling are combined to represent the intracellular regulatory signal during osmotic stress induced by salt. The output is a module where growth is represented by the concentration of stable RNAs and the transcription of the osmotic gene osmY. The time course of gene expression of transport of osmoprotectant represented by the symporter proP and of the osmY is successfully reproduced by the network. The behaviour of the rpoS mutant predicted by the model is in agreement with experimental data. We discuss the application of the model to food-borne pathogens such as Salmonella; although the genes considered have orthologs, it seems that supercoiling is not regulated in the same way. The model is limited to a few selected genes, but the regulatory interactions are numerous and span different time scales. In addition, they seem to be condition specific: the links that are important during the transition from exponential to stationary phase are not all needed during osmotic stress. This model is one of the first steps towards modelling adaptation to stress in food safety and has scope to be extended to other genes and pathways, other stresses relevant to the food industry, and food-borne pathogens. The method offers a good compromise between systems of ordinary differential equations, which would be unmanageable because of the size of the system and for which insufficient data are available

  17. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  18. Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

    OpenAIRE

    Dean Jankuloski; Pavle Sekulovski; Risto Prodanov; Zehra Hajrulai Musliu; Biljana Stojanovska Dimzovska

    2007-01-01

    Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micr...

  19. Occurrence of Foodborne Pathogens in Chickens Sandwiches Distributed in Different Supermarkets of Tehran Province, Iran

    OpenAIRE

    Zohreh Mashak; Hamidreza Sodagari; Behrooz Moraadi; Ashkan Ilkhanipour

    2014-01-01

    Background: Increasing urbanization, immigration and tourism has changed the human lifestyle. This modern lifestyle has demanded safety, quality, and fast availability of ready to eat (RTE) foods like chicken sandwiches. Objectives: For presentation of proper solutions regarding food safety, identification of pathogens in different foods is necessary. Therefore, the present study was carried out to assess the microbiological quality of chicken sandwiches distributed in Tehran provinc...

  20. Short chain and polyunsaturated fatty acids in host gut health and foodborne bacterial pathogen inhibition.

    Science.gov (United States)

    Peng, Mengfei; Biswas, Debabrata

    2017-12-12

    As a major source of microbes and their numerous beneficial effects, the gut microflora/microbiome is intimately linked to human health and disease. The exclusion of enteric pathogens by these commensal microbes partially depends upon the production of bioactive compounds such as short-chain fatty acids (SCFAs) and polyunsaturated fatty acids (PUFAs). These key intestinal microbial byproducts are crucial to the maintenance of a healthy gut microbial community. Moreover, SCFAs and PUFAs play multiple critical roles in host defense and immunity, including anti-cancer, anti-inflammation, and anti-oxidant activities, as well as out-competition of enteric bacterial pathogens. In this review article, we hereby aim to highlight the importance of SCFAs and PUFAs and the microbes involved in production of these beneficial intestinal components, and their biological functions, specifically as to their immunomodulation and interactions with enteric bacterial pathogens. Finally, we also advance potential applications of these fatty acids with regards to food safety and human gut health.

  1. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions.

    Science.gov (United States)

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.

  2. Hypoacylated LPS from Foodborne Pathogen Campylobacter jejuni Induces Moderate TLR4-Mediated Inflammatory Response in Murine Macrophages

    Directory of Open Access Journals (Sweden)

    Kirill V. Korneev

    2018-02-01

    Full Text Available Toll-like receptor 4 (TLR4 initiates immune response against Gram-negative bacteria upon specific recognition of lipid A moiety of lipopolysaccharide (LPS, the major component of their cell wall. Some natural differences between LPS variants in their ability to interact with TLR4 may lead to either insufficient activation that may not prevent bacterial growth, or excessive activation which may lead to septic shock. In this study we evaluated the biological activity of LPS isolated from pathogenic strain of Campylobacter jejuni, the most widespread bacterial cause of foodborne diarrhea in humans. With the help of hydrophobic chromatography and MALDI-TOF mass spectrometry we showed that LPS from a C. jejuni strain O2A consists of both hexaacyl and tetraacyl forms. Since such hypoacylation can result in a reduced immune response in humans, we assessed the activity of LPS from C. jejuni in mouse macrophages by measuring its capacity to activate TLR4-mediated proinflammatory cytokine and chemokine production, as well as NFκB-dependent reporter gene transcription. Our data support the hypothesis that LPS acylation correlates with its bioactivity.

  3. Antibacterial Activity of Fructus forsythia Essential Oil and the Application of EO-Loaded Nanoparticles to Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Na Guo

    2016-10-01

    Full Text Available Fructus forsythia essential oil (FEO with excellent antibacterial activity was rarely reported. The objective of the present study was to investigate the antibacterial activity and the antibacterial mechanism of FEO against two food-borne pathogenic bacteria, Escherichia coli (E. coli and Staphylococcus aureus (S. aureus in vitro. When treated FEO, the zones of inhibition (ZOI of E. coli (20.5 ± 0.25 mm and S. aureus (24.3 ± 0.21 mm were much larger than control (p < 0.05. The minimum inhibitory concentrations (MICs of FEO were 3.13 mg/mL and 1.56 mg/mL for E. coli and S. aureus, respectively. The antibacterial mechanism of FEO against E. coil was due to the changes in permeability and integrity of cell membrane leading to the leakage of nucleic acids and proteins. With the superior antibacterial activity of FEO, the nano-encapsulation method has been applied in FEO. When compared to FEO and blank chitosan nanoparticles, FEO-loaded nanoparticles (chitosan to FEO of 1:1 can effectively inhibit the growth of E. coil above 90% at room temperature. It is necessary to consider that FEO and FEO-loaded nanoparticles will become promising antibacterial additives for food preservative, cosmetic, and pharmaceutical applications.

  4. Screening of commercial and pecan shell-extracted liquid smoke agents as natural antimicrobials against foodborne pathogens.

    Science.gov (United States)

    Van Loo, Ellen J; Babu, D; Crandall, Philip G; Ricke, Steven C

    2012-06-01

    Liquid smoke extracts have traditionally been used as flavoring agents, are known to possess antioxidant properties, and serve as natural alternatives to conventional antimicrobials. The antimicrobial efficacies of commercial liquid smoke samples may vary depending on their source and composition and the methods used to extract and concentrate the smoke. We investigated the MICs of eight commercial liquid smoke samples against Salmonella Enteritidis, Staphylococcus aureus, and Escherichia coli . The commercial liquid smoke samples purchased were supplied by the manufacturer as water-based or concentrated extracts of smoke from different wood sources. The MICs of the commercial smokes to inhibit the growth of foodborne pathogens ranged from 0.5 to 6.0% for E. coli, 0.5 to 8.0% for Salmonella, and 0.38 to 6% for S. aureus. The MIC for each liquid smoke sample was similar in its effect on both E. coli and Salmonella. Solvent-extracted antimicrobials prepared using pecan shells displayed significant differences between their inhibitory concentrations depending on the type of solvent used for extraction. The results indicated that the liquid smoke samples tested in this study could serve as effective natural antimicrobials and that their inhibitory effects depended more on the solvents used for extraction than the wood source.

  5. Synergistic effects of sodium hypochlorite and ultraviolet radiation in reducing the levels of selected foodborne pathogenic bacteria.

    Science.gov (United States)

    Ha, Ji-Hyoung; Ha, Sang-Do

    2011-05-01

    The purpose of this study was to determine whether combined treatment would produce synergistic effects to facilitate the sterilization of food products during production relative to single treatment. To assess this hypothesis, we investigated the bactericidal effects of ultraviolet (UV) irradiation and a commercial chemical disinfectant, sodium hypochlorite (NaClO), on Bacillus cereus F4810/72, Cronobacter sakazakii KCTC 2949, Staphylococcus aureus ATCC 35556, Escherichia coli ATCC 10536, and Salmonella Typhimurium novobiocin/nalidixic acid in vitro. Various concentrations of NaClO (20, 60, 100, and 200 ppm NaClO) were tested along with exposure to UV radiation at various doses (6, 96, 216, 360, and 504 mW s/cm(2)). The combined NaClO/UV treatments resulted in greater reductions in bacterial counts than either treatment alone. The synergy values against B. cereus, C. sakazakii, S. aureus, Salmonella Typhimurium, and E. coli were 0.25-1.17, 0.33-1.97, 0.42-1.72, 0.02-1.44, and 0.01-0.85 log(10) CFU/mL, respectively. The results of this study suggest that a significant synergistic benefit results from combined NaClO/UV processing against food-borne pathogenic bacteria in vitro.

  6. Use of Frequency Distribution Functions to Establish Safe Conditions in Relation to the Foodborne Pathogen Bacillus cereus

    Directory of Open Access Journals (Sweden)

    Begoña Delgado

    2005-01-01

    Full Text Available Minimal processing implementation greatly depends on a detailed knowledge of the effects of preservation factors and their combinations on the spoilage and foodborne pathogenic microorganisms. The effectiveness of mild preservation conditions will become increasingly dependent on a more stochastic approach linking microbial physiological factors with product preservation factors. In this study, the validity of frequency distributions to efficiently describe the inactivation and growth of Bacillus cereus in the presence of natural antimicrobials (essential oils has been studied. For this purpose, vegetative cells were exposed to 0.6 mM of thymol or cymene, obtaining survival curves that were best described by the distribution of Weibull, since a tailing effect was observed. B. cereus was also exposed in a growth medium to a low concentration (0.1 mM of both antimicrobials, separately or combined, and the lag times obtained were fitted to a normal distribution, which allowed a description of dispersion of the start of growth. This allowed a more efficient evaluation of the experimental data to establish safe processing conditions according to accurate parameters and their implementation in risk assessment.

  7. Hypoacylated LPS from Foodborne Pathogen Campylobacter jejuni Induces Moderate TLR4-Mediated Inflammatory Response in Murine Macrophages.

    Science.gov (United States)

    Korneev, Kirill V; Kondakova, Anna N; Sviriaeva, Ekaterina N; Mitkin, Nikita A; Palmigiano, Angelo; Kruglov, Andrey A; Telegin, Georgy B; Drutskaya, Marina S; Sturiale, Luisa; Garozzo, Domenico; Nedospasov, Sergei A; Knirel, Yuriy A; Kuprash, Dmitry V

    2018-01-01

    Toll-like receptor 4 (TLR4) initiates immune response against Gram-negative bacteria upon specific recognition of lipid A moiety of lipopolysaccharide (LPS), the major component of their cell wall. Some natural differences between LPS variants in their ability to interact with TLR4 may lead to either insufficient activation that may not prevent bacterial growth, or excessive activation which may lead to septic shock. In this study we evaluated the biological activity of LPS isolated from pathogenic strain of Campylobacter jejuni , the most widespread bacterial cause of foodborne diarrhea in humans. With the help of hydrophobic chromatography and MALDI-TOF mass spectrometry we showed that LPS from a C. jejuni strain O2A consists of both hexaacyl and tetraacyl forms. Since such hypoacylation can result in a reduced immune response in humans, we assessed the activity of LPS from C. jejuni in mouse macrophages by measuring its capacity to activate TLR4-mediated proinflammatory cytokine and chemokine production, as well as NFκB-dependent reporter gene transcription. Our data support the hypothesis that LPS acylation correlates with its bioactivity.

  8. How Novel Methods Can Help Discover More Information about Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Mansel W Griffiths

    2000-01-01

    Full Text Available Considerable emphasis is being placed on quantitative risk assessment modelling as a basis for regulation of trade in food products. However, for models to be accurate, information about the behaviour of potential pathogens in foods needs to be available. The question is how to obtain this knowledge in a simple and cost effective way. One technique that has great potential is the use of reporter bacteria which have been genetically modified to express a phenotype that can be easily monitored, such as light production in luminescent organisms. Bacteria carrying these (lux genes can easily be detected using simple luminometers or more sophisticated low light imaging equipment.

  9. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Il-Hoon Cho

    2017-09-01

    Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  10. Sampling and Homogenization Strategies Significantly Influence the Detection of Foodborne Pathogens in Meat.

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-01-01

    Efficient preparation of food samples, comprising sampling and homogenization, for microbiological testing is an essential, yet largely neglected, component of foodstuff control. Salmonella enterica spiked chicken breasts were used as a surface contamination model whereas salami and meat paste acted as models of inner-matrix contamination. A systematic comparison of different homogenization approaches, namely, stomaching, sonication, and milling by FastPrep-24 or SpeedMill, revealed that for surface contamination a broad range of sample pretreatment steps is applicable and loss of culturability due to the homogenization procedure is marginal. In contrast, for inner-matrix contamination long treatments up to 8 min are required and only FastPrep-24 as a large-volume milling device produced consistently good recovery rates. In addition, sampling of different regions of the spiked sausages showed that pathogens are not necessarily homogenously distributed throughout the entire matrix. Instead, in meat paste the core region contained considerably more pathogens compared to the rim, whereas in the salamis the distribution was more even with an increased concentration within the intermediate region of the sausages. Our results indicate that sampling and homogenization as integral parts of food microbiology and monitoring deserve more attention to further improve food safety.

  11. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

    Science.gov (United States)

    Cho, Il-Hoon; Ku, Seockmo

    2017-09-30

    The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  12. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Zhan Lu

    2017-02-01

    Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  13. Effectiveness of inactivation of foodborne pathogens during simulated home pan frying of steak, hamburger or meat strips.

    Science.gov (United States)

    Lahou, Evy; Wang, Xiang; De Boeck, Elien; Verguldt, Elien; Geeraerd, Annemie; Devlieghere, Frank; Uyttendaele, Mieke

    2015-08-03

    In order to evaluate the effect of simulated home pan frying of raw meat and meat preparations of different animal species on the thermal inactivation of pathogens, the heat resistance (D-value) of three strains of Campylobacter jejuni, Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes and two strains of generic E. coli was validated in BHI and adjusted BHI (i.e. pH5.6 and 1.5% NaCl) at 60°C. The D-values were obtained of the linear phase of the survivor curves created in GInaFiT, a freeware tool to fit models to experimental data. The obtained D-values corresponded to those previously published in literature and confirmed L. monocytogenes to be the most heat resistant pathogen among them. Heat treatment in adjusted BHI significantly increased heat-resistance of E. coli O157:H7 and generic E. coli. Subsequently, the thermal inactivation of L. monocytogenes, Salmonella spp., C. jejuni and E. coli O157:H7 was evaluated using a standardized procedure simulating commonly used home pan frying of various types of meat including steaks or filets, hamburgers and meat strips from various animal species such as pork, beef, chicken, lamb and some turkey, horse, kangaroo and crocodile meat. Corresponding F70-values were calculated based upon measured core time/temperature profiles. It was noted that a core temperature of 70 °C was not always achieved and, moreover, a heat treatment equivalent to 2 min at 70 °C was also not always obtained. This was in particular noted in hamburgers although the meat was visually judged well done. On several occasions, residual survivors of the initial inoculated (4 logCFU/g) food borne pathogens could be recovered either by enumeration (limit of detection 1 logCFU/g) or by the presence/absence testing per 25 g. Pan frying of hamburgers yielded the highest number of surviving pathogenic bacteria (46%), followed by well-done filets and steaks (13%) and meat strips (12%). Taking only steaks (beef, horse, kangaroo, crocodile and

  14. Prevalence of foodborne pathogens in food from selected African countries – a meta-analysis

    DEFF Research Database (Denmark)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph

    2017-01-01

    for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78....../116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella......Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews...

  15. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  17. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    OpenAIRE

    Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

    2016-01-01

    Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

  18. The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis▿ †

    OpenAIRE

    Bitar, Alan Pavinski; Cao, Min; Marquis, Hélène

    2007-01-01

    The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl ma...

  19. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    OpenAIRE

    Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

    2015-01-01

    Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

  20. Application of MALDI-TOF MS fingerprinting as a quick tool for identification and clustering of foodborne pathogens isolated from food products.

    Science.gov (United States)

    Elbehiry, Ayman; Marzouk, Eman; Hamada, Mohamed; Al-Dubaib, Musaad; Alyamani, Essam; Moussa, Ihab M; AlRowaidhan, Anhar; Hemeg, Hassan A

    2017-10-01

    Foodborne pathogens can be associated with a wide variety of food products and it is very important to identify them to supply safe food and prevent foodborne infections. Since traditional techniques are timeconsuming and laborious, this study was designed for rapid identification and clustering of foodborne pathogens isolated from various restaurants in Al-Qassim region, Kingdom of Saudi Arabia (KSA) using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Sixty-nine bacterial and thirty-two fungal isolates isolated from 80 food samples were used in this study. Preliminary identification was carried out through culture and BD Phoenix™ methods. A confirmatory identification technique was then performed using MALDI-TOF MS. The BD Phoenix results revealed that 97% (67/69 isolates) of bacteria were correctly identified as 75% Enterobacter cloacae, 95.45% Campylobacter jejuni and 100% for Escherichia coli, Salmonella enterica, Staphylococcus aureus, Acinetobacter baumannii, and Klebsiella pneumoniae. While 94.44% (29/32 isolates) of fungi were correctly identified as 77.77% Alternaria alternate, 88.88% Aspergillus niger and 100% for Aspergillus flavus, Penicillium digitatum, Candida albicans and Debaryomyces hansenii. However, all bacterial and fungal isolates were 100% properly identified by MALDI-TOF MS fingerprinting with a score value ≥2.00. A gel view illustrated that the spectral peaks for the identified isolates fluctuate between 3,000 and 10,000 Da. The results of main spectra library (MSP) dendrogram showed that the bacterial and fungal isolates matched with 19 and 9 reference strains stored in the Bruker taxonomy, respectively. Our results indicated that MALDI-TOF MS is a promising technique for fast and accurate identification of foodborne pathogens.

  1. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  2. Rapid immuno-analytical system physically integrated with lens-free CMOS image sensor for food-borne pathogens.

    Science.gov (United States)

    Jeon, Jin-Woo; Kim, Jee-Hyun; Lee, Jong-Mook; Lee, Won-Ho; Lee, Do-Young; Paek, Se-Hwan

    2014-02-15

    To realize an inexpensive, pocket-sized immunosensor system, a rapid test devise based on cross-flow immuno-chromatography was physically combined with a lens-free CMOS image sensor (CIS), which was then applied to the detection of the food-borne pathogen, Salmonella typhimurium (S. typhimurium). Two CISs, each retaining 1.3 mega pixel array, were mounted on a printed circuit board to fabricate a disposable sensing module, being connectable with a signal detection system. For the bacterial analysis, a cellulose membrane-based immunosensing platform, ELISA-on-a-chip (EOC), was employed, being integrated with the CIS module, and the antigen-antibody reaction sites were aligned with the respective sensor. In such sensor construction, the chemiluminescent signals produced from the EOC are transferred directly into the sensors and are converted to electric signals on the detector. The EOC-CIS integrated sensor was capable of detecting a traceable amount of the bacterium (4.22 × 10(3)CFU/mL), nearly comparable to that adopting a sophisticated detector such as cooled-charge-coupled device, while having greatly reduced dimensions and cost. Upon coupling with immuno-magnetic separation, the sensor showed an additional 67-fold enhancement in the detection limit. Furthermore, a real sample test was carried out for fish muscles inoculated with a sample of 3.3CFU S. typhimurium per 10 g, which was able to be detected earlier than 6h after the onset of pre-enrichment by culture. © 2013 Elsevier B.V. All rights reserved.

  3. Phytochemical profiles and antimicrobial activity of aromatic Malaysian herb extracts against food-borne pathogenic and food spoilage microorganisms.

    Science.gov (United States)

    Aziman, Nurain; Abdullah, Noriham; Noor, Zainon Mohd; Kamarudin, Wan Saidatul Syida Wan; Zulkifli, Khairusy Syakirah

    2014-04-01

    Preliminary phytochemical and flavonoid compounds of aqueous and ethanolic extracts of 6 aromatic Malaysian herbs were screened and quantified using Reverse-Phase High Performance Liquid Chromatography (RP-HPLC). The herbal extracts were tested for their antimicrobial activity against 10 food-borne pathogenic and food spoilage microorganisms using disk diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)/minimum fungicidal concentration (MFC) of herbal extracts were determined. In the phytochemical screening process, both aqueous and ethanolic extracts of P. hydropiper exhibited presence of all 7 tested phytochemical compounds. Among all herbal extracts, the aqueous P. hydropiper and E. elatior extracts demonstrated the highest antibacterial activity against 7 tested Gram-positive and Gram-negative bacteria with diameter ranging from 7.0 to 18.5 mm and 6.5 to 19 mm, respectively. The MIC values for aqueous and ethanolic extracts ranged from 18.75 to 175 mg/mL and 0.391 to 200 mg/mL, respectively while the MBC/MFC values for aqueous and ethanolic extracts ranged from 25 to 200 mg/mL and 3.125 to 50 mg/mL, respectively. Major types of bioactive compounds in aqueous P. hydropiper and E. elatior extracts were identified using RP-HPLC instrument. Flavonoids found in these plants were epi-catechin, quercetin, and kaempferol. The ability of aqueous Persicaria hydropiper (L.) H. Gross and Etlingera elatior (Jack) R.M. Sm. extracts to inhibit the growth of bacteria is an indication of its broad spectrum antimicrobial potential. Hence these herbal extracts may be used as natural preservative to improve the safety and shelf-life of food and pharmaceutical products. © 2014 Institute of Food Technologists®

  4. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  5. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  6. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  7. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  8. The Antibiofilm Effect of Ginkgo biloba Extract Against Salmonella and Listeria Isolates from Poultry.

    Science.gov (United States)

    Wu, Yan; Park, Keun Cheol; Choi, Beom Geun; Park, Jin Hwa; Yoon, Ki Sun

    2016-05-01

    Salmonella spp. and Listeria spp. are common foodborne pathogens in poultry and have caused a large number of outbreaks worldwide. Biofilm formation is common in the food industry and is also a mechanism of antimicrobial resistance. The aim of this work was to investigate the antimicrobial effect and mechanism of Ginkgo biloba extract against the biofilm formation of Salmonella and Listeria isolates from poultry at retail markets. Bacteria detection, isolation, and enumeration were carried out on 27 chicken and 29 ducks at retail markets. The effects of temperature and G. biloba extract against biofilm formation of Salmonella and Listeria isolates were measured using the crystal violet assay and swimming and swarming motilities. The monitoring results of Salmonella and Listeria in 56 poultry carcasses at retail markets in Korea showed that the prevalence of Salmonella spp. in poultry was low (5.4%), but the prevalence of Listeria spp (78.6%) was high. L. innocua was the predominant serotype (80%) in the isolated Listeria species. Temperature, strain, and surface affected the biofilm formation of Salmonella spp. and Listeria spp. L. innocua showed the best biofilm formation ability on a 96-well plate, while Salmonella Enteritidis formed the most biofilm on a glass slide. Biofilm formation abilities of Salmonella spp. and Listeria spp. were increased with the increase of temperature. G. biloba extract at 75 μg/mL significantly inhibited biofilm formation of Salmonella spp. and Listeria spp (p Listeria, but not L. monocytogenes. The findings of this study provided the basis for the application of G. biloba extract as a food additive to promote the quality and safety of poultry products.

  9. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  10. Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Dean Jankuloski

    2007-11-01

    Full Text Available Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micro eco system and are source of dissemination and contamination of food born pathogens in final meat products. During the preparation of this study we have covered a 7 meat processing facilities and we took a total of 39 swabs from surfaces that come in direct or indirect contact with food. Listeria monocytogenes was discovered in 10 (25,64% swabs (locations. Prevalence of other Listeria spp. compared with total number of taken samples was 15 (38,46% Listeria innocua, 3 (7,69% Listeria welshimeri and 1 (2,65% isolate Listeria seeligeri.

  11. Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

    Science.gov (United States)

    Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

    2017-05-15

    E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Characterization of the interaction between the human pathogen Listeria monocytogenes and the model host C. elegans

    DEFF Research Database (Denmark)

    Simonsen, Karina T.; Nielsen, Jesper S.; Hansen, Annie A.

    In nature, C. elegans lives in the soil and feeds on bacteria. This constant contact with soil-borne microbes suggests that nematodes must have evolved protective responses against pathogens which makes the worm an attractive host-pathogen model for exploring their innate immune response....... In addition, C. elegans is a promising model for the identification of novel virulence factors in various pathogens. A large number of human, animal, plant and insect pathogens have been shown to kill the worm, when C. elegans was allowed to feed on pathogens in stead of its normal laboratory diet [1......]. However, the mechanisms that lead to the shortened life span of the worm have been shown to be very different depending on the nature of the pathogen. Examples include Yersinia pestis, which forms a biofilm layer on the cuticle of C. elegans thus inhibiting feeding [2], enteropathogenic Escherichia coli...

  13. Exposure to minimally processed pear and melon during shelf life could modify the pathogenic potential of Listeria monocytogenes.

    Science.gov (United States)

    Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel

    2017-04-01

    Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  15. Arcobacter: an emerging food-borne zoonotic pathogen, its public health concerns and advances in diagnosis and control - a comprehensive review.

    Science.gov (United States)

    Ramees, Thadiyam Puram; Dhama, Kuldeep; Karthik, Kumaragurubaran; Rathore, Ramswaroop Singh; Kumar, Ashok; Saminathan, Mani; Tiwari, Ruchi; Malik, Yashpal Singh; Singh, Raj Kumar

    2017-12-01

    Arcobacter has emerged as an important food-borne zoonotic pathogen, causing sometimes serious infections in humans and animals. Newer species of Arcobacter are being incessantly emerging (presently 25 species have been identified) with novel information on the evolutionary mechanisms and genetic diversity among different Arcobacter species. These have been reported from chickens, domestic animals (cattle, pigs, sheep, horses, dogs), reptiles (lizards, snakes and chelonians), meat (poultry, pork, goat, lamb, beef, rabbit), vegetables and from humans in different countries. Arcobacters are implicated as causative agents of diarrhea, mastitis and abortion in animals, while causing bacteremia, endocarditis, peritonitis, gastroenteritis and diarrhea in humans. Three species including A. butzleri, A. cryaerophilus and A. skirrowii are predominantly associated with clinical conditions. Arcobacters are primarily transmitted through contaminated food and water sources. Identification of Arcobacter by biochemical tests is difficult and isolation remains the gold standard method. Current diagnostic advances have provided various molecular methods for efficient detection and differentiation of the Arcobacters at genus and species level. To overcome the emerging antibiotic resistance problem there is an essential need to explore the potential of novel and alternative therapies. Strengthening of the diagnostic aspects is also suggested as in most cases Arcobacters goes unnoticed and hence the exact epidemiological status remains uncertain. This review updates the current knowledge and many aspects of this important food-borne pathogen, namely etiology, evolution and emergence, genetic diversity, epidemiology, the disease in animals and humans, public health concerns, and advances in its diagnosis, prevention and control.

  16. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  17. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  18. Control of Listeria species food safety at a poultry food production facility.

    Science.gov (United States)

    Fox, Edward M; Wall, Patrick G; Fanning, Séamus

    2015-10-01

    Surveillance and control of food-borne human pathogens, such as Listeria monocytogenes, is a critical aspect of modern food safety programs at food production facilities. This study evaluated contamination patterns of Listeria species at a poultry food production facility, and evaluated the efficacy of procedures to control the contamination and transfer of the bacteria throughout the plant. The presence of Listeria species was studied along the production chain, including raw ingredients, food-contact, non-food-contact surfaces, and finished product. All isolates were sub-typed by pulsed-field gel electrophoresis (PFGE) to identify possible entry points for Listeria species into the production chain, as well as identifying possible transfer routes through the facility. The efficacy of selected in-house sanitizers against a sub-set of the isolates was evaluated. Of the 77 different PFGE-types identified, 10 were found among two or more of the five categories/areas (ingredients, food preparation, cooking and packing, bulk packing, and product), indicating potential transfer routes at the facility. One of the six sanitizers used was identified as unsuitable for control of Listeria species. Combining PFGE data, together with information on isolate location and timeframe, facilitated identification of a persistent Listeria species contamination that had colonized the facility, along with others that were transient. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Effect of inoculum size, bacterial species, type of surfaces and contact time to the transfer of foodborne pathogens from inoculated to non-inoculated beef fillets via food processing surfaces.

    Science.gov (United States)

    Gkana, E; Chorianopoulos, N; Grounta, A; Koutsoumanis, K; Nychas, G-J E

    2017-04-01

    The objective of the present study was to determine the factors affecting the transfer of foodborne pathogens from inoculated beef fillets to non-inoculated ones, through food processing surfaces. Three different levels of inoculation of beef fillets surface were prepared: a high one of approximately 10 7  CFU/cm 2 , a medium one of 10 5  CFU/cm 2 and a low one of 10 3  CFU/cm 2 , using mixed-strains of Listeria monocytogenes, or Salmonella enterica Typhimurium, or Escherichia coli O157:H7. The inoculated fillets were then placed on 3 different types of surfaces (stainless steel-SS, polyethylene-PE and wood-WD), for 1 or 15 min. Subsequently, these fillets were removed from the cutting boards and six sequential non-inoculated fillets were placed on the same surfaces for the same period of time. All non-inoculated fillets were contaminated with a progressive reduction trend of each pathogen's population level from the inoculated fillets to the sixth non-inoculated ones that got in contact with the surfaces, and regardless the initial inoculum, a reduction of approximately 2 log CFU/g between inoculated and 1st non-inoculated fillet was observed. S. Typhimurium was transferred at lower mean population (2.39 log CFU/g) to contaminated fillets than E. coli O157:H7 (2.93 log CFU/g), followed by L. monocytogenes (3.12 log CFU/g; P < 0.05). Wooden surfaces (2.77 log CFU/g) enhanced the transfer of bacteria to subsequent fillets compared to other materials (2.66 log CFU/g for SS and PE; P < 0.05). Cross-contamination between meat and surfaces is a multifactorial process strongly depended on the species, initial contamination level, kind of surface, contact time and the number of subsequent fillet, according to analysis of variance. Thus, quantifying the cross-contamination risk associated with various steps of meat processing and food establishments or households can provide a scientific basis for risk management of such products. Copyright © 2016 Elsevier Ltd

  20. Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

    Directory of Open Access Journals (Sweden)

    Gusman Vera

    2014-01-01

    Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

  1. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-06-01

    Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

  2. Commensal microbes provide first line defense against Listeria monocytogenes infection

    Science.gov (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  3. Detection of Antibiotic Resistant Listeria spp. in Beef Burgers Distributed in Ahvaz City, Iran

    Directory of Open Access Journals (Sweden)

    Maktabi

    2016-03-01

    Full Text Available Background Listeria spp. are able to be survive in many foods during frozen storage. One particular species, Listeria monocytogenes, is one of the most important food-borne pathogens globally. The antimicrobial resistance of pathogenic microorganisms is a worldwide public health concern because of increasing global trade and travel. Objectives The aim of this study was to evaluate the occurrence and antibiotic resistance of Listeria spp. in the Iranian beef burgers distributed in Ahvaz city. Materials and Methods During a five-month period, 150 frozen burgers were purchased from local markets in Ahvaz city, and tested for presence of Listeria spp. The experimental procedure consisted of a one-step enrichment in Listeria enrichment broth, followed by plating on Oxford agar. Suspected colonies were subjected to subsequent biochemical tests and a polymerase chain reaction (PCR assay. The susceptibility of the isolates to various antibiotics was investigated using the Kirby-Bauer disk diffusion method, and the results were analyzed via the chi-square test and Fisher’s exact test using SPSS 16.0 software. Results Out of 150 samples, only two were contaminated with Listeria innocua, and the statistical analysis showed no significant differences in the prevalence of Listeria between companies (P > 0.05. One of the isolates was resistant to tetracycline and the other to co-trimoxazole. Both of the isolates showed an intermediate susceptibility to chloramphenicol; however, they were sensitive to the other tested antibiotics. Conclusions L. innocua is not a pathogen, but the presence of the bacterium could be an indicator of probable contamination with L. monocytogenes. Moreover, there is a potential risk to public health from the consumption of raw or undercooked burgers, which may increase the possibility of the acquisition of resistance to antibiotics.

  4. Genome-wide fitness analyses of the foodborne pathogen Campylobacter jejuni in in vitro and in vivo models

    DEFF Research Database (Denmark)

    de Vries, Stefan P. W.; Gupta, Srishti; Baig, Abiyad

    2017-01-01

    Campylobacter is the most common cause of foodborne bacterial illness worldwide. Faecal contamination of meat, especially chicken, during processing represents a key route of transmission to humans. There is a lack of insight into the mechanisms driving C. jejuni growth and survival within hosts...... to growth. We report novel C. jejuni factors essential throughout its life cycle. Importantly, we identified genes that fulfil important roles across multiple conditions. Our comprehensive screens showed which flagella elements are essential for growth and which are vital to the interaction with host...

  5. A sensitive biosensor using double-layer capillary based immunomagnetic separation and invertase-nanocluster based signal amplification for rapid detection of foodborne pathogen.

    Science.gov (United States)

    Huang, Fengchun; Zhang, Huilin; Wang, Lei; Lai, Weihua; Lin, Jianhan

    2018-02-15

    Combining double-layer capillary based high gradient immunomagnetic separation, invertase-nanocluster based signal amplification and glucose meter based signal detection, a novel biosensor was developed for sensitive and rapid detection of E. coli O157:H7 in this study. The streptavidin modified magnetic nanobeads (MNBs) were conjugated with the biotinylated polyclonal antibodies against E. coli O157:H7 to form the immune MNBs, which were captured by the high gradient magnetic field in the double-layer capillary to specifically separate and efficiently concentrate the target bacteria. Calcium chloride was used with the monoclonal antibodies against E. coli O157:H7 and the invertase to form the immune invertase-nanoclusters (INCs), which were used to react with the target bacteria to form the MNB-bacteria-INC complexes in the capillary. The sucrose was then injected into the capillary and catalyzed by the invertase on the complexes into the glucose, which was detected using the glucose meter to obtain the concentration of the glucose for final determination of the E. coli O157:H7 cells in the sample. A linear relationship between the readout of the glucose meter and the concentration of the E. coli O157:H7 cells (from 10 2 to 10 7 CFU/mL) was found and the lower detection limit of this biosensor was 79 CFU/mL. This biosensor might be extended for the detection of other foodborne pathogens by changing the antibodies and has shown the potential for the detection of foodborne pathogens in a large volume of sample to further increase the sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Foodborne Illness

    OpenAIRE

    He, Zhan; Liu, Xuan; Li, Renjie

    2008-01-01

    Foodborne illnesses are a significant public health challenge in the world. Preventing foodborne disease in meat processing is an essential point to insure food safety and quality. HACCP systems currently are used for food processor to identify food safety hazards and prevent food is contaminated. By the introducing HACCP system into China in 1990s, Chinese government and enterprises have took more attention to control and monitoring the flow of food to insure food quality in processors. Meat...

  7. Evaluation of antibacterial effect of Rosmarinus officinalis L. essential oil on three food-borne pathogens in vegetables by propidium monoazide quantitative PCR

    Directory of Open Access Journals (Sweden)

    M Azizkhani

    2015-08-01

    Full Text Available Essential oils (EOs have long been applied as flavoring agents in foods. Nowadays, due to the antimicrobial properties of EOs, they have been used as natural food preservatives. In this study, initial experiments were performed in order to elucidate the minimum bactericidal concentration of Rosmarinus officinalis L.EO on Escherichia coli O157:H7, Salmonella enterica and Listeria monocytogenes. Thereafter, PMA-qPCR was applied in order to selectively quantify living cells within a bacterial population treated with rosemary EO. Inactivation was obtained at EO concentrations of 1%, 0.45%, 0.9% for L. monocytogenes, E. coli O157:H7 and S. enterica, respectively. L. monocytogenes were totally killed within 45 min while it took 90 min for E. coli O157:H7and S. enterica. It was concluded that rosemary EO has the potential to be used as a natural food additive or bio-preservative since it was able to irreversibly inactivate the three tested pathogens at lower concentrations and short exposition times in comparison with the other EOs. In addition, PMA-qPCR approach proved quantitatively precise and specific to selectively detect live pathogenic bacteria in vegetables following inactivation with rosemary EO.

  8. Correlation between E. coli levels and the presence of foodborne pathogens in surface irrigation water: Establishment of a sampling program.

    Science.gov (United States)

    Truchado, Pilar; Hernandez, Natalia; Gil, Maria I; Ivanek, Renata; Allende, Ana

    2018-01-01

    To establish the association between microbial indicators and the presence of foodborne pathogens in irrigation water, Escherichia coli was enumerated using two quantification methods (plate counts and PMA-qPCR) and presence/absence of pathogenic microorganisms, including five strains from the Shiga toxigenic E. coli (O157:H7, O26, O103, O111 and O145) and Salmonella spp. were evaluated. The results confirmed that surface water can be considered a microbial hazard when used for irrigation. The levels of viable E. coli were very similar to those of cultivable E. coli, except for irrigation water obtained from water reservoirs. Comparison between the E. coli counts in samples positive and negative for the presence of pathogenic bacteria for the evaluated water sources identified E. coli level of 2.35 log cfu/100 mL as a cut-off able to correctly predict positive and negative samples with 93% sensitivity and 66% specificity, respectively. Thus, for the samples with levels of E. coli under 2.35 log cfu/100 mL (e.g., 2.24 log cfu/100 mL) there was a 90% probability that the samples were not contaminated with pathogenic microorganism in locations with similar prevalence. E. coli levels in irrigation water were affected by the ambient temperature confirming that water source and climate conditions should be taken into account by growers when designing a sampling program and the frequency of the monitoring to make a better and more efficient use of their resources. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Antibacterial Properties of Endophytic Bacteria Isolated from a Fern Species Equisetum arvense L. Against Foodborne Pathogenic Bacteria Staphylococcus aureus and Escherichia coli O157:H7.

    Science.gov (United States)

    Das, Gitishree; Patra, Jayanta Kumar; Baek, Kwang-Hyun

    2017-01-01

    Endophytic bacteria (EB) are a rich source of secondary metabolites with medicinal importance. In this study, EB were isolated from the bottle brush herb Equisetum arvense and identified based on 16S rRNA sequencing. Evaluation of its antibacterial potential was conducted using two common foodborne pathogenic bacteria, Staphylococcus aureus ATCC 12600 and Escherichia coli O157:H7 ATCC 43890. Out of 103 identified EB, three species, Streptomyces albolongus, Dermacoccus sp., and Mycobacterium sp., showed significant antibacterial activity against S. aureus with inhibition zones of 45.34 ± 0.15, 43.28 ± 0.19, and 22.98 ± 0.18 mm, respectively, whereas only two species, Streptomyces griseoaurantiacus (EAL196) and Paenibacillus sp. (EAS116), showed moderate antibacterial activity against E. coli O157:H7 with inhibition zones of 9.41 ± 0.29 and 10.44 ± 0.31 mm, respectively. Furthermore, ethyl acetate extract of S. albolongus, Mycobacterium sp., and Dermacoccus sp. showed antibacterial activity against S. aureus, with inhibition zones of 23.43 ± 0.21, 21.18 ± 0.22, and 19.72 ± 0.10 mm, respectively. The methanol extract of Dermacoccus sp. and Paenibacillus sp. showed antibacterial activity against S. aureus and E. coli O157:H7, with inhibition zones of 11.30 ± 0.17 and 10.01 ± 0.21 mm, respectively. Scanning electron microscopy indicated swollen and lysed cell membranes of pathogens treated with ethyl acetate extract. A possible reason might be, likely due to EB metabolites penetrating the bacterial cell membranes and affecting various metabolic functions resulting in lysis. To the best of our knowledge, this is the first study to report that EB from E. arvense can be used as a source of natural antibacterial compounds against foodborne pathogenic bacteria.

  10. Evaluation of a Recirculating Dipper Well Combined with Ozone Sanitizer for Control of Foodborne Pathogens in Food Service Operations.

    Science.gov (United States)

    Almeida, Giselle; Gibson, Kristen E

    2016-09-01

    In the retail food service industry, small countertop sinks, or dipper wells, are utilized to rinse and store serving utensils between uses. These dipper wells are designed to operate under a constant flow of water, which serves both to prevent the accumulation of microorganisms and to aid in the cleanliness of the dipper well itself. Here, a recirculating dipper well ozone sanitation system (DWOSS) was evaluated for the control and inactivation of Escherichia coli , Listeria innocua , PRD1 bacteriophage, and Staphylococcus aureus present on a stainless steel disher. In a low ozone (O 3 ) demand medium, the DWOSS achieved over a 5-log reduction for E. coli , L. innocua , and PRD1 at 30 s when exposed to 0.45 to 0.55 ppm of residual O 3 . A greater than 5-log total CFU reduction was achieved for S. aureus at a 600-s exposure time and 0.50 ppm of residual O 3 . When evaluated in the presence of high O 3 demand medium (10% skim milk), the DWOSS performed significantly better (P food service. To our knowledge, a dipper well with a cleaning-in-place sanitizing system is not currently available for use in the food service industry; and, thus, this is the first study to evaluate the efficacy of a cleaning-in-place dipper well.

  11. In vitro antimicrobial properties of plant essential oils thymus vulgaris, cymbopogon citratus and laurus nobilis against five important foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Alessandra Farias Millezi

    2012-03-01

    Full Text Available Several essential oils of condiment and medicinal plants possess proven antimicrobial activity and are of important interest for the food industry. Therefore, the Minimum Inhibitory Concentrations (MIC of those oils should be determined for various bacteria. MIC varies according to the oil used, the major compounds, and the physiology of the bacterium under study. In the present study, the essential oils of the plants Thymus vulgaris (time, Cymbopogon citratus (lemongrass and Laurus nobilis (bay were chemically quantified, and the MIC was determined on the bacteria Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, Listeria monocytogenes ATCC 19117, Salmonella enterica Enteritidis S64, and Pseudomonas aeruginosa ATCC 27853. The essential oil of C. citratus demonstrated bacterial activity at all concentrations tested and against all of the bacteria tested. The majority of essential oil compounds were geranial and neral. The major constituent of T. vulgaris was 1.8-cineol and of L. nobilis was linalool, which presented lower antibacterial activity, followed by 1.8-cineol. The Gram-negative bacteria demonstrated higher resistance to the use of the essential oils tested in this study. E. coli was the least sensitive and was inhibited only by the oils of C. citratus and L. nobilis.

  12. The food-borne pathogen Campylobacter jejuni depends on the AddAB DNA repair system to defend against bile in the intestinal environment.

    Science.gov (United States)

    Gourley, Christopher R; Negretti, Nicholas M; Konkel, Michael E

    2017-10-31

    Accurate repair of DNA damage is crucial to ensure genome stability and cell survival of all organisms. Bile functions as a defensive barrier against intestinal colonization by pathogenic microbes. Campylobacter jejuni, a leading bacterial cause of foodborne illness, possess strategies to mitigate the toxic components of bile. We recently found that growth of C. jejuni in medium with deoxycholate, a component of bile, caused DNA damage consistent with the exposure to reactive oxygen species. We hypothesized that C. jejuni must repair DNA damage caused by reactive oxygen species to restore chromosomal integrity. Our efforts focused on determining the importance of the putative AddAB DNA repair proteins. A C. jejuni addAB mutant demonstrated enhanced sensitivity to deoxycholate and was impaired in DNA double strand break repair. Complementation of the addAB mutant restored resistance to deoxycholate, as well as function of the DNA double strand break repair system. The importance of these findings translated to the natural host, where the AddAB system was found to be required for efficient C. jejuni colonization of the chicken intestine. This research provides new insight into the molecular mechanism utilized by C. jejuni, and possibly other intestinal pathogens, to survive in the presence of bile.

  13. Viability of probiotic micro-organism Lactobacillus acidophilus in dairy chocolate dessert and its action against foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Luciana Justo Beserra Rosa

    2015-01-01

    Full Text Available ABSTRACT:The ability to produce antimicrobial factors is considered an important feature of probiotic microorganisms. Bacteriocins, hydrogen peroxide, acetic acid and lactic acid are examples of these substances. The present research aimed to develop probiotic dairy desserts (DD with Lactobacillus acidophilusand evaluate the viability of this strain, as well as its action on food pathogens. Treatments with and without interactions between L. acidophilusand pathogenic Gram-negative bacteria (Salmonellasp. andEscherichiacoli O157:H7 and Gram positive (Bacillus cereusand Staphylococcus aureus were produced. The products were stored at a temperature of 8°C and analyzed at the times 24, 48, 72 hours, 7 days and 28 days (at 28 days, only T1 was analyzed because the other products were deteriorated. In an analysis of the potential for development of new products, the dairy dessert with L. acidophiluswas considered a probiotic product. Assessment of the counts of pathogens in dairy desserts with or without L. acidophilusshowed different behaviors of these products in response to pathogens, which could be justified by a possible action of bacteriocins or microbial competition, but there has been no overall reduction or reduction up to a safe level. It is concluded that the probiotic products developed reduced significant food pathogens, but not up to safe levels. Thus, we emphasize the importance of the use of quality tools in the development and monitoring of dairy desserts.

  14. Antibacterial Effects against Various Foodborne Pathogens and Sensory Properties of Yogurt Supplemented with Panax ginseng Marc Extract

    Science.gov (United States)

    Eom, Su Jin; Hwang, Ji Eun; Kim, Kee-Tae; Paik, Hyun-Dong

    2017-01-01

    Panax ginseng marc is produced from fresh ginseng roots during processing and is generally treated as industrial waste. The primary aim of this study was to improve its utilization in the dairy industry as a potential high-value resource. Yogurt was prepared from 11% skim milk powder, 0.1% pectin, 10% sucrose, and ginseng marc ethanol extract (GME, 0.5% and 1.0%) in milk, and was inoculated with a 0.02% yogurt culture (Lactobacillus acidophilus, Bifidobacterium longum, and Streptococcus thermophilus). After fermentation at 40°C for 6-8 h, the physicochemical properties of samples were analyzed by the AOAC, Kjeldahl, and Soxhlet methods. Sensory evaluation was performed based on consumer acceptability scores with a 7-point scale, and antimicrobial effects were measured by the agar plate method. The moisture, crude protein, crude fat, and ash contents of yogurt supplemented with 1% GME were 85.06±0.06%, 4.41±0.01%, 4.30±0.05%, and 0.81±0.03%, respectively, with no significant changes noted from those of yogurt without GME (control), except for an increase in the crude fat content. The sensory scores of color, flavor, texture, overall taste, and overall acceptance of yogurt supplemented with below 1% GME did not differ significantly (pyogurt. In addition, the growths of Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes, Escherichia coli, and Enterobacter sakazakii were inhibited during fermentation and storage. These results suggest that GME could be used in dairy products as a supplement and in the food industry as an antimicrobial material. PMID:29147103

  15. Effectiveness of Washing Procedures in Reducing Salmonella enterica and Listeria monocytogenes on a Raw Leafy Green Vegetable (Eruca vesicaria).

    Science.gov (United States)

    Pezzuto, Alessandra; Belluco, Simone; Losasso, Carmen; Patuzzi, Ilaria; Bordin, Paola; Piovesana, Alessia; Comin, Damiano; Mioni, Renzo; Ricci, Antonia

    2016-01-01

    Vegetables are an important source of nutrients, but they can host a large microbial population, particularly bacteria. Foodborne pathogens can contaminate raw vegetables at any stage of their production process with a potential for human infection. Appropriate washing can mitigate the risk of foodborne illness consequent to vegetable consumption by reducing pathogen levels, but few data are available to assess the efficacy of different practices. In the present work, six different washing methods, in the presence or absence of sanitisers (peracetic acid and percitric acid, sodium bicarbonate, sodium hypochlorite) and vinegar, were tested for their effectiveness in reducing Salmonella and Listeria counts after artificial contamination of raw rocket ( Eruca vesicaria ). Results showed that washing with sodium hypochlorite (200 mg/L) was the only method able to produce a significant 2 Log reduction of Salmonella counts, but only in the case of high initial contamination (7 Log CFU/g), suggesting potential harmful effects for consumers could occur. In the case of Listeria monocytogenes , all the examined washing methods were effective, with 200 mg/L sodium hypochlorite solution and a solution of peracetic and percitric acids displaying the best performances (2 and 1.5 Log reductions, respectively). This highlights the importance of targeting consumers on fit for purpose and safe washing practices to circumvent vegetable contamination by foodborne pathogens.

  16. Effectiveness of washing procedures in reducing Salmonella enterica and Listeria monocytogenes on a raw leafy green vegetable (Eruca vescicaria.

    Directory of Open Access Journals (Sweden)

    Alessandra Pezzuto

    2016-10-01

    Full Text Available Vegetables are an important source of nutrients, but they can host a large microbial population, particularly bacteria. Vegetables are an important source of nutrients, but they can host a large microbial population, particularly bacteria. Foodborne pathogens can contaminate raw vegetables at any stage of their production process with a potential for human infection. Appropriate washing can mitigate the risk of foodborne illness consequent to vegetable consumption by reducing pathogen levels, but few data are available to assess the efficacy of different practices. In the present work, six different washing methods, in the presence or absence of sanitisers (peracetic acid and percitric acid, sodium bicarbonate, sodium hypochlorite and vinegar, were tested for their effectiveness in reducing Salmonella and Listeria counts after artificial contamination of raw rocket (Eruca vescicaria. Results showed that washing with sodium hypochlorite (200 mg/L was the only method able to produce a significant 2 Log reduction of Salmonella counts, but only in the case of high initial contamination (7 Log CFU/g, suggesting potential harmful effects for consumers could occur. In the case of Listeria monocytogenes, all the examined washing methods were effective, with 200 mg/L sodium hypochlorite solution and a solution of peracetic and percitric acids displaying the best performances (2 and 1.5 Log reductions, respectively. This highlights the importance of targeting consumers on fit for purpose and safe washing practices to circumvent vegetable contamination by foodborne pathogens.

  17. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  18. Rapid Identification of the Foodborne Pathogen Trichinella spp. by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry.

    Directory of Open Access Journals (Sweden)

    Anne Mayer-Scholl

    Full Text Available Human trichinellosis occurs through consumption of raw or inadequately processed meat or meat products containing larvae of the parasitic nematodes of the genus Trichinella. Currently, nine species and three genotypes are recognized, of which T. spiralis, T. britovi and T. pseudospiralis have the highest public health relevance. To date, the differentiation of the larvae to the species and genotype level is based primarily on molecular methods, which can be relatively time consuming and labor intensive. Due to its rapidness and ease of use a matrix assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF MS reference spectra database using Trichinella strains of all known species and genotypes was created. A formicacid/acetonitrile protein extraction was carried out after pooling 10 larvae of each Trichinella species and genotype. Each sample was spotted 9 times using α-cyano 4-hydoxy cinnamic acid matrix and a MicroFlex LT mass spectrometer was used to acquire 3 spectra (m/z 2000 to 20000 Da from each spot resulting in 27 spectra/species or genotype. Following the spectra quality assessment, Biotyper software was used to create a main spectra library (MSP representing nine species and three genotypes of Trichinella. The evaluation of the spectra generated by MALDI-TOF MS revealed a classification which was comparable to the results obtained by molecular methods. Also, each Trichinella species utilized in this study was distinct and distinguishable with a high confidence level. Further, different conservation methods such as freezing and conservation in alcohol and the host species origin of the isolated larvae did not have a significant influence on the generated spectra. Therefore, the described MALDI-TOF MS can successfully be implemented for both genus and species level identification and represents a major step forward in the use of this technique in foodborne parasitology.

  19. Antibacterial effect of light emitting diodes of visible wavelengths on selected foodborne pathogens at different illumination temperatures.

    Science.gov (United States)

    Ghate, Vinayak S; Ng, Kheng Siang; Zhou, Weibiao; Yang, Hyunsoo; Khoo, Gek Hoon; Yoon, Won-Byong; Yuk, Hyun-Gyun

    2013-09-16

    The antibacterial effect of light emitting diodes (LEDs) in the visible region (461, 521 and 642 nm) of the electromagnetic spectrum was investigated on Escherichia coli O157:H7, Salmonella typhimurium, Listeria monocytogenes and Staphylococcus aureus. The irradiances of the 461, 521 and 642 nm LEDs were 22.1, 16 and 25.4 mW/cm², respectively. Bacterial cultures suspended in tryptic soy broth were illuminated by 10-watt LEDs at a distance of 4.5 cm for 7.5h at 20, 15 and 10 °C. Regardless of the bacterial strains, bacterial inactivation was observed with the range of 4.6-5.2 logCFU/ml at 10 and 15 °C after illumination with the 461 nm LED, while illumination with the 521 nm LED resulted in only 1.0-2.0 log reductions after 7.5h. On the other hand, no antibacterial effect was observed using the 642 nm LED treatment. The photodynamic inactivation by 461 and 521 nm LEDs was found to be greater at the set temperatures of 10 and 15 °C than at 20 °C. The D-values for the four bacterial strains at 10 and 15 °C after the illumination of 461 nm LED ranged from 1.29 to 1.74 h, indicating that there was no significant difference in the susceptibility of the bacterial strains to the LED illumination between 10 and 15 °C, except for L. monocytogenes. Regardless of the illumination temperature, sublethal injury was observed in all bacterial strains during illumination with the 461 and the 521 nm LED and the percentage of injured cells increased as the treatment time increased. Thus, the results show that the antibacterial effect of the LEDs was highly dependent on the wavelength and the illumination temperature. This study suggests the potential of 461 and 521 nm LEDs in combination with chilling to be used as a novel food preservation technology. © 2013 Elsevier B.V. All rights reserved.

  20. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants use......, such as antibiotic resistance....... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  1. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-01-01

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  2. Antibacterial activity of Rosmarinus officinalis L. and Thymus vulgaris L. essential oils and their combination against food-borne pathogens and spoilage bacteria in ready-to-eat vegetables.

    Science.gov (United States)

    Iseppi, Ramona; Sabia, Carla; de Niederhäusern, Simona; Pellati, Federica; Benvenuti, Stefania; Tardugno, Roberta; Bondi, Moreno; Messi, Patrizia

    2018-06-06

    The antibacterial activity of Rosmarinus officinalis L. and Thymus vulgaris L. essential oils (EOs), and their combination against food-borne and spoilage bacteria (Listeria monocytogenes, Salmonella enteritidis, Yersinia enterocolitica, Escherichia coli and Pseudomonas spp.) was determined. The EOs inhibitory effect was evaluated both in vitro by using the disk diffusion assay and the minimum inhibitory concentration (MIC) determination, and on food by using an artificially contaminated ready-to-eat (RTE) vegetables. The results showed that the lowest MIC values were obtained with R. officinalis and T. vulgaris EOs against E. coli (4 and 8 μL/mL, respectively). The incorporation of the EOs alone or their combination in RTE vegetables reduced the viable counts of all the tested strains. Lastly, in the on food study we simulated the worst hygienic conditions, obtaining results that can be considered a warranty of safety.

  3. Estimated Cost to a Restaurant of a Foodborne Illness Outbreak.

    Science.gov (United States)

    Bartsch, Sarah M; Asti, Lindsey; Nyathi, Sindiso; Spiker, Marie L; Lee, Bruce Y

    Although outbreaks of restaurant-associated foodborne illness occur periodically and make the news, a restaurant may not be aware of the cost of an outbreak. We estimated this cost under varying circumstances. We developed a computational simulation model; scenarios varied outbreak size (5 to 250 people affected), pathogen (n = 15), type of dining establishment (fast food, fast casual, casual dining, and fine dining), lost revenue (ie, meals lost per illness), cost of lawsuits and legal fees, fines, and insurance premium increases. We estimated that the cost of a single foodborne illness outbreak ranged from $3968 to $1.9 million for a fast-food restaurant, $6330 to $2.1 million for a fast-casual restaurant, $8030 to $2.2 million for a casual-dining restaurant, and $8273 to $2.6 million for a fine-dining restaurant, varying from a 5-person outbreak, with no lost revenue, lawsuits, legal fees, or fines, to a 250-person outbreak, with high lost revenue (100 meals lost per illness), and a high amount of lawsuits and legal fees ($1 656 569) and fines ($100 000). This cost amounts to 10% to 5790% of a restaurant's annual marketing costs and 0.3% to 101% of annual profits and revenue. The biggest cost drivers were lawsuits and legal fees, outbreak size, and lost revenue. Pathogen type affected the cost by a maximum of $337 000, the difference between a Bacillus cereus outbreak (least costly) and a listeria outbreak (most costly). The cost of a single foodborne illness outbreak to a restaurant can be substantial and outweigh the typical costs of prevention and control measures. Our study can help decision makers determine investment and motivate research for infection-control measures in restaurant settings.

  4. Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods.

    Science.gov (United States)

    Nemser, Sarah M; Doran, Tara; Grabenstein, Michael; McConnell, Terri; McGrath, Timothy; Pamboukian, Ruiqing; Smith, Angele C; Achen, Maya; Danzeisen, Gregory; Kim, Sun; Liu, Yong; Robeson, Sharon; Rosario, Grisel; McWilliams Wilson, Karen; Reimschuessel, Renate

    2014-09-01

    The Veterinary Laboratory Investigation and Response Network (Vet-LIRN), in collaboration with the Food Emergency Response Network (FERN) and its Microbiology Cooperative Agreement Program (MCAP) laboratories, conducted a study to evaluate the prevalence of selected microbial organisms in various types of pet foods. The goal of this blinded study was to help the Center for Veterinary Medicine prioritize potential future pet food-testing efforts. The study also increased the FERN laboratories' screening capabilities for foodborne pathogens in animal feed matrices, since such pathogens may also be a significant health risk to consumers who come into contact with pet foods. Six U.S. Food and Drug Administration FERN MCAP laboratories analyzed approximately 1056 samples over 2 years. Laboratories tested for Salmonella, Listeria, Escherichia coli O157:H7 enterohemorrhagic E. coli, and Shiga toxin-producing strains of E. coli (STEC). Dry and semimoist dog and cat foods purchased from local stores were tested during Phase 1. Raw dog and cat foods, exotic animal feed, and jerky-type treats purchased through the Internet were tested in Phase 2. Of the 480 dry and semimoist samples, only 2 tested positive: 1 for Salmonella and 1 for Listeria greyii. However, of the 576 samples analyzed during Phase 2, 66 samples were positive for Listeria (32 of those were Listeria monocytogenes) and 15 samples positive for Salmonella. These pathogens were isolated from raw foods and jerky-type treats, not the exotic animal dry feeds. This study showed that raw pet foods may harbor food safety pathogens, such as Listeria monocytogenes and Salmonella. Consumers should handle these products carefully, being mindful of the potential risks to human and animal health.

  5. Effects of bile salt deconjugation by probiotic strains on the survival of antibiotic-resistant foodborne pathogens under simulated gastric conditions.

    Science.gov (United States)

    He, Xinlong; Zou, Yunyun; Cho, Youngjae; Ahn, Juhee

    2012-06-01

    This study was designed to evaluate the effects of bile acid deconjugation by probiotic strains on the antibiotic susceptibility of antibiotic-sensitive and multiple antibiotic-resistant Salmonella Typhimurium and Staphylococcus aureus. Eight probiotic strains, Bifidobacterium longum B6, Lactobacillus acidophilus ADH, Lactobacillus brevis KACC 10553, Lactobacillus casei KACC 12413, Lactobacillus paracasei ATCC 25598, Lactobacillus rhamnosus GG, Leuconostoc mesenteroides KACC 12312, and Pediococcus acidilactici KACC 12307, were used to examine bile acid tolerance. The ability to deconjugate bile acids was evaluated using both thin-layer chromatography and high-performance liquid chromatography. The antibiotic susceptibility testing was carried out to determine the synergistic inhibitory activity of deconjugated bile acids. L. acidophilus, L. brevis, and P. acidilactici showed the most tolerance to the conjugated bile acids. P. acidilactici deconjugated glycocholic acid and glycodeoxycholate from 3.18 and 3.09 mM to the detection limits, respectively. The antibiotic susceptibility of selected foodborne pathogens was increased by increasing the concentration of deconjugated bile acids. The study results are useful for understanding the relationship between bile acid deconjugation by probiotic strains and antibiotic susceptibility in the presence of deconjugated bile acids, and they may be useful for designing new probiotic-antibiotic combination therapy based on bile acid deconjugation.

  6. Complete Genome Sequence of Streptococcus thermophilus KLDS 3.1003, A Strain with High Antimicrobial Potential against Foodborne and Vaginal Pathogens

    Directory of Open Access Journals (Sweden)

    Smith E. Evivie

    2017-07-01

    Full Text Available Lactic acid bacteria play increasingly important roles in the food industry. Streptococcus thermophilus KLDS 3.1003 strain was isolated from traditional yogurt in Inner Mongolia, China. It has shown high antimicrobial activity against selected foodborne and vaginal pathogens. In this study, we investigated and analyzed its complete genome sequence. The S. thermophilus KLDS 3.1003 genome comprise of a 1,899,956 bp chromosome with a G+C content of 38.92%, 1,995 genes, and 6 rRNAs. With the exception of S. thermophilus M17TZA496, S. thermophilus KLDS 3.1003 has more tRNAs (amino acid coding genes compared to some S. thermophilus strains available on the National Centre for Biotechnology Information database. MG-RAST annotation showed that this strain has 317 subsystems with most genes associated with amino acid and carbohydrate metabolism. This strain also has a unique EPS gene cluster containing 23 genes, and may be a mixed dairy starter culture. This information provides more insight into the molecular basis of its potentials for further applications in the dairy and allied industries.

  7. TrpA1 Regulates Defecation of Food-Borne Pathogens under the Control of the Duox Pathway.

    Directory of Open Access Journals (Sweden)

    Eun Jo Du

    2016-01-01

    Full Text Available Pathogen expulsion from the gut is an important defense strategy against infection, but little is known about how interaction between the intestinal microbiome and host immunity modulates defecation. In Drosophila melanogaster, dual oxidase (Duox kills pathogenic microbes by generating the microbicidal reactive oxygen species (ROS, hypochlorous acid (HOCl in response to bacterially excreted uracil. The physiological function of enzymatically generated HOCl in the gut is, however, unknown aside from its anti-microbial activity. Drosophila TRPA1 is an evolutionarily conserved receptor for reactive chemicals like HOCl, but a role for this molecule in mediating responses to gut microbial content has not been described. Here we identify a molecular mechanism through which bacteria-produced uracil facilitates pathogen-clearing defecation. Ingestion of uracil increases defecation frequency, requiring the Duox pathway and TrpA1. The TrpA1(A transcript spliced with exon10b (TrpA1(A10b that is present in a subset of midgut enteroendocrine cells (EECs is critical for uracil-dependent defecation. TRPA1(A10b heterologously expressed in Xenopus oocytes is an excellent HOCl receptor characterized with elevated sensitivity and fast activation kinetics of macroscopic HOCl-evoked currents compared to those of the alternative TRPA1(A10a isoform. Consistent with TrpA1's role in defecation, uracil-excreting Erwinia carotovora showed higher persistence in TrpA1-deficient guts. Taken together, our results propose that the uracil/Duox pathway promotes bacteria expulsion from the gut through the HOCl-sensitive receptor, TRPA1(A10b, thereby minimizing the chances that bacteria adapt to survive host defense systems.

  8. Urban prevalence of Listeria spp. and Listeria monocytogenes in public lavatories and on shoe soles of facility patrons in the European capital city Vienna.

    Science.gov (United States)

    Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M

    2015-05-01

    The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.

  9. Depletion of autophagy-related genes ATG3 and ATG5 in Tenebrio molitor leads to decreased survivability against an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Tindwa, Hamisi; Jo, Yong Hun; Patnaik, Bharat Bhusan; Noh, Mi Young; Kim, Dong Hyun; Kim, Iksoo; Han, Yeon Soo; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung

    2015-01-01

    Macroautophagy (autophagy) is an evolutionarily conserved catabolic process involved in physiological and developmental processes including cell survival, death, and innate immunity. Homologues of most of 36 originally discovered autophagy-related (ATG) genes in yeast have been characterized in higher eukaryotes including insects. In this study, the homologues of ATG3 (TmATG3) and ATG5 (TmATG5) were isolated from the coleopteran beetle, Tenebrio molitor by expressed sequence tag and RNAseq approaches. The cDNA of TmATG3 and TmATG5 comprise open-reading frame sizes of 963 and 792 bp encoding polypeptides of 320 and 263 amino acid residues, respectively. TmATG3 and TmATG5 mRNA are expressed in all developmental stages, and mainly in fat body and hemocytes of larvae. TmATG3 and TmATG5 showed an overall sequence identity of 58-95% to other insect Atg proteins. There exist clear one-to-one orthologs of TmATG3 and TmATG5 in Tribolium and that they clustered together in the gene tree. Depletion of TmATG3 and TmATG5 by RNA interference led to a significant reduction in survival ability of T. molitor larvae against an intracellular pathogen, Listeria monocytogenes. Six days post-Listeria challenge, the survival rate in the dsEGFP-injected (where EGFP is enhanced green fluorescent protein) control larvae was significantly higher (55%) compared to 4 and 3% for TmATG3 and TmATG5 double-stranded RNA injected larvae, respectively. These data suggested that TmATG3 and TmATG5 may play putative role in mediating autophagy-based clearance of Listeria in T. molitor model. © 2014 Wiley Periodicals, Inc.

  10. Prevalence and characterization of Listeria monocytogenes, Salmonella and Shiga toxin-producing Escherichia coli isolated from small Mexican retail markets of queso fresco.

    Science.gov (United States)

    Soto Beltran, Marcela; Gerba, Charles P; Porto Fett, Anna; Luchansky, John B; Chaidez, Cristobal

    2015-01-01

    Queso fresco (QF) is a handmade cheese consumed and produced in Latin America. In Mexico, QF production is associated with a microbiological risk. The aim of the study was to determine the incidence and characterization of Listeria monocytogenes, Salmonella spp., and Shiga toxin-producing Escherichia coli (STEC) in QF from retail markets of the north-western State of Sinaloa, Mexico, and to assess the effect of physicochemical parameters on Listeria presence. A total of 75 QF samples were obtained. L. monocytogenes, E. coli, and coliforms were detected in 9.3, 94, and 100%, respectively. Salmonella was not detected. STEC isolates showed virulence genes. Microbial loads were above the maximum values recommended by the Official Mexican Standards. Physicochemical parameters such as water activity (aw), moisture content, pH, and salinity played a role in Listeria prevalence in QF. Rigorous control in QF made in Culiacan, Mexico is needed to reduce the risk of foodborne pathogens.

  11. Screening food-borne and zoonotic pathogens associated with livestock practices in the Sumapaz region, Cundinamarca, Colombia

    DEFF Research Database (Denmark)

    Arenas, Nelson E.; Abril, Diego A.; Valencia, Paola

    2017-01-01

    -borne and zoonotic pathogens associated with local livestock practices. We evaluated 1098 cows from 46 livestock farms in the Sumapaz region that were selected by random. Of the total population of cattle, 962 animals (88%) were tested for bovine TB using a caudal-fold tuberculin test and 546 (50%) for brucellosis...... findings suggest that livestock products could be a source of exposure to Brucella and multidrug-resistant E. coli and S. aureus strains as a result of unhygienic livestock practices in the Sumapaz region. Training in good farming practices is the key to improving safety in food production.......Hazardous practices regarding antibiotics misuse, unsanitary milking procedures, and the commercial sales of raw milk and unpasteurized dairy products are currently being practiced by livestock farmers in the Sumapaz region (Colombia). The purpose of this study was to screen for food...

  12. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  13. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  14. Defensins from the tick Ixodes scapularis are effective against phytopathogenic fungi and the human bacterial pathogen Listeria grayi

    Czech Academy of Sciences Publication Activity Database

    Tonk, Miray; Cabezas-Cruz, A.; Valdés, James J.; Rego, Ryan O. M.; Chrudimská, Tereza; Strnad, Martin; Šíma, Radek; Bell-Sakyi, L.; Franta, Z.; Vilcinskas, A.; Grubhoffer, Libor; Rahnamaeian, M.

    2014-01-01

    Roč. 7, DEC 3 2015 (2014), s. 554 ISSN 1756-3305 R&D Projects: GA ČR(CZ) GAP302/11/1901; GA MŠk(CZ) EE2.3.30.0032; GA ČR GP13-12816P Institutional support: RVO:60077344 Keywords : Antimicrobial peptide * Defensin * Listeria grayi * Fusarium spp * Ixodes scapularis * Tick cell line Subject RIV: EE - Microbiology, Virology Impact factor: 3.430, year: 2014

  15. Using UVC Light-Emitting Diodes at Wavelengths of 266 to 279 Nanometers To Inactivate Foodborne Pathogens and Pasteurize Sliced Cheese

    Science.gov (United States)

    Kim, Soo-Ji; Kim, Do-Kyun

    2015-01-01

    UVC light is a widely used sterilization technology. However, UV lamps have several limitations, including low activity at refrigeration temperatures, a long warm-up time, and risk of mercury exposure. UV-type lamps only emit light at 254 nm, so as an alternative, UV light-emitting diodes (UV-LEDs) which can produce the desired wavelengths have been developed. In this study, we validated the inactivation efficacy of UV-LEDs by wavelength and compared the results to those of conventional UV lamps. Selective media inoculated with Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes were irradiated using UV-LEDs at 266, 270, 275, and 279 nm in the UVC spectrum at 0.1, 0.2, 0.5, and 0.7 mJ/cm2, respectively. The radiation intensity of the UV-LEDs was about 4 μW/cm2, and UV lamps were covered with polypropylene films to adjust the light intensity similar to those of UV-LEDs. In addition, we applied UV-LED to sliced cheese at doses of 1, 2, and 3 mJ/cm2. Our results showed that inactivation rates after UV-LED treatment were significantly different (P UV lamps at a similar intensity. On microbiological media, UV-LED treatments at 266 and 270 nm showed significantly different (P < 0.05) inactivation effects than other wavelength modules. For sliced cheeses, 4- to 5-log reductions occurred after treatment at 3 mJ/cm2 for all three pathogens, with negligible generation of injured cells. PMID:26386061

  16. Using UVC Light-Emitting Diodes at Wavelengths of 266 to 279 Nanometers To Inactivate Foodborne Pathogens and Pasteurize Sliced Cheese.

    Science.gov (United States)

    Kim, Soo-Ji; Kim, Do-Kyun; Kang, Dong-Hyun

    2016-01-01

    UVC light is a widely used sterilization technology. However, UV lamps have several limitations, including low activity at refrigeration temperatures, a long warm-up time, and risk of mercury exposure. UV-type lamps only emit light at 254 nm, so as an alternative, UV light-emitting diodes (UV-LEDs) which can produce the desired wavelengths have been developed. In this study, we validated the inactivation efficacy of UV-LEDs by wavelength and compared the results to those of conventional UV lamps. Selective media inoculated with Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes were irradiated using UV-LEDs at 266, 270, 275, and 279 nm in the UVC spectrum at 0.1, 0.2, 0.5, and 0.7 mJ/cm(2), respectively. The radiation intensity of the UV-LEDs was about 4 μW/cm(2), and UV lamps were covered with polypropylene films to adjust the light intensity similar to those of UV-LEDs. In addition, we applied UV-LED to sliced cheese at doses of 1, 2, and 3 mJ/cm(2). Our results showed that inactivation rates after UV-LED treatment were significantly different (P < 0.05) from those of UV lamps at a similar intensity. On microbiological media, UV-LED treatments at 266 and 270 nm showed significantly different (P < 0.05) inactivation effects than other wavelength modules. For sliced cheeses, 4- to 5-log reductions occurred after treatment at 3 mJ/cm(2) for all three pathogens, with negligible generation of injured cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Incidence and Trends of Infections with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance - Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2013-2016.

    Science.gov (United States)

    Marder, Ellyn P; Cieslak, Paul R; Cronquist, Alicia B; Dunn, John; Lathrop, Sarah; Rabatsky-Ehr, Therese; Ryan, Patricia; Smith, Kirk; Tobin-D'Angelo, Melissa; Vugia, Duc J; Zansky, Shelley; Holt, Kristin G; Wolpert, Beverly J; Lynch, Michael; Tauxe, Robert; Geissler, Aimee L

    2017-04-21

    Foodborne diseases represent a substantial public health concern in the United States. CDC's Foodborne Diseases Active Surveillance Network (FoodNet) monitors cases reported from 10 U.S. sites* of laboratory-diagnosed infections caused by nine enteric pathogens commonly transmitted through food. This report describes preliminary surveillance data for 2016 on the nine pathogens and changes in incidences compared with 2013-2015. In 2016, FoodNet identified 24,029 infections, 5,512 hospitalizations, and 98 deaths caused by these pathogens. The use of culture-independent diagnostic tests (CIDTs) by clinical laboratories to detect enteric pathogens has been steadily increasing since FoodNet began surveying clinical laboratories in 2010 (1). CIDTs complicate the interpretation of FoodNet surveillance data because pathogen detection could be affected by changes in health care provider behaviors or laboratory testing practices (2). Health care providers might be more likely to order CIDTs because these tests are quicker and easier to use than traditional culture methods, a circumstance that could increase pathogen detection (3). Similarly, pathogen detection could also be increasing as clinical laboratories adopt DNA-based syndromic panels, which include pathogens not often included in routine stool culture (4,5). In addition, CIDTs do not yield isolates, which public health officials rely on to distinguish pathogen subtypes, determine antimicrobial resistance, monitor trends, and detect outbreaks. To obtain isolates for infections identified by CIDTs, laboratories must perform reflex culture † ; if clinical laboratories do not, the burden of culturing falls to state public health laboratories, which might not be able to absorb that burden as the adoption of these tests increases (2). Strategies are needed to preserve access to bacterial isolates for further characterization and to determine the effect of changing trends in testing practices on surveillance.

  18. Antibacterial activity of novel peptide derived from Cry1Ab16 toxin and development of LbL films for foodborne pathogens control

    International Nuclear Information System (INIS)

    Plácido, Alexandra; Bragança, Idalina; Marani, Mariela; Rodrigues de Araujo, Alyne; Vasconcelos, Andreanne Gomes; Batziou, Krystallenia; Domingues, Valentina F.

    2017-01-01

    Escherichia coli is one of the most common etiological agents of diarrhea in developing countries. The appearance of resistant E. coli prevents treatment of these infections. Biotechnological products incorporating antimicrobial peptides are currently being considered in applications to prevent intestinal infections by these bacteria. The aim of this study was to evaluate the antibacterial activity of the peptide PcL342-354C, which is derived from the toxin Cry1Ab16 from Bacillus thuringiensis, against E. coli strains. We also report the preparation, characterization and evaluation of the antibacterial activity of LbL films containing PcL342-354C. The results showed that the PcL342-354C peptide inhibited the growth of different strains of E. coli with minimal inhibitory concentration ranging from 15.62–31.25 μg/mL and minimal bactericidal concentration was 250 μg/mL, indicating a potential antibacterial activity. The morphology of an ITO/Cashew gum/PcL342-354C film was analysed using atomic force microscopy which showed an increase of roughness due to the increase in the number of layers. The LbL films showed significant antibacterial activity against E. coli NCTC 9001 in both conditions tested (10 and 20 bilayers). Our results indicate that the peptide exhibits an antibacterial potential that can be tapped to develop biomaterials with antibacterial activity for use against foodborne pathogens. - Highlights: • The PcL342–354C peptide inhibited the growth of E. coli. • The peptide can be simply incorporated into edible films combined with cashew gum. • LbL films incorporating the peptide have antibacterial activity against E. coli. • The PcL342–354C exhibits an antibacterial potential that can be tapped to develop biomaterials.

  19. Antibacterial activity of novel peptide derived from Cry1Ab16 toxin and development of LbL films for foodborne pathogens control

    Energy Technology Data Exchange (ETDEWEB)

    Plácido, Alexandra, E-mail: alexandra.placido@gmail.com [REQUIMTE/LAQV, Instituto Superior de Engenharia do Porto, ISEP, Instituto Politécnico do Porto, Porto (Portugal); Bragança, Idalina, E-mail: linab_20@hotmail.com [REQUIMTE/LAQV, Instituto Superior de Engenharia do Porto, ISEP, Instituto Politécnico do Porto, Porto (Portugal); Marani, Mariela, E-mail: mmarani@cenpat-conicet.gob.ar [IPEEC-CONICET, Consejo Nacional de Investigaciones Científicas y Técnicas, Puerto Madryn, Chubut (Argentina); Rodrigues de Araujo, Alyne, E-mail: alyne_biomed@hotmail.com [Núcleo de Pesquisa em Biodiversidade e Biotecnologia, BIOTEC, Campus Ministro Reis Velloso, CMRV, Universidade Federal do Piauí, UFPI, Parnaíba, PI (Brazil); Vasconcelos, Andreanne Gomes, E-mail: andreannegv@gmail.com [Núcleo de Pesquisa em Biodiversidade e Biotecnologia, BIOTEC, Campus Ministro Reis Velloso, CMRV, Universidade Federal do Piauí, UFPI, Parnaíba, PI (Brazil); Batziou, Krystallenia, E-mail: batkrysta@gmail.com [REQUIMTE/UCIBIO, Departamento de Química e Bioquímica, Faculdade de Ciências da Universidade do Porto, Porto (Portugal); Domingues, Valentina F., E-mail: vfd@isep.ipp.pt [REQUIMTE/LAQV, Instituto Superior de Engenharia do Porto, ISEP, Instituto Politécnico do Porto, Porto (Portugal); and others

    2017-06-01

    Escherichia coli is one of the most common etiological agents of diarrhea in developing countries. The appearance of resistant E. coli prevents treatment of these infections. Biotechnological products incorporating antimicrobial peptides are currently being considered in applications to prevent intestinal infections by these bacteria. The aim of this study was to evaluate the antibacterial activity of the peptide PcL342-354C, which is derived from the toxin Cry1Ab16 from Bacillus thuringiensis, against E. coli strains. We also report the preparation, characterization and evaluation of the antibacterial activity of LbL films containing PcL342-354C. The results showed that the PcL342-354C peptide inhibited the growth of different strains of E. coli with minimal inhibitory concentration ranging from 15.62–31.25 μg/mL and minimal bactericidal concentration was 250 μg/mL, indicating a potential antibacterial activity. The morphology of an ITO/Cashew gum/PcL342-354C film was analysed using atomic force microscopy which showed an increase of roughness due to the increase in the number of layers. The LbL films showed significant antibacterial activity against E. coli NCTC 9001 in both conditions tested (10 and 20 bilayers). Our results indicate that the peptide exhibits an antibacterial potential that can be tapped to develop biomaterials with antibacterial activity for use against foodborne pathogens. - Highlights: • The PcL342–354C peptide inhibited the growth of E. coli. • The peptide can be simply incorporated into edible films combined with cashew gum. • LbL films incorporating the peptide have antibacterial activity against E. coli. • The PcL342–354C exhibits an antibacterial potential that can be tapped to develop biomaterials.

  20. The pathogenic potential of different pulsed-field gel electrophoresis types of Listeria monocytogenes strains isolated from food in Northeast Bosnia and Herzegovina.

    Science.gov (United States)

    Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo

    2011-09-01

    Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.

  1. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Current Knowledge on Listeria monocytogenes Biofilms in Food-Related Environments: Incidence, Resistance to Biocides, Ecology and Biocontrol

    Directory of Open Access Journals (Sweden)

    Pedro Rodríguez-López

    2018-06-01

    Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.

  3. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  4. Inactivation of Listeria monocytogenes in milk by pulsed electric field.

    Science.gov (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

    1998-09-01

    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  5. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  6. Potential applications for Annona squamosa leaf extract in the treatment and prevention of foodborne bacterial disease.

    Science.gov (United States)

    Dholvitayakhun, Achara; Trachoo, Nathanon; Sakee, Uthai; Cushnie, T P Tim

    2013-03-01

    Foodborne disease is a major public health problem. The present study examined Annona squamosa leaves, which are traditionally used to treat diarrhea and other infections, for their potential to be used in modern food safety or medicine. Active constituents were partially purified by ethanol extraction and column chromatography. MICs of the extract were 62.5 to 125 microg/mL against Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus, and 250 microg/mL against Campylobacter jejuni. In time-kill assays, 500 microg/mL of the extract reduced colony forming unit numbers of C. jejuni almost 10 000-fold within 12 hours. Similar decreases were seen against B. cereus, but over a longer time-frame. LC-MS analysis indicated the presence of reticuline and oxophoebine. Assessment of stability by MIC assay showed activity was heat-labile, with loss of activity greatest following high temperature treatments. Activity was relatively stable at refrigeration temperature. These results indicate A. squamosa has broad-spectrum but heat-labile activity against foodborne bacterial pathogens, and bactericidal activity against B. cereus and C. jejuni. This bactericidal activity is not sufficiently rapid for A. squamosa to be used as a food sanitizer, but the extract could potentially be developed as an additive for refrigerated foods, or a modern treatment for foodborne illness.

  7. Molecular diagnostics of foodborne pathogens

    DEFF Research Database (Denmark)

    Hansen, Trine

    be connected to specific genes. Deletion of either of the operons prgor flhDCin S. Typhimurium resulted in lower attachment ability to the pork meat surface. In addition, was it found that a S. Rissen isolate with low attachment ability after immobilized growth lacked two fimbriae genes, safC and lpf...... to be more complicated and for the method to be used for this type of samples, additional optimizations have to be conducted. In conclusion, the work present in this thesis contributes to the better understanding of the behavior of Salmonellain the pork processing and which factors that might influence...... behavior in pork processing environments, and detection of B. cereusin food, feed and water samples without prior cultivation. The persistence of Salmonellain food production chains has been suggested to be a result of bacterial attachment and surface colonization. It was found that the physiological state...

  8. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Microbiological Methods (NordVal) in comparative and collaborative trials, and was approved for detection of Campylobacter in chicken neck skin, cloacal swab and boot swab samples. A comparison study on probe chemistries for real-time PCR was performed on locked nucleic acid (LNA), minor groove binder (MGB...... of the optimization strategy were observed from increasing 1) the sampling volume from the pre-enrichment, 2) the paramagnetic particles applied in the DNA extraction procedure, and 3) the amount of DNA template in the PCR. This method was subsequently validated according to the recommendations of NordVal...

  9. The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2012-10-01

    Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

  10. [Antibacterial actin of vinegar against food-borne pathogenic bacteria including Escherichia coli O157:H7 (Part 2). Effect of sodium chloride and temperature on bactericidal activity].

    Science.gov (United States)

    Entani, E; Asai, M; Tsujihata, S; Tsukamoto, Y; Ohta, M

    1997-05-01

    Bactericidal effects of various kinds of AWASEZU (processed vinegar, 2.5% acidity) on food-borne pathogenic bacteria including Escherichia coli O157:H7 and other bacteria were examined. the order of bactericidal activities was NIHAIZU (3.5% NaCl was added) > SANBA-IZU (3.5% NaCl and 10% sucrose were added) > plain vinegar (spirit vinegar) > AMAZU (10% sucrose was added). This indicates that their activities were enhanced by the addition of sodium chloride and suppressed by the addition of sugar. On the other hand, when soy sauce was used instead of sodium chloride, the order of bactericidal activities was plain vinegar > AMAZU > NIHAIZU > SANBAIZU. This is mainly because their activities were suppressed by the increase in the pH value. The effect of sodium chloride (0.01-15%) and temperature (10-50 degrees C) on bactericidal activities against E. coli O157:H7 in spirit vinegar (0.5-2.5% acidity) was further examined. When vinegar was used in combination with sodium chloride, predominant synergism on the bactericidal activity was observed. Their activities were markedly enhanced by the addition of sodium chloride in proportion to the concentration. In addition to this, at higher temperatures spirit vinegar killed bacteria much more rapidly. It should be noted that the bactericidal activity of spirit vinegar was extremely enhanced by the combined use of the addition of sodium chloride and the rise of temperature. For example, in 2.5% acidity vinegar, the time required for 3 log decrease in viable cell numbers at 20 degrees C was shortened to 1/140-fold by the addition of 5% sodium chloride, shortened to 1/51-fold by the rise of the reaction temperature at 40 degrees C, and shortened to 1/830-fold; 0.89 minutes by both the addition of 5% sodium chloride and the rise of temperature at 40 degrees C. In order to propose the methods to prevent food poisoning by bacterial infection, bactericidal activities of vinegar solution containing sodium chloride on cooking tools and

  11. An Evaluation of Alternatives to Nitrites and Sulfites to Inhibit the Growth of Salmonella enterica and Listeria monocytogenes in Meat Products.

    Science.gov (United States)

    Lamas, Alexandre; Miranda, José Manuel; Vázquez, Beatriz; Cepeda, Alberto; Franco, Carlos Manuel

    2016-10-31

    In recent years, the use of nitrites and sulfites as food preservatives has been a cause for concern due to the health problems that these additives can cause in humans. Natural products have been studied as an alternative, but most of them have hardly been applied in the food industry for technological and economic reasons. In this sense, organic salts such as sodium acetate are a good alternative due to their affordability. Thus, this study evaluated the capacity of sodium nitrite, sodium sulfite, a sodium acetate product (TQI C-6000), and chitosan to inhibit two important foodborne pathogens, Salmonella enterica and Listeria monocytogenes . The MIC of each chemical was in vitro evaluated and their antibacterial action was subsequently checked in situ using minced meat as a food model. MIC values of sodium nitrite (10,000 mg/L) and sodium sulfite (50,000 mg/L) for Salmonella enterica were higher than the values allowed by legislation (450 mg/L for sulfites and 150 mg/L for nitrites). Additionally, the sodium acetate product caused the inhibition of Salmonella enterica and Listeria at a relative low quantity. The two foodborne pathogens were inhibited in the food model with 1% of the sodium acetate product. Additionally, there were no significant differences between sodium nitrite, sodium sulfite, and sodium acetate products in the inhibition of Salmonella enterica and Listeria monocytogenes in the food model. Thus, products based on sodium acetate can be an alternative to traditional preservatives in food products.

  12. An Evaluation of Alternatives to Nitrites and Sulfites to Inhibit the Growth of Salmonella enterica and Listeria monocytogenes in Meat Products

    Directory of Open Access Journals (Sweden)

    Alexandre Lamas

    2016-10-01

    Full Text Available In recent years, the use of nitrites and sulfites as food preservatives has been a cause for concern due to the health problems that these additives can cause in humans. Natural products have been studied as an alternative, but most of them have hardly been applied in the food industry for technological and economic reasons. In this sense, organic salts such as sodium acetate are a good alternative due to their affordability. Thus, this study evaluated the capacity of sodium nitrite, sodium sulfite, a sodium acetate product (TQI C-6000, and chitosan to inhibit two important foodborne pathogens, Salmonella enterica and Listeria monocytogenes. The MIC of each chemical was in vitro evaluated and their antibacterial action was subsequently checked in situ using minced meat as a food model. MIC values of sodium nitrite (10,000 mg/L and sodium sulfite (50,000 mg/L for Salmonella enterica were higher than the values allowed by legislation (450 mg/L for sulfites and 150 mg/L for nitrites. Additionally, the sodium acetate product caused the inhibition of Salmonella enterica and Listeria at a relative low quantity. The two foodborne pathogens were inhibited in the food model with 1% of the sodium acetate product. Additionally, there were no significant differences between sodium nitrite, sodium sulfite, and sodium acetate products in the inhibition of Salmonella enterica and Listeria monocytogenes in the food model. Thus, products based on sodium acetate can be an alternative to traditional preservatives in food products.

  13. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...

  14. Scoping the Impact of Changes in Population Age-Structure on the Future Burden of Foodborne Disease in The Netherlands, 2020–2060

    Directory of Open Access Journals (Sweden)

    Arie H. Havelaar

    2013-07-01

    Full Text Available A demographic shift towards a larger proportion of elderly in the Dutch population in the coming decades might change foodborne disease incidence and mortality. In the current study we focused on the age-specific changes in the occurrence of foodborne pathogens by combining age-specific demographic forecasts for 10-year periods between 2020 and 2060 with current age-specific infection probabilities for Campylobacter spp., non-typhoidal Salmonella, hepatitis A virus, acquired Toxoplasma gondii and Listeria monocytogenes. Disease incidence rates for the former three pathogens were estimated to change marginally, because increases and decreases in specific age groups cancelled out over all ages. Estimated incidence of reported cases per 100,000 for 2060 mounted to 12 (Salmonella, 51 (Campylobacter, 1.1 (hepatitis A virus and 2.1 (Toxoplasma. For L. monocytogenes, incidence increased by 45% from 0.41 per 100,000 in 2011 to 0.60 per 100,000. Estimated mortality rates increased two-fold for Salmonella and Campylobacter to 0.5 and 0.7 per 100,000, and increased by 25% for Listeria from 0.06 to 0.08. This straightforward scoping effort does not suggest major changes in incidence and mortality for these food borne pathogens based on changes in de population age-structure as independent factor. Other factors, such as changes in health care systems, social clustering and food processing and preparation, could not be included in the estimates.

  15. Listeria (Listeriosis)

    Science.gov (United States)

    ... The Listeria Initiative The Listeria Whole Genome Sequencing Project Publications Language: English (US) Español (Spanish) File Formats Help: How do I view different file formats (PDF, DOC, PPT, MPEG) on this site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file ...

  16. Attachment of 13 Types of Foodborne Bacteria to Jalapeño and Serrano Peppers and Antibacterial Effect of Roselle Calyx Extracts, Sodium Hypochlorite, Colloidal Silver, and Acetic Acid against These Foodborne Bacteria on Peppers.

    Science.gov (United States)

    Rangel-Vargas, Esmeralda; Gómez-Aldapa, Carlos A; Falfan-Cortes, Reyna N; Rodríguez-Marín, María L; Godínez-Oviedo, Angélica; Acevedo-Sandoval, Otilio A; Castro-Rosas, Javier

    2017-03-01

    Chili peppers are a very important crop in Mexico. However, these peppers have been associated with Salmonella infection outbreaks in the United States, and Salmonella and diarrheagenic Escherichia coli pathotypes have been isolated from jalapeño and serrano peppers in Mexico. To decrease microbial contamination of fruits and vegetables, chemical agents are commonly used; however, chemical agents used to eliminate pathogenic bacteria on vegetables have a limited antimicrobial effect. Roselle ( Hibiscus sabdariffa ) calyces have been reported to have an antimicrobial effect on pathogenic bacteria. In the present study, the antibacterial effect of four roselle calyx extracts (water, methanol, acetone, and ethyl acetate), sodium hypochlorite, colloidal silver, and acetic acid against foodborne bacteria was evaluated on contaminated jalapeño and serrano peppers. The 13 types of foodborne bacteria evaluated were Listeria monocytogenes , Shigella flexneri , Salmonella Typhimurium, Salmonella Typhi, Salmonella Montevideo, Staphylococcus aureus , E. coli O157:H7, five E. coli pathotypes (Shiga toxin producing, enteropathogenic, enterotoxigenic, enteroinvasive, and enteroaggregative), and Vibrio cholerae O1. All 13 types attached to both pepper types, with no significant differences in attachment between jalapeño and serrano peppers. Roselle calyx extract treatment resulted in a greater reduction in levels of all foodborne bacteria than did treatment with sodium hypochlorite, colloidal silver, and acetic acid on both pepper types. Roselle calyx extracts may be a useful for disinfection of chili peppers in the field, processing plants, restaurants, and homes.

  17. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  18. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Directory of Open Access Journals (Sweden)

    Li Ma

    Full Text Available Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP gene (gfp provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2 procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations, the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99% of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  19. The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

    2017-11-01

    In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the

  20. Characterization of a plasmid carrying cat, ermB and tetS genes in a foodborne Listeria monocytogenes strain and uptake of the plasmid by cariogenic Streptococcus mutans

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Shi, Lei

    2016-01-01

    A multi-drug resistant (MDR) Listeria monocytogenes isolate (serotype 1/2c) was recovered from a quick-frozen rice flour product collected from Langfang city in northern China. PCR screening identified the presence of cat, ermB and tetS genes. The plasmid profile of the strain showed the presence...... of an approximately 22.4-kb plasmid. Curing of this plasmid resulted in the loss of cat, ermB and tetS genes and increased susceptibility to several antibiotics, suggesting the involvement of the plasmid in multiple antibiotic resistances. Moreover, the plasmid was able to be uptaken by human oral pathogen...

  1. Infection with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance--Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2012-2015.

    Science.gov (United States)

    Huang, Jennifer Y; Henao, Olga L; Griffin, Patricia M; Vugia, Duc J; Cronquist, Alicia B; Hurd, Sharon; Tobin-D'Angelo, Melissa; Ryan, Patricia; Smith, Kirk; Lathrop, Sarah; Zansky, Shelley; Cieslak, Paul R; Dunn, John; Holt, Kristin G; Wolpert, Beverly J; Patrick, Mary E

    2016-04-15

    To evaluate progress toward prevention of enteric and foodborne illnesses in the United States, the Foodborne Diseases Active Surveillance Network (FoodNet) monitors the incidence of laboratory-confirmed infections caused by nine pathogens transmitted commonly through food in 10 U.S. sites. This report summarizes preliminary 2015 data and describes trends since 2012. In 2015, FoodNet reported 20,107 confirmed cases (defined as culture-confirmed bacterial infections and laboratory-confirmed parasitic infections), 4,531 hospitalizations, and 77 deaths. FoodNet also received reports of 3,112 positive culture-independent diagnostic tests (CIDTs) without culture-confirmation, a number that has markedly increased since 2012. Diagnostic testing practices for enteric pathogens are rapidly moving away from culture-based methods. The continued shift from culture-based methods to CIDTs that do not produce the isolates needed to distinguish between strains and subtypes affects the interpretation of public health surveillance data and ability to monitor progress toward prevention efforts. Expanded case definitions and strategies for obtaining bacterial isolates are crucial during this transition period.

  2. Simultaneous Detection of Escherichia coli O157:H7, Salmonella enteritidis, and Listeria monocytogenes at a Very Low Level Using Simultaneous Enrichment Broth and Multichannel SPR Biosensor.

    Science.gov (United States)

    Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa

    2017-10-01

    Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.

  3. Bactericidal and antibiofilm activity of bactenecin-derivative peptides against the food-pathogen Listeria monocytogenes: New perspectives for food processing industry.

    Science.gov (United States)

    Palmieri, Gianna; Balestrieri, Marco; Capuano, Federico; Proroga, Yolande T R; Pomilio, Francesco; Centorame, Patrizia; Riccio, Alessia; Marrone, Raffaele; Anastasio, Aniello

    2018-08-20

    Antimicrobial peptides have received great attention for their potential benefits to extend the shelf-life of food-products. Innate defense regulator peptide-1018 (IDR-1018) represents a promising candidate for such applications, due to its broad-spectrum antimicrobial activity, although food-isolated pathogens have been poorly investigated. Herein, we describe the design and the structural-functional characterization of a new 1018-derivative peptide named 1018-K6, in which the alanine in position 6 was replaced with a lysine. Spectroscopic analysis revealed a noticeable switch from β-sheet to helical conformations of 1018-K6 respect to IDR-1018, with a faster folding kinetic and increased structural stability. Moreover, 1018-K6 evidenced a significant antibiofilm/bactericidal efficiency specifically against Listeria monocytogenes isolates from food-products and food-processing environments, belonging to serotype 4b involved in the majority of human-listeriosis cases, with EC 50 values two- five-fold lower than those measured for IDR-1018. Therefore, a single amino-acid substitution in IDR-1018 sequence produced severe changes in peptide conformation and antimicrobial performances. Published by Elsevier B.V.

  4. Detection of Listeria monocytogenes in ready-to-eat foods sampled from a catering service in Apulia, Italy.

    Science.gov (United States)

    Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa

    2015-01-01

    Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.

  5. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin

    2015-01-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  6. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  7. Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2014-01-31

    Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in

  8. Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

    Science.gov (United States)

    Guenther, Susanne; Loessner, Martin J

    2011-03-01

    Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

  9. Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    nahid Navijouy

    2013-08-01

    Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

  10. Prevalence and Antimicrobial Resistance Profile of Listeria Species Isolated from Farmed and On-Sale Rainbow Trout ( Oncorhynchus mykiss) in Western Iran.

    Science.gov (United States)

    Rezai, Ramin; Ahmadi, Elham; Salimi, Behnam

    2018-05-01

    Listeria species are important foodborne pathogens, among which L. monocytogenes and L. ivanovii cause human listeriosis. The purpose of this study was to evaluate the incidence and antimicrobial resistance profiles of Listeria species in farmed and on-sale rainbow trout ( Oncorhynchus mykiss) in Kurdistan province, western Iran. A total of 240 fresh rainbow trout fish (120 samples from farms and 120 samples from retail outlets) were collected and analyzed phenotypically for the presence of Listeria. All Listeria isolates were differentiated with molecular techniques, and L. monocytogenes strains were identified to serotype. The antibiotic susceptibility of all Listeria isolates also was determined. Among the 240 samples, 86 (35.83%) were contaminated with Listeria: 32 samples of farmed fish and 54 samples of on-sale fish. The prevalence among the 240 samples was 9.16% (22 samples) for L. monocytogenes, 6.66% (16 samples) for L. ivanovii, 3.75% (9 samples) for L. welshimeri, 4.99% (12 samples) for L. grayi, 7.5% (18 samples) for L. innocua, and 3.75% (9 samples) for L. seeligeri. The prevalences of the human pathogenic strains L. monocytogenes and L. ivanovii were 4.16% (5 samples) and 14.16% (17 samples) in farmed fish and 5.83% (7 samples) and 7.5% (9 samples) in on-sale fish, respectively. Of the 22 L. monocytogenes isolates, 15, 3, and 4 were identified as serotypes 4b, 1/2a, and 1/2b, respectively. The highest rates of antibiotic resistance among the 86 Listeria isolates was observed against tetracycline (62.79% of all isolates), enrofloxacin (56.97%), and ciprofloxacin (38.37%). Very high resistance was also detected against penicillin (36.04%) and ampicillin (34.88%). These results highlight the potential public health threat posed by fish contaminated with Listeria species, including L. monocytogenes, in the west of Iran. Regular monitoring of Listeria contamination, upgrading of sanitary conditions in the fish industry, and prudent use of antibiotics is

  11. A Computational Study of Amensalistic Control of Listeria monocytogenes by Lactococcus lactis under Nutrient Rich Conditions in a Chemostat Setting

    Directory of Open Access Journals (Sweden)

    Hassan Khassehkhan

    2016-09-01

    Full Text Available We study a previously introduced mathematical model of amensalistic control of the foodborne pathogen Listeria monocytogenes by the generally regarded as safe lactic acid bacteria Lactococcus lactis in a chemostat setting under nutrient rich growth conditions. The control agent produces lactic acids and thus affects pH in the environment such that it becomes detrimental to the pathogen while it is much more tolerant to these self-inflicted environmental changes itself. The mathematical model consists of five nonlinear ordinary differential equations for both bacterial species, the concentration of lactic acids, the pH and malate. The model is algebraically too involved to allow a comprehensive, rigorous qualitative analysis. Therefore, we conduct a computational study. Our results imply that depending on the growth characteristics of the medium in which the bacteria are cultured, the pathogen can survive in an intermediate flow regime but will be eradicated for slower flow rates and washed out for higher flow rates.

  12. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Science.gov (United States)

    Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.

    2015-01-01

    Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence

  13. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Directory of Open Access Journals (Sweden)

    Deepti N. Nayak

    2015-06-01

    Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest

  14. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  15. Prevalence of Listeria Species in Ready-to-Eat Food in Shahrekord Restaurants

    OpenAIRE

    Rahimi, E; Shakerian, A. (PhD

    2014-01-01

    Background and Objective: Listeria bacteria with worldwide widespread are commonly found in soil, sewage, dust and water. Among which,Listeria monocytogenes can cause a serious food-borne disease. The objective of this study was to investigate the prevalence of Listeria species in ready-to-eat foods. Material and Methods: The samples (n=235) including oloveyh salad (n = 64), Yogurt stew (n= 35), vegetable salad (n=52), macaroni salad (n= 48) and meat salad (n =36) were collected from the rest...

  16. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei

    2012-02-01

    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  17. Genetic diversity of internalin genes in the ascB-dapE locus among Listeria monocytogenes lineages III and IV strains.

    Science.gov (United States)

    Chen, Jianshun; Cheng, Changyong; Lv, Yonghui; Fang, Weihuan

    2013-09-01

    Listeria monocytogenes is an important foodborne pathogen encompassing four phylogenetic lineages. Lineages III and IV are rare, but have been reported to show considerable biodiversity, providing important clues for the evolutionary history in Listeria. In this study, analysis of the ascB-dapE locus reveals genetic diversity in lineages III and IV, and is consistent with the classification of sublineages. Four of the six genetic patterns (two of sublineage IIIC and two of lineage IV) are specific to these two lineages. The ascB-dapE locus suggests a hot spot for genome diversification, and serves as an attractive molecular marker for better understanding of the biodiversity and population structure of lineages III and IV strains. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Fate of Escherichia coli O157:H7, Salmonella and Listeria innocua on minimally-processed peaches under different storage conditions.

    Science.gov (United States)

    Alegre, Isabel; Abadias, Maribel; Anguera, Marina; Usall, Josep; Viñas, Inmaculada

    2010-10-01

    Consumption of fresh-cut produce has sharply increased recently causing an increase of foodborne illnesses associated with these products. As generally, acidic fruits are considered 'safe' from a microbiological point of view, the aim of this work was to study the growth and survival of Escherichia coli O157:H7, Salmonella and Listeria innocua on minimally-processed peaches. The three foodborne pathogens population increased more than 2 log(10)units on fresh-cut peach when stored at 20 and 25 degrees C after 48 h. At 10 degrees C only L. innocua grew more than 1 log(10)unit and it was the only pathogen able to grow at 5 degrees C. Differences in growth occurred between different peach varieties tested, with higher population increases in those varieties with higher pH ('Royal Glory' 4.73+/-0.25 and 'Diana' 4.12+/-0.18). The use of common strategies on extending shelf life of fresh-cut produce, as modified atmosphere packaging and the use of the antioxidant substance, ascorbic acid (2%w/v), did not affect pathogens' growth at any of the temperatures tested (5 and 25 degrees C). Minimally-processed peaches have shown to be a good substrate for foodborne pathogens' growth regardless use of modified atmosphere and ascorbic acid. Therefore, maintaining cold chain and avoiding contamination is highly necessary. 2010 Elsevier Ltd. All rights reserved.

  19. Elongated cells of Listeria monocytogenes in biofilms in the presence of sucrose and bacteriocin-producing Leuconostoc mesenteroides A11

    Directory of Open Access Journals (Sweden)

    Regiane Priscilla Ratti

    2010-12-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.

  20. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  1. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  2. Viable-but-Nonculturable Listeria monocytogenes and Salmonella enterica Serovar Thompson Induced by Chlorine Stress Remain Infectious

    Directory of Open Access Journals (Sweden)

    Callum J. Highmore

    2018-04-01

    Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.

  3. Characterization of an Hfq dependent antisense sRNA in the Gram-positive human pathogen Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Lei Kristensen, Lisbeth; Hanghøj Chrisitansen, Mie

    between sRNA and target mRNA rely on the RNA chaperone Hfq. Hfq is a ubiquitous protein found in almost all genres of bacterial life. However, so far its role as an RNA chaperone has only been described in Gram-negative species such as Escherichia coli and Salmonella (Vogel, J. 2009). We previously...... identified several Hfq-binding sRNAs in the Gram-positive human pathogen L. monocytogenes (Christiansen et al 2006). Through bioinformatics, we have identified a number of candidate targets for one of these sRNAs (LhrA). Here, we present the characterization of one of these targets. Our results suggest...

  4. Selection tool for foodborne norovirus outbreaks.

    Science.gov (United States)

    Verhoef, Linda P B; Kroneman, Annelies; van Duynhoven, Yvonne; Boshuizen, Hendriek; van Pelt, Wilfrid; Koopmans, Marion

    2009-01-01

    Detection of pathogens in the food chain is limited mainly to bacteria, and the globalization of the food industry enables international viral foodborne outbreaks to occur. Outbreaks from 2002 through 2006 recorded in a European norovirus surveillance database were investigated for virologic and epidemiologic indicators of food relatedness. The resulting validated multivariate logistic regression model comparing foodborne (n = 224) and person-to-person (n = 654) outbreaks was used to create a practical web-based tool that can be limited to epidemiologic parameters for nongenotyping countries. Non-genogroup-II.4 outbreaks, higher numbers of cases, and outbreaks in restaurants or households characterized (sensitivity = 0.80, specificity = 0.86) foodborne outbreaks and reduced the percentage of outbreaks requiring source-tracing to 31%. The selection tool enabled prospectively focused follow-up. Use of this tool is likely to improve data quality and strain typing in current surveillance systems, which is necessary for identification of potential international foodborne outbreaks.

  5. Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Rajeswaran Radhakrishnan

    2017-12-01

    Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

  6. Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

    2017-11-01

    Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

  7. Prevalence and relative risk of Cronobacter spp., Salmonella spp., and Listeria monocytogenes associated with the body surfaces and guts of individual filth flies.

    Science.gov (United States)

    Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C

    2012-11-01

    Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.

  8. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards) , 2013 . Scientific Opinion on the evaluation of molecular typing methods for major food-borne microbiological hazards and their use for attribution modelling, outbreak investigation and scanning surveillance: Part 1 (evaluation of methods

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    An evaluation of molecular typing methods that can be applied to the food-borne pathogens Salmonella, Campylobacter, Shiga toxin-producing Escherichia coli and Listeria monocytogenes is presented. This evaluation is divided in two parts. Firstly, commonly used molecular typing methods are assessed...... against a set of predefined criteria relating to discriminatory capacity, reproducibility, repeatability and current or potential suitability for international harmonisation. Secondly, the methods are evaluated for their appropriateness for use in different public health-related applications...... and potential for use of molecular characterisation methods, including whole genome sequencing technologies, in microbial food safety. Recommendations are also made in order to encourage a holistic and structured approach to the use of molecular characterisation methods for food-borne pathogens; in particular...

  9. Listeria and Pregnancy

    Science.gov (United States)

    ... Events Advocacy For Patients About ACOG Listeria and Pregnancy Home For Patients Search FAQs Listeria and Pregnancy ... Pregnancy PFS013, January 2017 PDF Format Listeria and Pregnancy Fact Sheets Food Poisoning in Pregnant Women The ...

  10. Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

    Science.gov (United States)

    NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

    2018-03-01

    Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

  11. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytongenes single cells

    DEFF Research Database (Denmark)

    Nielsen, Dennis Sandris; Cho, Gyu-Sung; Hanak, Alexander

    2010-01-01

    and/or bacteriocin-producing LAB as “natural” food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure......A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins...

  12. Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

    Science.gov (United States)

    Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

  13. Prevalence and phylogenetic characterization of Listeria monocytogenes isolated from processed meat marketed in Egypt

    Directory of Open Access Journals (Sweden)

    Yasmin Mohamed

    2016-06-01

    Full Text Available Because of its high case fatality rate, listeriosis locates among the most frequent causes of death due to food-borne illness. In this study, a total of 150 processed meat samples were collected from Giza Governorate, Egypt. Phenotypic and genotypic identification of Listeria monocytogenes was performed using PCR incorporating listeriolysin O virulence gene hlyA followed by DNA sequence analysis. L. monocytogenes was confirmed in 4% of each of beef burger, minced meat, and luncheon samples. Phylogenetic analysis showed that all the six Egyptian isolates have high homology with Colombian isolate (EF030606, except one Egyptian isolate which showed high homology with Indian isolate (EU840690. The public health significance of these pathogens as well as recommended sanitary measures were discussed.

  14. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  15. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

    Science.gov (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

    2017-07-01

    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  16. Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

    Science.gov (United States)

    Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

    2017-07-04

    Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

  17. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  18. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

    2014-01-01

    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  19. Bacterial food-borne zoonoses.

    Science.gov (United States)

    Thorns, C J

    2000-04-01

    In many countries of the world, bacterial food-borne zoonotic infections are the most common cause of human intestinal disease. Salmonella and Campylobacter account for over 90% of all reported cases of bacteria-related food poisoning world-wide. Poultry and poultry products have been incriminated in the majority of traceable food-borne illnesses caused by these bacteria, although all domestic livestock are reservoirs of infection. In contrast to the enzootic nature of most Salmonella and Campylobacter infections, Salmonella Enteritidis caused a pandemic in both poultry and humans during the latter half of the 20th Century. Salmonella Typhimurium and Campylobacter appear to be more ubiquitous in the environment, colonising a greater variety of hosts and environmental niches. Verocytotoxin-producing Escherichia coli O157 (VTEC O157) also emerged as a major food-borne zoonotic pathogen in the 1980s and 1990s. Although infection is relatively rare in humans, clinical disease is often severe, with a significant mortality rate among the young and elderly. The epidemiology of VTEC O157 is poorly understood, although ruminants, especially cattle and sheep, appear to be the major source of infection. The dissemination of S. Enteritidis along the food chain is fairly well understood, and control programmes have been developed to target key areas of poultry meat and egg production. Recent evidence indicates that these control programmes have been associated with an overall reduction of S. Enteritidis along the food chain. Unfortunately, existing controls do not appear to reduce the levels of Campylobacter and VTEC O157 infections. Future control strategies need to consider variations in the epidemiologies of food-borne zoonotic infections, and apply a quantitative risk analysis approach to ensure that the most cost-effective programmes are developed.

  20. Foodborne Germs and Illnesses

    Science.gov (United States)

    ... Español (Spanish) Recommend on Facebook Tweet Share Compartir What Causes Food Poisoning? Many different disease-causing germs can contaminate ... email address: Enter Email Address What’s this? Submit What's this? Submit Button ... of Foodborne Illness in the U.S. Food Safety is a CDC Winnable Battle Foodborne Illness ...

  1. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Directory of Open Access Journals (Sweden)

    Yunfeng Xu

    2017-09-01

    Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.

  2. Prevalence of Salmonella enterica, Listeria monocytogenes, and pathogenic Escherichia coli in bulk tank milk and milk filters from US dairy operations in the National Animal Health Monitoring System Dairy 2014 study.

    Science.gov (United States)

    Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S

    2018-03-01

    The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Combined Effect of Thermosonication and Slightly Acidic Electrolyzed Water to Reduce Foodborne Pathogens and Spoilage Microorganisms on Fresh-cut Kale.

    Science.gov (United States)

    Mansur, Ahmad Rois; Oh, Deog-Hwan

    2015-06-01

    This study evaluated the efficacy of individual treatments (thermosonication [TS+DW] and slightly acidic electrolyzed water [SAcEW]) and their combination on reducing Escherichia coli O157:H7, Listeria monocytogenes, and spoilage microorganisms (total bacterial counts [TBC], Enterobacteriaceae, Pseudomonas spp., and yeast and mold counts [YMC]) on fresh-cut kale. For comparison, the antimicrobial efficacies of sodium chlorite (SC; 100 mg/L) and sodium hypochlorite (SH; 100 mg/L) were also evaluated. Each 10 g sample of kale leaves was inoculated to contain approximately 6 log CFU/g of E. coli O157:H7 or L. monocytogenes. Each inoculated or uninoculated samples was then dip treated with deionized water (DW; control), TS+DW, and SAcEW at various treatment conditions (temperature, physicochemical properties, and time) to assess the efficacy of each individual treatment. The efficacy of TS+DW or SAcEW was enhanced at 40 °C for 3 min, with an acoustic energy density of 400 W/L for TS+DW and available chlorine concentration of 5 mg/L for SAcEW. At 40 °C for 3 min, combined treatment of thermosonication 400 W/L and SAcEW 5 mg/L (TS+SAcEW) was more effective in reducing microorganisms compared to the individual treatments (SAcEW, SC, SH, and TS+DW) and combined treatments (TS+SC and TS+SH), which significantly (P 3.24 log CFU/g, respectively. The results suggest that the combined treatment of TS+SAcEW has the potential as a decontamination process in fresh-cut industry. © 2015 Institute of Food Technologists®

  4. Modelling a national programme for the control of foodborne pathogens in livestock: the case of Salmonella Dublin in the Danish cattle industry

    DEFF Research Database (Denmark)

    Jordan, D.; Nielsen, L.R.; Warnick, L.D.

    2008-01-01

    A 'virtual hierarchy' model is described for studying the spread of pathogens between herds of livestock. This novel approach to simulating disease has animals. herds, and geographic regions in a national livestock industry arranged as a hierarchy of objects in computer memory. Superimposed on all...

  5. A study on the effects of some laboratory-derived genetic mutations on biofilm formation by Listeria monocytogenes

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, S.; Parvathi, A.; George, J.; Krohne, G.; Karunasagar, Indrani; Karunasagar, Iddya

    , Germany Address for correspondence Sanath Kumar ENMU 2386 1500 S, Ave K Portales, New Mexico 88130 USA e-mail: sanathkm@yahoo.com Running Title: Gene mutations and Listeria biofilm Abstract Biofilms formed by the human pathogen Listeria...

  6. Antibacterial Activity of Clove ( Syzigium aromaticum L .) Essential Oil and Gamma Irradiation against Some Food-Borne Pathogens in Minced Chicken Meat

    International Nuclear Information System (INIS)

    Gibriel, A.Y.; ALI, H.G.M.; Abdeldaiem, M.H.

    2017-01-01

    Antibacterial activity of clove essential oil ( Syzigium aromaticum L.) against five strains of pathogenic bacteria namely, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhimurium, Escherichia coli and Bacillus cereus was investigated in vitro. The essential oil of clove exhibited antibacterial activity against tested microorganisms. Comparatively, 25, 50 and 100 ml/l concentrations of clove essential oil were of less inhibitory effect than 200, 300 and 500 ml/l concentrations. However, S. aureus showed less sensitivity towards clove essential oil inhibition; however Salmonella typhimurium was strongly inhibited by clove essential oil. Then, the effect of clove essential oil at two concentrations (3 and 5% v/w) and combined treatments between gamma irradiation at doses of 1, 2, 3, 4, 5 and 6 kGy and clove essential oil at concentrations as formerly on inactivation of Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhimurium , Escherichia coli and Bacillus cereus inoculated into chicken minced meat was investigated. Addition of clove essential oil to samples of chicken minced meat inoculated with three pathogens reduced the counts of these pathogens, proportionally with increasing concentration. The irradiated samples at doses of 3, 4, 5 and 6 kGy and that irradiated at doses 2, 3, 4, 5 and 6 kGy of chicken minced and containing 3 and 5% completely inactivation of inoculated pathogens and not detected during cold storage at 4±1°C for 7 days. Accordingly, clove essential oil can be used as natural antimicrobial additive or in combination treatments with gamma irradiation for incorporation in various food products. Also, there is a possibility of using low doses gamma irradiation and low concentrations clove essential oil for treatment of meat products in order to this to reduce the economic cost of products and improving hygienic quality and extend its shelf-life. Therefore clove essential oil could be used as preservative ingredients in

  7. Effects of Flower and Fruit Extracts of Melastoma malabathricum Linn. on Growth of Pathogenic Bacteria: Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Siti Nurhadis Che Omar

    2013-01-01

    Full Text Available Melastoma malabathricum Linn. is a shrub that comes with beautiful pink or purple flowers and has berries-like fruits rich in anthocyanins. This study was carried out with the aim to evaluate the inhibitory activities of different concentrations of the M. malabathricum Linn. flower and fruit crude extracts against Listeria monocytogenes IMR L55, Staphylococcus aureus IMR S244, Escherichia coli IMR E30, and Salmonella typhimurium IMR S100 using the disc diffusion method. The lowest concentrations of the extracts producing inhibition zones against the test microorganisms were used to determine their minimum inhibitory concentrations (MICs and minimum bactericidal concentrations (MBCs. In addition, the growth of Listeria monocytogenes IMR L55 and Staphylococcus aureus IMR S244 grown in medium supplemented with the respective extracts at different temperatures (4°C, 25°C, and 37°C and pHs (4, 6, 7, and 8 was determined.

  8. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions

    OpenAIRE

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow’s milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulenc...

  9. Foodborne parasites from wildlife

    DEFF Research Database (Denmark)

    Kapel, Christian Moliin Outzen; Fredensborg, Brian Lund

    2015-01-01

    The majority of wild foods consumed by humans are sourced from intensively managed or semi-farmed populations. Management practices inevitably affect wildlife density and habitat characteristics, which are key elements in the transmission of parasites. We consider the risk of transmission...... of foodborne parasites to humans from wildlife maintained under natural or semi-natural conditions. A deeper understanding will be useful in counteracting foodborne parasites arising from the growing industry of novel and exotic foods....

  10. Inactivation dynamics of 222 nm krypton-chlorine excilamp irradiation on Gram-positive and Gram-negative foodborne pathogenic bacteria.

    Science.gov (United States)

    Kang, Jun-Won; Kim, Sang-Soon; Kang, Dong-Hyun

    2018-07-01

    The object of this study was to elucidate the bactericidal mechanism of a 222 nm Krypton Chlorine (KrCl) excilamp compared with that of a 254 nm Low Pressure mercury (LP Hg) lamp. The KrCl excilamp had higher bactericidal capacity against Gram-positive pathogenic bacteria (Staphylococcus aureus and L. monocytogenes) and Gram-negative pathogenic bacteria (S. Typhimurium and E. coli O157:H7) than did the LP Hg lamp when cell suspensions in PBS were irradiated with each type of UV lamp. It was found out that the KrCl excilamp induced cell membrane damage as a form of depolarization. From the study of respiratory chain dehydrogenase activity and the lipid peroxidation assay, it was revealed that cell membrane damage was attributed to inactivation of enzymes related to generation of membrane potential and occurrence of lipid peroxidation. Direct absorption of UV radiation which led to photoreaction through formation of an excited state was one of the causes inducing cell damage. Additionally, generation of ROS and thus occurrence of secondary damage can be another cause. The LP Hg lamp only induced damage to DNA but not to other components such as lipids or proteins. This difference was derived from differences of UV radiation absorption by cellular materials. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on a review on the European Union Summary reports on trends and sources zoonoses, zoonotic agents and food-borne outbreaks in 2009 and 2010 – specifically for the data on Salmonella, Campylobacter, verotoxigenic Escherichia coli

    DEFF Research Database (Denmark)

    Hald, Tine

    health problems related to food and animal sources in the EU, it is desirable to differentiate between travel within and outside the EU. This would also be useful to better evaluate the public health impact of EU-wide food safety measures. Whenever possible the data/results should be analysed using......The European Union (EU) Summary Reports on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2009 and 2010 – specifically for the data on Salmonella, Campylobacter, verotoxigenic Escherichia coli, Listeria monocytogenes and foodborne outbreaks was reviewed. The main...... insight. Ultimately, summary measures of public health such as disability adjusted life years (DALYs) and cost-of-illness estimates should be presented. Travel information was found to be still incomplete in many MSs. For many pathogens this hampers source attribution. To better understand the public...

  12. Irrigation Water Sources and Time Intervals as Variables on the Presence of Campylobacter spp. and Listeria monocytogenes on Romaine Lettuce Grown in Muck Soil.

    Science.gov (United States)

    Guévremont, Evelyne; Lamoureux, Lisyanne; Généreux, Mylène; Côté, Caroline

    2017-07-01

    Irrigation water has been identified as a possible source of vegetable contamination by foodborne pathogens. Risk management for pathogens such as Campylobacter spp. and Listeria monocytogenes in fields can be influenced by the source of the irrigation water and the time interval between last irrigation and harvest. Plots of romaine lettuce were irrigated with manure-contaminated water or aerated pond water 21, 7, or 3 days prior to harvesting, and water and muck soil samples were collected at each irrigation treatment. Lettuce samples were collected at the end of the trials. The samples were tested for the presence of Campylobacter spp. and L. monocytogenes. Campylobacter coli was isolated from 33% of hog manure samples (n = 9) and from 11% of the contaminated water samples (n = 27), but no lettuce samples were positive (n = 288). L. monocytogenes was not found in manure, and only one sample of manure-contaminated irrigation water (n = 27) and one lettuce sample (n = 288) were positive. No Campylobacter or L. monocytogenes was recovered from the soil samples (n = 288). Because of the low incidence of pathogens, it was not possible to link the contamination of either soil or lettuce with the type of irrigation water. Nevertheless, experimental field trials mimicking real conditions provide new insights into the survival of two significant foodborne pathogens on romaine lettuce.

  13. Different methods to quantify Listeria monocytogenesbiofilms cells showed different profile in their viability

    Directory of Open Access Journals (Sweden)

    Lizziane Kretli Winkelströter

    2015-03-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen able to adhere and to form biofilms in several materials commonly present in food processing plants. The aim of this study was to evaluate the resistance of Listeria monocytogenes attached to abiotic surface, after treatment with sanitizers, by culture method, microscopy and Quantitative Real Time Polymerase Chain Reaction (qPCR. Biofilms of L. monocytogenes were obtained in stainless steel coupons immersed in Brain Heart Infusion Broth, under agitation at 37 °C for 24 h. The methods selected for this study were based on plate count, microscopic count with the aid of viability dyes (CTC-DAPI, and qPCR. Results of culture method showed that peroxyacetic acid was efficient to kill sessile L. monocytogenes populations, while sodium hypochlorite was only partially effective to kill attached L. monocytogenes (p < 0.05. When, viability dyes (CTC/DAPI combined with fluorescence microscopy and qPCR were used and lower counts were found after treatments (p < 0.05. Selective quantification of viable cells of L. monocytogenes by qPCR using EMA revelead that the pre-treatment with EMA was not appropriate since it also inhibited amplification of DNA from live cells by ca. 2 log. Thus, the use of CTC counts was the best method to count viable cells in biofilms.

  14. A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital.

    Science.gov (United States)

    Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild

    2010-12-01

    Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  15. Apoptotic death of Listeria monocytogenes-infected human macrophages induced by lactoferricin B, a bovine lactoferrin-derived peptide.

    Science.gov (United States)

    Longhi, C; Conte, M P; Ranaldi, S; Penta, M; Valenti, P; Tinari, A; Superti, F; Seganti, L

    2005-01-01

    Listeria monocytogenes, an intracellular facultative food-borne pathogen, was reported to induce apoptosis in vitro and in vivo in a variety of cell types with the exception of murine macrophages. These cells represent the predominant compartment of bacterial multiplication and die as a result of necrosis. In this study we showed that human non-activated and IFN-gamma-activated macrophagic-like (THP-1) cells infected with L. monocytogenes, mainly die by necrosis rather than by an apoptotic process. Two natural products derived from bovine milk, lactoferrin and its derivative peptide lactoferricin B, are capable of regulating the fate of infected human macrophages. Bovine lactoferrin treatment of macrophages protects them from L. monocytogenes-induced death whereas lactoferricin B, its derivative peptide, determines a shifting of the equilibrium from necrosis to apoptosis.

  16. OCCURRENCE OF LISTERIA MONOCYTOGENES IN READY TO EAT FOOD SAMPLES COLLECTED BY LOMBARDY REGION HEALTH AUTHORITIES IN 2009-2010

    Directory of Open Access Journals (Sweden)

    E. Oliverio

    2012-08-01

    Full Text Available The study provides data on the prevalence of Listeria monocytogenes in ready-to-eat food samples collected by Lombardy region health authorities and analyzed by Department of Food Microbiology, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna. From the total of 503 food samples analyzed, the pathogen was detected in 85 (16,9%. In particular it was highlighted in 8/152 (5,3% meat products, in 5/245 (2% dairy products and in 42/106 (39,6% fishery products. Given the considerable public health implications, the study confirms that a well-planned program of listeriosis surveillance should be enforced to suitably estimate the burden of disease and to prevent foodborne outbreaks.

  17. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

    DEFF Research Database (Denmark)

    Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

    2016-01-01

    proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...

  18. Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

    DEFF Research Database (Denmark)

    Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

    2017-01-01

    needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...

  19. Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.

    2014-01-01

    The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...... important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus...... chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases...

  20. Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

    Science.gov (United States)

    Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin

    2011-11-01

    To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.

  1. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    Directory of Open Access Journals (Sweden)

    Vanessa de Vasconcelos Byrne

    2016-06-01

    Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

  2. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

    Science.gov (United States)

    de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

    2016-01-01

    Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  3. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-09-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Flagellar motility is critical for Listeria monocytogenes biofilm formation.

    Science.gov (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

    2007-06-01

    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  5. Enhanced inactivation of food-borne pathogens in ready-to-eat sliced ham by near-infrared heating combined with UV-C irradiation and mechanism of the synergistic bactericidal action.

    Science.gov (United States)

    Ha, Jae-Won; Kang, Dong-Hyun

    2015-01-01

    The objective of the study described in this article was, first, to investigate the effect of the simultaneous application of near-infrared (NIR) heating and UV irradiation on inactivation of Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes in ready-to-eat (RTE) sliced ham and as well as its effect on product quality and, second, to elucidate the underlying mechanisms of the synergistic bactericidal action of NIR heating and UV irradiation. With the inoculation amounts used, simultaneous NIR-UV combined treatment for 70 s achieved 3.62, 4.17, and 3.43 log CFU reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. For all three pathogens, the simultaneous application of both technologies resulted in an additional log unit reduction as a result of their synergism compared to the sum of the reductions obtained after the individual treatments. To investigate the mechanisms of NIR-UV synergistic injury for a particular microorganism in a food base, we evaluated the effect of four types of metabolic inhibitors using the overlay method and confirmed that damage to cellular membranes and the inability of cells to repair these structures due to ribosomal damage were the primary factors related to the synergistic lethal effect. Additionally, NIR-UV combined treatment for a maximum of 70 s did not alter the color values or texture parameters of ham slices significantly (P > 0.05). These results suggest that a NIR-UV combined process could be an innovative antimicrobial intervention for RTE meat products. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

    Science.gov (United States)

    Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

  7. Chemical composition and in vitro antibacterial activity of essential oil and methanol extract of Echinophora platyloba D.C against some of food-borne pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Mohammad Hashemi

    2013-06-01

    Full Text Available Echinophora Platyloba D.C as a medicinal plant is used for preservation of foods and treatment of many diseases in different regions of Iran. The present study was undertaken to determine the chemical composition and investigation of the antibacterial effects of essential oil as well as methanol extract from aerial part of Echinophora Platyloba D.C against S. aureus, L. monocytogenes, S. Thyphimurium and E. coli. Chemical analysis using gas chromatography and mass spectrophotometry (GC/MS showed that ocimene (26.51%, 2,3-Dimethyl-cyclohexa- 1,3-diene (9.87%, alpha-pinene (7.69% and gamma-dodecanolactone (5.66% were dominant components of essential oil and the main constituents of methanol extract were o- Cymene (28.66%, methanol (8.50%, alpha-pinene (7.42% and gamma-decalactone (5.20%. The essential oil showed strong antimicrobial activity against tested bacteria, whereas the methanol extract almost remained inactive against gram-negative bacteria. The most sensitive bacteria to essential oil and extract of Echinophora Platyloba D.C were L. mono- cytogenes and S. aureus. Minimum inhibitory concentration (MIC values of essential oil against L. monocytogenes and S. aureus were 6250 and 12500 ppm, respectively. MIC of methanol extract against S. aureus and L. monocytogenes was 25000 ppm. Therefore, purifying and evaluation of antibacterial effects of the active substances of the essential oil and methanol extract of this plant for future application as antibacterial agents and food preservatives to combat pathogenic and toxigenic microorganisms is recommended.

  8. Prevalence of Listeria monocytogenes in traditional ice cream, Yazd, IRAN (1394 and compared to other studies in different parts of Iran

    Directory of Open Access Journals (Sweden)

    Negar Hamidian

    2017-07-01

    Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of  Listeria  species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov

  9. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  10. Effectiveness of superheated steam for inactivation of Escherichia coli O157:H7, Salmonella Typhimurium, Salmonella Enteritidis phage type 30, and Listeria monocytogenes on almonds and pistachios.

    Science.gov (United States)

    Ban, Ga-Hee; Kang, Dong-Hyun

    2016-03-02

    This study was undertaken to evaluate the effectiveness of superheated steam (SHS) on the inactivation of Escherichia coli O157:H7, Salmonella Typhimurium, Salmonella Enteritidis phage type (PT) 30 and Listeria monocytogenes on almonds and in-shell pistachios and to determine the effect of superheated steam heating on quality by measuring color and texture changes. Almonds and in-shell pistachios inoculated with four foodborne pathogens were treated with saturated steam (SS) at 100 °C and SHS at 125, 150, 175, and 200 °C for various times. Exposure of almonds and pistachios to SHS for 15 or 30s at 200 °C achieved >5l og reductions among all tested pathogens without causing significant changes in color values or texture parameters (P>0.05). For both almonds and pistachios, acid and peroxide values (PV) following SS and SHS treatment for up to 15s and 30s, respectively, were within the acceptable range (PV<1.0 meq/kg). These results show that thermal application of 200 °C SHS treatment for 15s and 30s did not affect the quality of almonds and pistachios, respectively. Therefore, SHS treatment is a very promising alternative technology for the tree nuts industry by improving inactivation of foodborne pathogens on almonds and pistachios while simultaneously reducing processing time. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Effect of various conditions on inactivation of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes in fresh-cut lettuce using ultraviolet radiation.

    Science.gov (United States)

    Kim, Yoon-Hee; Jeong, Seul-Gi; Back, Kyeong-Hwan; Park, Ki-Hwan; Chung, Myung-Sub; Kang, Dong-Hyun

    2013-09-16

    The effect of various conditions on inactivation of foodborne pathogens and quality of fresh-cut lettuce during ultraviolet (254 nm, UVC) radiation was investigated. Lettuce was inoculated with a cocktail of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes and treated at different temperatures (4 and 25 °C), distances between sample and lamp (10 and 50 cm), type of exposure (illuminated from one or two sides), UV intensities (1.36 to 6.80 mW/cm²), and exposure times (0.5 to 10 min), sequentially. UV treatment at 25 °C for 1 min achieved 1.45-, 1.35-, and 2.12-log reductions in surface-inoculated E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively, whereas the reduction of these pathogens at 4 °C was 0.31, 0.57, and 1.16 log, respectively. UV radiation was most effective when distance from UV lamp to the sample was minimal (10 cm) and radiation area was maximal (two-sided exposure). All UV intensities significantly (P0.05) different from those of nontreated samples up to 5 min exposure. However, these qualities significantly (Pradiation under optimized conditions could reduce foodborne pathogens without adversely affecting color quality properties of fresh-cut lettuce. © 2013 Elsevier B.V. All rights reserved.

  12. Foodborne Norovirus Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2012-09-17

    Dr. Aron Hall, a CDC epidemiologist specializing in noroviruses, discusses foodborne norovirus outbreaks.  Created: 9/17/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 9/17/2012.

  13. A sensitive impedance biosensor based on immunomagnetic separation and urease catalysis for rapid detection of Listeria monocytogenes using an immobilization-free interdigitated array microelectrode.

    Science.gov (United States)

    Chen, Qi; Lin, Jianhan; Gan, Chengqi; Wang, Yuhe; Wang, Dan; Xiong, Yonghua; Lai, Weihua; Li, Yuntao; Wang, Maohua

    2015-12-15

    In this study, we described a novel impedance biosensor combining immunomagnetic separation with urease catalysis for sensitive detection of foodborne bacteria using Listeria monocytogenes as model and an immobilization-free microelectrode as detector. The monoclonal antibodies (MAbs) were immobilized on the surface of the magnetic nanoparticles (MNPs) with the diameter of 180 nm by biotin-streptavidin system for specifically and efficiently separating Listeria cells from sample background. The polyclonal antibodies (PAbs) and the urease were modified onto the surface of the gold nanoparticles (AuNPs) with the diameter of 20 nm and the modified AuNPs were used to react with Listera to form the MNP-MAb-Listeria-PAb-AuNP-urease sandwich complexes. The urease in the complexes could catalyze the hydrolysis of the urea into ammonium carbonate and this led to an increase in the ionic strength of the media, which could be detected by the microelectrode. The magnetic separation efficiencies for L. monocytogenes at the concentrations ranging from 3.0×10(1) to 3.0×10(4) CFU/mL were over 95% for the pure cultures and over 85% for the spiked lettuce samples. The lower detection limit of this biosensor for L. monocytogenes was found to be 300 CFU/mL in both the pure cultures and the spiked lettuce samples. The microelectrode was demonstrated to be reusable for over 50 times with thorough cleaning by deionized water. This biosensor showed its potential to provide a simple, low-cost and sensitive method for rapid screening of foodborne pathogens and could be extended for detection of other biological or chemical targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food.

    Science.gov (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  15. Interaction of graphene family materials with Listeria monocytogenes and Salmonella enterica

    Science.gov (United States)

    Kurantowicz, Natalia; Sawosz, Ewa; Jaworski, Sławomir; Kutwin, Marta; Strojny, Barbara; Wierzbicki, Mateusz; Szeliga, Jacek; Hotowy, Anna; Lipińska, Ludwika; Koziński, Rafał; Jagiełło, Joanna; Chwalibog, André

    2015-01-01

    Graphene family materials have unique properties, which make them valuable for a range of applications. The antibacterial properties of graphene have been reported; however, findings have been contradictory. This study reports on the antimicrobial proprieties of three different graphene materials (pristine graphene (pG), graphene oxide (GO), and reduced graphene oxide (rGO)) against the food-borne bacterial pathogens Listeria monocytogenes and Salmonella enterica. A high concentration (250 μg/mL) of all the analyzed graphenes completely inhibited the growth of both pathogens, despite their difference in bacterial cell wall structure. At a lower concentration (25 μg/mL), similar effects were only observed with GO, as growth inhibition decreased with pG and rGO at the lower concentration. Interaction of the nanoparticles with the pathogenic bacteria was found to differ depending on the form of graphene. Microscopic imaging demonstrated that bacteria were arranged at the edges of pG and rGO, while with GO, they adhered to the nanoparticle surface. GO was found to have the highest antibacterial activity.

  16. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  17. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Directory of Open Access Journals (Sweden)

    Trajković-Pavlović Ljiljana

    2010-01-01

    Full Text Available Background/Aim. According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. Methods. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heattreated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphitoreducting Clostridia were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Results. Related to the national criteria on microbiological food safety, 88 (38.8% samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1% out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely

  18. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Science.gov (United States)

    Trajković-Pavlović, Ljiljana; Novaković, Budimka; Martinov-Cvejin, Mirjana; Gusman, Vera; Bijelović, Sanja; Dragnić, Natasa; Balać, Dragana

    2010-08-01

    According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heat-treated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphito-reducting Clostridia) were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO) were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Related to the national criteria on microbiological food safety, 88 (38.8%) samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1%) out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely to occur among samples with Campylobacter spp

  19. Antimicrobial activity of essential oils from Mediterranean aromatic plants against several foodborne and spoilage bacteria.

    Science.gov (United States)

    Silva, Nuno; Alves, Sofia; Gonçalves, Alexandre; Amaral, Joana S; Poeta, Patrícia

    2013-12-01

    The antimicrobial activity of essential oils extracted from a variety of aromatic plants, often used in the Portuguese gastronomy was studied in vitro by the agar diffusion method. The essential oils of thyme, oregano, rosemary, verbena, basil, peppermint, pennyroyal and mint were tested against Gram-positive (Listeria monocytogenes, Clostridium perfringens, Bacillus cereus, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, and Staphylococcus epidermidis) and Gram-negative strains (Salmonella enterica, Escherichia coli, and Pseudomonas aeruginosa). For most essential oils examined, S. aureus, was the most susceptible bacteria, while P. aeruginosa showed, in general, least susceptibility. Among the eight essential oils evaluated, thyme, oregano and pennyroyal oils showed the greatest antimicrobial activity, followed by rosemary, peppermint and verbena, while basil and mint showed the weakest antimicrobial activity. Most of the essential oils considered in this study exhibited a significant inhibitory effect. Thyme oil showed a promising inhibitory activity even at low concentration, thus revealing its potential as a natural preservative in food products against several causal agents of foodborne diseases and food spoilage. In general, the results demonstrate that, besides flavoring the food, the use of aromatic herbs in gastronomy can also contribute to a bacteriostatic effect against pathogens.

  20. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  1. Food-borne diseases - the challenges of 20 years ago still persist while new ones continue to emerge.

    NARCIS (Netherlands)

    Newell, D.G.; Koopmans, M.; Verhoef, L.; Duizer, E.; Aidara-Kane, A.; Sprong, H.; Opsteegh, M.; Langelaar, M.; Threfall, J.; Scheutz, F.; van der Giessen, J.; Kruse, H.

    2010-01-01

    The burden of diseases caused by food-borne pathogens remains largely unknown. Importantly data indicating trends in food-borne infectious intestinal disease is limited to a few industrialised countries, and even fewer pathogens. It has been predicted that the importance of diarrhoeal disease,

  2. Analysis of the role of betL in contributing to the growth and survival of Listeria monocytogenes LO28.

    Science.gov (United States)

    Sleator, R D; Gahan CGM; O'Driscoll, B; Hill, C

    2000-09-25

    Survival of the food-borne pathogen Listeria monocytogenes in environments of elevated osmolarity and reduced temperature is attributed, at least in part, to the accumulation of the trimethylammonium compound glycine betaine. Previously we identified betL, a gene encoding the secondary glycine betaine transporter BetL, which we linked to the salt tolerance of Listeria. In this report, we demonstrate that betL, preceded by a consensus sigmaB-dependent promoter, is regulated by osmotic up-shock, at least in part at the level of transcription. Using allelic exchange mutagenesis we constructed an in-frame deletion in betL, and used this mutant to determine the role of BetL in contributing to the growth and survival of L. monocytogenes, both in a high risk food (Camembert cheese) and animal model. Our results indicate that while BetL plays an important role in glycine betaine mediated osmoprotection, mutating the gene does not significantly effect either the cryotolerance or virulence of the organism.

  3. Prevalence of Salmonella spp. and Listeria monocytogenes at small-scale spanish factories producing traditional fermented sausages.

    Science.gov (United States)

    Martin, Belen; Garriga, Margarita; Aymerich, Teresa

    2011-05-01

    The manufacturing of fermented sausages is subject to natural contamination processes that can potentially carry foodborne pathogens along the process chain and result in contamination of the final product. The aim of this study was to evaluate the occurrence of Salmonella spp. and Listeria monocytogenes at different sampling points during the manufacturing process of fuet, a type of traditional fermented sausage, at 10 small-scale Spanish factories. The presence of both pathogens was studied in the raw materials (19 casings and 19 meat batters), the final products (19 fermented sausages), and the factory equipment (12 mincing, 12 mixing, and 19 stuffing machines, 19 cutting tables, 11 knives, and 12 cold rooms) by using classical microbiological techniques and real-time PCR. Salmonella was not detected in the equipment analyzed or in the final products, but it was detected in the raw materials (23.7% of samples). L. monocytogenes showed higher incidence than Salmonella and was detected in the equipment (11.8% of samples), the raw materials (28.9%), and the final products (15.8%), confirming its ubiquity throughout the manufacturing process of fermented sausages. Five factories were further investigated to study the changes in the distribution of pathogens in the fuet production process over a period of either 2 or 3 years. There was considerable variation in the incidence of both pathogens at different sampling periods, and there was no relation between seasonal variations or geographic location of the factories.

  4. Effect of marinating chicken meat with lemon, green tea, and turmeric against foodborne bacterial pathogenss

    Science.gov (United States)

    Foodborne diseases affect millions of people each year. To reduce the incidence of bacterial foodborne pathogens more effective treatment methods are needed. In this study we evaluated the effect of marinating chicken breast fillets with extracts of lemon, green tea, and turmeric against Campylob...

  5. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray

    2018-04-01

    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  6. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  7. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

    Science.gov (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  8. Listeria monocytogenes switches from dissemination to persistence by adopting a vacuolar lifestyle in epithelial cells

    Science.gov (United States)

    Mitchell, Gabriel

    2017-01-01

    Listeria monocytogenes causes listeriosis, a foodborne disease that poses serious risks to fetuses, newborns and immunocompromised adults. This intracellular bacterial pathogen proliferates in the host cytosol and exploits the host actin polymerization machinery to spread from cell-to-cell and disseminate in the host. Here, we report that during several days of infection in human hepatocytes or trophoblast cells, L. monocytogenes switches from this active motile lifestyle to a stage of persistence in vacuoles. Upon intercellular spread, bacteria gradually stopped producing the actin-nucleating protein ActA and became trapped in lysosome-like vacuoles termed Listeria-Containing Vacuoles (LisCVs). Subpopulations of bacteria resisted degradation in LisCVs and entered a slow/non-replicative state. During the subculture of host cells harboring LisCVs, bacteria showed a capacity to cycle between the vacuolar and the actin-based motility stages. When ActA was absent, such as in ΔactA mutants, vacuolar bacteria parasitized host cells in the so-called “viable but non-culturable” state (VBNC), preventing their detection by conventional colony counting methods. The exposure of infected cells to high doses of gentamicin did not trigger the formation of LisCVs, but selected for vacuolar and VBNC bacteria. Together, these results reveal the ability of L. monocytogenes to enter a persistent state in a subset of epithelial cells, which may favor the asymptomatic carriage of this pathogen, lengthen the incubation period of listeriosis, and promote bacterial survival during antibiotic therapy. PMID:29190284

  9. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Science.gov (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  10. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  11. Bifidobacterium breve IPLA20005 affects in vitro the expression of hly and luxS genes, related to the virulence of Listeria monocytogenes Lm23.

    Science.gov (United States)

    Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G

    2018-03-01

    Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.

  12. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

    Science.gov (United States)

    Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

    2015-01-01

    Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

  13. Effect of milk fat content on the performance of ohmic heating for inactivation of Escherichia coli O157:H7, Salmonella enterica Serovar Typhimurium and Listeria monocytogenes.

    Science.gov (United States)

    Kim, S-S; Kang, D-H

    2015-08-01

    The effect of milk fat content on ohmic heating compared to conventional heating for inactivation of food-borne pathogens was investigated. Sterile cream was mixed with sterile buffered peptone water and adjusted to 0, 3, 7, 10% (w/v) milk fat content. These samples with varying fat content were subjected to ohmic and conventional heating. The effect of milk fat on temperature increase and electrical conductivity were investigated. Also, the protective effect of milk fat on the inactivation of foodborne pathogens was studied. For conventional heating, temperatures of samples increased with time and were not significantly (P > 0.05) different regardless of fat content. Although the inactivation rate of Escherichia coli O157:H7, Salmonella Typhimurium and L. monocytogens decreased in samples of 10% fat content, a protective effect was not observed for conventional heating. In contrast with conventional heating, ohmic heating was significantly affected by milk fat content. Temperature increased more rapidly with lower fat content for ohmic heating due to higher electrical conductivity. Nonuniform heat generation of nonhomogeneous fat-containing samples was verified using a thermal infrared camera. Also, the protective effect of milk fat on E. coli O157:H7 and Listeria monocytogenes was observed in samples subjected to ohmic heating. These results indicate that food-borne pathogens can survive in nonhomogeneous fat-containing foods subjected to ohmic heating. Therefore, more attention is needed regarding ohmic heating than conventional heating for pasteurizing fat-containing foods. The importance of adequate pasteurization for high milk fat containing foods was identified. © 2015 The Society for Applied Microbiology.

  14. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

    2010-08-01

    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  15. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

    Science.gov (United States)

    Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

    2017-12-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Potential of fermented papaya beverage in the prevention of foodborne illness incidence

    Directory of Open Access Journals (Sweden)

    Koh, S.P.

    2017-05-01

    Full Text Available Foodborne illness is recognized as an emerging infectious disease. The incidence of foodborne infections is common and the majority cases are undiagnosed or unreported. Apart from some diarrhea or minor gastrointestinal problem, some foodborne pathogenic microbes may cause death, particularly to those people with weakened immune system. In this study, we have developed a new fermented papaya beverage using symbiotic culture of yeast and acetic acid bacteria under controlled biofermentation process. An in-vitro assessment of fermented papaya beverage against few foodborne pathogenic microorganism was conducted to determine its minimum bactericidal concentration (MBC>99. Three types of foodborne pathogen: Escherichia coli O157, Salmonella enterica serovar Typhimurium ATCC 53648, Salmonella enterica serovar Enteritidis (isolated from infectious chicken were selected. From minimum bactericidal concentration (MBC>99 assay, both fermented papaya pulp and leaves beverages have shown 100% killing rate against three selected foodborne pathogenic microbes. Inversely, non-fermented papaya pulp and leaves beverages indicated no inhibition at all. In fact, further dilution of fermented papaya pulp and leaves beverages demonstrated different degree of MBC>99 and brix value, but the pH value remained less than 3.5. These findings indicated the combination of soluble solid compounds presents in both fermented papaya beverage and product acidity play an important role in the inhibition of pathogenic microorganisms. The preliminary promising results of this work have shown that the great potential of fermented papaya beverages as a preventive measure to reduce the incidence of foodborne illness.

  17. Packaging properties and control of Listeria monocytogenes in bologna by cellulosic films incorporated with pediocin

    Directory of Open Access Journals (Sweden)

    Paula Judith Pérez Espitia

    2013-09-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen, able to survive and proliferate at refrigeration temperatures. As a result, ready-to-eat meat products have been associated with major outbreaks. Producing meat products involves lethal preservation treatments, e.g. thermal treatments. Listeria contamination, however, may be introduced when products are sliced and packaged at retail businesses or delicatessens. In Brazil, sliced bologna is very popular at retail markets. After slicing, however, bologna has a short shelf-life. The aim of this work was to study the effects of pediocin incorporation on the load at break, water vapor permeability rate and structure, by microscopic analysis, of antimicrobial cellulosic packaging. The potential application of the developed packaging for the preservation of bologna and inhibition of Listeria biofilm formation was also studied. Cellulosic antimicrobial packaging films were produced with cellulose acetate and acetone. Pediocin (commercially available concentrate ALTA TM 2341 was incorporated at 30, 40 and 50 % w/w. The load at break of films was studied using the Universal Testing Machine (Instron at 10 °C and 25 °C. The water vapor permeability was determined by gravimetric method. A scanning electron microscope was used to study the developed packaging structure. Antimicrobial activity of films against Listeria innoucua and L. monocytogenes was tested both in vitro and in bologna samples. Results showed that values of load at break decreased with increasing concentrations of pediocin at 10 °C and 25 °C. Regarding water vapor permeability, only the control and 50 % pediocin films presented statistical difference, with the 50 % pediocin film being more permeable. In vitro tests showed antimicrobial activity against L. innocua. Cellulosic film with 50 % pediocin reduced L. monocytogenes growth on sliced bologna by 1.2 log cycles after 9 days and prevented biofilm formation on packaging and bologna

  18. Survey for Listeria monocytogenes in and on Ready-to-Eat Foods from Retail Establishments in the United States (2010 through 2013): Assessing Potential Changes of Pathogen Prevalence and Levels in a Decade.

    Science.gov (United States)

    Luchansky, John B; Chen, Yuhuan; Porto-Fett, Anna C S; Pouillot, Régis; Shoyer, Bradley A; Johnson-DeRycke, Rachel; Eblen, Denise R; Hoelzer, Karin; Shaw, William K; van Doren, Jane M; Catlin, Michelle; Lee, Jeehyun; Tikekar, Rohan; Gallagher, Daniel; Lindsay, James A; Dennis, Sherri

    2017-06-01

    A multiyear interagency Listeria monocytogenes Market Basket Survey was undertaken for selected refrigerated ready-to-eat foods purchased at retail in four FoodNet sites in the United States. Food samples from 16 food categories in six broad groups (seafood, produce, dairy, meat, eggs, and combination foods) were collected weekly at large national chain supermarkets and independent grocery stores in California, Maryland, Connecticut, and Georgia for 100 weeks between December 2010 and March 2013. Of the 27,389 total samples, 116 samples tested positive by the BAX PCR system for L. monocytogenes , and the pathogen was isolated and confirmed for 102 samples. Among the 16 food categories, the proportion of positive samples (i.e., without considering clustering effects) based on recovery of a viable isolate of L. monocytogenes ranged from 0.00% (95% confidence interval: 0.00, 0.18) for the category of soft-ripened and semisoft cheese to 1.07% (0.63, 1.68) for raw cut vegetables. Among the 571 samples that tested positive for Listeria-like organisms, the proportion of positive samples ranged from 0.79% (0.45, 1.28) for soft-ripened and semisoft cheese to 4.76% (2.80, 7.51) for fresh crab meat or sushi. Across all 16 categories, L. monocytogenes contamination was significantly associated with the four states (P < 0.05) but not with the packaging location (prepackaged by the manufacturer versus made and/or packaged in the store), the type of store (national chain versus independent), or the season. Among the 102 samples positive for L. monocytogenes , levels ranged from <0.036 most probable number per g to 6.1 log CFU/g. For delicatessen (deli) meats, smoked seafood, seafood salads, soft-ripened and semisoft cheeses, and deli-type salads without meat, the percentage of positive samples was significantly lower (P < 0.001) in this survey than that reported a decade ago based on comparable surveys in the United States. Use of mixed logistic regression models to address

  19. Combined effect of synthetic enterocin CRL35 with cell wall, membrane-acting antibiotics and muranolytic enzymes against Listeria cells.

    Science.gov (United States)

    Salvucci, E; Hebert, E M; Sesma, F; Saavedra, L

    2010-08-01

    To evaluate the inhibition effectiveness of enterocin CRL35 in combination with cell wall, membrane-acting antibiotics and muranolytic enzymes against the foodborne pathogen Listeria. Synthetic enterocin CRL35 alone and in combination with monensin, bacitracin, gramicidin, mutanolysin and lysozyme were used in this study. Minimal inhibitory concentration (MIC) and fractional inhibitory concentration (FIC) index assays were performed using Listeria innocua 7 and Listeria monocytogenes FBUNT as sensitive strains. Antibiotics showed positive interactions with the bacteriocin in both strains tested. On the other hand, when mutanolysin and enterocin CRL35 were added to resting cells in a buffer system, the lytic effect of mutanolysin was enhanced. However, the addition of mutanolysin showed no effect on the growth of L. innocua 7 cells in a culture medium. Moreover, mutanolysin allowed the overgrowth of L. innocua 7 cells to an OD similar to control cells in the presence of inhibitory concentration of enterocin CRL35. In contrast, the combination of lysozyme and enterocin CRL35 resulted in a 50% inhibition of the L. innocua 7 growth. Based on our results, we conclude that the combination of synthetic enterocin CRL35 with some antibiotics is effective against L. innocua 7 and L. monocytogenes FBUNT cells, and more importantly the amount of these agents to be used was considerably reduced. The effectiveness of the combination of synthetic enterocin CRL35 with muramidases seems to depend on complex environments, and more detailed studies need to be performed to elucidate this issue. Enterocin CRL35 represents a promising agent that not only can ensure the quality and safety of food but it can also be combined with several antimicrobial agents important in the medical field.

  20. Effects of pulsed electric fields on pathogenic microorganisms of major concern in fluid foods: a review.

    Science.gov (United States)

    Mosqueda-Melgar, Jonathan; Elez-Martínez, Pedro; Raybaudi-Massilia, Rosa M; Martín-Belloso, Olga

    2008-09-01

    Pathogenic microorganisms such as Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni have been implicated in foodborne diseases and outbreaks worldwide. These bacteria have been associated with the consumption of fresh fruit juices, milk, and dairy products, which are foodstuff, highly demanded by consumers in retails and supermarkets. Nowadays, consumers require high quality, fresh-like, and safe foods. Pulsed electric field (PEF) is a non-thermal preservation method, able to inactivate pathogenic microorganisms without significant loss of the organoleptic and nutritional properties of food. The PEF treatment effectiveness to destroy bacteria such as Listeria innocua, E. coli, Salmonella Typhimurium, E. coli O157:H7 and E. coli 8739 at pasteurization levels (> or = 5.0 log(10) cycles) in some fluid foods was reported. However, data on the inactivation of some microorganisms such as Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni in fluid foods by PEF processing is very limited. Therefore, future works should be focused toward the inactivation of these pathogenic bacteria in real foods.

  1. Hyperspectral microscopy to identify foodborne bacteria with optimum lighting source

    Science.gov (United States)

    Hyperspectral microscopy is an emerging technology for rapid detection of foodborne pathogenic bacteria. Since scattering spectral signatures from hyperspectral microscopic images (HMI) vary with lighting sources, it is important to select optimal lights. The objective of this study is to compare t...

  2. AOTF hyperspectral microscope imaging for foodborne bacteria detection

    Science.gov (United States)

    Food safety is an important public health issue worldwide. Researchers have developed many different methods for detecting foodborne pathogens; however, most technologies currently being used have limitations, in terms of speed, sensitivity and selectivity, for practical use in the food industry. Ac...

  3. Foodborne illness: new developments concerning an old problem.

    Science.gov (United States)

    Kasowski, Eric J; Gackstetter, Gary D; Sharp, Trueman W

    2002-08-01

    Foodborne illnesses continue to cause substantial morbidity and mortality in the United States, primarily as gastroenteritis but occasionally as other syndromes as well. Most of these illnesses are caused by a variety of widely known infectious agents, principally viruses, and are probably the result of common mistakes in food handling in the home or in restaurants. The epidemiology of foodborne illness is evolving. Major changes in food production, distribution, and consumption have created opportunities for new pathogens to emerge and for old ones to reemerge, and the potential for widespread outbreaks is increasing. Antibiotic resistance in bacterial pathogens resulting from the widespread use of antimicrobial agents in animal husbandry is also an important concern. Clinicians must be aware of the changing epidemiology of foodborne illness to recognize and manage these conditions in the clinical setting. In addition, clinicians are critical in the reporting of recognized or suspected foodborne illness, so that public health authorities are able to investigate, understand, and ultimately better control them. A number of new techniques have been employed, and others under development will improve our ability to recognize and cope with foodborne diseases.

  4. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  5. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  6. Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.

    Science.gov (United States)

    Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa

    2012-06-01

    Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

  7. Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

    Science.gov (United States)

    Lee, Yuejia; Wang, Chinling

    2017-03-01

    Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

  8. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.

    Science.gov (United States)

    Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N

    2017-01-01

    Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  9. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death

    Directory of Open Access Journals (Sweden)

    Svitlana Vdovikova

    2017-05-01

    Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  10. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Directory of Open Access Journals (Sweden)

    Lisandra Aguilar-Bultet

    2018-02-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

  11. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Science.gov (United States)

    Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

  12. Typing and virulence factors of food-borne Candida spp. isolates.

    Science.gov (United States)

    Rajkowska, Katarzyna; Kunicka-Styczyńska, Alina

    2018-08-20

    Food-borne yeasts, excluding yeasts used as starter cultures, are commonly considered as food spoilage microorganisms. However, the incidence of non-C. albicans Candida (NCAC) infections has increased considerably over the past two decades. Although 15 Candida species are frequently identified as pathogens, a threat to human from food-borne Candida is poorly recognized. In the present study food-borne NCAC were characterized for the virulence factors, known to be associated with yeast pathogenicity. All food-borne strains in planktonic forms and 89% in biofilm structures represented biotypes established for C. albicans, and 61% demonstrated hemolytic activity. 56-94% of food-borne isolates formed biofilms on glass and biomaterials at a level comparable to clinical C. albicans. Nine out of eighteen tested food-borne NCAC strains (C. krusei, C. lusitaniae, C. famata, C. colliculosa, C. parapsilosis, C. tropicalis) showed similarity to clinical C. albicans in terms of their biotypes and the tested virulence factors, allocating them in a group of risk of potential pathogens. However, their capacity to grow at 37 °C seems to be the preliminary criterion in the study of potential virulence of food-borne yeasts. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Y

    2017-01-01

    Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect

  14. Minimum bactericidal concentration of phenols extracted from oil vegetation water on spoilers, starters and food-borne bacteria

    Directory of Open Access Journals (Sweden)

    Luca Fasolato

    2015-05-01

    Full Text Available The aim of the study was to assess the in vitro effect of phenols extracted from oil vegetation water (PEOW on several food-borne strains. Antibacterial activity of PEOW was based on the minimum bactericidal concentration (MBC on microtitre assay. The taxa tested were: Staphylococcus (n. 5, Listeria (n. 4, Escherichia (n. 2, Salmonella (n. 1, Pseudomonas (n. 3, Lactobacillus (n. 2 and Pediococcus (n. 1. S. aureus and L. monocytogens showed the lowest level of resistance to PEOW (MBC=1.5-3 mg/mL. In contrast, the Gram negative strains (e.g. S. Typhimurium and Pseudomonas spp. were in some cases unaffected by the tested doses and the MBCs ranged between 6 to 12 mg/mL. Starter cultures were dramatically reduced on growth (e.g. Staphylococcus xylosus; 0.75 mg/mL MBC. The thresholds for pathogenic strains could be considered for further applications of PEOW in food models (e.g. shelf life or challenge test studies.

  15. Listeriosis in animals, its public health significance (food-borne zoonosis) and advances in diagnosis and control: a comprehensive review.

    Science.gov (United States)

    Dhama, Kuldeep; Karthik, Kumaragurubaran; Tiwari, Ruchi; Shabbir, Muhammad Zubair; Barbuddhe, Sukhadeo; Malik, Satya Veer Singh; Singh, Raj Kumar

    2015-01-01

    Listeriosis is an infectious and fatal disease of animals, birds, fish, crustaceans and humans. It is an important food-borne zoonosis caused by Listeria monocytogenes, an intracellular pathogen with unique potential to spread from cell to cell, thereby crossing blood-brain, intestinal and placental barriers. The organism possesses a pile of virulence factors that help to infect the host and evade from host immune machinery. Though disease occurrence is sporadic throughout the world, it can result in severe damage during an outbreak. Listeriosis is characterized by septicaemia, encephalitis, meningitis, meningoencephalitis, abortion, stillbirth, perinatal infections and gastroenteritis with the incubation period varying with the form of infection. L. monocytogenes has been isolated worldwide from humans, animals, poultry, environmental sources like soil, river, decaying plants, and food sources like milk, meat and their products, seafood and vegetables. Since appropriate vaccines are not available and infection is mainly transmitted through foods in humans and animals, hygienic practices can prevent its spread. The present review describes etiology, epidemiology, transmission, clinical signs, post-mortem lesions, pathogenesis, public health significance, and advances in diagnosis, vaccines and treatment of this disease. Special attention has been given to novel as well as prospective emerging therapies that include bacteriophage and cytokine therapy, avian egg yolk antibodies and herbal therapy. Various vaccines, including advances in recombinant and DNA vaccines and their modes of eliciting immune response, are also discussed. Due focus has also been given regarding appropriate prevention and control strategies to be adapted for better management of this zoonotic disease.

  16. CesRK, a two-component signal transduction system in Listeria monocytogenes, responds to the presence of cell wall-acting antibiotics and affects beta-lactam resistance

    DEFF Research Database (Denmark)

    Kallipolitis, Birgitte H; Ingmer, Hanne; Gahan, Cormac G

    2003-01-01

    Listeria monocytogenes is a food-borne pathogen that can cause a variety of illnesses ranging from gastroenteritis to life-threatening septicemia. The beta-lactam antibiotic ampicillin remains the drug of choice for the treatment of listeriosis. We have previously identified a response regulator...... of L. monocytogenes to tolerate ethanol and cell wall-acting antibiotics of the beta-lactam family. Furthermore, CesRK controls the expression of a putative extracellular peptide encoded by the orf2420 gene, located immediately downstream from cesRK. Inactivation of orf2420 revealed that it contributes...... to ethanol tolerance and pathogenesis in mice. Interestingly, we found that transcription of orf2420 was strongly induced by subinhibitory concentrations of various cell wall-acting antibiotics, ethanol, and lysozyme. The induction of orf2420 expression was abolished in the absence of CesRK. Our data suggest...

  17. Effects of gamma and electron beam irradiation on the survival of pathogens inoculated into sliced and pizza cheeses

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun-Joo [Department of Food Science and Technology, Chung-Ang University, Ansung, Gyunggi-do 456-756 (Korea, Republic of); Ham, Jun-Sang [Animal Products Processing Division, National Livestock Research Institute, RDA, Suwon 441-706 (Korea, Republic of); Lee, Ju-Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Ha, Sang-Do [Department of Food Science and Technology, Chung-Ang University, Ansung, Gyunggi-do 456-756 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.k [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)

    2010-06-15

    The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens (Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10{sup 2} to 10{sup 3} Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10{sup 1} CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D{sub 10} values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.

  18. Effects of gamma and electron beam irradiation on the survival of pathogens inoculated into sliced and pizza cheeses

    International Nuclear Information System (INIS)

    Kim, Hyun-Joo; Ham, Jun-Sang; Lee, Ju-Woon; Kim, Keehyuk; Ha, Sang-Do; Jo, Cheorun

    2010-01-01

    The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens (Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10 2 to 10 3 Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10 1 CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D 10 values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.

  19. Effects of gamma and electron beam irradiation on the survival of pathogens inoculated into sliced and pizza cheeses

    Science.gov (United States)

    Kim, Hyun-Joo; Ham, Jun-Sang; Lee, Ju-Woon; Kim, Keehyuk; Ha, Sang-Do; Jo, Cheorun

    2010-06-01

    The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens ( Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10 2 to 10 3 Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10 1 CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D 10 values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.

  20. Synergy of a combination of nisin and citric acid against Staphylococcus aureus and Listeria monocytogenes.

    Science.gov (United States)

    Zhao, Xingchen; Zhen, Zhen; Wang, Xinyang; Guo, Na

    2017-12-01

    Food-borne diseases caused by pathogens, such as Staphylococcus aureus and Listeria monocytogenes, have long attracted attention globally from researchers, food industries, and food safety authorities. Nisin (NS) is the only bacteriocin used worldwide as a generally recognised as safe (GRAS) food preservative, while citric acid (CA) has an unrestricted use in foods since it has GRAS status. In this study, synergistic interactions of NS combined with CA against S. aureus and L. monocytogenes were studied by the chequerboard microdilution method, with fractional inhibitory concentration index values ranging from 0.25 to 0.375 and 0.19 to 0.375, respectively. The positive interactions were verified by time-kill studies in pasteurised milk and disk diffusion assays. The mechanism of the synergistic antibacterial of NS and CA is proposed following SEM analysis and the determination of release of cell constituents. These results suggest that the cell walls and membrane are the probable main targets of this antimicrobial combination. These findings indicated that the combination of NS and CA not only could be used as a new promising naturally sourced food preservative, but may also reduce the problem of bacterial resistance.

  1. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    International Nuclear Information System (INIS)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-01-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  2. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  3. Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.

    Science.gov (United States)

    Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P

    2012-01-01

    Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  5. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products.

    Science.gov (United States)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-03-15

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation (43% RH and 15 °C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2 days at 100% RH and 15 °C) prior to desiccation for 23 days significantly (Pbiofilm cells also desiccated in low salt, indicating the protective effect of the biofilm matrix. Osmoadaptation of cells in 5% NaCl before formation of the static biofilm significantly (Pbiofilm cells was significantly (Pbiofilm bacteria, however, as biofilm formation enhanced desiccation survival more bacteria were still transferred to smoked and fresh salmon. In conclusion, the current work shows the protective effect of biofilm formation, salt and osmoadaptation on the desiccation survival of L. monocytogenes, which in turn increases the potential for cross-contamination during food processing. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  7. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  9. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

    Science.gov (United States)

    Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

    2015-02-06

    Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

  10. Combined effect of ultrasound and essential oils to reduce Listeria monocytogenes on fresh produce.

    Science.gov (United States)

    Özcan, Gülçin; Demirel Zorba, Nükhet Nilüfer

    2016-06-01

    Salads prepared from contaminated fresh produce have a high risk of causing food-borne illnesses. Essential oils obtained from plants have antimicrobial activity and may provide a natural approach to reduce the pathogens on fresh produce. Additionally, ultrasound treatments have been shown to reduce the microbial counts on different foods. The objective of this study was to investigate the antimicrobial activities of cinnamon and lemon essential oils in vitro and in food applications. Mixtures of lettuce, parsley and dill were inoculated with Listeria monocytogenes and then dip-treated for 5 min in one of the following treatments: sterile tap water, chlorinated water, 1% lemon essential oil, 2% cinnamon essential oil or 2% cinnamon essential oil + ultrasound. The samples were stored at 4 ℃ and collected at d 0, 1, 3, 5, 7 and 9 post inoculation. The 1% lemon (4 log) and 2% cinnamon (2 log) essential oil washes provided partial inhibition against L. monocytogenes by d 1. The combined application of 2% cinnamon oil and ultrasound resulted in only 0.85 log inhibition by d 1; however, the number of L. monocytogenes increased during storage and became nearly equal to the control at d 9. Therefore, different combinations of essential oils with other antimicrobials or novel technologies are required. © The Author(s) 2015.

  11. Isolation and Confirmation of Listeria Species from Seafood off Goa Region by Polymerase Chain Reaction.

    Digital Repository Service at National Institute of Oceanography (India)

    Gawade, L.; Barbuddhe, S.B.; Bhosle, S.

    Several food borne outbreaks have highlighted the importance of Listeria monocytogenes to the public health and have been recognized as an emerging, important food borne pathogen, and a causative agent of listerioses. A number of genes are involved...

  12. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  13. From ontology selection and semantic web to the integrated information system of food-borne diseases and food safety

    Science.gov (United States)

    Over the last three decades, the rapid explosion of information and resources on human food-borne diseases and food safety has provided the ability to rapidly determine and interpret the mechanisms of survival and pathogenesis of food-borne pathogens. However, several factors have hindered effective...

  14. Sensitive genotyping of foodborne-associated human noroviruses and hepatitis A virus using an array-based platform

    Science.gov (United States)

    The viral pathogens, human norovirus (NoV) and hepatitis A virus (HAV), are significant contributors of foodborne associated outbreaks. To develop a typing tool for foodborne viruses, a focused, low-density DNA microarray was developed in conjunction with a rapid and high-throughput fluorescent meth...

  15. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  16. Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

    International Nuclear Information System (INIS)

    Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin

    2011-01-01

    To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham. - Highlights: → We compare irradiation and fumaric acid treatment on the inactivation of pathogens. → We examine changes in the populations of L. monocytogenes and S. typhimurium. → Irradiation at 2 kGy is more effective in sliced ham than fumaric acid treatment. → Low-dose irradiation can improve the microbial safety of sliced ham during storage.

  17. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland

    Directory of Open Access Journals (Sweden)

    Dara eLeong

    2014-08-01

    Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.

  18. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland.

    Science.gov (United States)

    Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran

    2014-01-01

    Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.

  19. Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

    Energy Technology Data Exchange (ETDEWEB)

    Song, Hyeon-Jeong; Lee, Ji-Hye [Department of Food Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Song, Kyung Bin, E-mail: kbsong@cnu.ac.kr [Department of Food Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)

    2011-11-15

    To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham. - Highlights: > We compare irradiation and fumaric acid treatment on the inactivation of pathogens. > We examine changes in the populations of L. monocytogenes and S. typhimurium. > Irradiation at 2 kGy is more effective in sliced ham than fumaric acid treatment. > Low-dose irradiation can improve the microbial safety of sliced ham during storage.

  20. Recent advances in understanding Listeria monocytogenes infection: the importance of subcellular and physiological context [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Daryl J. V. David

    2017-07-01

    Full Text Available The bacterial pathogen Listeria monocytogenes (Lm is the causative agent of listeriosis, a rare but fatal foodborne disease. During infection, Lm can traverse several host barriers and enter the cytosol of a variety of cell types. Thus, consideration of the extracellular and intracellular niches of Lm is critical for understanding the infection process. Here, we review advances in our understanding of Lm infection and highlight how the interactions between the host and the pathogen are context dependent. We discuss discoveries of how Lm senses entry into the host cell cytosol. We present findings concerning how the nature of the various cytoskeleton components subverted by Lm changes depending on both the stage of infection and the subcellular context. We present discoveries of critical components required for Lm traversal of physiological barriers. Interactions between the host gut microbiota and Lm will be briefly discussed. Finally, the importance of Lm biodiversity and post-genomics approaches as a promising way to discover novel virulence factors will be highlighted.

  1. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  2. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  3. Radiosensitization of Salmonella spp. and Listeria spp. in ready-to-eat baby spinach leaves.

    Science.gov (United States)

    Gomes, Carmen; Moreira, Rosana G; Castell-Perez, Elena

    2011-01-01

    The FDA recently approved irradiation treatment of leafy greens such as spinach up to 1 kGy; however, it is important to reduce the dose required to decontaminate the produce while maintaining its quality. Thus, the objectives of this study were: (1) to assess the radiation sensitivities of Salmonella spp. and Listeria spp. inoculated in ready-to-eat baby spinach leaves under modified atmosphere packaging (MAP) and irradiated using a 1.35-MeV Van de Graff accelerator (the leaves were irradiated both at room temperature and at -5 °C); and (2) to understand and optimize the synergistic effect of MAP and irradiation by studying the radiolysis of ozone formation under different temperatures, the effect of dose rate on its formation, and its decomposition. Results showed that increased concentrations of oxygen in the packaging significantly increased the radiation sensitivity of the test organisms, ranging from 7% up to 25% reduction in D(10)-values. In particular, radiosensitization could be effected (P radiation under modified atmosphere packaging (100% O(2) and N(2):O(2)[1:1]) may be a viable tool for reducing microbial populations or eliminating Salmonella spp. and Listeria spp. from baby spinach. A suggested treatment to achieve a 5-log reduction of the test organisms would be irradiation at room temperature under 100% O(2) atmosphere at a dose level of 0.7 kGy. Practical Application: Decontamination of minimally processed fruits and vegetables from food-borne pathogens presents technical and economical challenges to the produce industry. Internalized microorganisms cannot be eliminated by the current procedure (water-washed or treated with 200-ppm chlorine). The only technology available commercially is ionizing radiation; however, the actual radiation dose required to inactivate pathogens is too high to be tolerated by the product without unwanted changes. This study shows a new approach in using MAP with 100% O(2), which is converted to ozone to radiosensitize

  4. Stalling autophagy: a new function for Listeria phospholipases

    Directory of Open Access Journals (Sweden)

    Ivan Tattoli

    2014-01-01

    Full Text Available Listeria monocytogenes is a Gram-positive bacterial pathogen that induces its own uptake in non-phagocytic cells. Following invasion, Listeria escapes from the entry vacuole through the secretion of a pore-forming toxin, listeriolysin O (LLO that acts to damage and disrupt the vacuole membrane. Listeria then replicates in the cytosol and is able to spread from cell-to-cell using actin-based motility. In addition to LLO, Liste