WorldWideScience

Sample records for fluorescent multiplex pcr

  1. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  2. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection

    DEFF Research Database (Denmark)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi

    2016-01-01

    technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP...

  3. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

  4. Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M Heiat

    2010-07-01

    Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

  5. Clostridium perfringens isolate typing by multiplex PCR

    Directory of Open Access Journals (Sweden)

    MR Ahsani

    2010-01-01

    Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

  6. Multiplex PCR identification of Taenia spp. in rodents and carnivores.

    Science.gov (United States)

    Al-Sabi, Mohammad N S; Kapel, Christian M O

    2011-11-01

    The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

  7. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  8. A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

    Science.gov (United States)

    Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

    2015-07-07

    Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

  9. DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

    Science.gov (United States)

    Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

    2004-01-01

    Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

  10. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  11. Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

    Directory of Open Access Journals (Sweden)

    K. Kurta

    2017-12-01

    Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

  12. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  13. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  14. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  15. Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

    2000-05-05

    Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

  16. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  17. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2018-05-01

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  18. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  19. Authentication of Meat Species in Sucuk by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Osman İrfan İLHAK

    2015-01-01

    Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

  20. Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

    Science.gov (United States)

    Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

    2011-01-01

    In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

  1. Fluorescent multiplex cell flow systems and methods

    KAUST Repository

    Merzaban, Jasmeen; Abuelela, Ayman F.; Mohammad, Amal Jehad

    2017-01-01

    scanning system emits multiple electromagnetic wavelengths simultaneously it cause multiple fluorescent labels having different excitation wavelength maximums to fluoresce. The system can simultaneously capture real-time fluorescence images from at least

  2. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  4. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Directory of Open Access Journals (Sweden)

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  6. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  7. Fluorescent multiplex cell flow systems and methods

    KAUST Repository

    Merzaban, Jasmeen

    2017-06-01

    Systems and methods are provided for simultaneously assaying cell adhesion or cell rolling for multiple cell specimens. One embodiment provides a system for assaying adhesion or cell rolling of multiple cell specimens that includes a confocal imaging system containing a parallel plate flow chamber, a pump in fluid communication with the parallel plate flow chamber via a flow chamber inlet line and a cell suspension in fluid communication with the parallel plate flow chamber via a flow chamber outlet line. The system also includes a laser scanning system in electronic communication with the confocal imaging system, and a computer in communication with the confocal imaging system and laser scanning system. In certain embodiments, the laser scanning system emits multiple electromagnetic wavelengths simultaneously it cause multiple fluorescent labels having different excitation wavelength maximums to fluoresce. The system can simultaneously capture real-time fluorescence images from at least seven cell specimens in the parallel plate flow chamber.

  8. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Science.gov (United States)

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  9. Fluorescence-Based Multiplex Protein Detection Using Optically Encoded Microbeads

    Directory of Open Access Journals (Sweden)

    Dae Hong Jeong

    2012-03-01

    Full Text Available Potential utilization of proteins for early detection and diagnosis of various diseases has drawn considerable interest in the development of protein-based multiplex detection techniques. Among the various techniques for high-throughput protein screening, optically-encoded beads combined with fluorescence-based target monitoring have great advantages over the planar array-based multiplexing assays. This review discusses recent developments of analytical methods of screening protein molecules on microbead-based platforms. These include various strategies such as barcoded microbeads, molecular beacon-based techniques, and surface-enhanced Raman scattering-based techniques. Their applications for label-free protein detection are also addressed. Especially, the optically-encoded beads such as multilayer fluorescence beads and SERS-encoded beads are successful for generating a large number of coding.

  10. Genetic barcoding with fluorescent proteins for multiplexed applications.

    Science.gov (United States)

    Smurthwaite, Cameron A; Williams, Wesley; Fetsko, Alexandra; Abbadessa, Darin; Stolp, Zachary D; Reed, Connor W; Dharmawan, Andre; Wolkowicz, Roland

    2015-04-14

    Fluorescent proteins, fluorescent dyes and fluorophores in general have revolutionized the field of molecular cell biology. In particular, the discovery of fluorescent proteins and their genes have enabled the engineering of protein fusions for localization, the analysis of transcriptional activation and translation of proteins of interest, or the general tracking of individual cells and cell populations. The use of fluorescent protein genes in combination with retroviral technology has further allowed the expression of these proteins in mammalian cells in a stable and reliable manner. Shown here is how one can utilize these genes to give cells within a population of cells their own biosignature. As the biosignature is achieved with retroviral technology, cells are barcoded 'indefinitely'. As such, they can be individually tracked within a mixture of barcoded cells and utilized in more complex biological applications. The tracking of distinct populations in a mixture of cells is ideal for multiplexed applications such as discovery of drugs against a multitude of targets or the activation profile of different promoters. The protocol describes how to elegantly develop and amplify barcoded mammalian cells with distinct genetic fluorescent markers, and how to use several markers at once or one marker at different intensities. Finally, the protocol describes how the cells can be further utilized in combination with cell-based assays to increase the power of analysis through multiplexing.

  11. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  12. Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping

    Science.gov (United States)

    Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

  13. Disentangling mite predator-prey relationships by multiplex PCR.

    Science.gov (United States)

    Pérez-Sayas, Consuelo; Pina, Tatiana; Gómez-Martínez, María A; Camañes, Gemma; Ibáñez-Gual, María V; Jaques, Josep A; Hurtado, Mónica A

    2015-11-01

    Gut content analysis using molecular techniques can help elucidate predator-prey relationships in situations in which other methodologies are not feasible, such as in the case of trophic interactions between minute species such as mites. We designed species-specific primers for a mite community occurring in Spanish citrus orchards comprising two herbivores, the Tetranychidae Tetranychus urticae and Panonychus citri, and six predatory mites belonging to the Phytoseiidae family; these predatory mites are considered to be these herbivores' main biological control agents. These primers were successfully multiplexed in a single PCR to test the range of predators feeding on each of the two prey species. We estimated prey DNA detectability success over time (DS50), which depended on the predator-prey combination and ranged from 0.2 to 18 h. These values were further used to weight prey detection in field samples to disentangle the predatory role played by the most abundant predators (i.e. Euseius stipulatus and Phytoseiulus persimilis). The corrected predation value for E. stipulatus was significantly higher than for P. persimilis. However, because this 1.5-fold difference was less than that observed regarding their sevenfold difference in abundance, we conclude that P. persimilis is the most effective predator in the system; it preyed on tetranychids almost five times more frequently than E. stipulatus did. The present results demonstrate that molecular tools are appropriate to unravel predator-prey interactions in tiny species such as mites, which include important agricultural pests and their predators. © 2015 John Wiley & Sons Ltd.

  14. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  15. Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes.

    Directory of Open Access Journals (Sweden)

    Qiuying Huang

    2011-04-01

    Full Text Available Probe-based fluorescence melting curve analysis (FMCA is a powerful tool for mutation detection based on melting temperature generated by thermal denaturation of the probe-target hybrid. Nevertheless, the color multiplexing, probe design, and cross-platform compatibility remain to be limited by using existing probe chemistries. We hereby explored two dual-labeled, self-quenched probes, TaqMan and shared-stem molecular beacons, in their ability to conduct FMCA. Both probes could be directly used for FMCA and readily integrated with closed-tube amplicon hybridization under asymmetric PCR conditions. Improved flexibility of FMCA by using these probes was illustrated in three representative applications of FMCA: mutation scanning, mutation identification and mutation genotyping, all of which achieved improved color-multiplexing with easy probe design and versatile probe combination and all were validated with a large number of real clinical samples. The universal cross-platform compatibility of these probes-based FMCA was also demonstrated by a 4-color mutation genotyping assay performed on five different real-time PCR instruments. The dual-labeled, self-quenched probes offered unprecedented combined advantage of enhanced multiplexing, improved flexibility in probe design, and expanded cross-platform compatibility, which would substantially improve FMCA in mutation detection of various applications.

  16. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  17. Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

    Science.gov (United States)

    Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

  18. Practical implementation of a multiplex PCR for acute respiratory tract infections in children

    NARCIS (Netherlands)

    Gruteke, Paul; Glas, Afina S.; Dierdorp, Mirjam; Vreede, Willem B.; Pilon, Jan-Willem; Bruisten, Sylvia M.

    2004-01-01

    Molecular testing for acute respiratory infections (ARIs) has documented value but limited implementation due to questions that typically slow the acceptance of new tests. This study sought to address these questions and achieve implementation. Rhinovirus was added to a nested multiplex PCR (M-PCR),

  19. A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

    NARCIS (Netherlands)

    Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

    2015-01-01

    A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

  20. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

    Directory of Open Access Journals (Sweden)

    V Hallur

    2015-01-01

    Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  1. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  2. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  3. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  4. Frequency division multiplexed multi-color fluorescence microscope system

    Science.gov (United States)

    Le, Vu Nam; Yang, Huai Dong; Zhang, Si Chun; Zhang, Xin Rong; Jin, Guo Fan

    2017-10-01

    Grayscale camera can only obtain gray scale image of object, while the multicolor imaging technology can obtain the color information to distinguish the sample structures which have the same shapes but in different colors. In fluorescence microscopy, the current method of multicolor imaging are flawed. Problem of these method is affecting the efficiency of fluorescence imaging, reducing the sampling rate of CCD etc. In this paper, we propose a novel multiple color fluorescence microscopy imaging method which based on the Frequency division multiplexing (FDM) technology, by modulating the excitation lights and demodulating the fluorescence signal in frequency domain. This method uses periodic functions with different frequency to modulate amplitude of each excitation lights, and then combine these beams for illumination in a fluorescence microscopy imaging system. The imaging system will detect a multicolor fluorescence image by a grayscale camera. During the data processing, the signal obtained by each pixel of the camera will be processed with discrete Fourier transform, decomposed by color in the frequency domain and then used inverse discrete Fourier transform. After using this process for signals from all of the pixels, monochrome images of each color on the image plane can be obtained and multicolor image is also acquired. Based on this method, this paper has constructed and set up a two-color fluorescence microscope system with two excitation wavelengths of 488 nm and 639 nm. By using this system to observe the linearly movement of two kinds of fluorescent microspheres, after the data processing, we obtain a two-color fluorescence dynamic video which is consistent with the original image. This experiment shows that the dynamic phenomenon of multicolor fluorescent biological samples can be generally observed by this method. Compared with the current methods, this method can obtain the image signals of each color at the same time, and the color video's frame

  5. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Enhanced speed in fluorescence imaging using beat frequency multiplexing

    Science.gov (United States)

    Mikami, Hideharu; Kobayashi, Hirofumi; Wang, Yisen; Hamad, Syed; Ozeki, Yasuyuki; Goda, Keisuke

    2016-03-01

    Fluorescence imaging using radiofrequency-tagged emission (FIRE) is an emerging technique that enables higher imaging speed (namely, temporal resolution) in fluorescence microscopy compared to conventional fluorescence imaging techniques such as confocal microscopy and wide-field microscopy. It works based on the principle that it uses multiple intensity-modulated fields in an interferometric setup as excitation fields and applies frequency-division multiplexing to fluorescence signals. Unfortunately, despite its high potential, FIRE has limited imaging speed due to two practical limitations: signal bandwidth and signal detection efficiency. The signal bandwidth is limited by that of an acousto-optic deflector (AOD) employed in the setup, which is typically 100-200 MHz for the spectral range of fluorescence excitation (400-600 nm). The signal detection efficiency is limited by poor spatial mode-matching between two interfering fields to produce a modulated excitation field. Here we present a method to overcome these limitations and thus to achieve higher imaging speed than the prior version of FIRE. Our method achieves an increase in signal bandwidth by a factor of two and nearly optimal mode matching, which enables the imaging speed limited by the lifetime of the target fluorophore rather than the imaging system itself. The higher bandwidth and better signal detection efficiency work synergistically because higher bandwidth requires higher signal levels to avoid the contribution of shot noise and amplifier noise to the fluorescence signal. Due to its unprecedentedly high-speed performance, our method has a wide variety of applications in cancer detection, drug discovery, and regenerative medicine.

  7. A Multiplex PCR for Detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in Clinical Specimens

    National Research Council Canada - National Science Library

    McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D

    2005-01-01

    A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...

  8. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  9. RNA Imaging with Multiplexed Error Robust Fluorescence in situ Hybridization

    Science.gov (United States)

    Moffitt, Jeffrey R.; Zhuang, Xiaowei

    2016-01-01

    Quantitative measurements of both the copy number and spatial distribution of large fractions of the transcriptome in single-cells could revolutionize our understanding of a variety of cellular and tissue behaviors in both healthy and diseased states. Single-molecule Fluorescence In Situ Hybridization (smFISH)—an approach where individual RNAs are labeled with fluorescent probes and imaged in their native cellular and tissue context—provides both the copy number and spatial context of RNAs but has been limited in the number of RNA species that can be measured simultaneously. Here we describe Multiplexed Error Robust Fluorescence In Situ Hybridization (MERFISH), a massively parallelized form of smFISH that can image and identify hundreds to thousands of different RNA species simultaneously with high accuracy in individual cells in their native spatial context. We provide detailed protocols on all aspects of MERFISH, including probe design, data collection, and data analysis to allow interested laboratories to perform MERFISH measurements themselves. PMID:27241748

  10. Multicolor fluorescent biosensor for multiplexed detection of DNA.

    Science.gov (United States)

    Hu, Rong; Liu, Tao; Zhang, Xiao-Bing; Huan, Shuang-Yan; Wu, Cuichen; Fu, Ting; Tan, Weihong

    2014-05-20

    Development of efficient methods for highly sensitive and rapid screening of specific oligonucleotide sequences is essential to the early diagnosis of serious diseases. In this work, an aggregated cationic perylene diimide (PDI) derivative was found to efficiently quench the fluorescence emission of a variety of anionic oligonucleotide-labeled fluorophores that emit at wavelengths from the visible to NIR region. This broad-spectrum quencher was then adopted to develop a multicolor biosensor via a label-free approach for multiplexed fluorescent detection of DNA. The aggregated perylene derivative exhibits a very high quenching efficiency on all ssDNA-labeled dyes associated with biosensor detection, having efficiency values of 98.3 ± 0.9%, 97 ± 1.1%, and 98.2 ± 0.6% for FAM, TAMRA, and Cy5, respectively. An exonuclease-assisted autocatalytic target recycling amplification was also integrated into the sensing system. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity toward target DNA, resulting in a detection limit of 20 pM, which is about 50-fold lower than that of traditional unamplified homogeneous fluorescent assay methods. The quencher did not interfere with the catalytic activity of nuclease, and the biosensor could be manipulated in either preaddition or postaddition manner with similar sensitivity. Moreover, the proposed sensing system allows for simultaneous and multicolor analysis of several oligonucleotides in homogeneous solution, demonstrating its potential application in the rapid screening of multiple biotargets.

  11. Multiplexed phase-space imaging for 3D fluorescence microscopy.

    Science.gov (United States)

    Liu, Hsiou-Yuan; Zhong, Jingshan; Waller, Laura

    2017-06-26

    Optical phase-space functions describe spatial and angular information simultaneously; examples of optical phase-space functions include light fields in ray optics and Wigner functions in wave optics. Measurement of phase-space enables digital refocusing, aberration removal and 3D reconstruction. High-resolution capture of 4D phase-space datasets is, however, challenging. Previous scanning approaches are slow, light inefficient and do not achieve diffraction-limited resolution. Here, we propose a multiplexed method that solves these problems. We use a spatial light modulator (SLM) in the pupil plane of a microscope in order to sequentially pattern multiplexed coded apertures while capturing images in real space. Then, we reconstruct the 3D fluorescence distribution of our sample by solving an inverse problem via regularized least squares with a proximal accelerated gradient descent solver. We experimentally reconstruct a 101 Megavoxel 3D volume (1010×510×500µm with NA 0.4), demonstrating improved acquisition time, light throughput and resolution compared to scanning aperture methods. Our flexible patterning scheme further allows sparsity in the sample to be exploited for reduced data capture.

  12. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  13. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Science.gov (United States)

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  14. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  15. Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

    Science.gov (United States)

    Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

    2015-01-01

    To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

  16. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  17. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  18. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  19. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

    Science.gov (United States)

    Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

    2008-05-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

  20. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    Science.gov (United States)

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  1. Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

    Science.gov (United States)

    Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

    2002-01-01

    A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

  2. A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

    Science.gov (United States)

    Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

    2011-02-01

    In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  4. Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

    NARCIS (Netherlands)

    Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  5. Screening for circulating RAS/RAF mutations by multiplex digital PCR

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Jakobsen, Anders

    2016-01-01

    by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...

  6. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  8. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  9. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  10. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  11. Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

    Science.gov (United States)

    Jahan, F; Shamsuzzaman, S M; Akter, S

    2014-12-01

    Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

  12. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  13. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  14. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  15. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

    Science.gov (United States)

    Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

    2014-01-01

    Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  16. Multiplexed Detection of Attomoles of Nucleic Acids Using Fluorescent Nanoparticle Counting Platform.

    Science.gov (United States)

    Pei, Xiaojing; Yin, Haoyan; Lai, Tiancheng; Zhang, Junlong; Liu, Feng; Xu, Xiao; Li, Na

    2018-01-16

    The sensitive multiplexed detection of nucleic acids in a single sample by a simple manner is of pivotal importance for the diagnosis and therapy of human diseases. Herein, we constructed an automatic fluorescent nanoparticle (FNP) counting platform with a common fluorescence microscopic imaging setup for nonamplification multiplexed detection of attomoles of nucleic acids. Taking the advantages of the highly bright, multicolor emitting FNPs and magnetic separation, the platform enables sensitive multiplexed detection without the need for extra fluorescent labels. Quantification for multiplex DNAs, multiplex microRNAs (miRNA), as well as a DNA and miRNA mixture was achieved with a similar dynamic range, a limit of detection down to 5 amol (5 μL detection volume), and a 81-115% spike recovery from different biological sample matrices. In particular, the sensitivity for multiplex miRNA is by far among the highest without using amplification or the lock nucleic acid hybridization enhancement strategy. Results regarding miRNA-141 from four different cell lines were agreeable with those of the quantitative reverse transcription polymerase chain reaction. Simultaneous detection of miRNA-141 and miRNA-21 in four different cell lines yielded consistent results with publications, indicating the potential for monitoring multiplex miRNA expression associated with the collaborative regulation of important cellular events. This work expands the rule set of multiplex nucleic acid detection strategies and shows promising potential application in clinical diagnosis.

  17. Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

    Science.gov (United States)

    Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

    2015-05-01

    Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  18. Parallel excitation-emission multiplexed fluorescence lifetime confocal microscopy for live cell imaging.

    Science.gov (United States)

    Zhao, Ming; Li, Yu; Peng, Leilei

    2014-05-05

    We present a novel excitation-emission multiplexed fluorescence lifetime microscopy (FLIM) method that surpasses current FLIM techniques in multiplexing capability. The method employs Fourier multiplexing to simultaneously acquire confocal fluorescence lifetime images of multiple excitation wavelength and emission color combinations at 44,000 pixels/sec. The system is built with low-cost CW laser sources and standard PMTs with versatile spectral configuration, which can be implemented as an add-on to commercial confocal microscopes. The Fourier lifetime confocal method allows fast multiplexed FLIM imaging, which makes it possible to monitor multiple biological processes in live cells. The low cost and compatibility with commercial systems could also make multiplexed FLIM more accessible to biological research community.

  19. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  20. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  1. Multiplex real-time PCR for identification of canine parvovirus antigenic types.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

    2016-07-01

    Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  3. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  4. Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans

    Czech Academy of Sciences Publication Activity Database

    Wicht, B.; Yanagida, T.; Scholz, Tomáš; Ito, A.; Jiménez, J. A.; Brabec, Jan

    2010-01-01

    Roč. 48, č. 9 (2010), s. 3111-3116 ISSN 0095-1137 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR EVIDENCE * PACIFIC SALMON * NIHONKAIENSE * Diphyllobothrium * multiplex PCR * the cytochrome c oxidase subunit 1 * mitochondrial DNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 4.220, year: 2010

  5. Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

    Science.gov (United States)

    Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

    2015-01-01

    Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

  6. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  7. Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad

    2012-01-01

    Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

  8. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  9. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  10. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    Science.gov (United States)

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  11. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  12. Fluorescent genetic barcoding in mammalian cells for enhanced multiplexing capabilities in flow cytometry.

    Science.gov (United States)

    Smurthwaite, Cameron A; Hilton, Brett J; O'Hanlon, Ryan; Stolp, Zachary D; Hancock, Bryan M; Abbadessa, Darin; Stotland, Aleksandr; Sklar, Larry A; Wolkowicz, Roland

    2014-01-01

    The discovery of the green fluorescent protein from Aequorea victoria has revolutionized the field of cell and molecular biology. Since its discovery a growing panel of fluorescent proteins, fluorophores and fluorescent-coupled staining methodologies, have expanded the analytical capabilities of flow cytometry. Here, we exploit the power of genetic engineering to barcode individual cells with genes encoding fluorescent proteins. For genetic engineering, we utilize retroviral technology, which allows for the expression of ectopic genetic information in a stable manner in mammalian cells. We have genetically barcoded both adherent and nonadherent cells with different fluorescent proteins. Multiplexing power was increased by combining both the number of distinct fluorescent proteins, and the fluorescence intensity in each channel. Moreover, retroviral expression has proven to be stable for at least a 6-month period, which is critical for applications such as biological screens. We have shown the applicability of fluorescent barcoded multiplexing to cell-based assays that rely themselves on genetic barcoding, or on classical staining protocols. Fluorescent genetic barcoding gives the cell an inherited characteristic that distinguishes it from its counterpart. Once cell lines are developed, no further manipulation or staining is required, decreasing time, nonspecific background associated with staining protocols, and cost. The increasing number of discovered and/or engineered fluorescent proteins with unique absorbance/emission spectra, combined with the growing number of detection devices and lasers, increases multiplexing versatility, making fluorescent genetic barcoding a powerful tool for flow cytometry-based analysis. © 2013 International Society for Advancement of Cytometry.

  13. Fluorescence-Raman Dual Modal Endoscopic System for Multiplexed Molecular Diagnostics

    Science.gov (United States)

    Jeong, Sinyoung; Kim, Yong-Il; Kang, Homan; Kim, Gunsung; Cha, Myeong Geun; Chang, Hyejin; Jung, Kyung Oh; Kim, Young-Hwa; Jun, Bong-Hyun; Hwang, Do Won; Lee, Yun-Sang; Youn, Hyewon; Lee, Yoon-Sik; Kang, Keon Wook; Lee, Dong Soo; Jeong, Dae Hong

    2015-03-01

    Optical endoscopic imaging, which was recently equipped with bioluminescence, fluorescence, and Raman scattering, allows minimally invasive real-time detection of pathologies on the surface of hollow organs. To characterize pathologic lesions in a multiplexed way, we developed a dual modal fluorescence-Raman endomicroscopic system (FRES), which used fluorescence and surface-enhanced Raman scattering nanoprobes (F-SERS dots). Real-time, in vivo, and multiple target detection of a specific cancer was successful, based on the fast imaging capability of fluorescence signals and the multiplex capability of simultaneously detected SERS signals using an optical fiber bundle for intraoperative endoscopic system. Human epidermal growth factor receptor 2 (HER2) and epidermal growth factor receptor (EGFR) on the breast cancer xenografts in a mouse orthotopic model were successfully detected in a multiplexed way, illustrating the potential of FRES as a molecular diagnostic instrument that enables real-time tumor characterization of receptors during routine endoscopic procedures.

  14. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  15. Post-PCR detection of nucleic acids using metalloporphyrin labels and time-resolved fluorescence

    International Nuclear Information System (INIS)

    O'Shea, Desmond J.; O'Sullivan, Paul J.; Ponomarev, Gelii V.; Papkovsky, Dmitri B.

    2005-01-01

    Phosphorescent platinum(II)-coproporphyrin label (PtCP) was evaluated in post-PCR detection of nucleic acids by time-resolved fluorescence (TR-F) using three common formats. PtCP-labelled oligonucleotide primers and PtCP-dUTP were incorporated in a PCR to produce labelled amplified target -173 or 305 bp DNA. Alternatively, aminoallyl-dUTP was incorporated in a PCR and the product was subsequently labelled with PtCP. The resulting PCR mixtures containing labelled dsDNA were separated on 1.5% agarose gels and then analysed by ethidium bromide staining and by direct detection of PtCP label on a commercial TR-F plate reader Victor 2 (Perkin Elmer Life Sciences) used in scanning mode. In all cases label incorporation and high yields of amplified DNA were observed. Direct TR-F detection of PtCP-labelled DNA from a gel provided high sensitivity and signal to noise ratio, with limits of detection in the range of 9-22 pg for all three formats. The sensitivity achieved with PtCP label was considerably better than that achieved with ethidium bromide staining (∼1 ng of dsDNA) or with conventional fluorescent label FITC. Neither the FITC label nor ethidium bromide staining interfered with PtCP detection, thus allowing multiplexed detection

  16. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  17. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

    Directory of Open Access Journals (Sweden)

    Kor-jent van Dijk

    2014-11-01

    Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

  19. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  20. Genomic Characterization of Flavobacterium psychrophilum Serotypes and Development of a Multiplex PCR-Based Serotyping Scheme

    Directory of Open Access Journals (Sweden)

    Tatiana Rochat

    2017-09-01

    Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.

  1. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Science.gov (United States)

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  2. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  5. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  6. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  7. Development of a multiplex real time PCR to detect thermophilic lactic acid bacteria in natural whey starters.

    Science.gov (United States)

    Bottari, Benedetta; Agrimonti, Caterina; Gatti, Monica; Neviani, Erasmo; Marmiroli, Nelson

    2013-01-01

    A multiplex real time PCR (mRealT-PCR) useful to rapidly screen microbial composition of thermophilic starter cultures for hard cooked cheeses and to compare samples with potentially different technological properties was developed. Novel primers directed toward pheS gene were designed and optimized for multiple detection of Lactobacillus helveticus, Lactobacillus delbrueckii, Streptococcus thermophilus and Lactobacillus fermentum. The assay was based on SYBR Green chemistry followed by melting curves analysis. The method was then evaluated for applications in the specific detection of the 4 lactic acid bacteria (LAB) in 29 different natural whey starters for Parmigiano Reggiano cheese production. The results obtained by mRealT-PCR were also compared with those obtained on the same samples by Fluorescence in Situ Hybridization (FISH) and Length-Heterogeneity PCR (LH-PCR). The mRealT-PCR developed in this study, was found to be effective for analyzing species present in the samples with an average sensitivity down to less than 600 copies of DNA and therefore sensitive enough to detect even minor LAB community members of thermophilic starter cultures. The assay was able to describe the microbial population of all the different natural whey starter samples analyzed, despite their natural variability. A higher number of whey starter samples with S. thermophilus and L. fermentum present in their microbial community were revealed, suggesting that these species could be more frequent in Parmigiano Reggiano natural whey starter samples than previously shown. The method was more effective than LH-PCR and FISH and, considering that these two techniques have to be used in combination to detect the less abundant species, the mRealT-PCR was also faster. Providing a single step sensitive detection of L. helveticus, L. delbrueckii, S. thermophilus and L. fermentum, the developed mRealT-PCR could be used for screening thermophilic starter cultures and to follow the presence of

  8. A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

    Directory of Open Access Journals (Sweden)

    Van Neste Leander

    2012-06-01

    Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

  9. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  10. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  11. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  12. Molecular differentiation of Opisthorchis viverrini and Clonorchis sinensis eggs by multiplex real-time PCR with high resolution melting analysis.

    Science.gov (United States)

    Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Laummaunwai, Porntip; Lulitanond, Viraphong; Doanh, Pham Ngoc; Maleewong, Wanchai

    2013-12-01

    Opisthorchis viverrini and Clonorchis sinensis are parasites known to be carcinogenic and causative agents of cholangiocarcinoma in Asia. The standard method for diagnosis for those parasite infections is stool examination to detect parasite eggs. However, the method has low sensitivity, and eggs of O. viverrini and C. sinensis are difficult to distinguish from each other and from those of some other trematodes. Here, we report a multiplex real-time PCR coupled with high resolution melting (HRM) analysis for the differentiation of O. viverrini and C. sinensis eggs in fecal samples. Using 2 pairs of species-specific primers, DNA sequences from a portion of the mitochondrial NADH dehydrogenase subunit 2 (nad 2) gene, were amplified to generate 209 and 165 bp products for O. viverrini and C. sinensis, respectively. The distinct characteristics of HRM patterns were analyzed, and the melting temperatures peaked at 82.4±0.09℃ and 85.9±0.08℃ for O. viverrini and C. sinensis, respectively. This technique was able to detect as few as 1 egg of O. viverrini and 2 eggs of C. sinensis in a 150 mg fecal sample, which is equivalent to 7 and 14 eggs per gram of feces, respectively. The method is species-specific, rapid, simple, and does not require fluorescent probes or post-PCR processing for discrimination of eggs of the 2 species. It offers a new tool for differentiation and detection of Asian liver fluke infections in stool specimens.

  13. Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

    Science.gov (United States)

    Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

    2017-12-01

    Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

  14. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

    Directory of Open Access Journals (Sweden)

    Whyte Paul

    2008-09-01

    Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

  15. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  16. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  17. Detection of four important Eimeria species by multiplex PCR in a single assay.

    Science.gov (United States)

    You, Myung-Jo

    2014-06-01

    The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  19. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  20. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  2. Fluorescent microarray for multiplexed quantification of environmental contaminants in seawater samples

    Science.gov (United States)

    The development of a fluorescent multiplexed microarray platform able to detect and quantify a wide variety of pollutants in seawater is reported. The microarray platform has been manufactured by spotting 6 different bioconjugate competitors and it uses a cocktail of 6 monoclonal and polyclonal anti...

  3. Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

    DEFF Research Database (Denmark)

    Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

    2009-01-01

    methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...

  4. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

    Science.gov (United States)

    Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

    2013-05-01

    This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

  6. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Directory of Open Access Journals (Sweden)

    Ghalia Boubaker

    Full Text Available Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10 and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3, E. equinus (G4, E. ortleppi (G5, and E. canadensis (G6-G10. The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR allowing three levels of discrimination: (i Echinococcus genus, (ii E. granulosus complex in common, and (iii the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20 and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13. The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%. Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.

  7. Group-specific multiplex PCR detection systems for the identification of flying insect prey.

    Directory of Open Access Journals (Sweden)

    Daniela Sint

    Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

  8. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  9. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  10. Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

    OpenAIRE

    Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

    2011-01-01

    Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

  11. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  12. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  13. Fluorescence-intensity multiplexing: simultaneous seven-marker, two-color immunophenotyping using flow cytometry.

    Science.gov (United States)

    Bradford, Jolene A; Buller, Gayle; Suter, Michael; Ignatius, Michael; Beechem, Joseph M

    2004-10-01

    Conventional immuno-based multiparameter flow cytometric analysis has been limited by the requirement of a dedicated detection channel for each antibody-fluorophore set. To address the need to resolve multiple biological targets simultaneously, flow cytometers with as many as 10-15 detection channels have been developed. In this study, a new Zenon immunolabeling technology is developed that allows for multiple antigen detection per detection channel using a single fluorophore, through a unique method of fluorescence-intensity multiplexing. By varying the Zenon labeling reagent-to-antibody molar ratio, the fluorescence intensity of the antibody-labeled cellular targets can be used as a unique identifier. Although demonstrated in the present study with lymphocyte immunophenotyping, this approach is broadly applicable for any immuno-based multiplexed flow cytomety assay. Lymphocyte immunophenotyping of 38 clinical blood specimens using CD3, CD4, CD8, CD16, CD56, CD19, and CD20 antibodies was performed using conventional flow cytometric analysis and fluorescence-intensity multiplexing analysis. Conventional analysis measures a single antibody-fluorophore per photomultiplier tube (PMT). Fluorescence-intensity multiplex analysis simultaneously measures seven markers with two PMTs, using Zenon labeling reagent-antibody complexes in a single tube: CD19, CD4, CD8, and CD16 antibodies labeled with Zenon Alexa Fluor 488 Mouse IgG(1) labeling reagent and CD56, CD3, and CD20 antibodies labeled with Zenon R-Phycoerythrin (R-PE) Mouse IgG(1) or IgG(2b) labeling reagents. The lymphocyte immunophenotyping results from fluorescence-intensity multiplexing using Zenon labeling reagents in a single tube were comparable to results from conventional flow cytometric analysis. Simultaneous evaluation of multiple antigens using a single fluorophore can be performed using antibodies labeled with varying ratios of a Zenon labeling reagent. Labeling two sets of antibodies with different Zenon

  14. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  15. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  16. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  17. A Multiplex PCR for the Simultaneous Detection and Genotyping of the Echinococcus granulosus Complex

    Science.gov (United States)

    Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A.; Rosenzvit, Mara C.; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2013-01-01

    Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1–G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1–G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6–G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus. PMID:23350011

  18. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Science.gov (United States)

    Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2013-01-01

    Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus.

  19. The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M. R. Keyhkhaee

    2006-07-01

    Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.

  20. Isolation and identification of Enterococcus faecalis from necrotic root canals using multiplex PCR.

    Science.gov (United States)

    Mahmoudpour, Ali; Rahimi, Saeed; Sina, Mahmood; Soroush, Mohammad H; Shahi, Shahriar; Shahisa, Shahriar; Asl-Aminabadi, Naser

    2007-09-01

    This study was designed to survey the incidence of Enterococcus faecalis infection in symptomatic and asymptomatic root canals of necrotic teeth using PCR and to isolate the bacterium for further screening. Sixty patients categorized according to their clinical symptoms were used for sampling by insertion of paper points into the root canals and absorbing all the fluids present within them. The samples were incubated in 1.0 ml 2xYT (containing 16 g bacto tryptone, 10 g yeast extract and 5.0 g NaCl per liter) for 24 h at 37 degrees C without aeration prior to multiplex PCR analysis. To assist the isolation of E. faecalis, sub-samples were further grown in the same medium supplemented with 6.5% NaCl and back-inoculated into bile esculin. Using multiple cultivation-dependent and PCR analyses, 6 cases (10%) of E. faecalis were identified. Four isolates were obtained from asymptomatic cases of chronic apical periodontitis, and the other two were associated with phoenix abscess and acute apical abscess, respectively. No E. faecalis infection was found in 5 patients with acute apical periodontitis or in 9 with chronic suppurative periodontitis. Our results indicate that there is no significant difference in the incidence of E. faecalis between symptomatic and asymptomatic necrotic dental root canals (P > 0.05).

  1. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  2. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  3. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  4. Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

    Science.gov (United States)

    Williams, D Ross; Chanos, Panagiotis

    2012-12-01

    Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

  5. Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed

    Directory of Open Access Journals (Sweden)

    Al-ssum, R. M.

    2010-01-01

    Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.

  6. Development of a multiplex real-time PCR for the simultaneous detection of herpes simplex and varicella zoster viruses in cerebrospinal fluid and lesion swab specimens.

    Science.gov (United States)

    Wong, Anita A; Pabbaraju, Kanti; Wong, Sallene; Tellier, Raymond

    2016-03-01

    Herpes simplex viruses (HSV) and varicella zoster virus (VZV) can have very similar and wide-ranging clinical presentations. Rapid identification is necessary for timely antiviral therapy, especially with infections involving the central nervous system, neonates, and immunocompromised individuals. Detection of HSV-1, HSV-2 and VZV was combined into one real-time PCR reaction utilizing hydrolysis probes. The assay was validated on the LightCycler(®) (Roche) and Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific Inc.) to detect alphaherpesviruses in cerebral spinal fluid (CSF) and lesion swab specimens, respectively. Validation data on blood and tissue samples are also presented. The multiplex assay showed excellent sensitivity, specificity and reproducibility when compared to two singleplex real-time PCR assays for CSF samples and direct fluorescent antigen/culture for lesion swab samples. Implementation of the multiplex assay has facilitated improved sensitivity and accuracy as well as reduced turn-around-times and costs. The results from a large data set of 16,622 prospective samples tested between August 16, 2012 to February 1, 2014 at the Provincial Laboratory for Public Health (Alberta, Canada) are presented here. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Exploiting fluorescence for multiplex immunoassays on protein microarrays

    International Nuclear Information System (INIS)

    Herbáth, Melinda; Balogh, Andrea; Matkó, János; Papp, Krisztián; Prechl, József

    2014-01-01

    Protein microarray technology is becoming the method of choice for identifying protein interaction partners, detecting specific proteins, carbohydrates and lipids, or for characterizing protein interactions and serum antibodies in a massively parallel manner. Availability of the well-established instrumentation of DNA arrays and development of new fluorescent detection instruments promoted the spread of this technique. Fluorescent detection has the advantage of high sensitivity, specificity, simplicity and wide dynamic range required by most measurements. Fluorescence through specifically designed probes and an increasing variety of detection modes offers an excellent tool for such microarray platforms. Measuring for example the level of antibodies, their isotypes and/or antigen specificity simultaneously can offer more complex and comprehensive information about the investigated biological phenomenon, especially if we take into consideration that hundreds of samples can be measured in a single assay. Not only body fluids, but also cell lysates, extracted cellular components, and intact living cells can be analyzed on protein arrays for monitoring functional responses to printed samples on the surface. As a rapidly evolving area, protein microarray technology offers a great bulk of information and new depth of knowledge. These are the features that endow protein arrays with wide applicability and robust sample analyzing capability. On the whole, protein arrays are emerging new tools not just in proteomics, but glycomics, lipidomics, and are also important for immunological research. In this review we attempt to summarize the technical aspects of planar fluorescent microarray technology along with the description of its main immunological applications. (topical review)

  8. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus

    NARCIS (Netherlands)

    E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)

    2010-01-01

    textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus

  9. High throughput multiplex real time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants

    OpenAIRE

    Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.

    2016-01-01

    Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...

  10. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    Science.gov (United States)

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  11. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    Science.gov (United States)

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  12. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  13. Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

    Directory of Open Access Journals (Sweden)

    Zahra Gharibi

    2017-10-01

    Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

  14. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA...

  15. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  16. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  17. Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Alireza Talebi

    2011-09-01

    Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.

  18. Comparison of culture, single and multiplex real-time PCR for detection of Sabin poliovirus shedding in recently vaccinated Indian children.

    Science.gov (United States)

    Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep

    2017-08-01

    Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.

  19. Polarization Multiplexing of Fluorescent Emission Using Multiresonant Plasmonic Antennas.

    Science.gov (United States)

    De Leo, Eva; Cocina, Ario; Tiwari, Preksha; Poulikakos, Lisa V; Marqués-Gallego, Patricia; le Feber, Boris; Norris, David J; Prins, Ferry

    2017-12-26

    Combining the ability to localize electromagnetic fields at the nanoscale with a directional response, plasmonic antennas offer an effective strategy to shape the far-field pattern of coupled emitters. Here, we introduce a family of directional multiresonant antennas that allows for polarization-resolved spectral identification of fluorescent emission. The geometry consists of a central aperture surrounded by concentric polygonal corrugations. By varying the periodicity of each axis of the polygon individually, this structure can support multiple resonances that provide independent control over emission directionality for multiple wavelengths. Moreover, since each resonant wavelength is directly mapped to a specific polarization orientation, spectral information can be encoded in the polarization state of the out-scattered beam. To demonstrate the potential of such structures in enabling simplified detection schemes and additional functionalities in sensing and imaging applications, we use the central subwavelength aperture as a built-in nanocuvette and manipulate the fluorescent response of colloidal-quantum-dot emitters coupled to the multiresonant antenna.

  20. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  1. An ion quencher operated lamp for multiplexed fluorescent bioassays.

    Science.gov (United States)

    Qing, Taiping; Sun, Huanhuan; He, Xiaoxiao; Huang, Xiaoqin; He, Dinggeng; Bu, Hongchang; Qiao, Zhenzhen; Wang, Kemin

    2018-02-01

    A novel and adjustable lamp based on competitive interaction among dsDNA-SYBR Green I (SGI), ion quencher, and analyte was designed for bioanalysis. The "filament" and switch of the lamp could be customized by employing different dsDNA and ion quencher. The poly(AT/TA) dsDNA was successfully screened as the most effective filament of the lamp. Two common ions, Hg 2+ and Fe 3+ , were selected as the model switch, and the corresponding ligand molecules cysteine (Cys) and pyrophosphate ions (PPi) were selected as the targets. When the fluorescence-quenched dsDNA/SGI-ion complex was introduced into a target-containing system, ions could be bound by competitive molecules and separate from the complex, thereby lighting the lamp. However, no light was observed if the biomolecule could not snatch the metal ions from the complex. Under the optimal conditions, sensitive and selective detection of Cys and PPi was achieved by the lamp, with practical applications in fetal bovine serum and human urine. This ion quencher regulated lamp for fluorescent bioassays is simple in design, fast in operation, and is more convenient than other methods. Significantly, as many molecules could form stable complexes with metal ions selectively, this ion quencher operated lamp has potential for the detection of a wide spectrum of analytes. Graphical abstract A novel and adjustable lamp on the basis of competitive interaction among dsDNA-SYBR Green I, ions quencher and analyte was designed for bioanalysis. The filament and switch of lamp could be customized by employing different dsDNA and ions quencher.

  2. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  3. ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.

    Science.gov (United States)

    Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R

    2018-03-09

    Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.

  4. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  5. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

    Science.gov (United States)

    Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz; Gray, Darren J.; Verweij, Jaco J.; Clements, Archie C. A.; Gomes, Santina J.; Traub, Rebecca; McCarthy, James S.

    2016-01-01

    Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%). Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections. Conclusions/Significance Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and

  6. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique.

    Science.gov (United States)

    Ertas, Nurhan; Gonulalan, Zafer; Yildirim, Yeliz; Kum, Erhan

    2010-08-15

    The aim of this study was to investigate the presence of Staphylococcus aureus (S. aureus) and staphylococcal enterotoxins (SEs) genes in sheep cheese and dairy dessert samples by multiplex PCR (mPCR) technique. A total of 150 samples were analyzed consisting of 50 dairy dessert samples and 100 sheep cheese. Coagulase positive staphylococci (CPS) were found in 86 (57.3%) out of 150 analyzed samples. S. aureus were isolated from 60 (60%), 26 (52%) of sheep cheese and from of dairy desserts, respectively. Five suspected colonies were tested from each sheep cheese and dairy dessert samples for phenotypic and genotypic characterizations. A total of 430 isolates from the 86 positive samples were investigated in this study. Eighty (18.6%) isolates were characterized as S. aureus. The enterotoxin genes (sea, seb, sec, sed) were found in 13 (3.02%) out of 80 isolates. From cheese isolates, sea, seb and sed were detected in 5 (1.6%), 2 (0.6%), 1 (0.3%), respectively. From dairy dessert isolates, sea, sec and sed were detected in 3 (2.3%), 1 (0.76%), 1 (0.76%), respectively. The presence of SEs was identified in 12 (2.8%) out of 80 isolates by using ELISA technique. It was determined that these SEs had a distribution of 7 (1.6%) SEA, 2 (0.46%) SEB, 1 (0.23%) SEC, and 2 (0.46%) SED. SEs were found in 7 (2.3%) cheese and 5 (3.8%) dairy dessert isolates. In conclusion, S.aureus and their SEs were found to be present in sheep cheese and dairy desserts in this study. It is emphasized that the presence of S. aureus and their SEs genes in sheep cheese and dairy desserts may be regarded as a potential risk for human health. Copyright 2010 Elsevier B.V. All rights reserved.

  7. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Directory of Open Access Journals (Sweden)

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  8. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

    Science.gov (United States)

    Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

    2015-06-15

    Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.

    Science.gov (United States)

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-12-01

    Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.

  10. Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

    Science.gov (United States)

    del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

    2007-02-01

    Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

  11. Detection of Human Bocavirus DNA by Multiplex PCR Analysis: Postmortem Case Report

    Directory of Open Access Journals (Sweden)

    Nihan Ziyade

    2015-06-01

    Full Text Available Background: Human bocavirus (HBoV is a virus belonging to the Parvoviridae family, which has been newly discovered to be associated with respiratory tract infections in children. There are many reports worldwide on the endemicity of this virus. Since it is relatively new, it is not routinely detected in clinical laboratory investigations. Case Report: We demonstrated that HBoV infection caused the death of a 5-month-old girl with a history of high fever and wheezing. Human bocavirus (HBoV 1/2/3/4 was found in a nasopharyngeal swab, paraffin-embedded lung tissue and stool samples by multiplex PCR methods using postmortem microbiological analysis. Conclusion: This case suggests that lower respiratory tract infections due to HBoV may cause severe and life-threatening diseases. Postmortem microbiology is useful in both clinical and forensic autopsies, and allows a suspected infection to be confirmed. To our knowledge, this report is the first document of a HBoV postmortem case in Turkey.

  12. Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.

    Science.gov (United States)

    Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C

    2015-04-01

    Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).

  13. Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

    Directory of Open Access Journals (Sweden)

    Rahimi M.T.

    2016-09-01

    Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

  14. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  16. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....

  17. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  18. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Science.gov (United States)

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  19. A Multiplex PCR for Simultaneous Detection of Three Zoonotic Parasites Ancylostoma ceylanicum, A. caninum, and Giardia lamblia Assemblage A

    Directory of Open Access Journals (Sweden)

    Wei Hu

    2015-01-01

    Full Text Available Ancylostoma ceylanicum, A. caninum, and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats; they can also infect humans, causing parasitic zoonoses. In this study, a multiplex PCR method was developed for simultaneous identification and detection of those three zoonotic parasites. Three pairs of specific primers were designed based on ITS sequence of A. ceylanicum and A. caninum and TPI gene of G. lamblia available in the GenBank. The multiplex PCR reaction system was established by optimizing the reaction condition, and a series of tests on the sensitivity, specificity, and clinical application were also conducted. Results showed that three target fragments were amplified specifically; the detection limit was 10 eggs for both A. ceylanicum and A. caninum, 72 pg DNA for G. lamblia. Of 112 clinical fecal samples, 34.8% and 17.8% samples were positive for A. caninum and A. ceylanicum, respectively, while only 2.7% samples were positive for G. lamblia assemblage A. It is concluded that the established multiplex PCR assay is a convenient, rapid, cost-effective, and high-efficiency method for molecular detection and epidemiological investigation of three zoonotic parasites.

  20. Multiplex PCR for specific and robust detection of Xanthomonas campestris pv. musacearum in pure culture and infected plant material

    DEFF Research Database (Denmark)

    Adriko, John; Aritua, V.; Mortensen, Carmen Nieves

    2012-01-01

    The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...

  1. [Application of multiplex PCR for the screening of genotyping system for the rare blood groups Fy(a-), s-,k-,Di(b-) and Js(b-)].

    Science.gov (United States)

    Jiao, Wei; Xie, Li; Li, Hailan; Lan, Jiao; Mo, Zhuning; Yang, Ziji; Liu, Fei; Xiao, Ruiping; He, Yunlei; Ye, Luyi; Zhu, Ziyan

    2014-04-01

    To screen rare blood groups Fy(a-), s-, k-, Di(b-) and Js(b-) in an ethnic Zhuang population. Sequence-specific primers were designed based on single nucleotide polymorphism (SNP) sites of blood group antigens Fy(b) and s. A specific multiplex PCR system I was established. Multiplex PCR system II was applied to detect alleles antigens Di(b), k, Js(b)1910 and Js(b) 2019 at the same time. The two systems was were used to screen for rare blood group antigens in 4490 randomly selected healthy donors of Guangxi Zhuang ethnic origin. We successfully made the multiplex PCR system I. We detected the rare blood group antigens using the two PCR system. There are five Fy(a-), three s(-), two Di(b-) in 4490 Guangxi zhuang random samples. The multiplex PCR system I has achieved good accuracy and stability. With multiplex PCR systems I and II, 4490 samples were screened. Five Fy(a-), three s(-) and two Di(b-) samples were discovered. Multiplex PCR is an effective methods, which can be used for high throughput screening of rare blood groups. The rare blood types of Guangxi Zhuang ethnic origin obtained through the screening can provide valuable information for compatible blood transfusion. Through screening we obtained precious rare blood type materials which can be used to improve the capability of compatible infusion and reduce the transfusion reactions.

  2. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    Science.gov (United States)

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  3. Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

    DEFF Research Database (Denmark)

    Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

    2007-01-01

    , multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

  4. Multiplex and high-throughput DNA detection using surface plasmon mediated fluorescence

    Science.gov (United States)

    Mei, Zhong

    The overall objective of this research project was to develop a user-friendly and sensitive biosensor for nucleic acid aptamers with multiplexing and high-throughput capability. The sensing was based on the fluorescence signals emitted by the fluorophores coupling with plamonic nanoparticle (gold nanorod) deposited on a patterned substrate. Gold nanorods (GNRs) were synthesized using a binary mixture of hexadecyltrimethylammonium bromide (CTAB) and sodium oleate (NaOL) in seed mediated growth method. Polytetrafluoroethylene (PTFE) printed glass slides were selectively coated with a gold thin-film to define hydrophilic areas for GNR deposition. Due to the wettablity contrast, GNR solution dropped on the slide was induced to assemble exclusively in the hydrophilic spots. By controlling temperature and humidity of the evaporation process, vertically-standing GNR arrays were achieved on the pattered slide. Fluorescence was conjugated to GNR surface via DNA double strand with tunable length. Theoretical simulation predicted a flat layer ( 30 nm thick) of uniform "hot spots" presented on the GNR tips, which could modify the nearby fluorescence. Experimentally, the vertical GNR arrays yielded metallic enhanced fluorescence (MEF) effect, which was dependent on the spectrum overlap and GNR-fluorophore distance. Specifically, the maximum enhancement of Quasar 670 and Alexa 750 was observed when it was coupled with GNR664 (plasmonic wavelength 664 nm) and GNR778 respectively at a distance of 16 nm, while the carboxyfluorescein (FAM) was at maximal intensity when attached to gold nanosphere520. This offers an opportunity for multiplexed DNA sensing. Based on this, we developed a novel GNR mediated fluorescence biosensor for DNA detection. Fluorescence labeled haipin-DNA probes were introduced to designated spots of GNR array with the matching LSPR wavelengths on the substrate. The fluorescence was quenched originally because of Forster resonance energy transfer (FRET) effect

  5. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  6. Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

    Science.gov (United States)

    Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

    2009-07-01

    The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

  7. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Science.gov (United States)

    Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent

    2016-01-01

    Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  8. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Directory of Open Access Journals (Sweden)

    Cengiz Ikten

    Full Text Available Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.. Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  9. Novel multiplex PCR reveals multiple trypanosomatid species infecting North American bumble bees (Hymenoptera: Apidae: Bombus).

    Science.gov (United States)

    Tripodi, Amber D; Szalanski, Allen L; Strange, James P

    2018-03-01

    Crithidia bombi and Crithidia expoeki (Trypanosomatidae) are common parasites of bumble bees (Bombus spp.). Crithidia bombi was described in the 1980s, and C. expoeki was recently discovered using molecular tools. Both species have cosmopolitan distributions among their bumble bee hosts, but there have been few bumble bee studies that have identified infections to species since the original description of C. expoeki in 2010. Morphological identification of species is difficult due to variability within each stage of their complex lifecycles, although they can be easily differentiated through DNA sequencing. However, DNA sequencing can be expensive, particularly with many samples to diagnose. In order to reliably and inexpensively distinguish Crithidia species for a large-scale survey, we developed a multiplex PCR protocol using species-specific primers with a universal trypanosomatid primer set to detect unexpected relatives. We applied this method to 356 trypanosomatid-positive bumble bees from North America as a first-look at the distribution and host range of each parasite in the region. Crithidia bombi was more common (90.2%) than C. expoeki (21.3%), with most C. expoeki-positive samples existing as co-infections with C. bombi (13.8%). This two-step detection method also revealed that 2.2% samples were positive for trypanosmatids that were neither C. bombi nor C. expoeki. Sequencing revealed that two individuals were positive for C. mellificae, one for Lotmaria passim, and three for two unclassified trypanosomatids. This two-step method is effective in diagnosing known bumble bee infecting Crithidia species, and allowing for the discovery of unknown potential symbionts. Published by Elsevier Inc.

  10. Rapid detection and strain typing of Chlamydia trachomatis using a highly multiplexed microfluidic PCR assay.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.

  11. Virus reactivations after autologous hematopoietic stem cell transplantation detected by multiplex PCR assay.

    Science.gov (United States)

    Inazawa, Natsuko; Hori, Tsukasa; Nojima, Masanori; Saito, Makoto; Igarashi, Keita; Yamamoto, Masaki; Shimizu, Norio; Yoto, Yuko; Tsutsumi, Hiroyuki

    2017-02-01

    Several studies have indicated that viral reactivations following allogeneic hematopoietic stem cell transplantation (allo-HSCT) are frequent, but viral reactivations after autologous HSCT (auto-HSCT) have not been investigated in detail. We performed multiplex polymerase chain reaction (PCR) assay to examine multiple viral reactivations simultaneously in 24 patients undergoing auto-HSCT between September 2010 and December 2012. Weekly whole blood samples were collected from pre- to 42 days post-HSCT, and tested for the following 13 viruses; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, adeno virus (ADV), BK virus (BKV), JC virus (JCV), parvovirus B19 (B19V), and hepatitis B virus (HBV).  Fifteen (63%) patients had at least one type of viral reactivation. HHV6 (n = 10; 41.7%) was most frequently detected followed by EBV (n = 7; 29.2%). HHV-6 peaked on day 21 after HSCT and promptly declined. In addition, HBV, CMV, HHV7, and B19V were each detected in one patient. HHV6 reactivation was detected in almost half the auto-HSCT patients, which was similar to the incidence in allo-HSCT patients. The incidence of EBV was unexpectedly high. Viral infections in patients undergoing auto-HSCT were higher than previously reported in other studies. Although there were no particular complications of viral infection, we should pay attention to possible viral reactivations in auto-HSCT patients. J. Med. Virol. 89:358-362, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  13. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  14. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  15. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    Science.gov (United States)

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  16. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  17. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience.

    Science.gov (United States)

    Nielsen, Alex Christian Yde; Böttiger, Blenda; Midgley, Sofie Elisabeth; Nielsen, Lars Peter

    2013-11-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay. The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses in 171 (8%) and 66 (3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause similar clinical symptoms. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

    Science.gov (United States)

    Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

    2010-09-01

    The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

  19. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    Directory of Open Access Journals (Sweden)

    Hirohito Ogawa

    Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  20. Multiplex real-time PCR assays for detection of eight Shiga toxin-producing Escherichia coli in food samples by melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2015-12-23

    Shiga toxin-producing Escherichia coli (STEC) are pathogenic strains of E. coli that can cause bloody diarrhea and kidney failure. Seven STEC serogroups, O157, O26, O45, O103, O111, O121 and O145 are responsible for more than 71% of the total infections caused by this group of pathogens. All seven serogroups are currently considered as adulterants in non-intact beef products in the U.S. In this study, two multiplex melt curve real-time PCR assays with internal amplification controls (IACs) were standardized for the detection of eight STEC serogroups. The first multiplex assay targeted E. coli serogroups O145, O121, O104, and O157; while the second set detected E. coli serogroups O26, O45, O103 and O111. The applicability of the assays was tested using 11 different meat and produce samples. For food samples spiked with a cocktail of four STEC serogroups with a combined count of 10 CFU/25 g food, all targets of the multiplex assays were detected after an enrichment period of 6h. The assays also worked efficiently when 325 g of food samples were spiked with 10 CFU of STECs. The assays are not dependent on fluorescent-labeled probes or immunomagnetic beads, and can be used for the detection of eight STEC serogroups in less than 11h. Routine preliminary screening of STECs in food samples is performed by testing for the presence of STEC virulence genes. The assays developed in this study can be useful as a first- or second-tier test for the identification of the eight O serogroup-specific genes in suspected food samples. Copyright © 2015. Published by Elsevier B.V.

  1. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  2. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  3. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  4. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...

  6. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  7. High-throughput screening of hybridoma supernatants using multiplexed fluorescent cell barcoding on live cells.

    Science.gov (United States)

    Lu, Mei; Chan, Brian M; Schow, Peter W; Chang, Wesley S; King, Chadwick T

    2017-12-01

    With current available assay formats using either immobilized protein (ELISA, enzyme-linked immunosorbent assay) or immunostaining of fixed cells for primary monoclonal antibody (mAb) screening, researchers often fail to identify and characterize antibodies that recognize the native conformation of cell-surface antigens. Therefore, screening using live cells has become an integral and important step contributing to the successful identification of therapeutic antibody candidates. Thus the need for developing high-throughput screening (HTS) technologies using live cells has become a major priority for therapeutic mAb discovery and development. We have developed a novel technique called Multiplexed Fluorescent Cell Barcoding (MFCB), a flow cytometry-based method based upon the Fluorescent Cell Barcoding (FCB) technique and the Luminex fluorescent bead array system, but is applicable to high-through mAb screens on live cells. Using this technique in our system, we can simultaneously identify or characterize the antibody-antigen binding of up to nine unique fluorescent labeled cell populations in the time that it would normally take to process a single population. This has significantly reduced the amount of time needed for the identification of potential lead candidates. This new technology enables investigators to conduct large-scale primary hybridoma screens using flow cytometry. This in turn has allowed us to screen antibodies more efficiently than before and streamline identification and characterization of lead molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    Science.gov (United States)

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  9. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  10. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  11. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization.

    Science.gov (United States)

    Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can

    2009-06-08

    A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.

  12. Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

    Directory of Open Access Journals (Sweden)

    Chang Chieh-Ting

    2008-06-01

    Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

  13. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  14. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari

    2010-10-01

    A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.

  15. Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea

    DEFF Research Database (Denmark)

    Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni

    2017-01-01

    and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. Methods: A real-time multiplex PCR method with internal inhibition control...... microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Conclusions: Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof...

  16. Instrumentation and Fluorescent Chemistries Used in qPCR

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Trine

    2012-01-01

    will be discussed from a user perspective leading to an instrument selection guide. Differences between fluorescent DNA binding dyes and target-specific fluorescently labeled primers or probes for detection of amplicon accumulation will be discussed, along with the properties and applications of the most frequently...

  17. Fluorescently labelled multiplex lateral flow immunoassay based on cadmium-free quantum dots.

    Science.gov (United States)

    Beloglazova, Natalia V; Sobolev, Aleksander M; Tessier, Mickael D; Hens, Zeger; Goryacheva, Irina Yu; De Saeger, Sarah

    2017-03-01

    A sensitive tool for simultaneous qualitative detection of two mycotoxins based on use of non-cadmium quantum dots (QDs) is presented for the first time. QDs have proven themselves as promising fluorescent labels for biolabeling and chemical analysis. With an increasing global tendency to regulate and limit the use of hazardous elements, indium phosphide (InP) QDs are highlighted as environmentally-friendly alternatives to the highly efficient and well-studied, but potentially toxic Cd- and Pb-based QDs. Here, we developed water-soluble InP QDs-based fluorescent nanostructures. They consisted of core/shell InP/ZnS QDs enrobed in a silica shell that allowed the water solubility (QD@SiO 2 ). Then we applied the QD@SiO 2 as novel, silica shell-encapsulated fluorescent labels in immunoassays for rapid multiplexed screening. Two mycotoxins, zearalenone and deoxynivalenol, were simultaneously detected in maize and wheat, since the two QD@SiO 2 labelled conjugates emit at two different, individually detectable wavelengths. The cutoff values for the simultaneous determination were 50 and 500μgkg -1 for zearalenone and deoxynivalenol, respectively, in both maize and wheat. Liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) was used to confirm the result. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  19. Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

    Science.gov (United States)

    Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

    2017-08-01

    A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  1. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

    NARCIS (Netherlands)

    Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

    2005-01-01

    Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

  2. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  4. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    Directory of Open Access Journals (Sweden)

    Neng Chen

    2014-07-01

    Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.

  5. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  7. Evaluation of a PCR multiplex for detection and differentiation of Mycoplasma synoviae, M. gallisepticum, and M. gallisepticum strain F-vaccine

    Directory of Open Access Journals (Sweden)

    Elena Mettifogo

    2015-01-01

    Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.

  8. Detection of gene copy number aberrations in mantle cell lymphoma by a single quantitative multiplex PCR assay: clinicopathological relevance and prognosis value.

    Science.gov (United States)

    Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé

    2009-09-01

    The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.

  9. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  10. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  11. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  12. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  13. Fluorescence quantitative PCR in detection of HBV DNA

    International Nuclear Information System (INIS)

    Shen Zheng; Li Ming; Shen Xia

    2003-01-01

    Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease

  14. Detection of Mycobacterium chelonae, Mycobacterium abscessus Group, and Mycobacterium fortuitum Complex by a Multiplex Real-Time PCR Directly from Clinical Samples Using the BD MAX System.

    Science.gov (United States)

    Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond

    2017-03-01

    A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  15. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  16. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  17. Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of -Thalassemia

    Directory of Open Access Journals (Sweden)

    Raquel M. Fernández

    2013-01-01

    Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.

  18. Evidence of presence of Mycobacterium tuberculosis in bovine tissue samples by multiplex PCR: possible relevance to reverse zoonosis.

    Science.gov (United States)

    Mittal, M; Chakravarti, S; Sharma, V; Sanjeeth, B S; Churamani, C P; Kanwar, N S

    2014-04-01

    Bovine tuberculosis, caused by Mycobacterium bovis, remains one of the most important zoonotic health concerns worldwide. The transmission of Mycobacterium tuberculosis from humans to animals also occurs especially in countries where there is close interaction of humans with the animals. In the present study, thirty bovine lung tissue autopsy samples from an organized dairy farm located in North India were screened for the presence of Mycobacterium tuberculosis complex by smear microscopy, histopathological findings and PCR. Differential diagnosis of M. tuberculosis and M. bovis was made based on the deletion of mce-3 operon in M. bovis. The present study found eight of these samples positive for M. tuberculosis by multiplex PCR. Sequencing was performed on two PCR-positive representative samples and on annotation, and BLAST analysis confirmed the presence of gene fragment specific to Mycobacterium tuberculosis. The presence of M. tuberculosis in all the positive samples raises the possibility of human-to-cattle transmission and possible adaptation of this organism in bovine tissues. This study accentuates the importance of screening and differential diagnosis of Mycobacterium tuberculosis complex in humans and livestock for adopting effective TB control and eradication programmes. © 2014 Blackwell Verlag GmbH.

  19. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  20. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  3. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  4. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    Science.gov (United States)

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  6. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  7. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

    DEFF Research Database (Denmark)

    Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz

    2016-01-01

    Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission...... of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity...... of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two...

  8. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  9. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency

    International Nuclear Information System (INIS)

    Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael

    2014-01-01

    The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)

  10. Laser Capture Microdissection and Multiplex-Tandem PCR Analysis of Proximal Tubular Epithelial Cell Signaling in Human Kidney Disease

    Science.gov (United States)

    Wilkinson, Ray; Wang, Xiangju; Kassianos, Andrew J.; Zuryn, Steven; Roper, Kathrein E.; Osborne, Andrew; Sampangi, Sandeep; Francis, Leo; Raghunath, Vishwas; Healy, Helen

    2014-01-01

    Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD) but emerging evidence is now linking many forms of acute kidney disease (AKD) with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC) are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate “real time” gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i) confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii) provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii) identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv) describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue. PMID:24475278

  11. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  12. Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

    Science.gov (United States)

    Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

    2017-06-01

    Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Development of a qualitative, multiplex real-time PCR kit for screening of genetically modified organisms (GMOs).

    Science.gov (United States)

    Dörries, Hans-Henno; Remus, Ivonne; Grönewald, Astrid; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2010-03-01

    The number of commercially available genetically modified organisms (GMOs) and therefore the diversity of possible target sequences for molecular detection techniques are constantly increasing. As a result, GMO laboratories and the food production industry currently are forced to apply many different methods to reliably test raw material and complex processed food products. Screening methods have become more and more relevant to minimize the analytical effort and to make a preselection for further analysis (e.g., specific identification or quantification of the GMO). A multiplex real-time PCR kit was developed to detect the 35S promoter of the cauliflower mosaic virus, the terminator of the nopaline synthase gene of Agrobacterium tumefaciens, the 35S promoter from the figwort mosaic virus, and the bar gene of the soil bacterium Streptomyces hygroscopicus as the most widely used sequences in GMOs. The kit contains a second assay for the detection of plant-derived DNA to control the quality of the often processed and refined sample material. Additionally, the plant-specific assay comprises a homologous internal amplification control for inhibition control. The determined limits of detection for the five assays were 10 target copies/reaction. No amplification products were observed with DNAs of 26 bacterial species, 25 yeasts, 13 molds, and 41 not genetically modified plants. The specificity of the assays was further demonstrated to be 100% by the specific amplification of DNA derived from reference material from 22 genetically modified crops. The applicability of the kit in routine laboratory use was verified by testing of 50 spiked and unspiked food products. The herein described kit represents a simple and sensitive GMO screening method for the reliable detection of multiple GMO-specific target sequences in a multiplex real-time PCR reaction.

  14. Multiplex PCR in determination of Opiinae parasitoids of fruit flies, Bactrocera sp., infesting star fruit and guava.

    Science.gov (United States)

    Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S

    2014-01-23

    Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an

  15. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  16. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  17. Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

    Directory of Open Access Journals (Sweden)

    Maryam Dehghani

    2017-02-01

    Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

  18. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  19. Clinical Application of a Multiplex Real-Time PCR Assay for Simultaneous Detection of Legionella Species, Legionella pneumophila, and Legionella pneumophila Serogroup 1

    OpenAIRE

    Benitez, Alvaro J.; Winchell, Jonas M.

    2014-01-01

    We developed a single-tube multiplex real-time PCR assay capable of simultaneously detecting and discriminating Legionella spp., Legionella pneumophila, and Legionella pneumophila serogroup 1 in primary specimens. Evaluation of 21 clinical specimens and 115 clinical isolates demonstrated this assay to be a rapid, high-throughput diagnostic test with 100% specificity that may aid during legionellosis outbreaks and epidemiologic investigations.

  20. Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats.

    Science.gov (United States)

    Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang

    2003-09-01

    A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.

  1. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

    DEFF Research Database (Denmark)

    Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

    2018-01-01

    Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

  2. A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

    NARCIS (Netherlands)

    Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

    2007-01-01

    Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

  3. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  4. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.

  5. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Multiplex PCR, amplicon size and hybridization efficiency on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez, Juan J; Morling, Niels

    2004-01-01

    We tested the SNP typing protocol developed for the NanoChip electronic microarray by analyzing the four Y chromosome loci SRY1532, SRY8299, TAT, and 92R7. Amplicons of different lengths containing the same locus were purified and addressed to the NanoChip array and fluorescently labelled reporte...

  7. Multiplex competitive microbead-based flow cytometric immunoassay using quantum dot fluorescent labels

    International Nuclear Information System (INIS)

    Yu, Hye-Weon; Kim, In S.; Niessner, Reinhard; Knopp, Dietmar

    2012-01-01

    Highlights: ► First time, duplex competitive bead-based flow cytometric immunoassay was developed using ODs. ► Antibody-coated QD detection probes and antigen-immobilized microspheres were synthesized. ► The two model target analytes were low molecular weight compounds of microbial and chemical origin. ► The determination of different water types was possible after simple filtration of samples. - Abstract: In answer to the ever-increasing need to perform the simultaneous analysis of environmental hazards, microcarrier-based multiplex technologies show great promise. Further integration with biofunctionalized quantum dots (QDs) creates new opportunities to extend the capabilities of multicolor flow cytometry with their unique fluorescence properties. Here, we have developed a competitive microbead-based flow cytometric immunoassay using QDs fluorescent labels for simultaneous detection of two analytes, bringing the benefits of sensitive, rapid and easy-of-manipulation analytical tool for environmental contaminants. As model target compounds, the cyanobacterial toxin microcystin-LR and the polycyclic aromatic hydrocarbon compound benzo[a]pyrene were selected. The assay was carried out in two steps: the competitive immunological reaction of multiple targets using their exclusive sensing elements of QD/antibody detection probes and antigen-coated microsphere, and the subsequent flow cytometric analysis. The fluorescence of the QD-encoded microsphere was thus found to be inversely proportional to target analyte concentration. Under optimized conditions, the proposed assay performed well within 30 min for the identification and quantitative analysis of the two environmental contaminants. For microcystin-LR and benzo[a]pyrene, dose–response curves with IC 50 values of 5 μg L −1 and 1.1 μg L −1 and dynamic ranges of 0.52–30 μg L −1 and 0.13–10 μg L −1 were obtained, respectively. Recovery was 92.6–106.5% for 5 types of water samples like bottled

  8. An Evaluation of Quantitative PCR Assays (TaqMan® and SYBR Green for the Detection of Babesia bigemina and Babesia bovis, and a Novel Fluorescent-ITS1-PCR Capillary Electrophoresis Method for Genotyping B. bovis Isolates

    Directory of Open Access Journals (Sweden)

    Bing Zhang

    2016-09-01

    Full Text Available Babesia spp. are tick-transmitted haemoparasites causing tick fever in cattle. In Australia, economic losses to the cattle industry from tick fever are estimated at AUD$26 Million per annum. If animals recover from these infections, they become immune carriers. Here we describe a novel multiplex TaqMan qPCR targeting cytochrome b genes for the identification of Babesia spp. The assay shows high sensitivity, specificity and reproducibility, and allows quantification of parasite DNA from Babesia bovis and B. bigemina compared to standard PCR assays. A previously published cytochrome b SYBR Green qPCR was also tested in this study, showing slightly higher sensitivity than the Taqman qPCRs but requires melting curve analysis post-PCR to confirm specificity. The SYBR Green assays were further evaluated using both diagnostic submissions and vaccinated cattle (at 7, 9, 11 and 14 days post-inoculation showed that B. bigemina can be detected more frequently than B. bovis. Due to fewer circulating parasites, B. bovis detection in carrier animals requires higher DNA input. Preliminary data for a novel fluorescent PCR genotyping based on the Internal Transcribed Spacer 1 region to detect vaccine and field alleles of B. bovis are described. This assay is capable of detecting vaccine and novel field isolate alleles in a single sample.

  9. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  10. A novel RT-multiplex PCR for enteroviruses, hepatitis A and E viruses and influenza A virus among infants and children with diarrhea in Vietnam.

    Science.gov (United States)

    Phan, T G; Nguyen, T A; Yan, H; Okitsu, S; Ushijima, H

    2005-06-01

    A novel reverse transcription-multiplex polymerase chain reaction (RT-multiplex PCR) assay that can detect enteroviruses, hepatitis A and E viruses and influenza A virus from various hosts (avian species, human, swine and horse) was developed. The identification of that group of viruses was performed with the mixture of four pairs of published specific primers (F1 and R1, P3 and P4, 2s and 2as, MMU42 and MMU43) for amplifying viral genomes and specifically generated four different amplicon sizes of 440, 267, 146 and 219 bp for enteroviruses, hepatitis A and E viruses and influenza A virus, respectively. A total of 276 fecal specimens (previously screened for rotavirus, adenovirus, norovirus, sapovirus and astrovirus-negative) from infants and children admitted into hospital with acute gastroenteritis in Ho Chi Minh city, Vietnam during October 2002 and September 2003 were collected and further tested for the presence of those viruses by RT-multiplex PCR. Enteroviruses were identified in 27 specimens and this represented 9.8%. No hepatitis A and E viruses and influenza A virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were also assessed and demonstrated the strong validation against RT-monoplex PCR. Taken together, the findings clearly indicated that this novel RT-multiplex PCR is a simple and potential assay for rapid, sensitive, specific and cost-effective laboratory diagnosis to investigate molecular epidemiology of acute gastroenteritis caused by enteroviruses, hepatitis A and E viruses and influenza A virus. This report is the first, to our knowledge, detecting these kinds of viruses in diarrheal feces from infants and children in Vietnam.

  11. Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

    Science.gov (United States)

    Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

    2017-01-01

    A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

  12. A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.

    Science.gov (United States)

    Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S

    2011-12-01

    Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Reliability and short-term intra-individual variability of telomere length measurement using monochrome multiplexing quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Sangmi Kim

    Full Text Available Studies examining the association between telomere length and cancer risk have often relied on measurement of telomere length from a single blood draw using a real-time PCR technique. We examined the reliability of telomere length measurement using sequential samples collected over a 9-month period.Relative telomere length in peripheral blood was estimated using a single tube monochrome multiplex quantitative PCR assay in blood DNA samples from 27 non-pregnant adult women (aged 35 to 74 years collected in 7 visits over a 9-month period. A linear mixed model was used to estimate the components of variance for telomere length measurements attributed to variation among women and variation between time points within women. Mean telomere length measurement at any single visit was not significantly different from the average of 7 visits. Plates had a significant systematic influence on telomere length measurements, although measurements between different plates were highly correlated. After controlling for plate effects, 64% of the remaining variance was estimated to be accounted for by variance due to subject. Variance explained by time of visit within a subject was minor, contributing 5% of the remaining variance.Our data demonstrate good short-term reliability of telomere length measurement using blood from a single draw. However, the existence of technical variability, particularly plate effects, reinforces the need for technical replicates and balancing of case and control samples across plates.

  14. Simple and highly discriminatory VNTR-based multiplex PCR for tracing sources of Aspergillus flavus isolates.

    Directory of Open Access Journals (Sweden)

    Dong Ying Wang

    Full Text Available Aspergillus flavus is second only to A. fumigatus in causing invasive aspergillosis and it is the major agent responsible for fungal sinusitis, keratitis and endophthalmitis in many countries in the Middle East, Africa and Southeast Asia. Despite the growing challenge due to A. flavus, data on the molecular epidemiology of this fungus remain scarce. The objective of the present study was to develop a new typing method based on the detection of VNTR (Variable number tandem repeat markers. Eight VNTR markers located on 6 different chromosomes (1, 2, 3, 5, 7 and 8 of A. flavus were selected, combined by pairs for multiplex amplifications and tested on 30 unrelated isolates and six reference strains. The Simpson index for individual markers ranged from 0.398 to 0.818. A combined loci index calculated with all the markers yielded an index of 0.998. The MLVA (Multiple Locus VNTR Analysis technique proved to be specific and reproducible. In a second time, a total of 55 isolates from Chinese avian farms and from a Tunisian hospital have been evaluated. One major cluster of genotypes could be defined by using the graphing algorithm termed Minimum Spanning Tree. This cluster comprised most of the isolates collected in an avian farm in southern China. The MLVA technique should be considered as an excellent and cost-effective typing method that could be used in many laboratories without the need for sophisticated equipment.

  15. Epidemiological survey on Mycoplasma gallisepticum and M. synoviae by multiplex PCR in commercial poultry Investigação epidemiológica de Mycoplasma gallisepticum e M. synoviae por PCR Multiplex em estabelecimentos comerciais de aves

    Directory of Open Access Journals (Sweden)

    Marcos Roberto Buim

    2009-07-01

    Full Text Available Mycoplasmas are important avian pathogens, which cause respiratory and joint diseases that result in large economic losses in Brazilian and world-wide poultry industry. This investigation regarding the main species of mycoplasmas, Mycoplasma gallisepticum (MG and M. synoviae (MS, responsible for the above mentioned conditions, was carried out through PCR Multiplex analysis. One thousand and forty-six (1,046 samples of tracheal swabs and piped embryos were collected from 33 farms with laying hens, breeders, broilers or hatchery, located in the Brazilian states of São Paulo, Paraná and Pernambuco, where respiratory problems or drops in egg production had occurred. The MG and MS prevalence on the farms was 72.7%. These results indicated (1 high dissemination of mycoplasmas in the evaluated farms, with predominance of MS, either as single infectious agent or associated with other mycoplasmas in 20 farms (60.6%, and (2 an increase of MS and decrease of MG infection in Brazilian commercial poultry.Os Micoplasmas são importantes patógenos aviários que causam doenças respiratórias e de articulações que resultam em grandes perdas econômicas para a indústria avícola brasileira e mundial. O estudo das principais espécies de Mycoplasma, Mycoplasma gallisepticum (MG e M. synoviae (MS, responsáveis pelas doenças mencionadas acima, foram analisadas pela técnica de PCR Multiplex. Foram colhidas 1046 amostras de suabe traqueal e embriões bicados de 33 estabelecimentos de aves de postura, matrizes, frangos de corte e um incubatório, localizados nos Estados brasileiros de São Paulo, Paraná e Pernambuco, as quais apresentavam problemas respiratórios ou queda na produção de ovos. A prevalência de MS e MG nas granjas foi de 72,7%. Os resultados indicaram uma alta disseminação de Mycoplasma nas granjas avaliadas, com predominância de MS, como um único agente infeccioso ou associado com outros micoplasmas em 20 granjas (60,6%. Assim, este

  16. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  17. Development of a multiplex methylation-specific PCR as candidate triage test for women with an HPV-positive cervical scrape

    International Nuclear Information System (INIS)

    Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM

    2012-01-01

    Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions

  18. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  19. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  20. A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

    Directory of Open Access Journals (Sweden)

    Brisabois Anne

    2011-06-01

    Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

  1. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

    2012-01-01

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  2. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  3. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  4. A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

    Science.gov (United States)

    Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

    2018-04-01

    Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

  5. Fluorescent Quantification of DNA Based on Core-Shell Fe3O4@SiO2@Au Nanocomposites and Multiplex Ligation-Dependent Probe Amplification.

    Science.gov (United States)

    Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue

    2015-02-01

    In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.

  6. Monitoring the Various Types of Clostridium botulinumin in Four Kinds of Food Stuffs Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Vahid Sadeghi Sarvestani

    2014-03-01

    Full Text Available Background &Objective: Food poisoning (FP caused by C. botulinum is the most serious feature of FP inpeople consuming the contaminated foodstuffs (Canned meat, vegetarian foods, dairy products and seafood products. Botulism is basically detected by the identification of live bacteria and/or its toxins. Among various types of microorganisms (i.e. A, B, C1, C2, D, E, F, serotypes A, B, E and F are considered as the main human pathogens. The present study was aimed at investigating the possible roles of various foodstuffs to induce the food intoxication and also to compare the culture and molecular assays for identifying the microorganism.Materials &Methods: Three Lab techniques including biochemical, culture (enriched in TPGY and cooked meat medium and MPCR were used to detect C. botulinum in the samples. As the molecular based techniques have recently employed for the rapid and reliable identification of the bacteria and its toxins, the PCR assay, using three pairs of primers were designed and optimized to identify A, B and E strains in the contaminated specimens. The PCR was able to amplify 782, 205 and 389 bp genes specified for A, B and E types of the bacteria, respectively. Results: Total number of 290 specimens including fish, honey,"kashk"and"Dough" were tested, in which 5%, 4%, 2.5% and 1.25%, were found positive, respectively. Using selective culture of the specimens on the enriched samples, it was shown that just four samples were found positive.Conclusion: As a final conclusion, the molecular based techniques are recommended as a reliable tool to detect C. botulinum and, its toxins and spores in foodstuffs. Moreover, it is strongly advised to use it in food microbial Lab and also the epidemiological surveys.

  7. Multiplex real-time PCR for the detection and quantification of latent and persistent viral genomes in cellular or plasma blood fractions.

    Science.gov (United States)

    Compston, Lara Isobel; Sarkobie, Francis; Li, Chengyao; Candotti, Daniel; Opare-Sem, Ohene; Allain, Jean-Pierre

    2008-07-01

    In common with latent viruses such as herpesviruses, parvovirus B19, HBV and GBV-C are contained successfully by the immune response and persist in the host. When immune control breaks down, reactivation of both latent and persistent viruses occurs. Two multiplex assays were developed (B19, HBV, HHV-8), (EBV, CMV, VZV) for blood screening, and tested on blood donor samples from Ghana to determine baseline prevalence of viraemia in immunocompetent persons. Single-virus real-time quantitative PCR (qPCR) assays were optimised for viral load determination of positive initial screening. The qPCR method utilised was absolute quantification with external standards. Multiplex and single-virus qPCR assays had similar sensitivity, except for the B19 assay in which sensitivity was 100-fold lower. Assays were optimised for reproducibility and repeatability, with R(2) of 0.9 being obtained for most assays. With the exception of B19 and CMV, assays had 100% detection limit ranging between 10(1) and 10(2) copies, IU or arbitrary units under single-virus and multiplex assay conditions. The prevalence of viraemia was 1.6% HBV (0.8% DNA+/HBsAg-, 0.8% DNA+/HBsAg+), 0.8% parvovirus B19, and 3.3% GBV-C viraemia in the plasma fraction. The prevalence of four herpesviruses was 1.0% HHV-8, 0.85% CMV, and 8.3% EBV, and no detectable VZV viraemia.

  8. A Multiplex PCR/LDR Assay for the Simultaneous Identification of Category A Infectious Pathogens: Agents of Viral Hemorrhagic Fever and Variola Virus.

    Directory of Open Access Journals (Sweden)

    Sanchita Das

    Full Text Available CDC designated category A infectious agents pose a major risk to national security and require special action for public health preparedness. They include viruses that cause viral hemorrhagic fever (VHF syndrome as well as variola virus, the agent of smallpox. VHF is characterized by hemorrhage and fever with multi-organ failure leading to high morbidity and mortality. Smallpox, a prior scourge, has been eradicated for decades, making it a particularly serious threat if released nefariously in the essentially non-immune world population. Early detection of the causative agents, and the ability to distinguish them from other pathogens, is essential to contain outbreaks, implement proper control measures, and prevent morbidity and mortality. We have developed a multiplex detection assay that uses several species-specific PCR primers to generate amplicons from multiple pathogens; these are then targeted in a ligase detection reaction (LDR. The resultant fluorescently-labeled ligation products are detected on a universal array enabling simultaneous identification of the pathogens. The assay was evaluated on 32 different isolates associated with VHF (ebolavirus, marburgvirus, Crimean Congo hemorrhagic fever virus, Lassa fever virus, Rift Valley fever virus, Dengue virus, and Yellow fever virus as well as variola virus and vaccinia virus (the agent of smallpox and its vaccine strain, respectively. The assay was able to detect all viruses tested, including 8 sequences representative of different variola virus strains from the CDC repository. It does not cross react with other emerging zoonoses such as monkeypox virus or cowpox virus, or six flaviviruses tested (St. Louis encephalitis virus, Murray Valley encephalitis virus, Powassan virus, Tick-borne encephalitis virus, West Nile virus and Japanese encephalitis virus.

  9. A Multiplex PCR/LDR Assay for the Simultaneous Identification of Category A Infectious Pathogens: Agents of Viral Hemorrhagic Fever and Variola Virus.

    Science.gov (United States)

    Das, Sanchita; Rundell, Mark S; Mirza, Aashiq H; Pingle, Maneesh R; Shigyo, Kristi; Garrison, Aura R; Paragas, Jason; Smith, Scott K; Olson, Victoria A; Larone, Davise H; Spitzer, Eric D; Barany, Francis; Golightly, Linnie M

    2015-01-01

    CDC designated category A infectious agents pose a major risk to national security and require special action for public health preparedness. They include viruses that cause viral hemorrhagic fever (VHF) syndrome as well as variola virus, the agent of smallpox. VHF is characterized by hemorrhage and fever with multi-organ failure leading to high morbidity and mortality. Smallpox, a prior scourge, has been eradicated for decades, making it a particularly serious threat if released nefariously in the essentially non-immune world population. Early detection of the causative agents, and the ability to distinguish them from other pathogens, is essential to contain outbreaks, implement proper control measures, and prevent morbidity and mortality. We have developed a multiplex detection assay that uses several species-specific PCR primers to generate amplicons from multiple pathogens; these are then targeted in a ligase detection reaction (LDR). The resultant fluorescently-labeled ligation products are detected on a universal array enabling simultaneous identification of the pathogens. The assay was evaluated on 32 different isolates associated with VHF (ebolavirus, marburgvirus, Crimean Congo hemorrhagic fever virus, Lassa fever virus, Rift Valley fever virus, Dengue virus, and Yellow fever virus) as well as variola virus and vaccinia virus (the agent of smallpox and its vaccine strain, respectively). The assay was able to detect all viruses tested, including 8 sequences representative of different variola virus strains from the CDC repository. It does not cross react with other emerging zoonoses such as monkeypox virus or cowpox virus, or six flaviviruses tested (St. Louis encephalitis virus, Murray Valley encephalitis virus, Powassan virus, Tick-borne encephalitis virus, West Nile virus and Japanese encephalitis virus).

  10. A Multiplex PCR assay to differentiate between dog and red fox.

    Science.gov (United States)

    Weissenberger, M; Reichert, W; Mattern, R

    2011-11-01

    Foxes are frequently the cause of car accidents in Baden-Württemberg (BW, Germany). The domestic dog (Canis familiaris) is in close relation to the red fox (Vulpes vulpes) and the silver fox which is a coat colour variant of the red fox. As insurance claims that involve accidents with animals require authentication, we analyzed frequency distribution and allele sizes in two canine microsatellite loci in 26 dogs (different breeds) and 19 red foxes of the region of BW, Germany. Moreover, sequencing analysis was performed. Red foxes exhibited only 1 allele at each microsatellite locus, whereas in dog 7 alleles at the CPH4 locus and 6 alleles at the CPH12 locus were detected. Sequences of PCR products from the two species revealed several differences between dogs and foxes. We established a sequenced allelic ladder and give population data from dogs and red foxes from the region of BW, Germany. Using microsatellite polymorphisms is efficient in differentiating between dogs and foxes in forensic casework. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Quantitation of Marek's disease and chicken anemia viruses in organs of experimentally infected chickens and commercial chickens by multiplex real-time PCR.

    Science.gov (United States)

    Davidson, Irit; Raibshtein, I; Al-Touri, A

    2013-06-01

    The worldwide distribution of chicken anemia virus (CAV) and Marek's disease virus (MDV) is well documented. In addition to their economic significance in single- or dual-virus infections, the two viruses can often accompany various other pathogens and affect poultry health either directly, by causing tumors, anemia, and delayed growth, or indirectly, by aggravating other diseases, as a result of their immunosuppressive effects. After a decade of employing the molecular diagnosis of those viruses, which replaced conventional virus isolation, we present the development of a real-time multiplex PCR for the simultaneous detection of both viruses. The real-time PCRs for MDV and for CAV alone are more sensitive than the respective end-point PCRs. In addition, the multiplex real-time shows a similar sensitivity when compared to the single real-time PCR for each virus. The newly developed real-time multiplex PCR is of importance in terms of the diagnosis and detection of low copies of each virus, MDV and CAV in single- and in multiple-virus infections, and its applicability will be further evaluated.

  12. Combination of microbiological culture and multiplex PCR increases the range of vaginal microorganisms identified in cervical cancer patients at high risk for bacterial vaginosis and vaginitis.

    Science.gov (United States)

    Schmidt, Katarzyna; Cybulski, Zefiryn; Roszak, Andrzej; Grabiec, Alicja; Talaga, Zofia; Urbański, Bartosz; Odważna, Joanna; Wojciechowicz, Jacek

    2015-05-01

    Bacterial vaginosis (BV) and vaginitis in cervical cancer patients might becaused by mixed aerobic, anaerobic, and atypical bacteria. Since genital tract infections can be complicated, early and accurate identification of causal pathogens is vital. The purpose of this study was i) to determinate if currently used aerobic culture methods are sufficiently sensitive to identify pathogens that can appear in the cervix of women after cancer treatment; ii) to investigate if molecular methods can improve the diagnostic process of BV and vaginitis, as well as broaden the range of detectable pathogens that would otherwise be difficult to cultivate. A one-year hospital-based study was conducted in 2011/2012. Cervical swabs from 130 patients were examined by microbiological culture and multiplex PCR. Swab samples were positive for 107 and 93 women by microbiological culture and multiplex PCR, respectively The most common bacteria isolated from culture were: Escherichia coli, Enterococcus faecalis, Streptococcus agalactiae, and Staphylococcus aureus, and using the molecular technique were: Gardnerella vaginalis, Bacteroides fragilis, Ureoplasma ureoliticum/parvum, Mobiluncus curtisii and Atopobium vaginae. Multiplex PCR might contribute to the diagnosis of genital tract infections and it broadens the number of detectable microorganisms responsible for BV. Combination of these two methods may become the basis for standardized diagnosis of BV and vaginitis.

  13. High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants.

    Science.gov (United States)

    Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N

    2016-05-01

    To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.

  14. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  15. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  16. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  17. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    Science.gov (United States)

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  18. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    Science.gov (United States)

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  19. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

    Directory of Open Access Journals (Sweden)

    Valeria Velasco

    Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

  20. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  1. 1-Million droplet array with wide-field fluorescence imaging for digital PCR.

    Science.gov (United States)

    Hatch, Andrew C; Fisher, Jeffrey S; Tovar, Armando R; Hsieh, Albert T; Lin, Robert; Pentoney, Stephen L; Yang, David L; Lee, Abraham P

    2011-11-21

    Digital droplet reactors are useful as chemical and biological containers to discretize reagents into picolitre or nanolitre volumes for analysis of single cells, organisms, or molecules. However, most DNA based assays require processing of samples on the order of tens of microlitres and contain as few as one to as many as millions of fragments to be detected. Presented in this work is a droplet microfluidic platform and fluorescence imaging setup designed to better meet the needs of the high-throughput and high-dynamic-range by integrating multiple high-throughput droplet processing schemes on the chip. The design is capable of generating over 1-million, monodisperse, 50 picolitre droplets in 2-7 minutes that then self-assemble into high density 3-dimensional sphere packing configurations in a large viewing chamber for visualization and analysis. This device then undergoes on-chip polymerase chain reaction (PCR) amplification and fluorescence detection to digitally quantify the sample's nucleic acid contents. Wide-field fluorescence images are captured using a low cost 21-megapixel digital camera and macro-lens with an 8-12 cm(2) field-of-view at 1× to 0.85× magnification, respectively. We demonstrate both end-point and real-time imaging ability to perform on-chip quantitative digital PCR analysis of the entire droplet array. Compared to previous work, this highly integrated design yields a 100-fold increase in the number of on-chip digitized reactors with simultaneous fluorescence imaging for digital PCR based assays.

  2. One-Step Multiplex RT-qPCR Assay for the detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

    International Nuclear Information System (INIS)

    Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.

    2016-01-01

    Full text: Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%–4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  3. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

    Directory of Open Access Journals (Sweden)

    Tirumala Bharani Kumar Settypalli

    Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  4. Evaluation of two real-time multiplex PCR screening assays detecting fetal RHD in plasma from RhD negative women to ascertain the requirement for antenatal RhD prophylaxis

    DEFF Research Database (Denmark)

    Clausen, Frederik Banch; Krog, Grethe Risum; Rieneck, Klaus

    2011-01-01

    and 5. We used the same fluorescent dye for the exon 7 and 10 probes to increase sensitivity; exon 5 was VIC labeled. We evaluated possible inhibition of DNA amplification with dilution experiments. We then tested the two multiplex assays with DNA extracted from 97 plasma samples from 38 RhD negative......OBJECTIVE: To evaluate two different multiplex real-time PCR assays detecting fetal RHD for screening of RhD negative women in relation to antenatal RhD prophylaxis. METHODS: We designed a duplex assay for the detection of RHD exon 7 and 10 and a triplex assay for the detection of RHD exon 7, 10...... assay (exon 7/10), accuracy was 94.2%. Detection of exon 5 was less reliable. CONCLUSION: The duplex assay using exon 7/10 was the most reliable for prenatal prediction of fetal RhD type as a candidate assay for screening of RhD negative women in relation to antenatal RhD prophylaxis. The triplex assay...

  5. Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

    Science.gov (United States)

    Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R

    2018-03-23

    Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  6. Clinical applicability and prognostic significance of molecular response assessed by fluorescent-PCR of immunoglobulin genes in multiple myeloma. Results from a GEM/PETHEMA study.

    Science.gov (United States)

    Martinez-Lopez, Joaquin; Fernández-Redondo, Elena; García-Sánz, Ramón; Montalbán, María Angeles; Martínez-Sánchez, Pilar; Pavia, Bruno; Mateos, María Victoria; Rosiñol, Laura; Martín, Marisa; Ayala, Rosa; Martínez, Rafael; Blanchard, María Jesus; Alegre, Adrian; Besalduch, Joan; Bargay, Joan; Hernandez, Miguel T; Sarasquete, María Eugenia; Sanchez-Godoy, Pedro; Fernández, Manuela; Blade, Joan; San Miguel, Jesús F; Lahuerta, Juan Jose

    2013-12-01

    Minimal residual disease monitoring is becoming increasingly important in multiple myeloma (MM), but multiparameter flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) techniques are not routinely available. This study investigated the prognostic influence of achieving molecular response assessed by fluorescent-PCR (F-PCR) in 130 newly diagnosed MM patients from Grupo Español Multidisciplinar de Melanoma (GEM)2000/GEM05 trials (NCT00560053, NCT00443235, NCT00464217) who achieved almost very good partial response after induction therapy. As a reference, we used the results observed with simultaneous MFC. F-PCR at diagnosis was performed on DNA using three different multiplex PCRs: IGH D-J, IGK V-J and KDE rearrangements. The applicability of F-PCR was 91·5%. After induction therapy, 64 patients achieved molecular response and 66 non-molecular response; median progression-free survival (PFS) was 61 versus 36 months, respectively (P = 0·001). Median overall survival (OS) was not reached (NR) in molecular response patients (5-year survival: 75%) versus 66 months in the non-molecular response group (P = 0·03). The corresponding PFS and OS values for patients with immunophenotypic versus non-immunophenotypic response were 67 versus 42 months (P = 0·005) and NR (5-year survival: 95%) versus 69 months (P = 0·004), respectively. F-PCR analysis is a rapid, affordable, and easily performable technique that, in some circumstances, may be a valid approach for minimal residual disease investigations in MM. © 2013 John Wiley & Sons Ltd.

  7. Molecular identification of Pseudoplatystoma sp. fish fillets by Multiplex PCR / Identificação molecular de filés de peixe Pseudoplatystoma sp. por PCR-Multiplex

    Directory of Open Access Journals (Sweden)

    Cátia Maria de Oliveira Lobo

    2014-08-01

    Full Text Available Nuclear and mitochondrial genes were used as molecular markers for verifying the iden-tity of fish fillets marketed as pintado (Pseudoplatystoma corruscans. Based on THE polymorphisms of nuclear DNA (RAG2, globin, and EF1 genes and mitochondrial regions (16S, we examined whether the fillets originated from inbred species of pintado or from hybrids derived from crosses between cachara (P. reticulatum and pintado. Nuclear genes from both species were detected in the analyzed fillets (n = 29. This clearly iden-tified these fish as interspecific hybrids (or F1/first filial generation of the type “cacha-pinta,” resulting from a cross between female cachara and male pintado. These results demonstrate that monitoring fish fillet trading is crucial for detecting discrepancies between the marketed species and related information declared on the label. Species that are frequently hybridized, such as pintado and cachara, require special attention. -------------------------------------------------------------------- Marcadores moleculares (PCR-Multiplex de genes nucleares e mitocondriais foram uti-lizados para verificar a identidade molecular de filés de peixe comercializados como pintado (Pseudoplatystoma corruscans com base em polimorfismos de regiões do DNA nuclear (genes RAG2, globina e EF1 e mitocondriais (16S para verificar se os filés per-tenciam a espécie pura de pintado ou se eram híbridos derivados do cruzamento entre cachara (Pseudoplatystoma reticulatum e pintado (Pseudoplatystoma corruscans. Os filés analisados (n = 29 apresentaram genes nucleares de ambas espécies P. corruscans e P. reticulatum, e desta forma, foram identificados como híbridos interespecíficos ou F1 (primeira geração filial do tipo “cachapinta” resultante do cruzamento entre uma fêmea de cachara e um macho de pintado. Estes resultados mostram que o monitora-mento da comercialização de filés de peixe é fundamental para identificar situações onde

  8. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  9. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  10. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  11. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  12. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

  13. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  14. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  15. Prevalence of Eimeria spp. in Broilers by Multiplex PCR in the Southern Region of Brazil on Two Hundred and Fifty Farms.

    Science.gov (United States)

    Moraes, Julio Cesar; França, Marciél; Sartor, Amélia Aparecida; Bellato, Valdomiro; de Moura, Anderson Barbosa; de Lourdes Borba Magalhães, Maria; de Souza, Antonio Pereira; Miletti, Luiz Claudio

    2015-06-01

    Parasitic infections caused by Eimeria species are responsible for most economic losses in poultry production. Prevalence studies can adequately assist the design of prophylaxis strategies for disease control. Therefore, stool samples from 251 flocks of broilers from 28 to 48 days old were collected in 21 municipalities in the state of Santa Catarina, Brazil, to detect and examine the prevalence of Eimeria acervulina, Eimeria maxima, Eimeria tenella, Eimeria mitis, Eimeria praecox, Eimeria necatrix, and Eimeria brunetti. The oocysts were recovered and quantified, and the species were identified by a multiplex PCR technique. Amplicons of seven Eimeria species originating from the PCR-positive samples were cloned. Microscopy studies demonstrated that 96% of the farms were positive for the Eimeria. Seven species were identified, as follows: E. maxima (63.7%) and E. acervulina (63.3%) were the most prevalent species, followed by E. tenella (54.6%), E. mitis (38.6%), E. praecox (25.1%), E. necatrix (24.3%), and E. brunetti (13.1%). The average number of species detected per farm was 2.96, and the most common were E. acervulina, E. maxima, and E. tenella (9.16%). The sequencing of the clones confirmed the specificity and effectiveness of multiplex PCR for the identification of seven species of Eimeria, so this tool can be useful in studying circulating species in poultry farms, thereby assisting prophylactic measures against coccidiosis.

  16. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  17. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  18. Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

    Science.gov (United States)

    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

    2013-08-01

    Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

  19. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  20. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

    2010-12-03

    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

  1. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina

    2010-12-01

    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

  2. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  3. Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites.

    Science.gov (United States)

    Hamoy, I G; Santos, E J M; Santos, S E B

    2008-01-22

    The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.

  4. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    Science.gov (United States)

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  5. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacteria and Viruses in Pepper and Tomato Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.

  6. Synthetic internal control sequences to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

    Science.gov (United States)

    Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...

  7. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

    Science.gov (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

    2013-10-01

    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea.

    Science.gov (United States)

    Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni; Ursing, Johan; Rombo, Lars; Kofoed, Poul-Erik; Kantele, Anu

    2017-09-01

    In developing countries, diarrhoea is the most common cause of death for children under five years of age, with Giardia lamblia, Cryptosporidium and Entamoeba histolytica as the most frequent pathogenic parasites. Traditional microscopy for stool parasites has poor sensitivity and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. A real-time multiplex PCR method with internal inhibition control was developed for detecting Giardia lamblia, Cryptosporidium hominis/parvum and Entamoeba histolytica directly from stool specimens. Applicability to dried samples was checked by comparing with fresh ones in a small test material. Finally, the assay was applied to dried specimens collected from Guinea-Bissauan children with diarrhoea. The PCR's analytical sensitivity limit was 0.1 ng/ml for G. lamblia DNA, 0.01 ng/ml for E. histolytica DNA and 0.1 ng/ml for Cryptosporidium sp. In the test material, the assay performed similarly with fresh and dried stools. Of the 52 Guinea-Bissauan samples, local microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof of concept, it worked well on stools collected from Guinea-Bissauan children with diarrhoea. It provides an epidemiological tool for analysing dried specimens from regions poor in resources.

  9. Multiplexed fluorescent microarray for human salivary protein analysis using polymer microspheres and fiber-optic bundles.

    Science.gov (United States)

    Nie, Shuai; Benito-Peña, Elena; Zhang, Huaibin; Wu, Yue; Walt, David R

    2013-10-10

    Herein, we describe a protocol for simultaneously measuring six proteins in saliva using a fiber-optic microsphere-based antibody array. The immuno-array technology employed combines the advantages of microsphere-based suspension array fabrication with the use of fluorescence microscopy. As described in the video protocol, commercially available 4.5 μm polymer microspheres were encoded into seven different types, differentiated by the concentration of two fluorescent dyes physically trapped inside the microspheres. The encoded microspheres containing surface carboxyl groups were modified with monoclonal capture antibodies through EDC/NHS coupling chemistry. To assemble the protein microarray, the different types of encoded and functionalized microspheres were mixed and randomly deposited in 4.5 μm microwells, which were chemically etched at the proximal end of a fiber-optic bundle. The fiber-optic bundle was used as both a carrier and for imaging the microspheres. Once assembled, the microarray was used to capture proteins in the saliva supernatant collected from the clinic. The detection was based on a sandwich immunoassay using a mixture of biotinylated detection antibodies for different analytes with a streptavidin-conjugated fluorescent probe, R-phycoerythrin. The microarray was imaged by fluorescence microscopy in three different channels, two for microsphere registration and one for the assay signal. The fluorescence micrographs were then decoded and analyzed using a homemade algorithm in MATLAB.

  10. Development of a multiplex qPCR in real time for quantification and differential diagnosis of Salmonella Gallinarum and Salmonella Pullorum.

    Science.gov (United States)

    Rubio, Marcela da Silva; Penha Filho, Rafael Antonio Casarin; Almeida, Adriana Maria de; Berchieri, Angelo

    2017-12-01

    Currently there are 2659 Salmonella serovars. The host-specific biovars Salmonella Pullorum and Salmonella Gallinarum cause systemic infections in food-producing and wild birds. Fast diagnosis is crucial to control the dissemination in avian environments. The present work describes the development of a multiplex qPCR in real time using a low-cost DNA dye (SYBr Green) to identify and quantify these biovars. Primers were chosen based on genomic regions of difference (RoD) and optimized to control dimers. Primers pSGP detect both host-specific biovars but not other serovars and pSG and pSP differentiate biovars. Three amplicons showed different melting temperatures (Tm), allowing differentiation. The pSGP amplicon (97 bp) showed Tm of 78°C for both biovars. The pSG amplicon (273 bp) showed a Tm of 86.2°C for S. Gallinarum and pSP amplicon (260 bp) dissociated at 84.8°C for S. Pullorum identification. The multiplex qPCR in real time showed high sensitivity and was capable of quantifying 10 8 -10 1 CFU of these biovars.

  11. Development of a multiplex PCR assay for fine-scale population genetic analysis of the Komodo monitor Varanus komodoensis based on 18 polymorphic microsatellite loci.

    Science.gov (United States)

    Ciofi, Claudio; Tzika, Athanasia C; Natali, Chiara; Watts, Phillip C; Sulandari, Sri; Zein, Moch S A; Milinkovitch, Michel C

    2011-05-01

    Multiplex PCR assays for the coamplification of microsatellite loci allow rapid and cost-effective genetic analyses and the production of efficient screening protocols for international breeding programs. We constructed a partial genomic library enriched for di-nucleotide repeats and characterized 14 new microsatellite loci for the Komodo monitor (or Komodo dragon, Varanus komodoensis). Using these novel microsatellites and four previously described loci, we developed multiplex PCR assays that may be loaded on a genetic analyser in three separate panels. We tested the novel set of microsatellites for polymorphism using 69 individuals from three island populations and evaluated the resolving power of the entire panel of 18 loci by conducting (i) a preliminary assignment test to determine population(s) of origin and (ii) a parentage analysis for 43 captive Komodo monitors. This panel of polymorphic loci proved useful for both purposes and thus can be exploited for fine-scale population genetic analyses and as part of international captive breeding programs directed at maintaining genetically viable ex situ populations and reintroductions. © 2011 Blackwell Publishing Ltd.

  12. Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

    Science.gov (United States)

    Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

    2017-08-01

    We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  13. Development of a multiplex real-time PCR assay for detection of human enteric viruses other than norovirus using samples collected from gastroenteritis patients in Fukui Prefecture, Japan.

    Science.gov (United States)

    Kowada, Kazuaki; Takeuchi, Kenji; Hirano, Eiko; Toho, Miho; Sada, Kiyonao

    2018-01-01

    There are many varieties of gastroenteritis viruses, of which norovirus (NoV) accounts for over 90% of the viral food poisoning incidents in Japan. However, protocols for rapidly identifying other gastroenteritis viruses need to be established to investigate NoV-negative cases intensively. In this study, a multiplex real-time PCR assay targeting rotavirus A, rotavirus C, sapovirus, astrovirus, adenovirus, and enterovirus was developed using stool samples collected from gastroenteritis patients between 2010 and 2013 in Fukui Prefecture, Japan. Of the 126 samples collected sporadically from pediatric patients with suspected infectious gastroenteritis, 51 were positive for non-NoV target viruses, whereas 27 were positive for NoV, showing a high prevalence of non-NoV viruses in pediatric patients. In contrast, testing in 382 samples of 58 gastroenteritis outbreaks showed that non-NoV viruses were detected in 13 samples, with NoV in 267. Of the 267 NoV-positive patients, only two were co-infected with non-NoV target viruses, suggesting that testing for non-NoV gastroenteritis viruses in NoV-positive samples was mostly unnecessary in outbreak investigations. Given these results, multiplex real-time PCR testing for non-NoV gastroenteritis viruses, conducted separately from NoV testing, may be helpful to deal with two types of epidemiological investigations, regular surveillance of infectious gastroenteritis and urgent testing when gastroenteritis outbreaks occur. © 2017 Wiley Periodicals, Inc.

  14. Application of multiplex PCR approaches for shark molecular identification: feasibility and applications for fisheries management and conservation in the Eastern Tropical Pacific.

    Science.gov (United States)

    Caballero, S; Cardeñosa, D; Soler, G; Hyde, J

    2012-03-01

    Here we describe the application of new and existing multiplex PCR methodologies for shark species molecular identification. Four multiplex systems (group ID, thresher sharks, hammerhead sharks and miscellaneous shark) were employed with primers previously described and some designed in this study, which allow for species identification after running PCR products through an agarose gel. This system was implemented for samples (bodies and fins) collected from unidentified sharks landed in the port of Buenaventura and from confiscated tissues obtained from illegal fishing around the Malpelo Island Marine Protected Area, Pacific Coast of Colombia. This method has allowed reliable identification, to date, of 407 samples to the genus and/or species levels, most of them (380) identified as the pelagic thresher shark (Alopias pelagicus). Another seven samples were identified as scalloped hammerhead sharks (Sphyrna lewini). This is an easy-to-implement and reliable identification method that could even be used locally to monitor shark captures in the main fishing ports of developed and developing countries. © 2011 Blackwell Publishing Ltd.

  15. A multiplex, internally controlled real-time PCR assay for detection of toxigenic Clostridium difficile and identification of hypervirulent strain 027/ST-1

    DEFF Research Database (Denmark)

    Hoegh, A M; Nielsen, J B; Lester, A

    2012-01-01

    The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...

  16. Multiplex Real-Time PCR Assay Using TaqMan Probes for the Identification of Trypanosoma cruzi DTUs in Biological and Clinical Samples

    Science.gov (United States)

    Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.

    2015-01-01

    Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316

  17. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  18. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

    Science.gov (United States)

    Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

    2014-07-01

    A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

  19. Simultaneous fitting of real-time PCR data with efficiency of amplification modeled as Gaussian function of target fluorescence

    Directory of Open Access Journals (Sweden)

    Lazar Andreas

    2008-02-01

    Full Text Available Abstract Background In real-time PCR, it is necessary to consider the efficiency of amplification (EA of amplicons in order to determine initial target levels properly. EAs can be deduced from standard curves, but these involve extra effort and cost and may yield invalid EAs. Alternatively, EA can be extracted from individual fluorescence curves. Unfortunately, this is not reliable enough. Results Here we introduce simultaneous non-linear fitting to determine – without standard curves – an optimal common EA for all samples of a group. In order to adjust EA as a function of target fluorescence, and still to describe fluorescence as a function of cycle number, we use an iterative algorithm that increases fluorescence cycle by cycle and thus simulates the PCR process. A Gauss peak function is used to model the decrease of EA with increasing amplicon accumulation. Our approach was validated experimentally with hydrolysis probe or SYBR green detection with dilution series of 5 different targets. It performed distinctly better in terms of accuracy than standard curve, DART-PCR, and LinRegPCR approaches. Based on reliable EAs, it was possible to detect that for some amplicons, extraordinary fluorescence (EA > 2.00 was generated with locked nucleic acid hydrolysis probes, but not with SYBR green. Conclusion In comparison to previously reported approaches that are based on the separate analysis of each curve and on modelling EA as a function of cycle number, our approach yields more accurate and precise estimates of relative initial target levels.

  20. A new multiplex real-time TaqMan® PCR for quantification of Mycoplasma hyopneumoniae, M. hyorhinis and M. flocculare: Exploratory epidemiological investigations to research mycoplasmal association in enzootic pneumonia-like lesions in slaughtered pigs.

    Science.gov (United States)

    Fourour, Sarah; Fablet, Christelle; Tocqueville, Véronique; Dorenlor, Virginie; Eono, Florent; Eveno, Eric; Kempf, Isabelle; Marois-Créhan, Corinne

    2018-03-30

    A new multiplex qPCR targeting Mycoplasma (M.) hyopneumoniae, M. hyorhinis and M. flocculare was developed and the relationship between the detection of those mycoplasma species and the extent of gross pneumonia like lesions in slaughtered pigs lungs were investigated. The multiplex qPCR method targets the p102, p37 and fruA genes and has detection limits of 14, 146, and 16 genome equivalents μl -1 for M. hyopneumoniae, M. hyorhinis and M. flocculare, respectively. In all, 671 lungs were collected and analysed, among them 666 were scored for macroscopic pneumonia and categorized according to the extent of the lesions (no or minor lesions, moderate lesions, and extensive lesions). According to results of multiplex qPCR, 59.5% were positive for M. hyopneumoniae, 3.4% for M. hyorhinis and 34.7% for M. flocculare, with on average, 3.1x10 7 , 9.7x10 6 and 5.7x10 6 genome equivalents of mycoplasma ml -1 , respectively. More results showed that no or minor lesions were associated with multiplex qPCR-negative results or qPCR-positive results for M. flocculare. Moderate to extensive lesions were positively correlated with qPCR-positive results for M. hyopneumoniae. Extensive lesions were associated with qPCR-positive results for at least two mycoplasma species (M. hyopneumoniae and M. hyorhinis). The findings also indicated that M. hyopneumoniae and M. hyorhinis significantly increased the odds for a lung to have macroscopic pneumonia. No relationship was found between the extent of lesions and the mycoplasma genome load. This new multiplex qPCR appears to be specific, sufficiently sensitive and repeatable. The validation of this method with field samples guarantees its use for field epidemiological investigations, particularly to gain more insight into the etiology of the porcine respiratory disease complex. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. A novel, multiplexed, probe-based quantitative PCR assay for the soybean root- and stem-rot pathogen, Phytophthora sojae, utilizes its transposable element.

    Science.gov (United States)

    Haudenshield, James S; Song, Jeong Y; Hartman, Glen L

    2017-01-01

    Phytophthora root rot of soybean [Glycine max (L.) Merr.] is caused by the oomycete Phytophthora sojae (Kaufm. & Gerd.). P. sojae has a narrow host range, consisting primarily of soybean, and it is a serious pathogen worldwide. It exists in root and stem tissues as mycelium, wherein it can form oospores which subsequently germinate to release motile, infectious zoospores. Molecular assays detecting DNA of P. sojae are useful in disease diagnostics, and for determining the presence of the organism in host tissues, soils, and runoff or ponded water from potentially infested fields. Such assays as published have utilized ITS sequences from the nuclear ribosomal RNA genes in conventional PCR or dye-binding quantitative PCR (Q-PCR) but are not amenable to multiplexing, and some of these assays did not utilize control strategies for type I or type II errors. In this study, we describe primers and a bifunctional probe with specificity to a gypsy-like retroelement in the P. sojae genome to create a fluorogenic 5'-exonuclease linear hydrolysis assay, with a multiplexed internal control reaction detecting an exogenous target to validate negative calls, and with uracil-deglycosylase-mediated protection against carryover contamination. The assay specifically detected 13 different P. sojae isolates, and excluded 17 other Phytophthora species along with 20 non-Phytophthora fungal and oomycete species pathogenic on soybean. A diagnostic limit of detection of 34 fg total P. sojae DNA was observed in serial dilutions, equivalent to 0.3 genome, and a practical detection sensitivity of four zoospores per sample was achieved, despite losses during DNA extraction.

  2. Multiplex Real-Time PCR Assay Targeting Eight Parasites Customized to the Korean Population: Potential Use for Detection in Diarrheal Stool Samples from Gastroenteritis Patients.

    Directory of Open Access Journals (Sweden)

    Eun Jeong Won

    Full Text Available Intestinal parasitic diseases occur worldwide and can cause diarrhea or gastroenteritis; however, their diagnosis is quite difficult, especially in low-endemism countries. We developed a multiplex real-time PCR assay for detection of eight intestinal parasites and prospectively evaluated it for patients with gastroenteritis. The assay targeted Cryptosporidium parvum, Giardia lamblia, Entamoeba histolytica, Blastocystis hominis, Dientamoeba fragilis, Clonorchis sinensis, Metagonimus yokogawai, and Gymnophalloides seoi. Performance characteristics were evaluated based on recovery after DNA extraction, analytical sensitivity, specificity, reproducibility, cross-reactivity, and interference characteristics. Clinical performance was validated against microscopy on 123 diarrheal samples. The assay demonstrated strong correlations between DNA concentrations and Ct values (R2, 0.9924-0.9998, and had a high PCR efficiency (83.3%-109.5%. Polymerase chain reactions detected as few as 10-30 copies of genomic DNA, and coefficient of variance was 0-7%. There was no cross-reactivity to the other 54 microorganisms tested. Interference occurred only in presence of high concentrations of erythrocytes or leukocytes. This assay had a higher correct identification rate (100.0% vs. 90.2% and lower incorrect ID rate (0.0% vs. 9.8% when compared to microscopy. Overall, this assay showed a higher sensitivity (100.0%; 95% confidence interval [CI] of 80.5-100.0 than microscopy (29.4%; 95% CI 10.31-55.96, and the specificity levels were comparable for both methods (100.0%; 95% CI 96.58-100.0. This newly developed multiplex real-time PCR assay offers a potential use for detecting intestinal parasitic pathogens customized to the Korean population.

  3. Developing a novel fiber optic fluorescence device for multiplexed high-throughput cytotoxic screening.

    Science.gov (United States)

    Lee, Dennis; Barnes, Stephen

    2010-01-01

    The need for new pharmacological agents is unending. Yet the drug discovery process has changed substantially over the past decade and continues to evolve in response to new technologies. There is presently a high demand to reduce discovery time by improving specific lab disciplines and developing new technology platforms in the area of cell-based assay screening. Here we present the developmental concept and early stage testing of the Ab-Sniffer, a novel fiber optic fluorescence device for high-throughput cytotoxicity screening using an immobilized whole cell approach. The fused silica fibers are chemically functionalized with biotin to provide interaction with fluorescently labeled, streptavidin functionalized alginate-chitosan microspheres. The microspheres are also functionalized with Concanavalin A to facilitate binding to living cells. By using lymphoma cells and rituximab in an adaptation of a well-known cytotoxicity protocol we demonstrate the utility of the Ab-Sniffer for functional screening of potential drug compounds rather than indirect, non-functional screening via binding assay. The platform can be extended to any assay capable of being tied to a fluorescence response including multiple target cells in each well of a multi-well plate for high-throughput screening.

  4. Platform for Quantitative Evaluation of Spatial Intratumoral Heterogeneity in Multiplexed Fluorescence Images.

    Science.gov (United States)

    Spagnolo, Daniel M; Al-Kofahi, Yousef; Zhu, Peihong; Lezon, Timothy R; Gough, Albert; Stern, Andrew M; Lee, Adrian V; Ginty, Fiona; Sarachan, Brion; Taylor, D Lansing; Chennubhotla, S Chakra

    2017-11-01

    We introduce THRIVE (Tumor Heterogeneity Research Interactive Visualization Environment), an open-source tool developed to assist cancer researchers in interactive hypothesis testing. The focus of this tool is to quantify spatial intratumoral heterogeneity (ITH), and the interactions between different cell phenotypes and noncellular constituents. Specifically, we foresee applications in phenotyping cells within tumor microenvironments, recognizing tumor boundaries, identifying degrees of immune infiltration and epithelial/stromal separation, and identification of heterotypic signaling networks underlying microdomains. The THRIVE platform provides an integrated workflow for analyzing whole-slide immunofluorescence images and tissue microarrays, including algorithms for segmentation, quantification, and heterogeneity analysis. THRIVE promotes flexible deployment, a maintainable code base using open-source libraries, and an extensible framework for customizing algorithms with ease. THRIVE was designed with highly multiplexed immunofluorescence images in mind, and, by providing a platform to efficiently analyze high-dimensional immunofluorescence signals, we hope to advance these data toward mainstream adoption in cancer research. Cancer Res; 77(21); e71-74. ©2017 AACR . ©2017 American Association for Cancer Research.

  5. Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

    Science.gov (United States)

    Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

    2016-03-12

    Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

  6. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

    Science.gov (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

    1996-06-01

    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  7. Cell Painting, a high-content image-based assay for morphological profiling using multiplexed fluorescent dyes

    Science.gov (United States)

    Bray, Mark-Anthony; Singh, Shantanu; Han, Han; Davis, Chadwick T.; Borgeson, Blake; Hartland, Cathy; Kost-Alimova, Maria; Gustafsdottir, Sigrun M.; Gibson, Christopher C.; Carpenter, Anne E.

    2016-01-01

    In morphological profiling, quantitative data are extracted from microscopy images of cells to identify biologically relevant similarities and differences among samples based on these profiles. This protocol describes the design and execution of experiments using Cell Painting, a morphological profiling assay multiplexing six fluorescent dyes imaged in five channels, to reveal eight broadly relevant cellular components or organelles. Cells are plated in multi-well plates, perturbed with the treatments to be tested, stained, fixed, and imaged on a high-throughput microscope. Then, automated image analysis software identifies individual cells and measures ~1,500 morphological features (various measures of size, shape, texture, intensity, etc.) to produce a rich profile suitable for detecting subtle phenotypes. Profiles of cell populations treated with different experimental perturbations can be compared to suit many goals, such as identifying the phenotypic impact of chemical or genetic perturbations, grouping compounds and/or genes into functional pathways, and identifying signatures of disease. Cell culture and image acquisition takes two weeks; feature extraction and data analysis take an additional 1-2 weeks. PMID:27560178

  8. An aggregated perylene-based broad-spectrum, efficient and label-free quencher for multiplexed fluorescent bioassays.

    Science.gov (United States)

    Liu, Tao; Hu, Rong; Lv, Yi-Fan; Wu, Yuan; Liang, Hao; Huan, Shuang-Yan; Zhang, Xiao-Bing; Tan, Weihong; Yu, Ru-Qin

    2014-08-15

    Fluorescent sensing systems based on the quenching of fluorophores have found wide applications in bioassays. An efficient quencher will endow the sensing system a high sensitivity. The frequently used quenchers are based on organic molecules or nanomaterials, which usually need tedious synthesizing and modifying steps, and exhibit different quenching efficiencies to different fluorophores. In this work, we for the first time report that aggregated perylene derivative can serve as a broad-spectrum and label-free quencher that is able to efficiently quench a variety of fluorophores, such as green, red and far red dyes labeled on DNA. By choosing nucleases as model biomolecules, such a broad-spectrum quencher was then employed to construct a multiplexed bioassay platform through a label-free manner. Due to the high quenching efficiency of the aggregated perylene, the proposed platform could detect nuclease with high sensitivity, with a detection limit of 0.03U/mL for EcoRV, and 0.05U/mL for EcoRI. The perylene quencher does not affect the activity of nuclease, which makes it possible to design post-addition type bioassay platform. Moreover, the proposed platform allows simultaneous and multicolor analysis of nucleases in homogeneous solution, demonstrating its value of potential application in rapid screening of multiple bio-targets. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Internally controlled, generic real-time PCR for quantification and multiplex real-time PCR with serotype-specific probes for serotyping of dengue virus infections

    NARCIS (Netherlands)

    Menting, Sandra; Thai, Khoa T. D.; Nga, Tran T. T.; Phuong, Hoang L.; Klatser, Paul; Wolthers, Katja C.; Binh, Tran Q.; de Vries, Peter J.; Beld, Marcel

    2011-01-01

    Dengue has become a global public health problem and a sensitive diagnostic test for early phase detection can be life saving. An internally controlled, generic real-time PCR was developed and validated by testing serial dilutions of a DENV positive control RNA in the presence of a fixed amount of

  10. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  12. Development of a Multiplexed Microsphere PCR for Culture-Free Detection and Gram-Typing of Bacteria in Human Blood Samples.

    Science.gov (United States)

    Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross T; Hill, Geoffrey R; Corrie, Simon R; Markey, Kate A

    2018-05-11

    Bloodstream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected bloodstream infection remain centered around blood culture (highly variable timing, in the order of hours to days to become positive), and empiric use of broad-spectrum antibiotics is therefore employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g., combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives); however, current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5 h time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labeled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labeled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.

  13. Development and validation of the AmpFℓSTR® Identifiler® Direct PCR Amplification Kit: a multiplex assay for the direct amplification of single-source samples.

    Science.gov (United States)

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K

    2011-07-01

    The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.

  14. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  15. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  16. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  17. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    International Nuclear Information System (INIS)

    Ouyang, Yiwen; Duarte, Gabriela R.M.; Poe, Brian L.; Riehl, Paul S.; Santos, Fernando M. dos; Martin-Didonet, Claudia C.G.; Carrilho, Emanuel; Landers, James P.

    2015-01-01

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s −1 with a cooling rate of roughly −12 ± 0.9 °C s −1 assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification

  18. A strain-specific multiplex RT-PCR for Australian rabbit haemorrhagic disease viruses uncovers a new recombinant virus variant in rabbits and hares.

    Science.gov (United States)

    Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T

    2018-04-01

    Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.

  19. Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2.

    Science.gov (United States)

    Chiapponi, Chiara; Moreno, Ana; Barbieri, Ilaria; Merenda, Marianna; Foni, Emanuela

    2012-09-01

    In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1×10(-1) TCID(50)/200μl for avian-like H1N1, 1×10(0) TCID(50)/200μl for human-like H1N2 and 1×10(1) TCID(50)/200μl for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Prevalence and antimicrobial susceptibilities of anaerobic bacteria isolated from perforated corneal ulcers by culture and multiplex PCR: an evaluation in cases with keratitis and endophthalmitis.

    Science.gov (United States)

    Tokman, Hrisi Bahar; İskeleli, Güzin; Dalar, Zeynep Güngördü; Kangaba, Achille Aime; Demirci, Mehmet; Akay, Hatice K; Borsa, Bariş Ata; Algingil, Reyhan Çalişkan; Kocazeybek, Bekir S; Torun, Müzeyyen Mamal; Kiraz, Nuri

    2014-01-01

    Anaerobic bacteria play an important role in eye infections; however, there is limited epidemiologic data based on the the role of these bacteria in the etiology of keratitis and endophthalmitis. The aim of this re- search is to determine the prevalence of anaerobic bacteria in perforated corneal ulcers of patients with keratitis and endophthalmitis and to evaluate their antimicrobial susceptibilities. Corneal scrapings were taken by the ophthalmologist using sterile needles. For the isolation of anaerobic bacteria, samples were inoculated on specific media and were incubated under anaerobic conditions obtained with Anaero-Gen (Oxoid & Mitsubishi Gas Company) in anaerobic jars (Oxoid USA, Inc. Columbia, MD, USA). The molecular identification of anaerobic bacteria was performed by multiplex PCR and the susceptibilities of an- aerobic bacteria to penicillin, chloramphenicol, and clindamycin were determined with the E test (bioMerieux). 51 strains of anaerobic bacteria belonging to four different genuses were detected by multiplex PCR and only 46 strains were isolated by culture. All of them were found susceptible to chloramphenicol whereas penicillin resistance was found in 13.3% of P.anaerobius strains, clindamycin resistance was found in 34.8% of P.acnes and 13.3% of P. anaerobius strains. Additionnaly, one strain of P. granulosum was found resistant to clindamycin, one strain of B. fragilis and one strain of P.melaninogenica were found resistant to penicillin and clindamycin. Routine analyses of anaerobes in perforated corneal ulcers is inevitable and usage of appropriate molecular methods, for the detection of bacteria responsible from severe infections which might not be deter- mined by cultivation, may serve for the early decision of the appropriate treatment. Taking into account the in- creasing antimicrobial resistance of anaerobic bacteria, alternative eye specific antibiotics effective against anaer- obes are needed to achieve a successful treatment.

  1. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    OpenAIRE

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  2. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  3. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Comparison of one commercial and two in-house TaqMan multiplex real-time PCR assays for detection of enteropathogenic, enterotoxigenic and enteroaggregative Escherichia coli.

    Science.gov (United States)

    Hahn, Andreas; Luetgehetmann, Marc; Landt, Olfert; Schwarz, Norbert Georg; Frickmann, Hagen

    2017-11-01

    Enteropathogenic, enterotoxigenic and enteroaggregative Escherichia coli (EPEC, ETEC, EAEC) are among the most frequent causes of diarrhoea during travel or on military deployments. Cost-efficient and reliable real-time multiplex PCR (mPCR) assays are desirable for surveillance or point prevalence studies in remote and resource-limited tropical settings. We compared one commercial PCR kit and two in-house assays without using a gold standard to estimate sensitivity and specificity of each assay. Residual materials from nucleic acid extractions of stool samples from two groups with presumably different prevalences and increased likelihood of being infected or colonised by diarrhoeagenic E. coli were included in the assessment. One group comprised samples from returnees from tropical deployments, the second group was of migrants and study participants from high-endemicity settings. Each sample was assessed with all of the PCR assays. Cycle threshold (Ct) values were descriptively compared. The calculated sensitivities for the commercial test vs. the in-house tests were for EPEC 0.84 vs. 0.89 and 0.96, for ETEC 0.83 vs. 0.76 and 0.61, and for EAEC 0.69 vs. 0.54 and 0.69. False positive results were rare - specificity was 0.94 and 0.97 for two EPEC tests and 1.0 for all other tests. Most positive samples had late Ct values corresponding to low quantities of pathogens. Discordant test results were associated with late Ct values. As commercial and in-house assays showed comparable results, in-house tests can be assumed to be safe while affording considerable savings, making them a valuable alternative for surveillance testing in resource-limited tropical areas. © 2017 John Wiley & Sons Ltd.

  5. Multiplex PCR Assay for Identification of Six Different Staphylococcus spp. and Simultaneous Detection of Methicillin and Mupirocin Resistance

    OpenAIRE

    Campos-Peña, E.; Martín-Nuñez, E.; Pulido-Reyes, G.; Martín-Padrón, J.; Caro-Carrillo, E.; Donate-Correa, J.; Lorenzo-Castrillejo, I.; Alcoba-Flórez, J.; Machín, F.; Méndez-Alvarez, S.

    2014-01-01

    We describe a new, efficient, sensitive, and fast single-tube multiple-PCR protocol for the identification of the most clinically significant Staphylococcus spp. and the simultaneous detection of the methicillin and mupirocin resistance loci. The protocol identifies at the species level isolates belonging to S. aureus, S. epidermidis, S. haemolyticus, S. hominis, S. lugdunensis, and S. saprophyticus.

  6. Sexagem de embriões bovinos fecundados in vitro pela técnica de PCR multiplex

    Directory of Open Access Journals (Sweden)

    Marcelo Rezende Luz

    2000-12-01

    Full Text Available In the present study the polymerase chain reaction (PCR was used for sexing ninety-two in vitro fertilized bovine embryos. The embryos were obtained after in vitro fertilization of oocytes from slaughterhouses. The oocytes were matured, fertilized, and cultured until the blastocyst stage. The embryos were washed in PBS solution, and transferred to polypropylene tubes with containing ultrapure water and immediately frozen at -196ºC. The embryos were thawed on ice and treated with proteinase K. For the PCR reaction, aliquots of 34 µl from each tube were mixed to the primers BC1.2 and microsatellite sequence 1715, dNTPs, MgCl2, 10X PCR buffer, Taq DNA polymerase and water in a final volume of 50 µl. The samples were amplified and the PCR products separated by electrophoresis in a 8% polyacrylamide gel. The gels were stained in ethidium bromide solution and vizualized under UV-light. The amplification rate was 93.47%, with 41 (47.67% male embryos and 45 (52.32% female embryos. The use of 8% polyacrylamide gel was efficient for separating DNA fragments of very similar size.

  7. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Yiwen [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Duarte, Gabriela R.M. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Universidade Federal de Goiás, Goiânia, GO 74690-900 (Brazil); Poe, Brian L.; Riehl, Paul S. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Santos, Fernando M. dos; Martin-Didonet, Claudia C.G. [Universidade Estadual de Goiás, Anápolis, GO 75132-400 (Brazil); Carrilho, Emanuel [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos, SP 13566-590 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, CP 6154, Campinas, SP 13083-970 (Brazil); Landers, James P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia Health Science Center, Charlottesville, VA (United States)

    2015-12-11

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s{sup −1} with a cooling rate of roughly −12 ± 0.9 °C s{sup −1} assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low

  8. Development and Interlaboratory Validation of a Simple Screening Method for Genetically Modified Maize Using a ΔΔC(q)-Based Multiplex Real-Time PCR Assay.

    Science.gov (United States)

    Noguchi, Akio; Nakamura, Kosuke; Sakata, Kozue; Sato-Fukuda, Nozomi; Ishigaki, Takumi; Mano, Junichi; Takabatake, Reona; Kitta, Kazumi; Teshima, Reiko; Kondo, Kazunari; Nishimaki-Mogami, Tomoko

    2016-04-19

    A number of genetically modified (GM) maize events have been developed and approved worldwide for commercial cultivation. A screening method is needed to monitor GM maize approved for commercialization in countries that mandate the labeling of foods containing a specified threshold level of GM crops. In Japan, a screening method has been implemented to monitor approved GM maize since 2001. However, the screening method currently used in Japan is time-consuming and requires generation of a calibration curve and experimental conversion factor (C(f)) value. We developed a simple screening method that avoids the need for a calibration curve and C(f) value. In this method, ΔC(q) values between the target sequences and the endogenous gene are calculated using multiplex real-time PCR, and the ΔΔC(q) value between the analytical and control samples is used as the criterion for determining analytical samples in which the GM organism content is below the threshold level for labeling of GM crops. An interlaboratory study indicated that the method is applicable independently with at least two models of PCR instruments used in this study.

  9. Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

    2016-05-01

    Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Microgravity validation of a novel system for RNA isolation and multiplex quantitative real time PCR analysis of gene expression on the International Space Station.

    Directory of Open Access Journals (Sweden)

    Macarena Parra

    Full Text Available The International Space Station (ISS National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for

  11. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Nandagopal Murugan

    2018-02-01

    Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

  12. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    OpenAIRE

    Wong Min-Liang; Hsu Tien-Huan; Lin Fong-Yuan; Lin Kuan-Hsun; Chiou Shyan-Song; Wang Chi-Young; Lee Min-Shiuh; Chulakasian Songkhla; Chang Tien-Jye; Hsu Wei-Li

    2010-01-01

    Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hen...

  13. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

    Science.gov (United States)

    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

    2010-07-01

    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  14. Retrospective Species Identification of Microsporidian Spores in Diarrheic Fecal Samples from Human Immunodeficiency Virus/AIDS Patients by Multiplexed Fluorescence In Situ Hybridization▿

    Science.gov (United States)

    Graczyk, Thaddeus K.; Johansson, Michael A.; Tamang, Leena; Visvesvara, Govinda S.; Moura, Laci S.; DaSilva, Alexandre J.; Girouard, Autumn S.; Matos, Olga

    2007-01-01

    In order to assess the applicability of multiplexed fluorescence in situ hybridization (FISH) assay for the clinical setting, we conducted retrospective analysis of 110 formalin-stored diarrheic stool samples from human immunodeficiency virus (HIV)/AIDS patients with intestinal microsporidiosis collected between 1992 and 2003. The multiplexed FISH assay identified microsporidian spores in 94 of 110 (85.5%) samples: 49 (52.1%) were positive for Enterocytozoon bieneusi, 43 (45.8%) were positive for Encephalitozoon intestinalis, 2 (2.1%) were positive for Encephalitozoon hellem, and 9 samples (9.6%) contained both E. bieneusi and E. intestinalis spores. Quantitative spore counts per ml of stool yielded concentration values from 3.5 × 103 to 4.4 × 105 for E. bieneusi (mean, 8.8 × 104/ml), 2.3 × 102 to 7.8 × 104 (mean, 1.5 × 104/ml) for E. intestinalis, and 1.8 × 102 to 3.6 × 102 for E. hellem (mean, 2.7 × 102/ml). Identification of microsporidian spores by multiplex FISH assay was more sensitive than both Chromotrope-2R and CalcoFluor White M2R stains; 85.5% versus 72.7 and 70.9%, respectively. The study demonstrated that microsporidian coinfection in HIV/AIDS patients with intestinal microsporidiosis is not uncommon and that formalin-stored fecal samples older than 10 years may not be suitable for retrospective analysis by techniques targeting rRNA. Multiplexed FISH assay is a reliable, quantitative fluorescence microscopy method for the simultaneous identification of E. bieneusi, E. intestinalis, and E. hellem, as well as Encephalitozoon cuniculi, spores in fecal samples and is a useful tool for assessing spore shedding intensity in intestinal microsporidiosis. The method can be used for epidemiological investigations and applied in clinical settings. PMID:17287331

  15. On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    Science.gov (United States)

    Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

    2013-07-25

    A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  17. Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

    Directory of Open Access Journals (Sweden)

    Sinem Oktem-Okullu

    Full Text Available The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1, IL-17 (Th17, and FOXP3 (Treg expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

  18. Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

    Science.gov (United States)

    Oktem-Okullu, Sinem; Tiftikci, Arzu; Saruc, Murat; Cicek, Bahattin; Vardareli, Eser; Tozun, Nurdan; Kocagoz, Tanil; Sezerman, Ugur; Yavuz, Ahmet Sinan; Sayi-Yazgan, Ayca

    2015-01-01

    The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1), IL-17 (Th17), and FOXP3 (Treg) expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

  19. Identification of genomic differences between Campylobacter jejuni subsp. jejuni and C. jejuni subsp. doylei at the nap locus leads to the development of a C. jejuni subspeciation multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Heath Sekou

    2007-02-01

    Full Text Available Abstract Background The human bacterial pathogen Campylobacter jejuni contains two subspecies: C. jejuni subsp. jejuni (Cjj and C. jejuni subsp. doylei (Cjd. Although Cjd strains are isolated infrequently in many parts of the world, they are obtained primarily from human clinical samples and result in an unusual clinical symptomatology in that, in addition to gastroenteritis, they are associated often with bacteremia. In this study, we describe a novel multiplex PCR method, based on the nitrate reductase (nap locus, that can be used to unambiguously subspeciate C. jejuni isolates. Results Internal and flanking napA and napB primer sets were designed, based on existing C. jejuni and Campylobacter coli genome sequences to create two multiplex PCR primer sets, nap mpx1 and nap mpx2. Genomic DNA from 161 C. jejuni subsp. jejuni (Cjj and 27 C. jejuni subsp. doylei (Cjd strains were amplified with these multiplex primer sets. The Cjd strains could be distinguished clearly from the Cjj strains using either nap mpx1 or mpx2. In addition, combination of either nap multiplex method with an existing lpxA speciation multiplex method resulted in the unambiguous and simultaneous speciation and subspeciation of the thermophilic Campylobacters. The Cjd nap amplicons were also sequenced: all Cjd strains tested contained identical 2761 bp deletions in napA and several Cjd strains contained deletions in napB. Conclusion The nap multiplex PCR primer sets are robust and give a 100% discrimination of C. jejuni subspecies. The ability to rapidly subspeciate C. jejuni as well as speciate thermophilic Campylobacter species, most of which are pathogenic in humans, in a single amplification will be of value to clinical laboratories in strain identification and the determination of the environmental source of campylobacterioses caused by Cjd. Finally, the sequences of the Cjd napA and napB loci suggest that Cjd strains arose from a common ancestor, providing clues as to

  20. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  1. Assessing the performance of multiplexed tandem PCR for the diagnosis of pathogenic genotypes of Theileria orientalis using pooled blood samples from cattle.

    Science.gov (United States)

    Gebrekidan, Hagos; Gasser, Robin B; Stevenson, Mark A; McGrath, Sean; Jabbar, Abdul

    2017-02-01

    Oriental theileriosis caused by multiple genotypes of Theileria orientalis is an important tick-borne disease of bovines. Here, we assessed the performance of an established multiplexed tandem PCR (MT-PCR) for the diagnosis of the two recognized, pathogenic genotypes (chitose and ikeda) of T. orientalis in cattle using pooled blood samples. We used a total of 265 cattle blood samples, which were divided into two groups according to previous MT-PCR results for individual samples. Samples in group 1 (n = 155) were from a herd with a relatively high prevalence of T. orientalis infection; and those in group 2 (n = 110) were from four herds with a low prevalence. For group 1, 31 and 15 batches of five- and ten-pooled samples (selected at random), respectively, were formed. For group 2, 22 and 11 batches of five- and ten-pooled samples (selected at random), respectively, were formed. DNAs from individual pooled samples in each batch and group were then tested by MT-PCR. For group 1, the apparent prevalences estimated using the 31 batches of five-pooled samples (97%) and 15 batches of ten-pooled samples (100%) were significantly higher compared with individual samples (75%). For group 2, higher apparent prevalences (9% and 36%) were also recorded for the 22 and 11 batches of pooled samples, respectively, compared with individual samples (7%). Overall, the average infection intensity recorded for the genotypes of chitose and ikeda were considerably lower in pooled compared with individual samples. The diagnostic specificities of MT-PCR were estimated at 95% and 94%, respectively, when batches of five- and ten-pooled samples were tested, and 94% for individual samples. The diagnostic sensitivity of this assay was estimated at 98% same for all individual, five- and ten-pooled samples. This study shows that screening batches of five- and ten-pooled blood samples from cattle herds are similar to those obtained for individual samples, and, importantly, that the reduced cost

  2. Development of a multiplex Q-PCR to detect Trichoderma harzianum Rifai strain T22 in plant roots.

    Science.gov (United States)

    Horn, Ivo R; van Rijn, Menno; Zwetsloot, Tom J J; Basmagi, Said; Dirks-Mulder, Anita; van Leeuwen, Willem B; Ravensberg, Willem J; Gravendeel, Barbara

    2016-02-01

    The fungal species Trichoderma harzianum is widely used as a biological agent in crop protection. To verify the continued presence of this fungus on plant roots manually inoculated with T. harzianum strain T22, a Q-PCR was designed using specific probes for this particular strain. To develop these molecular diagnostic tools, genome mining was first carried out to retrieve putative new regions by which different strains of T. harzianum could be distinguished. Subsequently, Sanger sequencing of the L-aminoacid oxidase gene (aox1) in T. harzianum was applied to determine the mutations differing between various strains isolated from the Trichoderma collection of Koppert Biological Systems. Based on the sequence information obtained, a set of hydrolysis probes was subsequently developed which discriminated T. harzianum T22 strains varying in only a single nucleotide. Probes designed for two strains uniquely recognized the respective strains in Q-PCR with a detection limit of 12,5ng DNA. Titration assays in which T. harzianum DNA from distinct strains was varied further underscored the specificity of the probes. Lastly, fungal DNA extracted from roots of greenhouse cultured tomato plants was analyzed using the probe-based assay. DNA from T. harzianum strain T22 could readily be identified on roots of greenhouse reared tomato plants inoculated with varying concentrations up to one week after treatment with a detection limit of 3e6 colony forming units of T. harzianum T22. We conclude that the Q-PCR method is a reliable and robust method for assessing the presence and quantity of T. harzianum strain T22 in manually inoculated plant material. Our method provides scope for the development of DNA based strain specific identification of additional strains of Trichoderma and other fungal biological control agents. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-a-chip Agilent DNA 1000 platform.

    Science.gov (United States)

    Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš

    2016-01-01

    Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.

  4. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  5. Towards a pathogenic Escherichia coli detection platform using multiplex SYBR®Green Real-time PCR methods and high resolution melting analysis.

    Directory of Open Access Journals (Sweden)

    Dafni-Maria Kagkli

    Full Text Available Escherichia coli is a group of bacteria which has raised a lot of safety concerns in recent years. Five major intestinal pathogenic groups have been recognized amongst which the verocytotoxin or shiga-toxin (stx1 and/or stx2 producing E. coli (VTEC or STEC respectively have received a lot of attention recently. Indeed, due to the high number of outbreaks related to VTEC strains, the European Food Safety Authority (EFSA has requested the monitoring of the "top-five" serogroups (O26, O103, O111, O145 and O157 most often encountered in food borne diseases and addressed the need for validated VTEC detection methods. Here we report the development of a set of intercalating dye Real-time PCR methods capable of rapidly detecting the presence of the toxin genes together with intimin (eae in the case of VTEC, or aggregative protein (aggR, in the case of the O104:H4 strain responsible for the outbreak in Germany in 2011. All reactions were optimized to perform at the same annealing temperature permitting the multiplex application in order to minimize the need of material and to allow for high-throughput analysis. In addition, High Resolution Melting (HRM analysis allowing the discrimination among strains possessing similar virulence traits was established. The development, application to food samples and the flexibility in use of the methods are thoroughly discussed. Together, these Real-time PCR methods facilitate the detection of VTEC in a new highly efficient way and could represent the basis for developing a simple pathogenic E. coli platform.

  6. Novel Multiplex PCR Assay for Detection of Chlorhexidine-Quaternary Ammonium, Mupirocin, and Methicillin Resistance Genes, with Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci.

    Science.gov (United States)

    McClure, Jo-Ann; Zaal DeLongchamp, Johanna; Conly, John M; Zhang, Kunyan

    2017-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a clinically significant pathogen that is resistant to a wide variety of antibiotics and responsible for a large number of nosocomial infections worldwide. The Agency for Healthcare Research and Quality and the Centers for Disease Control and Prevention recently recommended the adoption of universal mupirocin-chlorhexidine decolonization of all admitted intensive care unit patients rather than MRSA screening with targeted treatments, which raises a serious concern about the selection of resistance to mupirocin and chlorhexidine in strains of staphylococci. Thus, a simple, rapid, and reliable approach is paramount in monitoring the prevalence of resistance to these agents. We developed a simple multiplex PCR assay capable of screening Staphylococcus isolates for the presence of antiseptic resistance genes for chlorhexidine and quaternary ammonium compounds, as well as mupirocin and methicillin resistance genes, while simultaneously discriminating S. aureus from coagulase-negative staphylococci (CoNS). The assay incorporates 7 PCR targets, including the Staphylococcus 16S rRNA gene (specifically detecting Staphylococcus spp.), nuc (distinguishing S. aureus from CoNS), mecA (distinguishing MRSA from methicillin-susceptible S. aureus ), mupA and mupB (identifying high-level mupirocin resistance), and qac and smr (identifying chlorhexidine and quaternary ammonium resistance). Our assay demonstrated 100% sensitivity, specificity, and accuracy in a total of 23 variant antiseptic- and/or antibiotic-resistant control strains. Further validation of our assay using 378 randomly selected and previously well-characterized local clinical isolates confirmed its feasibility and practicality. This may prove to be a useful tool for multidrug-resistant Staphylococcus monitoring in clinical laboratories, particularly in the wake of increased chlorhexidine and mupirocin treatments. Copyright © 2017 American Society for Microbiology.

  7. DEVELOPMENT OF REAL-TIME MULTIPLEX PCR FOR THE QUANTITATIVE DETERMINATION OF TREC'S AND KREC'S IN WHOLE BLOOD AND IN DRIED BLOOD SPOTS

    Directory of Open Access Journals (Sweden)

    M. A. Gordukova

    2015-01-01

    Full Text Available Primary immunodeficiencies (PID such as severe combined immunodeficiency (SCID and X-linked agammaglobulinemia are characterized by the lack of functional Tand B-cells, respectively. Without early diagnosis and prompt treatment children with PID suffer from severe infectious diseases, leading to their death or disability. Our purpose was developing of simple, inexpensive, high throughput technique based on the quantitative determination of TREC and KREC molecules by real-time PCR, and its validation in a group of children with a verified diagnosis of SCID and X-linked agammaglobulinemia.In this study, we developed and validated multiplex real-time PCR for the TREC’s and KREC’s quantitative analysis. We have shown that linear range of Ct changes depending on the concentrations of targets with a correlation coefficient R2 not worse than 0.98 was observed at concentrations from 109 to 5 × 104 copies per ml. The lowest amount of targets reliably detected in a reaction volume was 10 TREC’s copies, 5 KREC ‘s copies and 5 copies of internal control (IL17RA. We determined the age-depended reference values of TRECs and KRECs in whole blood in 29 boys and 27 girls with normal immunological parameters. The normal cut-offs for TRECs and KRECs were defined in dry blood spots depending on the method of extraction.The proposed method showed 100% diagnostic sensitivity and specificity in the studied group. The method can be proposed as a screening tool for the diagnosis of SCID and X-linked agammaglobulinemia both in whole blood and in the dry blood spots. The further investigation is required with larger number of samples. 

  8. Typing of O26 enterohaemorrhagic and enteropathogenic Escherichia coli isolated from humans and cattle with IS621 multiplex PCR-based fingerprinting.

    Science.gov (United States)

    Mainil, J G; Bardiau, M; Ooka, T; Ogura, Y; Murase, K; Etoh, Y; Ichihara, S; Horikawa, K; Buvens, G; Piérard, D; Itoh, T; Hayashi, T

    2011-09-01

    This study evaluated a typing method of O26:H11 enterohaemorrhagic and enteropathogenic Escherichia coli (EHEC and EPEC) based on the variation in genomic location and copy numbers of IS621. Two multiplex PCRs, targeting either the left (5') or right (3') IS/chromosome junction of 12 IS621 insertion sites and one PCR specific of another truncated copy, were developed. Thirty-eight amplification profiles were observed amongst a collection of 69 human and bovine O26:H11 EHEC and EPEC. Seventy-one per cent of the 45 EHEC and EPEC with identical IS621 fingerprints within groups of two, three or four isolates had >85% pulsed field gel electrophoresis (PFGE) profile similarity, including four groups of epidemiologically related EHEC or EPEC, while most of the groups had identical IS621 fingerprints and PFGE profiles. The IS621 fingerprinting and the PFGE are complementary typing assays of EHEC and EPEC; though, the former is less discriminatory. The IS621 printing method represents a rapid (24 h) first-line surveillance and typing assay, to compare and trace back O26:H11 EHEC and EPEC during surveys in farms, multiple human cases and outbreaks. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology. No claim to Belgian Government works.

  9. Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

    LENUS (Irish Health Repository)

    Vickers, I

    2011-03-01

    The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

  10. A novel one-step real-time multiplex PCR assay to detect Streptococcus agalactiae presence and serotypes Ia, Ib, and III.

    Science.gov (United States)

    Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S

    2017-09-01

    Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

    Science.gov (United States)

    Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

    2017-10-01

    Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. A Multiplex PCR Assay for Differentiating Coconut Rhinoceros Beetle (Coleoptera: Scarabaeidae) From Oriental Flower Beetle (Coleoptera: Scarabaeidae) in Early Life Stages and Excrement.

    Science.gov (United States)

    Watanabe, S; Melzer, M J

    2017-04-01

    The coconut rhinoceros beetle, Oryctes rhinoceros (L.), is a major pest of coconut and other palm trees. An incipient coconut rhinoceros beetle population was recently discovered on the island of Oahu, Hawaii and is currently the target of a large, mutiagency eradication program. Confounding this program is the widespread presence of another scarab beetle on Oahu, the oriental flower beetle, Protaetia orientalis (Gory and Percheron 1833). Eggs, early life stages, and fecal excrement of coconut rhinoceros beetle and oriental flower beetle are morphologically indistinguishable, thereby creating uncertainty when such specimens are discovered in the field. Here, we report the development of a multiplex PCR assay targeting cytochrome oxidase I of coconut rhinoceros beetle and oriental flower beetle that can rapidly detect and distinguish between these insects. This assay also features an internal positive control to ensure DNA of sufficient quantity and quality is used in the assay, increasing its reliability and reducing the chances of false negative results. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

    Directory of Open Access Journals (Sweden)

    Wong Min-Liang

    2010-06-01

    Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  15. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus.

    Science.gov (United States)

    Chulakasian, Songkhla; Lee, Min-Shiuh; Wang, Chi-Young; Chiou, Shyan-Song; Lin, Kuan-Hsun; Lin, Fong-Yuan; Hsu, Tien-Huan; Wong, Min-Liang; Chang, Tien-Jye; Hsu, Wei-Li

    2010-06-10

    Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  16. A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

    Science.gov (United States)

    Bisset, S A; Knight, J S; Bouchet, C L G

    2014-02-24

    A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible

  17. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Directory of Open Access Journals (Sweden)

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  18. The Staphylococcus aureus Exotoxin Recognition Using a Sensor Designed by Nanosilica and SEA genotyping by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    H. Ahari

    2014-09-01

    Full Text Available Considering the ever increasing population and industrialization of the developmental trend of human life, we are no longer able to detect the toxins produced in food products using the traditional techniques. This is due to the fact that the isolation time for food products is not cost-effective, and even in most of the cases, the precision of practical techniques like bacterial cultivation and other techniques suffers from operator errors, or the errors of the mixtures used. Hence, with the advent of nanotechnology, the design of selective and smart sensors has turned into one of the greatest industrial revelations of the quality control of food products that, in few minutes time and with a very high precision, can identify the volume and toxicity of the bacteria. In this research, based on the bacterial antibody's connection to nanoparticles, a sensor was used. In this part of the research, as the basis for absorption for the recognition of bacterial toxin, medium sized silica nanoparticles of 10 nm in the form of solid powder were utilized with Notrino brand. Then the suspension produced from the agent-linked nanosilica, which was connected to the bacterial antibody, was positioned near the samples of distilled water, which were contaminated with Staphylococcus aureus bacterial toxin with the density of  10-3 molar, so that in case any toxin exists in the sample, a connection between the toxin antigen and the antibody would be formed. Finally, the light absorption related to the connection of antigen to the particle-attached antibody was measured using spectrophotometry. The 23S rRNA gene that is conserved in all Staphylococcus spp. was used as the control. The accuracy of the test was monitored by using the serial dilution (l0-6 of overnight cell culture of Staphylococcus spp. bacteria (OD600: 0.02 = 107 cell. It showed that the sensitivity of PCR is 10 bacteria per ml of cells within few hours. The results indicated that the sensor

  19. Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay

    Directory of Open Access Journals (Sweden)

    Dabisch-Ruthe Mareike

    2012-07-01

    Full Text Available Abstract Background A broad spectrum of pathogens is causative for respiratory tract infections, but symptoms are mostly similar. Therefore, the identification of the causative viruses and bacteria is only feasible using multiplex PCR or several monoplex PCR tests in parallel. Methods The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP, were compared to monoplex real-time PCR with quantified standardized control material. All assays include the most common respiratory pathogens. Results To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 101 to 105 copies/ml. Concordant results were received for rhinovirus, whereas the RVP detected influenzavirus, RSV and hMPV more frequently in low concentrations. The RespiFinder-19 and the RespiFinder-SMART-22 showed a higher analytical sensitivity for adenoviruses and coronaviruses, whereas the RVP was incapable to detect adenovirus and coronavirus in concentrations of 104 copies/ml. The RespiFinder-19 and RespiFinder-SMART-22A did not detect influenzaviruses (104 copies/ml and RSV (103 copies/ml. The detection of all 13 viruses in one sample was only achieved using monoplex PCR. To analyze possible competitive amplification reactions between the different viruses, samples were further inoculated with only 4 different viruses in one sample. Compared to the detection of 13 viruses in parallel, only a few differences were found. The incidence of respiratory viruses was compared in tracheal secretion (TS samples (n = 100 of mechanically ventilated patients in winter (n = 50 and summer (n = 50. In winter, respiratory viruses were detected in 32 TS samples (64% by RespiFinder-19, whereas the detection rate with RVP was only 22%. The most frequent viruses were adenovirus (32% and PIV-2 (20%. Multiple infections were detected

  20. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay.

    Science.gov (United States)

    Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica

    2017-07-01

    Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.

  1. The Use of Multiplex PCR to Determine the Prevalence of Enterotoxigenic Staphylococcus aureus Isolated from Raw Milk, Feta Cheese, and Hand Swabs.

    Science.gov (United States)

    Zeinhom, Mohamed M A; Abdel-Latef, Gihan K; Jordan, Kieran

    2015-12-01

    Staphylococcus aureus (S. aureus) can cause mastitis in cattle and, therefore, can be present in milk. This study was undertaken to determine the prevalence of coagulase positive S. aureus and its enterotoxin genes sea, seb, and sec in isolates recovered from raw milk, feta cheese, and human hand swabs of milk and cheese handlers in Beni-Suef province, Egypt. A total of 100 samples of raw milk and 50 samples of pasteurized-milk feta cheese were collected. In addition, 50 hand swabs from milk handlers and 25 hand swabs from cheese handlers were examined for the presence of coagulase positive S. aureus. The isolates were characterized by multiplex PCR for detection of sea, seb, and sec genes, and for resistance to 5 classes of commonly used antibiotics. Twelve (12/100), 12 (6/50), and 17% (13/75) of milk, cheese, and hand swab samples, respectively, were positive for coagulase positive S. aureus. One isolate was obtained from each positive sample (31 isolates), and none contained genes for SEA or SEC production. Twenty-five percent, 33%, and 31%, respectively, of the isolates contained the genes for SEB, resulting in 3%, 4%, and 5% of samples being positive for toxin producing coagulase positive S. aureus, respectively. At least one isolate was resistant to each of the antibiotics tested. Despite the low potential for SEB production shown, preventative measures, such as maintenance of the cold-chain and good hygienic practices should be implemented to further reduce the potential risk to public health from SEB, and to reduce the spread of antimicrobial resistance. © 2015 Institute of Food Technologists®

  2. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  3. Efficiency of semi-automated fluorescent multiplex PCRs with 11 microsatellite markers for genetic studies of deer populations.

    Science.gov (United States)

    Bonnet, A; Thévenon, S; Maudet, F; Maillard, J C

    2002-10-01

    Thirty bovine and eight ovine microsatellite primer pairs were tested on four tropical deer species: Eld's and Swamp deer (highly threatened) and Rusa and Vietnamese Sika deer (economically important). Thirty markers gave an amplified product in all four species (78.9%). The number of polymorphic microsatellite markers varied among the species from 14 in Eld's deer (47%) to 20 in Swamp deer (67%). Among them, 11 microsatellite loci were multiplexed in three polymerase chain reactions (PCRs) and labelled with three different fluorochromes that can be loaded in one gel-lane. To test the efficiency of the multiplex, primary genetic studies (mean number of alleles, expected heterozygosities and Fis values) were carried out on four deer populations. Parentage exclusion probability and probability of identity were computed and discussed on a Swamp deer population. These multiplexes PCRs were also tested on several other deer species and subspecies. The aim of this study is to establish a tool useful for genetic studies of population structure and diversity in four tropical deer species which with few modifications can be applied to other species of the genus Cervus.

  4. Multiplexed salivary protein profiling for patients with respiratory diseases using fiber-optic bundles and fluorescent antibody-based microarrays.

    Science.gov (United States)

    Nie, Shuai; Benito-Peña, Elena; Zhang, Huaibin; Wu, Yue; Walt, David R

    2013-10-01

    Over the past 40 years, the incidence and prevalence of respiratory diseases have increased significantly throughout the world, damaging economic productivity and challenging health care systems. Current diagnoses of different respiratory diseases generally involve invasive sampling methods such as induced sputum or bronchoalveolar lavage that are uncomfortable, or even painful, for the patient. In this paper, we present a platform incorporating fiber-optic bundles and antibody-based microarrays to perform multiplexed protein profiling of a panel of six salivary biomarkers for asthma and cystic fibrosis (CF) diagnosis. The platform utilizes an optical fiber bundle containing approximately 50,000 individual 4.5 μm diameter fibers that are chemically etched to create microwells in which modified microspheres decorated with monoclonal capture antibodies can be deposited. On the basis of a sandwich immunoassay format, the array quantifies human vascular endothelial growth factor (VEGF), interferon gamma-induced protein 10 (IP-10), interleukin-8 (IL-8), epidermal growth factor (EGF), matrix metalloproteinase 9 (MMP-9), and interleukin-1 beta (IL-1β) salivary biomarkers in the subpicomolar range. Saliva supernatants collected from 291 individuals (164 asthmatics, 71 CF patients, and 56 healthy controls (HC)) were analyzed on the platform to profile each group of patients using this six-analyte suite. It was found that four of the six proteins were observed to be significantly elevated (p < 0.01) in asthma and CF patients compared with HC. These results demonstrate the potential to use the multiplexed protein array platform for respiratory disease diagnosis.

  5. Multiplex PCR for the detection of BCL-1/IGH and BCL-2/IGH gene rearrangements--clinical validation in a prospective study of blood and bone marrow in 258 patients with or suspected of non-Hodgkin's lymphoma

    DEFF Research Database (Denmark)

    Nyvold, Charlotte G; Bendix, Knud; Brandsborg, Margrethe

    2007-01-01

    prospectively been evaluated. Eleven patients (4%) were found t(11;14)+ and 37 patients (14%) t(14;18)+. Comparing these results to standard diagnostic methods of PB and/or BM identified PCR+ samples that were normal by morphology (BCL-1/IGH: 1/11; BCL-2/IGH: 17/37). Equally important, patients who were......We have designed a multiplex PCR, which allows for fast and high throughput demonstration of the BCL-1/IGH and BCL-2/IGH fusion DNA observed primarily in mantle cell- and follicular non-Hodgkin's lymphoma (NHL). Blood (PB) and/or bone marrow (BM) from 258 patients suspected of NHL have...... not clonal in PB and/or BM by flow cytometry were identified as PCR+ (BCL-1/IGH: 3/11; BCL-2/IGH: 23/37). We conclude that this multiplex approach allows for easy and sensitive molecular determination of molecular lesions in NHL, which have diagnostic and prognostic importance. Udgivelsesdato: 2007-null...

  6. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  7. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Detecção de cepas patogênicas pela PCR multiplex e avaliação da sensibilidade a antimicrobianos de Escherichia coli isoladas de leitões diarréicos Detection of pathogenic strains by multiplex PCR and antimicrobial sensitivity of Escherichia coli isolated from piglets

    Directory of Open Access Journals (Sweden)

    N.R. Macêdo

    2007-10-01

    Full Text Available Avaliou-se a freqüência dos genes de fímbrias (K88, K99, 987P, F18 e F41 e toxinas (LT, Stb, StaP e Stx2e de cepas de E. coli isoladas de leitões com diarréia usando a técnica de PCR multiplex com primers específicos para esses genes, e estudou-se o padrão de sensibilidade das cepas patogênicas pelo método de difusão em disco ao florfenicol, ceftiofur sódico, colistina, fosfomicina, neomicina, norfloxacina, sulfa + trimetoprim, doxiciclina, tetraciclina e lincomicina. Foram utilizadas 144 amostras de E.coli isoladas de leitões com diarréia, provenientes de granjas localizadas no estado de Minas Gerais. Dessas, 42 (29,2% foram positivas para pelo menos um dos fatores de virulência testados. Dentre essas 42 amostras, 23 (54,8% apresentaram genes de fímbria e toxina, sete (16,6% apresentaram somente genes de toxinas e 12 (28,6% amostras somente genes de fímbria. O resultado do teste de sensibilidade aos antimicrobianos demonstrou que o florfenicol (89,5 % e o ceftiofur sódico (84,2% foram as drogas de melhor eficácia in vitro sobre cepas de E. coli com fatores de virulência.The frequency of virulence determinants genes for fimbrial adhesions (K88, K99, 987P, F18 and F41 and toxins (LT, Stb, StaP and Stx2e in E. coli strains isolated from diarrheic piglets using the multiplex polymerase chain reaction assay with specific primers for these genes was studied. The antimicrobial sensitivity pattern of pathogenic isolates for florfenicol, sodium ceftiofur, colistin, fosfomycin, neomycin, norfloxacin, sulfa + trimetoprim, doxycycline, tetracycline and lincomycin was also tested using the disk diffusion method. E. coli were isolated from 144 diarrheic piglets from farms in the state of Minas Gerais. Forty-two out of 144 studied samples (29.2% were positive for at least one tested virulence factor. Out of these 42, 23 samples (54.8% contained fimbria and toxin genes, seven (16.6% samples had genes for toxins only and 12 (28.6% samples

  9. Detection of MDM2/CDK4 amplification in lipomatous soft tissue tumors from formalin-fixed, paraffin-embedded tissue: comparison of multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridization (FISH).

    Science.gov (United States)

    Creytens, David; van Gorp, Joost; Ferdinande, Liesbeth; Speel, Ernst-Jan; Libbrecht, Louis

    2015-02-01

    In this study, the detection of MDM2 and CDK4 amplification was evaluated in lipomatous soft tissue tumors using multiplex ligation-dependent probe amplification (MLPA), a PCR-based technique, in comparison with fluorescence in situ hybridization (FISH). These 2 techniques were evaluated in a series of 77 formalin-fixed, paraffin-embedded lipomatous tumors (27 benign adipose tumors, 28 atypical lipomatous tumors/well-differentiated liposarcomas, 18 dedifferentiated liposarcomas, and 4 pleomorphic liposarcomas). Using MLPA, with a cut-off ratio of >2, 36/71 samples (22 atypical lipomatous tumors/well-differentiated liposarcomas, and 14 dedifferentiated liposarcomas) showed MDM2 and CDK4 amplification. Using FISH as gold standard, MLPA showed a sensitivity of 90% (36/40) and a specificity of 100% (31/31) in detecting amplification of MDM2 and CDK4 in lipomatous soft tissue tumors. In case of high-level amplification (MDM2-CDK4/CEP12 ratio >5), concordance was 100%. Four cases of atypical lipomatous tumor/well-differentiated liposarcoma (4/26, 15%) with a low MDM2 and CDK4 amplification level (MDM2-CDK4/CEP12 ratio ranging between 2 and 2.5) detected by FISH showed no amplification by MLPA, although gain of MDM2 and CDK4 (ratios ranging between 1.6 and 1.9) was seen with MLPA. No amplification was detected in benign lipomatous tumors and pleomorphic liposarcomas. Furthermore, there was a very high concordance between the ratios obtained by FISH and MLPA. In conclusion, MLPA proves to be an appropriate and straightforward technique for screening MDM2/CDK4 amplification in lipomatous tumors, especially when a correct cut-off value and reference samples are chosen, and could be considered a good alternative to FISH to determine MDM2 and CDK4 amplification in liposarcomas. Moreover, because MLPA, as a multiplex technique, allows simultaneous detection of multiple chromosomal changes of interest, it could be in the future a very reliable and fast molecular analysis on

  10. Evaluation of the new AmpliSens multiplex real-time PCR assay for simultaneous detection of Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, and Trichomonas vaginalis.

    Science.gov (United States)

    Rumyantseva, Tatiana; Golparian, Daniel; Nilsson, Christian S; Johansson, Emma; Falk, My; Fredlund, Hans; Van Dam, Alje; Guschin, Alexander; Unemo, Magnus

    2015-10-01

    In this study, we performed an evaluation of the new CE-marked multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay compared to APTIMA tests, i.e., APTIMA COMBO 2 assay, APTIMA Trichomonas vaginalis assay (FDA-approved), and two different APTIMA Mycoplasma genitalium assays (research use only; one of them only used for discrepancy analysis). Vaginal swabs (n = 209) and first-void urine (FVU) specimens from females (n = 498) and males (n = 554), consecutive attendees (n = 1261) at a dermatovenerological clinic in Sweden, were examined. The sensitivity of the AmpliSens PCR assay for detection of C. trachomatis (6.3% prevalence), M. genitalium (5.7% prevalence), N. gonorrhoeae (0.3% prevalence), and T. vaginalis (0.08% prevalence) was 97.5% (95% confidence interval (CI): 91.2-99.6%), 81.9% (95% CI: 70.7-89.7%), 100% (95% CI: 40.2-100%) and 100% (95% CI: 16.5-100%), respectively. The specificity of the AmpliSens PCR assay was 100% (95% CI: 99.6-100%) for all agents. The analytical sensitivity and specificity for N. gonorrhoeae detection was excellent, i.e., 55 international gonococcal strains detected and 135 isolates of 13 non-gonococcal Neisseria species were negative. In conclusion, the multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay demonstrated high sensitivity and excellent specificity for the detection of C. trachomatis, N. gonorrhoeae, and T. vaginalis, and excellent specificity but suboptimal sensitivity for M. genitalium detection. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  11. Prospective evaluation of the SeptiFAST multiplex real-time PCR assay for surveillance and diagnosis of infections in haematological patients after allogeneic stem cell transplantation compared to routine microbiological assays and an in-house real-time PCR method.

    Science.gov (United States)

    Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus

    2017-12-01

    We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.

  12. MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments

    NARCIS (Netherlands)

    Bustin, S.A.; Beaulieu, J.F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.; Olsvik, P.A.; Penning, L.C.; Toegel, S.

    2010-01-01

    MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments Stephen A Bustin1 , Jean-François Beaulieu2 , Jim Huggett3 , Rolf Jaggi4 , Frederick SB Kibenge5 , Pål A Olsvik6 , Louis C Penning7 and Stefan Toegel8 1 Centre for

  13. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  14. Multiplexed interfacial transduction of nucleic acid hybridization using a single color of immobilized quantum dot donor and two acceptors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Algar, W Russ; Krull, Ulrich J

    2010-01-01

    A multiplexed solid-phase assay for the detection of nucleic acid hybridization was developed on the basis of a single color of immobilized CdSe/ZnS quantum dot (QD) as a donor in fluorescence resonance energy transfer (FRET). This work demonstrated that two channels of detection did not necessitate two different QD donors. Two probe oligonucleotides were coimmobilized on optical fibers modified with QDs, and a sandwich assay was used to associate the acceptor dyes with interfacial hybridization events without target labeling. FRET-sensitized acceptor emission provided an analytical signal that was concentration dependent down to 10 nM. Changes in the ratio of coimmobilized probe oligonucleotides were found to yield linear changes in the relative amounts of acceptor emission. These changes were compared to previous studies that used mixed films of two QD donors for two detection channels. The analysis indicated that probe dilution effects were primarily driven by changes in acceptor number density and that QD dilution effects or changes in mean donor-acceptor distance were secondary. Hybridization kinetics were found to be consistent between different ratios of coimmobilized probes, suggesting that hybridization in this type of system occurred via the accepted model for solid-phase hybridization, where adsorption and then diffusion at the solid interface drove hybridization.

  15. A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe.

    Directory of Open Access Journals (Sweden)

    Ke Feng

    Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

  16. One-step cross-genogroup multiplex RT-qPCR with an internal control system for the detection of infectious pancreatic necrosis virus (IPNV).

    Science.gov (United States)

    Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard

    2017-09-01

    Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    DEFF Research Database (Denmark)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke

    2012-01-01

    BACKGROUND:Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent...... steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS...... to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. CONCLUSION:Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control...

  18. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Science.gov (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  19. A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

    Directory of Open Access Journals (Sweden)

    Loo Keat

    2012-05-01

    Full Text Available Abstract Background Hyperhomocysteinemia as a consequence of the MTHFR 677 C > T variant is associated with cardiovascular disease and stroke. Another factor that can potentially contribute to these disorders is a depleted nitric oxide level, which can be due to the presence of eNOS +894 G > T and eNOS −786 T > C variants that make an individual more susceptible to endothelial dysfunction. A number of genotyping methods have been developed to investigate these variants. However, simultaneous detection methods using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis are still lacking. In this study, a novel multiplex PCR-RFLP method for the simultaneous detection of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants was developed. A total of 114 healthy Malay subjects were recruited. The MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants were genotyped using the novel multiplex PCR-RFLP and confirmed by DNA sequencing as well as snpBLAST. Allele frequencies of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C were calculated using the Hardy Weinberg equation. Methods The 114 healthy volunteers were recruited for this study, and their DNA was extracted. Primer pair was designed using Primer 3 Software version 0.4.0 and validated against the BLAST database. The primer specificity, functionality and annealing temperature were tested using uniplex PCR methods that were later combined into a single multiplex PCR. Restriction Fragment Length Polymorphism (RFLP was performed in three separate tubes followed by agarose gel electrophoresis. PCR product residual was purified and sent for DNA sequencing. Results The allele frequencies for MTHFR 677 C > T were 0.89 (C allele and 0.11 (T allele; for eNOS +894 G > T, the allele frequencies were 0.58 (G allele and 0.43 (T allele; and for eNOS −786 T > C, the allele

  20. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox

  1. On optical detection of densely labeled synapses in neuropil and mapping connectivity with combinatorially multiplexed fluorescent synaptic markers.

    Directory of Open Access Journals (Sweden)

    Yuriy Mishchenko

    Full Text Available We propose a new method for mapping neural connectivity optically, by utilizing Cre/Lox system Brainbow to tag synapses of different neurons with random mixtures of different fluorophores, such as GFP, YFP, etc., and then detecting patterns of fluorophores at different synapses using light microscopy (LM. Such patterns will immediately report the pre- and post-synaptic cells at each synaptic connection, without tracing neural projections from individual synapses to corresponding cell bodies. We simulate fluorescence from a population of densely labeled synapses in a block of hippocampal neuropil, completely reconstructed from electron microscopy data, and show that high-end LM is able to detect such patterns with over 95% accuracy. We conclude, therefore, that with the described approach neural connectivity in macroscopically large neural circuits can be mapped with great accuracy, in scalable manner, using fast optical tools, and straightforward image processing. Relying on an electron microscopy dataset, we also derive and explicitly enumerate the conditions that should be met to allow synaptic connectivity studies with high-resolution optical tools.

  2. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    Science.gov (United States)

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  3. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  4. Aplicación de las pruebas de PCR convencional simple y múltiple para la identificación de aislamientos de Leptospira spp. en Colombia Application of conventional and multiplex PCR assays for identification of isolates of Leptospira spp. in Colombia

    Directory of Open Access Journals (Sweden)

    Natali Moreno

    2010-12-01

    and multiplex PCR methods (using primers directed against lipl32 and secY/flaB genes, respectively. To assess the capacity of PCR methods to identify pathogenic and saprophytic species of Leptospira ssp. Material and methods. 22 international reference strains and 12 colombian isolates were used. DNA was extracted with a commercial kit (Wizard. Specificity and sensitivity of both PCR methods were evaluated. Results. The maximum dilution of DNA samples allowing the detection of Leptospira ssp was determined to be 1:10000 for the PCR lipL32 and 1:100/1:1000 for the multiplex PCR secY/flaB. Both PCR didn’t detect DNA from microorganisms unrelated to Leptospira ssp. The lipL32 PCR specifically amplified a 423bp fragment from all pathogenic Leptospira reference strains, while the secY/flaB PCR amplified both 285bp (secY and 793bp (flaB fragments from 18 reference strains. The lipL32 PCR detected 7/12 colombian isolates, while secY/flaB PCR detected both secY and flaB genes from 6/12 isolates. Conclusions. Best results were obtained with the lipL32 PCR, which displayed a better sensitivity and a better capacity to detect different strains than the multiplex PCR. The secY primers showed a poor specificity to pathogenic species and a poor sensitivity. Thus, lipL32 primers show high potential for molecular diagnosis of Leptospira spp in clinical and environmental samples.

  5. Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Noor, M Omair; Krull, Ulrich J

    2013-08-06

    A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

  6. Analysis of Light Gathering Abilities of Dynamically Solidified Micro-lenses, and Their Implementation to Improve Sensitivity of Fluorescent PCR Micro-detectors.

    Science.gov (United States)

    Wu, Jian; Guo, Wei; Wang, Chunyan; Yu, Kuanxin; Chen, Tao; Li, Yinghui

    2015-06-01

    Fluorescent polymerase chain reaction (PCR) is becoming the preferred method of quantitative analysis due to its high specificity and sensitivity. We propose to use a new kind of micro-lens, dynamically solidified with optic glue, to improve the sensitivity of fluorescent PCR micro-detector. We developed light ray track equations for these lenses and used them to calculate relative light intensity distribution curve for stimulation lenses and illumination point probability distribution curve for detection lenses. We manufactured dynamically solidified micro-lenses using optic glue NOA61, and measured their light gathering ability. Lenses with radius/thickness (R/H) ratio of 4 reached light focusing ratio of 3.85 (stimulation lens) and photon collection efficiency of 0.86 (detection lens). We then used dynamically solidified lenses in PCR fluorescence micro-detector and analyzed their effect on the detector sensitivity. We showed that the use of dynamically solidified micro-lenses with R/H = 4 resulted in over 4.4-fold increased sensitivity of the detector.

  7. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  8. Comparison of a new multiplex real-time PCR with the Kato Katz thick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools.

    Science.gov (United States)

    Ng-Nguyen, Dinh; Stevenson, Mark A; Dorny, Pierre; Gabriël, Sarah; Vo, Tinh Van; Nguyen, Van-Anh Thi; Phan, Trong Van; Hii, Sze Fui; Traub, Rebecca J

    2017-07-01

    Taenia solium, the cause of neurocysticercosis (NCC), has significant socioeconomic impacts on communities in developing countries. This disease, along with taeniasis is estimated to infect 2.5 to 5 million people globally. Control of T. solium NCC necessitates accurate diagnosis and treatment of T. solium taeniasis carriers. In areas where all three species of Taenia tapeworms (T. solium, Taenia saginata and Taenia asiatica) occur sympatrically, conventional microscope- and copro-antigen based diagnostic methods are unable to distinguish between these three Taenia species. Molecular diagnostic tools have been developed to overcome this limitation; however, conventional PCR-based techniques remain unsuitable for large-scale deployment in community-based surveys. Moreover, a real-time PCR (qPCR) for the discrimination of all three species of Taenia in human stool does not exist. This study describes the development and validation of a new triplex Taq-Man probe-based qPCR for the detection and discrimination of all three Taenia human tapeworms in human stools collected from communities in the Central Highlands of Vietnam. The diagnostic characteristics of the test are compared with conventional Kato Katz (KK) thick smear and copro-antigen ELISA (cAgELISA) method utilizing fecal samples from a community based cross-sectional study. Using this new multiplex real-time PCR we provide an estimate of the true prevalence of taeniasis in the source population for the community based cross-sectional study. Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1) gene of T. solium and the cytochrome oxidase subunit I (COX-1) gene of T. saginata and T. asiatica. The newly designed triplex qPCR (T3qPCR) was compared to KK and cAgELISA for the detection of Taenia eggs in stool samples collected from 342 individuals in Dak Lak province, Central

  9. Comparison of a new multiplex real-time PCR with the Kato Katz thick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools.

    Directory of Open Access Journals (Sweden)

    Dinh Ng-Nguyen

    2017-07-01

    Full Text Available Taenia solium, the cause of neurocysticercosis (NCC, has significant socioeconomic impacts on communities in developing countries. This disease, along with taeniasis is estimated to infect 2.5 to 5 million people globally. Control of T. solium NCC necessitates accurate diagnosis and treatment of T. solium taeniasis carriers. In areas where all three species of Taenia tapeworms (T. solium, Taenia saginata and Taenia asiatica occur sympatrically, conventional microscope- and copro-antigen based diagnostic methods are unable to distinguish between these three Taenia species. Molecular diagnostic tools have been developed to overcome this limitation; however, conventional PCR-based techniques remain unsuitable for large-scale deployment in community-based surveys. Moreover, a real-time PCR (qPCR for the discrimination of all three species of Taenia in human stool does not exist. This study describes the development and validation of a new triplex Taq-Man probe-based qPCR for the detection and discrimination of all three Taenia human tapeworms in human stools collected from communities in the Central Highlands of Vietnam. The diagnostic characteristics of the test are compared with conventional Kato Katz (KK thick smear and copro-antigen ELISA (cAgELISA method utilizing fecal samples from a community based cross-sectional study. Using this new multiplex real-time PCR we provide an estimate of the true prevalence of taeniasis in the source population for the community based cross-sectional study.Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1 gene of T. solium and the cytochrome oxidase subunit I (COX-1 gene of T. saginata and T. asiatica. The newly designed triplex qPCR (T3qPCR was compared to KK and cAgELISA for the detection of Taenia eggs in stool samples collected from 342 individuals in Dak Lak province

  10. Comparison of a new multiplex real-time PCR with the Kato Katz thick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools

    Science.gov (United States)

    Stevenson, Mark A.; Dorny, Pierre; Gabriël, Sarah; Vo, Tinh Van; Nguyen, Van-Anh Thi; Phan, Trong Van; Hii, Sze Fui; Traub, Rebecca J.

    2017-01-01

    Background Taenia solium, the cause of neurocysticercosis (NCC), has significant socioeconomic impacts on communities in developing countries. This disease, along with taeniasis is estimated to infect 2.5 to 5 million people globally. Control of T. solium NCC necessitates accurate diagnosis and treatment of T. solium taeniasis carriers. In areas where all three species of Taenia tapeworms (T. solium, Taenia saginata and Taenia asiatica) occur sympatrically, conventional microscope- and copro-antigen based diagnostic methods are unable to distinguish between these three Taenia species. Molecular diagnostic tools have been developed to overcome this limitation; however, conventional PCR-based techniques remain unsuitable for large-scale deployment in community-based surveys. Moreover, a real-time PCR (qPCR) for the discrimination of all three species of Taenia in human stool does not exist. This study describes the development and validation of a new triplex Taq-Man probe-based qPCR for the detection and discrimination of all three Taenia human tapeworms in human stools collected from communities in the Central Highlands of Vietnam. The diagnostic characteristics of the test are compared with conventional Kato Katz (KK) thick smear and copro-antigen ELISA (cAgELISA) method utilizing fecal samples from a community based cross-sectional study. Using this new multiplex real-time PCR we provide an estimate of the true prevalence of taeniasis in the source population for the community based cross-sectional study. Methodology/Principal findings Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1) gene of T. solium and the cytochrome oxidase subunit I (COX-1) gene of T. saginata and T. asiatica. The newly designed triplex qPCR (T3qPCR) was compared to KK and cAgELISA for the detection of Taenia eggs in stool samples collected from 342

  11. Analogue multiplexer

    International Nuclear Information System (INIS)

    Gorshkov, V.A.; Kuznetsov, A.N.

    1980-01-01

    In systems of signal recording from several parallel spectrometric channels one can considerably reduce the total apparatus volume using a special unit - an analog multiplexer. A description of the multiplexer in the CAMAC system on the base of fast linear gating circuits which allows one analog-to-code converter to attend four spectrometric channels is given. On the example of the 4-channel spectrometer the logics of interaction of the multiple with analog-to-digital coxernver and signal recorder is shown. Electrical and functional multiplexer flow-sheets are given and its main characteristics are presented

  12. Simultaneous detection of Legionella species and L. anisa, L. bozemanii, L. longbeachae and L. micdadei using conserved primers and multiple probes in a multiplex real-time PCR assay.

    Science.gov (United States)

    Cross, Kristen E; Mercante, Jeffrey W; Benitez, Alvaro J; Brown, Ellen W; Diaz, Maureen H; Winchell, Jonas M

    2016-07-01

    Legionnaires' disease is a severe respiratory disease that is estimated to cause between 8,000 and 18,000 hospitalizations each year, though the exact burden is unknown due to under-utilization of diagnostic testing. Although Legionella pneumophila is the most common species detected in clinical cases (80-90%), other species have also been reported to cause disease. However, little is known about Legionnaires' disease caused by these non-pneumophila species. We designed a multiplex real-time PCR assay for detection of all Legionella spp. and simultaneous specific identification of four clinically-relevant Legionella species, L. anisa, L. bozemanii, L. longbeachae, and L. micdadei, using 5'-hydrolysis probe real-time PCR. The analytical sensitivity for detection of nucleic acid from each target species was ≤50fg per reaction. We demonstrated the utility of this assay in spiked human sputum specimens. This assay could serve as a tool for understanding the scope and impact of non-pneumophila Legionella species in human disease. Published by Elsevier Inc.

  13. Lutzomyia (Pintomyia) fischeri (Diptera: Psychodidae: Phlebotominae), a probable vector of American cutaneous leishmaniasis: detection of natural infection by Leishmania (Viannia) DNA in specimens from the municipality of Porto Alegre (RS), Brazil, using multiplex PCR assay.

    Science.gov (United States)

    Pita-Pereira, Daniela de; Souza, Getúlio D; Pereira, Thaís de Araújo; Zwetsch, Adriana; Britto, Constança; Rangel, Elizabeth F

    2011-12-01

    In order to determine natural Leishmania (Viannia) infection in Lutzomyia (Pintomyia) fischeri, a multiplex PCR methodology coupled to non-isotopic hybridization was adopted for the analysis of sand fly samples collected by CDC light traps in an endemic area of American Cutaneous Leishmaniasis (ACL) in the periurban region of the municipality of Porto Alegre, Rio Grande do Sul State, Brazil. We analyzed by PCR methodology 560 specimens of Lutzomyia (Pintomyia) fischeri (520 females and 40 males). The wild sand flies were grouped into 56 pools (52 females and 4 males) of 10 each, and positive results were detected in 2 of the 52 female pools, representing a minimum infection rate of 0.38% based on the presence of at least 1 infected insect in the pool. This result associated with some local evidence such as anthopophily, spatial distribution in accordance with the transmission area and human case incidence, suggests that L. (P.)fischeri may be considered as a secondary vector of ACL in the studied locality. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Multiplex real-time quantitative PCR, microscopy and rapid diagnostic immuno-chromatographic tests for the detection of Plasmodium spp: performance, limit of detection analysis and quality assurance

    Directory of Open Access Journals (Sweden)

    Ralevski Filip

    2009-12-01

    costly than reference microscopy. Discussion These data suggest that multiplex QPCR although more costly confers a significant diagnostic advantage in terms of LOD compared to reference microscopy and ICTs for all four species. Quality assurance of QPCR is essential to the maintenance of proficiency in the clinical laboratory. ICTs showed good concordance between readers however lacked sensitivity for non-falciparum species due to antigenic differences and low parasitemia. Conclusion Multiplex QPCR but not ICTs is an essential adjunct to microscopy in the reference laboratory detection of malaria species specifically due to the superior LOD. ICTs are better suited to the non-reference laboratory where lower specimen volumes challenge microscopy proficiency in the non-endemic setting.

  15. Simultaneous discrimination of species and strains in Lactobacillus rhamnosus using species-specific PCR combined with multiplex mini-sequencing technology.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen

    2015-12-01

    This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

    Science.gov (United States)

    Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

    2010-12-01

    This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

  17. Whole Genome Sequencing and Multiplex qPCR Methods to Identify Campylobacter jejuni Encoding cst-II or cst-III Sialyltransferase

    Directory of Open Access Journals (Sweden)

    Jason M. Neal-McKinney

    2018-03-01

    Full Text Available Campylobacter jejuni causes more than 2 million cases of gastroenteritis annually in the United States, and is also linked to the autoimmune sequelae Guillan–Barre syndrome (GBS. GBS often results in flaccid paralysis, as the myelin sheaths of nerve cells are degraded by the adaptive immune response. Certain strains of C. jejuni modify their lipooligosaccharide (LOS with the addition of neuraminic acid, resulting in LOS moieties that are structurally similar to gangliosides present on nerve cells. This can trigger GBS in a susceptible host, as antibodies generated against C. jejuni can cross-react with gangliosides, leading to demyelination of nerves and a loss of signal transduction. The goal of this study was to develop a quantitative PCR (qPCR method and use whole genome sequencing data to detect the Campylobactersialyltransferase (cst genes responsible for the addition of neuraminic acid to LOS. The qPCR method was used to screen a library of 89 C. jejuni field samples collected by the Food and Drug Administration Pacific Northwest Lab (PNL as well as clinical isolates transferred to PNL. In silico analysis was used to screen 827 C. jejuni genomes in the FDA GenomeTrakr SRA database. The results indicate that a majority of C. jejuni strains could produce LOS with ganglioside mimicry, as 43.8% of PNL isolates and 46.9% of the GenomeTrakr isolates lacked the cst genes. The methods described in this study can be used by public health laboratories to rapidly determine whether a C. jejuni isolate has the potential to induce GBS. Based on these results, a majority of C. jejuni in the PNL collection and submitted to GenomeTrakr have the potential to produce LOS that mimics human gangliosides.

  18. A Multiplex Real-Time PCR Assay to Diagnose and Separate Helicoverpa armigera and H. zea (Lepidoptera: Noctuidae) in the New World.

    Science.gov (United States)

    Gilligan, Todd M; Tembrock, Luke R; Farris, Roxanne E; Barr, Norman B; van der Straten, Marja J; van de Vossenberg, Bart T L H; Metz-Verschure, Eveline

    2015-01-01

    The Old World bollworm, Helicoverpa armigera (Hübner), and the corn earworm, H. zea (Boddie), are two of the most important agricultural pests in the world. Diagnosing these two species is difficult-adults can only be separated with a complex dissection, and larvae cannot be identified to species using morphology, necessitating the use of geographic origin for identification in most instances. With the discovery of H. armigera in the New World, identification of immature Helicoverpa based on origin is no longer possible because H. zea also occurs in all of the geographic regions where H. armigera has been discovered. DNA barcoding and restriction fragment length polymorphism (RFLP) analyses have been reported in publications to distinguish these species, but these methods both require post-PCR processing (i.e., DNA sequencing or restriction digestion) to complete. We report the first real-time PCR assay to distinguish these pests based on two hydrolysis probes that bind to a segment of the internal transcribed spacer region 2 (ITS2) amplified using a single primer pair. One probe targets H. armigera, the second probe targets H. zea, and a third probe that targets a conserved segment of 18S rDNA is used as a control of DNA quality. The assay can be completed in 50 minutes when using isolated DNA and is successfully tested on larvae intercepted at ports of entry and adults captured during domestic surveys. We demonstrate that the assay can be run in triplex with no negative effects on sensitivity, can be run using alternative real-time PCR reagents and instruments, and does not cross react with other New World Heliothinae.

  19. A Multiplex Real-Time PCR Assay to Diagnose and Separate Helicoverpa armigera and H. zea (Lepidoptera: Noctuidae in the New World.

    Directory of Open Access Journals (Sweden)

    Todd M Gilligan

    Full Text Available The Old World bollworm, Helicoverpa armigera (Hübner, and the corn earworm, H. zea (Boddie, are two of the most important agricultural pests in the world. Diagnosing these two species is difficult-adults can only be separated with a complex dissection, and larvae cannot be identified to species using morphology, necessitating the use of geographic origin for identification in most instances. With the discovery of H. armigera in the New World, identification of immature Helicoverpa based on origin is no longer possible because H. zea also occurs in all of the geographic regions where H. armigera has been discovered. DNA barcoding and restriction fragment length polymorphism (RFLP analyses have been reported in publications to distinguish these species, but these methods both require post-PCR processing (i.e., DNA sequencing or restriction digestion to complete. We report the first real-time PCR assay to distinguish these pests based on two hydrolysis probes that bind to a segment of the internal transcribed spacer region 2 (ITS2 amplified using a single primer pair. One probe targets H. armigera, the second probe targets H. zea, and a third probe that targets a conserved segment of 18S rDNA is used as a control of DNA quality. The assay can be completed in 50 minutes when using isolated DNA and is successfully tested on larvae intercepted at ports of entry and adults captured during domestic surveys. We demonstrate that the assay can be run in triplex with no negative effects on sensitivity, can be run using alternative real-time PCR reagents and instruments, and does not cross react with other New World Heliothinae.

  20. Use of multiplex PCR based molecular diagnostics in diagnosis of suspected CNS infections in tertiary care setting-A retrospective study.

    Science.gov (United States)

    Javali, Mahendra; Acharya, Purushottam; Mehta, Aneesh; John, Aju Abraham; Mahale, Rohan; Srinivasa, R

    2017-10-01

    CNS infections like meningitis and encephalitis pose enormous healthcare challenges due to mortality, sequelae and socioeconomic burden. In tertiary setting, clinical, microbiological, cytological and radiological investigations are not distinctive enough for diagnosing microbial etiology. Molecular diagnostics is filling this gap. We evaluated the clinical impact of a commercially available multiplex molecular diagnostic system - SES for diagnosing suspected CNS infections. This study was conducted in our tertiary level Neurology ICU. 110 patients admitted during Nov-2010 to April-2014 were included. CSF samples of patients clinically suspected of having CNS infections were subjected to routine investigation in our laboratory and SES test at XCyton Diagnostics. We studied the impact of SES in diagnosis of CNS infections and its efficacy in helping therapeutic management. SES showed detection rate of 42.18% and clinical specificity of 100%. It had 10 times higher detection rate than conventional tests. Streptococcus pneumoniae and Mycobacterium tuberculosis were two top bacterial pathogens. VZV was most detected viral pathogen. SES results elicited changes in therapy in both positive and negative cases. We observed superior patient outcomes as measured by GCS scale. 75% and 82.14% of the patients positive and negative on SES respectively, recovered fully. Detecting causative organism and ruling out infectious etiology remain the most critical aspect for management and prognosis of patients with suspected CNS infections. In this study, we observed higher detection rate of pathogens, target specific escalation and evidence based de-escalation of antimicrobials using SES. Institution of appropriate therapy helped reduce unnecessary use of antimicrobials. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  2. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Sal