WorldWideScience

Sample records for fluorescent amplified fragment

  1. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  2. Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2012-09-15

    Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

  3. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  5. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  6. Amplifier channel for a fission fragment semiconductor detector

    International Nuclear Information System (INIS)

    Tyurin, G.P.

    1981-01-01

    To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

  7. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...

  8. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  9. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  10. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

  11. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  12. Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Angen, Øystein

    2007-01-01

    Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

  13. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

    Science.gov (United States)

    Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

  14. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  15. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  16. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  17. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  18. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  19. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

  1. Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

    1999-01-01

    The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

  2. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  3. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  4. Mass amplifying probe for sensitive fluorescence anisotropy detection of small molecules in complex biological samples.

    Science.gov (United States)

    Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James

    2012-07-03

    Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective

  5. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  6. Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

    Science.gov (United States)

    K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

    1994-01-01

    A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

  7. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  8. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  9. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  10. Technique for Increasing the Selectivity of the Method of Laser Fragmentation/Laser-Induced Fluorescence

    Science.gov (United States)

    Bobrovnikov, S. M.; Gorlov, E. V.; Zharkov, V. I.

    2018-05-01

    A technique for increasing the selectivity of the method of detecting high-energy materials (HEMs) based on laser fragmentation of HEM molecules with subsequent laser excitation of fluorescence of the characteristic NO fragments from the first vibrational level of the ground state is suggested.

  11. Fluorescent hydroxylamine derived from the fragmentation of PAMAM dendrimers for intracellular hypochlorite recognition.

    Science.gov (United States)

    Wu, Te-Haw; Liu, Ching-Ping; Chien, Chih-Te; Lin, Shu-Yi

    2013-08-26

    Herein, a promising sensing approach based on the structure fragmentation of poly(amidoamine) (PAMAM) dendrimers for the selective detection of intracellular hypochlorite (OCl(-)) is reported. PAMAM dendrimers were easily disrupted by a cascade of oxidations in the tertiary amines of the dendritic core to produce an unsaturated hydroxylamine with blue fluorescence. Specially, the novel fluorophore was only sensitive to OCl(-), one of reactive oxygen species (ROS), resulting in an irreversible fluorescence turn-off. The fluorescent hydroxylamine was selectively oxidised by OCl(-) to form a labile oxoammonium cation that underwent further degradation. Without using any troublesomely synthetic steps, the novel sensing platform based on the fragmentation of PAMAM dendrimers, can be applied to detect OCl(-) in macrophage cells. The results suggest that the sensing approach may be useful for the detection of intracellular OCl(-) with minimal interference from biological matrixes. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Enhanced 1.32 μm fluorescence and broadband amplifying for O-band optical amplifier in Nd3+-doped tellurite glass

    Science.gov (United States)

    Zhou, Zi-zhong; Zhou, Ming-han; Su, Xiu-e.; Cheng, Pan; Zhou, Ya-xun

    2017-01-01

    WO3 oxides with relatively high phonon energy and different concentrations were introduced into the Nd3+-doped tellurite-based glasses of TeO2-ZnO-Na2O to improve the 1.32 μm band fluorescence emission. The absorption spectra, Raman spectra, 1.32 μm band fluorescence spectra and differential scanning calorimeter (DSC) curves were measured, together with the Judd-Ofelt intensity parameters, stimulated emission and gain parameters were calculated to evaluate the effects of WO3 amount on the glass structure and spectroscopic properties of 1.32 μm band fluorescence. It is shown that the introduction of an appropriate amount of WO3 oxide can effectively improve the 1.32 μm band fluorescence intensity through the enhanced multi-phonon relaxation (MPR) processes between the excited levels of Nd3+. The results indicate that the prepared Nd3+-doped tellurite glass with an appropriate amount of WO3 oxide is a potential gain medium applied for the O-band broad and high-gain fiber amplifier.

  13. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  14. Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

    Science.gov (United States)

    Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

    2016-06-01

    To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

  15. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  16. Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Qiu, T; Jiang, L L; Yang, Y F

    2016-08-19

    The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

  17. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

  18. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  19. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  20. A recombinant estrogen receptor fragment-based homogeneous fluorescent assay for rapid detection of estrogens.

    Science.gov (United States)

    Wang, Dan; Xie, Jiangbi; Zhu, Xiaocui; Li, Jinqiu; Zhao, Dongqin; Zhao, Meiping

    2014-05-15

    In this work, we demonstrate a novel estrogenic receptor fragment-based homogeneous fluorescent assay which enables rapid and sensitive detection of 17β-estradiol (E2) and other highly potent estrogens. A modified human estrogenic receptor fragment (N-His × 6-hER270-595-C-Strep tag II) has been constructed that contains amino acids 270-595 of wild-type human estrogenic receptor α (hER270-595) and two specific tags (6 × His and Strep tag II) fused to the N and C terminus, respectively. The designed receptor protein fragment could be easily produced by prokaryotic expression with high yield and high purity. The obtained protein exhibits high binding affinity to E2 and the two tags greatly facilitate the application of the recombinant protein. Taking advantage of the unique spectroscopic properties of coumestrol (CS), a fluorescent phytoestrogen, a CS/hER270-595-based fluorescent assay has been developed which can sensitively respond to E2 within 1.0 min with a linear working range from 0.1 to 20 ng/mL and a limit of detection of 0.1 ng/mL. The assay was successfully applied for rapid detection of E2 in the culture medium of rat hippocampal neurons. The method also holds great potential for high-throughput monitoring the variation of estrogen levels in complex biological fluids, which is crucial for investigation of the molecular basis of various estrogen-involved processes. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  3. Scanning force microscopy and fluorescence microscopy of microcontact printed antibodies and antibody fragments.

    Science.gov (United States)

    LaGraff, John R; Chu-LaGraff, Quynh

    2006-05-09

    Unlabeled primary immunoglobulin G (IgG) antibodies and its F(ab')2 and Fc fragments were attached to oxygen-plasma-cleaned glass substrates using either microcontact printing (MCP) or physical adsorption during bath application from dilute solutions. Fluorescently labeled secondary IgGs were then bound to surface-immobilized IgG, and the relative surface coverage was determined by measuring the fluorescence intensity. Results indicated that the surface coverage of IgG increased with increasing protein solution concentration for both MCP and bath-applied IgG and that a greater concentration of IgG was transferred to a glass substrate using MCP than during physisorption during bath applications. Scanning force microscopy (SFM) showed that patterned MCP IgG monolayers were 5 nm in height, indicating that IgG molecules lie flat on the substrate. After incubation with a secondary IgG, the overall line thickness increased to around 15 nm, indicating that the secondary IgG was in a more vertical orientation with respect to the substrate. The surface roughness of these MCP patterned IgG bilayers as measured by SFM was observed to increase with increasing surface coverage. Physisorption of IgG to both unmodified patterned polydimethylsiloxane (PDMS) stamps and plasma-cleaned glass substrates was modeled by Langmuir adsorption kinetics yielding IgG binding constants of K(MCP) = 1.7(2) x 10(7) M(-1) and K(bath) = 7.8(7) x 10(5) M(-1), respectively. MCP experiments involving primary F(ab')2 and Fc fragments incubated in fluorescently labeled fragment-specific secondary IgGs were carried out to test for the function and orientation of IgG. Finally, possible origins of MCP stamping defects such as pits, pull outs, droplets, and reverse protein transfer are discussed.

  4. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  5. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  6. Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Brouat, C; McKey, D; Douzery, E J P

    2004-05-01

    Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

  7. Amplified fluorescent aptasensor through catalytic recycling for highly sensitive detection of ochratoxin A.

    Science.gov (United States)

    Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang

    2015-03-15

    This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  9. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  10. O-GlcNAcase Fragment Discovery with Fluorescence Polarimetry.

    Science.gov (United States)

    Borodkin, Vladimir S; Rafie, Karim; Selvan, Nithya; Aristotelous, Tonia; Navratilova, Iva; Ferenbach, Andrew T; van Aalten, Daan M F

    2018-05-18

    The attachment of the sugar N-acetyl-D-glucosamine (GlcNAc) to specific serine and threonine residues on proteins is referred to as protein O-GlcNAcylation. O-GlcNAc transferase (OGT) is the enzyme responsible for carrying out the modification, while O-GlcNAcase (OGA) reverses it. Protein O-GlcNAcylation has been implicated in a wide range of cellular processes including transcription, proteostasis, and stress response. Dysregulation of O-GlcNAc has been linked to diabetes, cancer, and neurodegenerative and cardiovascular disease. OGA has been proposed to be a drug target for the treatment of Alzheimer's and cardiovascular disease given that increased O-GlcNAc levels appear to exert a protective effect. The search for specific, potent, and drug-like OGA inhibitors with bioavailability in the brain is therefore a field of active research, requiring orthogonal high-throughput assay platforms. Here, we describe the synthesis of a novel probe for use in a fluorescence polarization based assay for the discovery of inhibitors of OGA. We show that the probe is suitable for use with both human OGA, as well as the orthologous bacterial counterpart from Clostridium perfringens, CpOGA, and the lysosomal hexosaminidases HexA/B. We structurally characterize CpOGA in complex with a ligand identified from a fragment library screen using this assay. The versatile synthesis procedure could be adapted for making fluorescent probes for the assay of other glycoside hydrolases.

  11. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  12. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  13. Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

    Science.gov (United States)

    Johnsen, G; Kruse, H; Hofshagen, M

    2006-12-01

    We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

  14. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  15. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  16. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  17. High-efficiency electroluminescence and amplified spontaneous emission from a thermally activated delayed fluorescent near-infrared emitter

    Science.gov (United States)

    Kim, Dae-Hyeon; D'Aléo, Anthony; Chen, Xian-Kai; Sandanayaka, Atula D. S.; Yao, Dandan; Zhao, Li; Komino, Takeshi; Zaborova, Elena; Canard, Gabriel; Tsuchiya, Youichi; Choi, Eunyoung; Wu, Jeong Weon; Fages, Frédéric; Brédas, Jean-Luc; Ribierre, Jean-Charles; Adachi, Chihaya

    2018-02-01

    Near-infrared organic light-emitting diodes and semiconductor lasers could benefit a variety of applications including night-vision displays, sensors and information-secured displays. Organic dyes can generate electroluminescence efficiently at visible wavelengths, but organic light-emitting diodes are still underperforming in the near-infrared region. Here, we report thermally activated delayed fluorescent organic light-emitting diodes that operate at near-infrared wavelengths with a maximum external quantum efficiency of nearly 10% using a boron difluoride curcuminoid derivative. As well as an effective upconversion from triplet to singlet excited states due to the non-adiabatic coupling effect, this donor-acceptor-donor compound also exhibits efficient amplified spontaneous emission. By controlling the polarity of the active medium, the maximum emission wavelength of the electroluminescence spectrum can be tuned from 700 to 780 nm. This study represents an important advance in near-infrared organic light-emitting diodes and the design of alternative molecular architectures for photonic applications based on thermally activated delayed fluorescence.

  18. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  19. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  20. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  1. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  2. Generation and characterization of a stable red fluorescent ...

    African Journals Online (AJOL)

    An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...

  3. TRANSGENIC STRATEGY FOR IDENTIFYING SYNAPTIC CONNECTIONS IN MICE BY FLUORESCENCE COMPLEMENTATION (GRASP

    Directory of Open Access Journals (Sweden)

    Masahito eYamagata

    2012-02-01

    Full Text Available In the "GFP reconstitution across synaptic partners" (GRASP method, non-fluorescent fragments of GFP are expressed in two different neurons; the fragments self-assemble at synapses between the two to form a fluorophore. GRASP has proven useful for light microscopic identification of synapses in two invertebrate species, Caenorhabditis elegans and Drosophila melanogaster, but has not yet been applied to vertebrates. Here, we describe GRASP constructs that function in mammalian cells and implement a transgenic strategy in which a Cre-dependent gene switch leads to expression of the two fragments in mutually exclusive neuronal subsets in mice. Using a transgenic line that expresses Cre selectively in rod photoreceptors, we demonstrate labeling of synapses in the outer plexiform layer of the retina. Labeling is specific, in that synapses made by rods remain labeled for at least 6 months whereas nearby synapses made by intercalated cone photoreceptors on many of the same interneurons remain unlabeled. We also generated antisera that label reconstituted GFP but neither fragment in order to amplify the GRASP signal and thereby increase the sensitivity of the method.

  4. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  5. Plasmonically amplified fluorescence bioassay with microarray format

    Science.gov (United States)

    Gogalic, S.; Hageneder, S.; Ctortecka, C.; Bauch, M.; Khan, I.; Preininger, Claudia; Sauer, U.; Dostalek, J.

    2015-05-01

    Plasmonic amplification of fluorescence signal in bioassays with microarray detection format is reported. A crossed relief diffraction grating was designed to couple an excitation laser beam to surface plasmons at the wavelength overlapping with the absorption and emission bands of fluorophore Dy647 that was used as a label. The surface of periodically corrugated sensor chip was coated with surface plasmon-supporting gold layer and a thin SU8 polymer film carrying epoxy groups. These groups were employed for the covalent immobilization of capture antibodies at arrays of spots. The plasmonic amplification of fluorescence signal on the developed microarray chip was tested by using interleukin 8 sandwich immunoassay. The readout was performed ex situ after drying the chip by using a commercial scanner with high numerical aperture collecting lens. Obtained results reveal the enhancement of fluorescence signal by a factor of 5 when compared to a regular glass chip.

  6. Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

    OpenAIRE

    Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

    2001-01-01

    Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

  7. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  8. An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

    Science.gov (United States)

    Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

    2013-04-15

    An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  10. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  11. Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

    International Nuclear Information System (INIS)

    Zhao, B.; Zheng, X.Z.

    2015-01-01

    Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

  12. Protein subcellular localization assays using split fluorescent proteins

    Science.gov (United States)

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2009-09-08

    The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

  13. Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bernander, S

    2000-01-01

    The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

  14. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  15. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  16. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  17. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  18. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  19. X-ray image amplifying tube

    International Nuclear Information System (INIS)

    1977-01-01

    The photo electrons from the picture on the fluorescent input screen are amplified by an electron optical system and produce an intensified image on the output screen. This can be photographed and shown on a TV screen. The effects of stray magnetic fields are reduced by covering the input screen with a grating made of strips of ferromagnetic material such as μ metal. (T.S.E.T.)

  20. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    Science.gov (United States)

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  1. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  2. RNA signal amplifier circuit with integrated fluorescence output.

    Science.gov (United States)

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  3. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  4. Evaluation of chemical fluorescent dyes as a protein conjugation partner for live cell imaging.

    Directory of Open Access Journals (Sweden)

    Yoko Hayashi-Takanaka

    Full Text Available To optimize live cell fluorescence imaging, the choice of fluorescent substrate is a critical factor. Although genetically encoded fluorescent proteins have been used widely, chemical fluorescent dyes are still useful when conjugated to proteins or ligands. However, little information is available for the suitability of different fluorescent dyes for live imaging. We here systematically analyzed the property of a number of commercial fluorescent dyes when conjugated with antigen-binding (Fab fragments directed against specific histone modifications, in particular, phosphorylated H3S28 (H3S28ph and acetylated H3K9 (H3K9ac. These Fab fragments were conjugated with a fluorescent dye and loaded into living HeLa cells. H3S28ph-specific Fab fragments were expected to be enriched in condensed chromosomes, as H3S28 is phosphorylated during mitosis. However, the degree of Fab fragment enrichment on mitotic chromosomes varied depending on the conjugated dye. In general, green fluorescent dyes showed higher enrichment, compared to red and far-red fluorescent dyes, even when dye:protein conjugation ratios were similar. These differences are partly explained by an altered affinity of Fab fragment after dye-conjugation; some dyes have less effect on the affinity, while others can affect it more. Moreover, red and far-red fluorescent dyes tended to form aggregates in the cytoplasm. Similar results were observed when H3K9ac-specific Fab fragments were used, suggesting that the properties of each dye affect different Fab fragments similarly. According to our analysis, conjugation with green fluorescent dyes, like Alexa Fluor 488 and Dylight 488, has the least effect on Fab affinity and is the best for live cell imaging, although these dyes are less photostable than red fluorescent dyes. When multicolor imaging is required, we recommend the following dye combinations for optimal results: Alexa Fluor 488 (green, Cy3 (red, and Cy5 or CF640 (far-red.

  5. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  6. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  7. Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bergmans, A

    2002-01-01

    The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

  8. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  9. Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome

    International Nuclear Information System (INIS)

    Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie

    2008-01-01

    Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus

  10. Amplification of the Signal Intensity of Fluorescence-Based Fiber-Optic Biosensors Using a Fabry-Perot Resonator Structure

    Directory of Open Access Journals (Sweden)

    Meng-Chang Hsieh

    2015-02-01

    Full Text Available Fluorescent biosensors have been widely used in biomedical applications. To amplify the intensity of fluorescence signals, this study developed a novel structure for an evanescent wave fiber-optic biosensor by using a Fabry-Perot resonator structure. An excitation light was coupled into the optical fiber through a laser-drilled hole on the proximal end of the resonator. After entering the resonator, the excitation light was reflected back and forth inside the resonator, thereby amplifying the intensity of the light in the fiber. Subsequently, the light was used to excite the fluorescent molecules in the reactive region of the sensor. The experimental results showed that the biosensor signal was amplified eight-fold when the resonator reflector was formed using a 92% reflective coating. Furthermore, in a simulation, the biosensor signal could be amplified 20-fold by using a 99% reflector.

  11. Gold and silver nanoparticles based superquenching of fluorescence: A review

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Debanjana; Chattopadhyay, Nitin, E-mail: nitin.chattopadhyay@yahoo.com

    2015-04-15

    The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K{sub SV}~10{sup 7}–10{sup 10} mol{sup −1} dm{sup 3}) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10{sup 2} mol{sup −1} dm{sup 3}). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors.

  12. Gold and silver nanoparticles based superquenching of fluorescence: A review

    International Nuclear Information System (INIS)

    Ghosh, Debanjana; Chattopadhyay, Nitin

    2015-01-01

    The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K SV ~10 7 –10 10 mol −1 dm 3 ) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10 2 mol −1 dm 3 ). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors

  13. Scanning fluorescence detector for high-throughput DNA genotyping

    Science.gov (United States)

    Rusch, Terry L.; Petsinger, Jeremy; Christensen, Carl; Vaske, David A.; Brumley, Robert L., Jr.; Luckey, John A.; Weber, James L.

    1996-04-01

    A new scanning fluorescence detector (SCAFUD) was developed for high-throughput genotyping of short tandem repeat polymorphisms (STRPs). Fluorescent dyes are incorporated into relatively short DNA fragments via polymerase chain reaction (PCR) and are separated by electrophoresis in short, wide polyacrylamide gels (144 lanes with well to read distances of 14 cm). Excitation light from an argon laser with primary lines at 488 and 514 nm is introduced into the gel through a fiber optic cable, dichroic mirror, and 40X microscope objective. Emitted fluorescent light is collected confocally through a second fiber. The confocal head is translated across the bottom of the gel at 0.5 Hz. The detection unit utilizes dichroic mirrors and band pass filters to direct light with 10 - 20 nm bandwidths to four photomultiplier tubes (PMTs). PMT signals are independently amplified with variable gain and then sampled at a rate of 2500 points per scan using a computer based A/D board. LabView software (National Instruments) is used for instrument operation. Currently, three fluorescent dyes (Fam, Hex and Rox) are simultaneously detected with peak detection wavelengths of 543, 567, and 613 nm, respectively. The detection limit for fluorescein-labeled primers is about 100 attomoles. Planned SCAFUD upgrades include rearrangement of laser head geometry, use of additional excitation lasers for simultaneous detection of more dyes, and the use of detector arrays instead of individual PMTs. Extensive software has been written for automatic analysis of SCAFUD images. The software enables background subtraction, band identification, multiple- dye signal resolution, lane finding, band sizing and allele calling. Whole genome screens are currently underway to search for loci influencing such complex diseases as diabetes, asthma, and hypertension. Seven production SCAFUDs are currently in operation. Genotyping output for the coming year is projected to be about one million total genotypes (DNA

  14. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  15. NONINVASIVE OPTICAL IMAGING OF STAPHYLOCOCCUS AUREUS INFECTION IN VIVO USING AN ANTIMICROBIAL PEPTIDE FRAGMENT BASED NEAR-INFRARED FLUORESCENT PROBES

    Directory of Open Access Journals (Sweden)

    CUICUI LIU

    2013-07-01

    Full Text Available The diagnosis of bacterial infections remains a major challenge in medicine. Optical imaging of bacterial infection in living animals is usually conducted with genetic reporters such as light-emitting enzymes or fluorescent proteins. However, there are many circumstances where genetic reporters are not applicable, and there is an urgent need for exogenous synthetic probes that can selectively target bacteria. Optical imaging of bacteria in vivo is much less developed than methods such as radioimaging and MRI. Furthermore near-infrared (NIR dyes with emission wavelengths in the region of 650–900 nm can propagate through two or more centimeters of tissue and may enable deeper tissue imaging if sensitive detection techniques are employed. Here we constructed an antimicrobial peptide fragment UBI29-41-based near-infrared fluorescent imaging probe. The probe is composed of UBI29-41 conjugated to a near infrared dye ICG-Der-02. UBI29-41 is a cationic antimicrobial peptide that targets the anionic surfaces of bacterial cells. The probe allows detection of Staphylococcus aureus infection (5 × 107 cells in a mouse local infection model using whole animal near-infrared fluorescence imaging. Furthermore, we demonstrate that the UBI29-41-based imaging probe can selectively accumulate within bacteria. The significantly higher accumulation in bacterial infection suggests that UBI29-41-based imaging probe may be a promising imaging agent to detect bacterial infections.

  16. Resonantly enhanced production of excited fragments of gaseous molecules following core-level excitation

    International Nuclear Information System (INIS)

    Chen, J.M.; Lu, K.T.; Lee, J.M.; Ho, S.C.; Chang, H.W.; Lee, Y.Y.

    2005-01-01

    State-selective dissociation dynamics for the excited fragments of gaseous Si(CH 3 ) 2 Cl 2 following Cl 2p and Si 2p core-level excitations have been investigated by resonant photoemission spectroscopy and dispersed UV/optical fluorescence spectroscopy. The main features in the gaseous Si(CH 3 ) 2 Cl 2 fluorescence spectrum are identified as the emission from excited Si*, Si + *, CH* and H*. The core-to-Rydberg excitations at both Si 2p and Cl 2p edges lead to a noteworthy production of not only the excited atomic fragments, neutral and ionic (Si*, Si + *) but also the excited diatomic fragments (CH*). In particular, the excited neutral atomic fragments Si* are significantly reinforced. The experimental results provide deeper insight into the state-selective dissociation dynamics for the excited fragments of molecules via core-level excitation

  17. Interactions between colloidal silver and photosynthetic pigments located in cyanobacteria fragments and in solution.

    Science.gov (United States)

    Siejak, Przemysław; Frackowiak, Danuta

    2007-09-25

    Changes in the yield of the fluorescence emitted by pigments of photosynthetic organisms could be used for the establishment of the presence of some toxic substances. The presence of colloidal metals can be indicated by enhancement of pigments' emission as a result of plasmons generation. The spectra of the pigments of cyanobacterium Synechocystis located in the bacterium fragments and in solutions with and without colloidal silver additions have been measured. The quantum yield of the pigments' fluorescence in solution has been observed to increase at some wavelength of excitation, while the fluorescence of the pigments in the bacteria fragments has been only quenched as a consequence of interactions with colloidal silver particles. Close contact between pigment molecules located in bacteria fragments and silver particles is probably not possible. We plan in future to investigate the influence of other, more typical metal pollutants of water, using similar spectral methods and several other photosynthetic bacteria pigments, in solution, in cell fragments and in the whole bacteria organisms.

  18. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  19. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  20. Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

    Science.gov (United States)

    Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

    2017-08-01

    Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  1. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    Science.gov (United States)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  2. Fiber Amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten

    2017-01-01

    The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

  3. KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Emma Suryati

    2013-03-01

    Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

  4. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  5. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  6. System for Gamma an X rays fluorescence spectrometric

    International Nuclear Information System (INIS)

    Alonso Abad, D.; Arista Romeu, E.; Bolanos Perez, L. and others

    1997-01-01

    A system for spectrometry of gamma or fluorescence X rays is presented. It sis composed by a Si(Li) semiconductors detector, a charge sensitive preamplifier, a high voltage power supply, a spectrometric amplifier and a monolithic 1024 channels multichannel analyzers or an IBM compatible 4096 channels add - on- card multichannel analyzer. The system can be configured as a 1024 or 4096 channels gamma or fluorescent X rays spectrometer

  7. Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

    2014-10-21

    Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

  8. Signal recognition particle assembly in relation to the function of amplified nucleoli of Xenopus oocytes.

    Science.gov (United States)

    Sommerville, John; Brumwell, Craig L; Politz, Joan C Ritland; Pederson, Thoru

    2005-03-15

    The signal recognition particle (SRP) is a ribonucleoprotein machine that controls the translation and intracellular sorting of membrane and secreted proteins. The SRP contains a core RNA subunit with which six proteins are assembled. Recent work in both yeast and mammalian cells has identified the nucleolus as a possible initial site of SRP assembly. In the present study, SRP RNA and protein components were identified in the extrachromosomal, amplified nucleoli of Xenopus laevis oocytes. Fluorescent SRP RNA microinjected into the oocyte nucleus became specifically localized in the nucleoli, and endogenous SRP RNA was also detected in oocyte nucleoli by RNA in situ hybridization. An initial step in the assembly of SRP involves the binding of the SRP19 protein to SRP RNA. When green fluorescent protein (GFP)-tagged SRP19 protein was injected into the oocyte cytoplasm it was imported into the nucleus and became concentrated in the amplified nucleoli. After visiting the amplified nucleoli, GFP-tagged SRP19 protein was detected in the cytoplasm in a ribonucleoprotein complex, having a sedimentation coefficient characteristic of the SRP. These results suggest that the amplified nucleoli of Xenopus oocytes produce maternal stores not only of ribosomes, the classical product of nucleoli, but also of SRP, presumably as a global developmental strategy for stockpiling translational machinery for early embryogenesis.

  9. Protein- protein interaction detection system using fluorescent protein microdomains

    Science.gov (United States)

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  10. Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

    Directory of Open Access Journals (Sweden)

    PAULO Z. PASSAMANI

    2017-12-01

    Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

  11. In vivo fluorescent detection of Fe-S clusters coordinated by human GRX2.

    Science.gov (United States)

    Hoff, Kevin G; Culler, Stephanie J; Nguyen, Peter Q; McGuire, Ryan M; Silberg, Jonathan J; Smolke, Christina D

    2009-12-24

    A major challenge to studying Fe-S cluster biosynthesis in higher eukaryotes is the lack of simple tools for imaging metallocluster binding to proteins. We describe the first fluorescent approach for in vivo detection of 2Fe2S clusters that is based upon the complementation of Venus fluorescent protein fragments via human glutaredoxin 2 (GRX2) coordination of a 2Fe2S cluster. We show that Escherichia coli and mammalian cells expressing Venus fragments fused to GRX2 exhibit greater fluorescence than cells expressing fragments fused to a C37A mutant that cannot coordinate a metallocluster. In addition, we find that maximal fluorescence in the cytosol of mammalian cells requires the iron-sulfur cluster assembly proteins ISCU and NFS1. These findings provide evidence that glutaredoxins can dimerize within mammalian cells through coordination of a 2Fe2S cluster as observed with purified recombinant proteins. Copyright 2009 Elsevier Ltd. All rights reserved.

  12. Gain measurement in a CW medium-power diode pumped Nd:YAG laser amplifier by ASE analysis

    International Nuclear Information System (INIS)

    Razzaghi, D; Hajiesmaeilbaigi, F; Ruzbehani, M

    2014-01-01

    Using the relation between amplified spontaneous emission intensity and gain, a set of formulas is derived for gain evaluation by comparing fluorescence yield in two different lengths of the active medium. Experimental measurements are carried out and gain is calculated by solving the derived formula. For comparison, measurements are also carried out using the probe beam method, which shows good agreement between the two methods in a typical CW medium-power diode pumped Nd:YAG amplifier. (paper)

  13. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

  14. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  15. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  16. Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

    Science.gov (United States)

    Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

    2016-11-25

    Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Detection of chromosomal aberrations by fluorescence in situ hybridization in the first three postirradiation divisions of human lymphocytes

    International Nuclear Information System (INIS)

    Boei, J.J.W.A.; Vermeulen, S.; Natarajan, A.T.

    1996-01-01

    Chromosomal aberrations in human lymphocytes were analyzed by fluorescence in situ hybridization (FISH) in the first 3 postirradiation (0 and 2 Gy) divisions. Cells were grown in the presence of BrdU, collected at different sampling times (47, 70 and 91 h) and analyzed using an alphoid centromeric probe and PCR amplified DNA libraries for chromosomes 2 and 8. Following differential staining of sister chromatids, the analyzed cells were identified to be either in the first, second or third mitosis after irradiation. The frequencies of both dicentrics and fragments showed a reduction of about 50% after each cell generation, whereas translocations were more persistent. Cells within the same postirradiation division showed higher aberration frequencies when derived from later sampling times, indicating a delay in progression of aberrant cells. As a result, the frequencies for dicentrics and fragments remained rather constant at different sampling times if the cell cycle parameter was not taken into account. Thus, the average generation time of the lymphocytes had a clear effect on the obtained aberration frequencies. The described method allows the study of the persistence of chromosome damage using the FISH technique during 3 subsequent cell divisions in vitro

  18. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  19. Self-Assembly of Colloidal Photonic Crystals of PS@PNIPAM Nanoparticles and Temperature-Responsive Tunable Fluorescence.

    Science.gov (United States)

    Yuan, Shuai; Ge, Fengyan; Yang, Xue; Guang, Shanyi

    2016-11-01

    A strategy for significantly enhancing fluorescence is developed based on the coupling of optical properties of colloidal photonic crystals (CPCs) with responsive microgel. In this paper, thermoresponsive microgel PNIPAM was employed for the fabrication of core-shell structure. The core-shell PS@PNIPAM nanoparticles (NPs) are then assembled to CPCs by a vertical deposition method. Subsequently, the novel functional material (RhB/CPCs) can be prepared by depositing fluorescent dye molecules (RhB) on the top of PS@PNIPAM CPCs. We obtained an increase in the fluorescent intensity up to 15-fold and 22-fold compared with RhB on the glass slid and the uneven film. Due to the unique responsive shrinking properties of PNIPAM shell, the amplifying fluorescence behavior of CPCs can be well tuned by varying the temperature. In contrast to RhB on the glass slid, a 15-fold and 12-fold fluorescence enhancement can be observed when the temperature of RhB/CPCs was 20 °C and 50 °C, respectively. The mechanism on enhancement fluorescence of tunable CPCs can be achieved by measurements of thermoresponsive properties. The results indicate that the responsive fluorescence-amplifying method based on CPCs made with responsive core-shell NPs has a potential application for the development of efficient fluorescence sensors.

  20. Operation amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2008-01-01

    To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

  1. Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

    Science.gov (United States)

    Tan, Ming-pu

    2010-01-01

    Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  2. Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

    Science.gov (United States)

    Kirley, Terence L; Norman, Andrew B

    2015-01-01

    Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

  3. Resonance Fluorescence from an Artificial Atom in Squeezed Vacuum

    Directory of Open Access Journals (Sweden)

    D. M. Toyli

    2016-07-01

    Full Text Available We present an experimental realization of resonance fluorescence in squeezed vacuum. We strongly couple microwave-frequency squeezed light to a superconducting artificial atom and detect the resulting fluorescence with high resolution enabled by a broadband traveling-wave parametric amplifier. We investigate the fluorescence spectra in the weak and strong driving regimes, observing up to 3.1 dB of reduction of the fluorescence linewidth below the ordinary vacuum level and a dramatic dependence of the Mollow triplet spectrum on the relative phase of the driving and squeezed vacuum fields. Our results are in excellent agreement with predictions for spectra produced by a two-level atom in squeezed vacuum [Phys. Rev. Lett. 58, 2539 (1987], demonstrating that resonance fluorescence offers a resource-efficient means to characterize squeezing in cryogenic environments.

  4. Fluorescent Random Amplified Microsatellites (F-RAMS) analysis of mushrooms as a forensic investigative tool

    Czech Academy of Sciences Publication Activity Database

    Kallifatidis, B.; Borovička, Jan; Stránská, J.; Drábek, J.; Mills, D. K.

    2014-01-01

    Roč. 9, MAR (2014), s. 25-32 ISSN 1872-4973 Institutional support: RVO:61389005 Keywords : random amplified microsatellites * hallucinogenic mashrooms * DNA profiling Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.604, year: 2014

  5. Electron detachment dissociation of fluorescently labeled sialylated oligosaccharides.

    Science.gov (United States)

    Zhou, Wen; Håkansson, Kristina

    2011-12-01

    We explored the application of electron detachment dissociation (EDD) and infrared multiphoton dissociation (IRMPD) tandem mass spectrometry to fluorescently labeled sialylated oligosaccharides. Standard sialylated oligosaccharides and a sialylated N-linked glycan released from human transferrin were investigated. EDD yielded extensive glycosidic cleavages and cross-ring cleavages in all cases studied, consistently providing complementary structural information compared with infrared multiphoton dissociation. Neutral losses and satellite ions such as C-2H ions were also observed following EDD. In addition, we examined the influence of different fluorescent labels. The acidic label 2-aminobenzoic acid (2-AA) enhanced signal abundance in negative-ion mode. However, few cross-ring fragments were observed for 2-AA-labeled oligosaccharides. The neutral label 2-aminobenzamide (2-AB) resulted in more cross-ring cleavages compared with 2-AA-labeled species, but not as extensive fragmentation as for native oligosaccharides, likely resulting from altered negative charge locations from introduction of the fluorescent tag. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Amplifier Distortion

    Science.gov (United States)

    Keeports, David

    2006-12-01

    By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

  7. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  9. Triphenylamine based benzimidazole and benzothiazole: Synthesis and applications in fluorescent chemosensors and laser dyes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yang [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); University of Chinese Academy of Sciences, Beijing 100039 (China); Li, Bin, E-mail: libinteacher@163.com [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Zhang, Liming; Guan, Yunlong [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China)

    2014-01-15

    Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. The TPA-benzimidazole chemosensor was tested for a number of metal ions and found to exhibit binding affinity for Fe{sup 3+} and Hg{sup 2+} in acetonitrile, and the fluorescence quenching was achieved through a PET process. The appearance of an isosbestic point in absorption titrations and Job's plot analysis supported 1:1 stoichiometries for Fe{sup 3+} and Hg{sup 2+} ions. Laser experiments showed that under transversal pumping with a Q-switched Nd:YAG (355 nm) laser in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) at 436 nm. -- Highlights: • Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. • The TPA-benzimidazole exhibits binding affinity for Fe{sup 3+} and Hg{sup 2+} in acetonitrile and the fluorescence quenching was achieved through a PET process. • Under transversal pumping at 355 nm in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) in 436 nm.

  10. Triphenylamine based benzimidazole and benzothiazole: Synthesis and applications in fluorescent chemosensors and laser dyes

    International Nuclear Information System (INIS)

    Yang, Yang; Li, Bin; Zhang, Liming; Guan, Yunlong

    2014-01-01

    Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. The TPA-benzimidazole chemosensor was tested for a number of metal ions and found to exhibit binding affinity for Fe 3+ and Hg 2+ in acetonitrile, and the fluorescence quenching was achieved through a PET process. The appearance of an isosbestic point in absorption titrations and Job's plot analysis supported 1:1 stoichiometries for Fe 3+ and Hg 2+ ions. Laser experiments showed that under transversal pumping with a Q-switched Nd:YAG (355 nm) laser in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) at 436 nm. -- Highlights: • Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. • The TPA-benzimidazole exhibits binding affinity for Fe 3+ and Hg 2+ in acetonitrile and the fluorescence quenching was achieved through a PET process. • Under transversal pumping at 355 nm in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) in 436 nm

  11. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    Science.gov (United States)

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  12. Electron Detachment Dissociation (EDD) of Fluorescently Labeled Sialylated Oligosaccharides

    Science.gov (United States)

    Zhou, Wen; Håkansson, Kristina

    2012-01-01

    We explored the application of electron detachment dissociation (EDD) and infrared multiphoton dissociation (IRMPD) tandem mass spectrometry to fluorescently labeled sialylated oligosaccharides. Standard sialylated oligosaccharides and a sialylated N-linked glycan released from human transferrin were investigated. EDD yielded extensive glycosidic cleavages and cross-ring cleavages in all cases studied, consistently providing complementary structural information compared to IRMPD. Neutral losses and satellite ions such as C – 2H ions were also observed following EDD. In addition, we examined the influence of different fluorescent labels. The acidic label 2-aminobenzoic acid (2-AA) enhanced signal abundance in negative-ion mode. However, few cross-ring fragments were observed for 2-AA labeled oligosaccharides. The neutral label 2-aminobenzamide (2-AB) resulted in more cross-ring cleavages compared to 2-AA labeled species, but not as extensive fragmentation as for native oligosaccharides, likely resulting from altered negative charge locations from introduction of the fluorescent tag. PMID:22120881

  13. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

  14. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  15. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  16. Auto-Zero Differential Amplifier

    Science.gov (United States)

    Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

    2017-01-01

    An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

  17. Theoretical Investigation of Oxazine 170 Perchlorate Doped Polymeric Optical Fiber Amplifier

    Directory of Open Access Journals (Sweden)

    Piotr Miluski

    2017-01-01

    Full Text Available Optical signal amplification in the waveguiding structure of optical fibers can be used for optical telecommunication systems and new light sources constructions. Organic dyes doped materials are interesting for new applications in polymeric optical fibers technology due to their benefits (efficient fluorescence, high absorption cross section, and easy processing. This article presents a numerical simulation of gain in poly(methyl methacrylate optical fiber doped by Oxazine 170 Perchlorate. The calculated gain characteristic for the used dye molar concentration (0.2·10-6–1.4·10-6 and pump power (1–10 kW is presented. The fabricated fluorescent polymeric optical fiber is also shown. The presented analysis can be used for optical amplifier construction based on dye-doped polymeric optical fiber (POF.

  18. Portable musical instrument amplifier

    Science.gov (United States)

    Christian, David E.

    1990-07-24

    The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

  19. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  20. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  1. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2011-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

  2. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, S.; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

  3. GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

    International Nuclear Information System (INIS)

    Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

    2008-01-01

    Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

  4. A High-Performance Fluorescence Immunoassay Based on the Relaxation of Quenching, Exemplified by Detection of Cardiac Troponin I

    Directory of Open Access Journals (Sweden)

    Seung-Wan Kim

    2016-05-01

    Full Text Available The intramolecular fluorescence self-quenching phenomenon is a major drawback in developing high-performance fluorometric biosensors which use common fluorophores as signal generators. We propose two strategies involving liberation of the fluorescent molecules by means of enzymatic fragmentation of protein or dehybridization of double-stranded DNA. In the former, bovine serum albumin (BSA was coupled with the fluorescent BODIPY dye (Red BSA, and then immobilized on a solid surface. When the insolubilized Red BSA was treated with proteinase K (10 units/mL for 30 min, the fluorescent signal was significantly increased (3.5-fold compared to the untreated control. In the second case, fluorophore-tagged DNA probes were linked to gold nanoparticles by hybridization with capture DNA strands densely immobilized on the surface. The quenched fluorescence signal was recovered (3.7-fold by thermal dehybridization, which was induced with light of a specific wavelength (e.g., 530 nm for less than 1 min. We next applied the Red BSA self-quenching relaxation technique employing enzymatic fragmentation to a high-performance immunoassay of cardiac troponin I (cTnI in a microtiter plate format. The detection limit was 0.19 ng/mL cTnI, and the fluorescent signal was enhanced approximately 4.1-fold compared with the conventional method of direct measurement of the fluorescent signal from a non-fragmented fluorophore-labeled antibody.

  5. Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

    International Nuclear Information System (INIS)

    Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

    2016-01-01

    Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

  6. A study on a portable fluorescence imaging system

    Science.gov (United States)

    Chang, Han-Chao; Wu, Wen-Hong; Chang, Chun-Li; Huang, Kuo-Cheng; Chang, Chung-Hsing; Chiu, Shang-Chen

    2011-09-01

    The fluorescent reaction is that an organism or dye, excited by UV light (200-405 nm), emits a specific frequency of light; the light is usually a visible or near infrared light (405-900 nm). During the UV light irradiation, the photosensitive agent will be induced to start the photochemical reaction. In addition, the fluorescence image can be used for fluorescence diagnosis and then photodynamic therapy can be given to dental diseases and skin cancer, which has become a useful tool to provide scientific evidence in many biomedical researches. However, most of the methods on acquiring fluorescence biology traces are still stay in primitive stage, catching by naked eyes and researcher's subjective judgment. This article presents a portable camera to obtain the fluorescence image and to make up a deficit from observer competence and subjective judgment. Furthermore, the portable camera offers the 375nm UV-LED exciting light source for user to record fluorescence image and makes the recorded image become persuasive scientific evidence. In addition, when the raising the rate between signal and noise, the signal processing module will not only amplify the fluorescence signal up to 70 %, but also decrease the noise significantly from environmental light on bill and nude mouse testing.

  7. Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

    DEFF Research Database (Denmark)

    Wang, Z.; Durhuus, T.; Mikkelsen, Benny

    1994-01-01

    A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

  8. Fluorescence in situ hybridization on human metaphase chromosomes detected by near-field scanning optical microscopy

    NARCIS (Netherlands)

    Moers, M.H.P.; Moers, M.H.P.; Kalle, W.H.J.; Kalle, W.H.J.; Ruiter, A.G.T.; Wiegant, J.C.A.G.; Raap, A.K.; Greve, Jan; de Grooth, B.G.; van Hulst, N.F.

    1996-01-01

    Fluorescence in situ hybridization o­n human metaphase chromosomes is detected by near-field scanning optical microscopy. This combination of cytochemical and scanning probe techniques enables the localization and identification of several fluorescently labelled genomic DNA fragments o­n a single

  9. Laser-induced fluorescence detection strategies for sodium atoms and compounds in high-pressure combustors

    Science.gov (United States)

    Weiland, Karen J. R.; Wise, Michael L.; Smith, Gregory P.

    1993-01-01

    A variety of laser-induced fluorescence schemes were examined experimentally in atmospheric pressure flames to determine their use for sodium atom and salt detection in high-pressure, optically thick environments. Collisional energy transfer plays a large role in fluorescence detection. Optimum sensitivity, at the parts in 10 exp 9 level for a single laser pulse, was obtained with the excitation of the 4p-3s transition at 330 nm and the detection of the 3d-3p fluorescence at 818 nm. Fluorescence loss processes, such as ionization and amplified spontaneous emission, were examined. A new laser-induced atomization/laser-induced fluorescence detection technique was demonstrated for NaOH and NaCl. A 248-nm excimer laser photodissociates the salt molecules present in the seeded flames prior to atom detection by laser-induced fluorescence.

  10. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS)

    Science.gov (United States)

    Abraham, Jerrold L.; Chandra, Subhash; Agrawal, Anoop

    2014-01-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease (CBD) from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water, and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry (SIMS) instrument, CAMECA IMS 3f SIMS ion microscope. The beryllium content of shrapnel (~100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (~25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y-and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (~0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either present in an

  11. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS).

    Science.gov (United States)

    Abraham, J L; Chandra, S; Agrawal, A

    2014-11-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry instrument, CAMECA IMS 3f secondary ion mass spectrometry ion microscope. The beryllium content of shrapnel (∼100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (∼25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y- and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (∼0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either

  12. X-ray fluorescence in geology

    International Nuclear Information System (INIS)

    Dutra, C.V.; Gomes, C.B.

    1990-01-01

    This work is about the X-ray fluorescence aplication in geology. It's showing the X-ray origin and excitation. About the instrumentation this work shows the following: X-ray tubes, colimators, analysers crystals, detectors, amplifiers, pulse height selector, and others electronic components. By X-ray fluorescente are done quantitative and qualitative geological analysis and this work shows this analysis and its detection limits. The problems determination is the example. In this work was done yet the comparative analysis of the various instrumental methods in geochemistry. (C.G.) [pt

  13. Antares laser power amplifier

    International Nuclear Information System (INIS)

    Stine, R.D.; Ross, G.F.; Silvernail, C.

    1979-01-01

    The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

  14. Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

    Science.gov (United States)

    Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

    2006-07-01

    The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

  15. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  16. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  17. Probing the binding of Cu(2+) ions to a fragment of the Aβ(1-42) polypeptide using fluorescence spectroscopy, isothermal titration calorimetry and molecular dynamics simulations.

    Science.gov (United States)

    Makowska, Joanna; Żamojć, Krzysztof; Wyrzykowski, Dariusz; Żmudzińska, Wioletta; Uber, Dorota; Wierzbicka, Małgorzata; Wiczk, Wiesław; Chmurzyński, Lech

    2016-09-01

    Steady-state and time-resolved fluorescence quenching measurements supported by isothermal titration calorimetry (ITC) and molecular dynamics simulations (MD), with the NMR-derived restraints, were used to investigate the interactions of Cu(2+) ions with a fragment of the Aβ(1-42) polypeptide, Aβ(5-16) with the following sequence: Ac-Arg-His-Asp-Ser-Gly-Tyr-Glu-Val-His-His-Gln-Lys-NH2, denoted as HZ1. The studies presented in this paper, when compared with our previous results (Makowska et al., Spectrochim. Acta A 153: 451-456), show that the affinity of the peptide to metal ions is conformation-dependent. All the measurements were carried out in 20mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution, pH6.0. The Stern-Volmer equations, along with spectroscopic observations, were used to determine the quenching and binding parameters. The obtained results unequivocally suggest that Cu(2+) ions quench the fluorescence of HZ1 only through a static quenching mechanism, in contrast to the fragment from the N-terminal part of the FPB28 protein, with sequence Ac-Tyr-Lys-Thr-Ala-Asp-Gly-Lys-Thr-Tyr- NH2 (D9) and its derivative with a single point mutation: Ac-Tyr-Lys-Thr-Ala-Asn-Gly-Lys-Thr-Tyr- NH2 (D9_M), where dynamic quenching occurred. The thermodynamic parameters (ΔITCH, ΔITCS) for the interactions between Cu(2+) ions and the HZ1 peptide were determined from the calorimetric data. The conditional thermodynamic parameters suggest that, under the experimental conditions, the formation of the Cu(2+)-HZ1 complex is both an enthalpy and entropy driven process. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Explosion-evaporation model for fragment production in intermediate-energy nuclear collisions

    International Nuclear Information System (INIS)

    Fai, G.; Randrup, J.

    1981-01-01

    Nuclear collisions at intermediate energies may create transient systems of hot nuclear matter that decay into many nuclear fragments. The disassembly of such a nuclear fireball is described as a two-stage process. In the primary explosion stage the system quickly fragments into nucleons and composite nuclei according to the available phase space. The explosion produces excited nuclei with half-lives longer than the time associated with the breakup. In the secondary evaporation stage, these nuclei decay, first by sequential emission of light particles (neutrons, protons, alphas), later by electromagnetic radiation. The secondary stage in general changes the relative abundancies of the various fragment species. This general feature makes it essential to take account of the composite fragments before using d/p as a measure of the entropy of the initial source. The formation of unbound nuclei at the explosion stage also has the desirable effect of enhancing the final abundancies of particularly stable nuclei, e.g., 4 He. For neutron-excessive sources the presence of composite nuclei amplifies the ratio of observed neutrons and protons; this effect persists for heavier mirror systems. Predictions of the model are qualitatively compared to available experimental data. The model offers a convenient way to augment existing dynamical models, such as intra-nuclear cascade and nuclear fluid dynamics, to yield actual nuclear fragments rather than merely matter distributions

  19. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  20. Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge.

    Science.gov (United States)

    MacDonald, N A; Cappelli, M A; Hargus, W A

    2012-11-01

    A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s(')[1/2](1)(0)-6p(')[3/2](2) xenon atomic transition at λ = 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

  1. CMOS Current-mode Operational Amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1992-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  2. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  3. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  4. Distributed Sensor Particles for Remote Fluorescence Detection of Trace Analytes: UXO/CW; TOPICAL

    International Nuclear Information System (INIS)

    SINGH, ANUP K.; GUPTA, ALOK; MULCHANDANI, ASHOK; CHEN, WILFRED; BHATIA, RIMPLE B.; SCHOENIGER, JOSEPH S.; ASHLEY, CAROL S.; BRINKER, C. JEFFREY; HANCE, BRADLEY G.; SCHMITT, RANDAL L.; JOHNSON, MARK S.; HARGIS JR. PHILIP J.; SIMONSON, ROBERT J.

    2001-01-01

    This report summarizes the development of sensor particles for remote detection of trace chemical analytes over broad areas, e.g residual trinitrotoluene from buried landmines or other unexploded ordnance (UXO). We also describe the potential of the sensor particle approach for the detection of chemical warfare (CW) agents. The primary goal of this work has been the development of sensor particles that incorporate sample preconcentration, analyte molecular recognition, chemical signal amplification, and fluorescence signal transduction within a ''grain of sand''. Two approaches for particle-based chemical-to-fluorescence signal transduction are described: (1) enzyme-amplified immunoassays using biocompatible inorganic encapsulants, and (2) oxidative quenching of a unique fluorescent polymer by TNT

  5. CMOS Current-mode Operational Amplifier

    OpenAIRE

    Kaulberg, Thomas

    1992-01-01

    A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

  6. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  7. Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

    International Nuclear Information System (INIS)

    Gartia, Manas Ranjan; Hsiao, Austin; Logan Liu, G; Sivaguru, Mayandi; Chen Yi

    2011-01-01

    We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

  8. Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

    Energy Technology Data Exchange (ETDEWEB)

    Gartia, Manas Ranjan [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois, Urbana, IL 61801 (United States); Hsiao, Austin; Logan Liu, G [Department of Bioengineering, University of Illinois, Urbana, IL 61801 (United States); Sivaguru, Mayandi [Institute for Genomic Biology, University of Illinois, Urbana, IL 61801 (United States); Chen Yi, E-mail: loganliu@illinois.edu [Department of Electrical and Computer Engineering, University of Illinois, Urbana, IL 61801 (United States)

    2011-09-07

    We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

  9. MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

    Science.gov (United States)

    Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

    2012-05-01

    MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Novel fluorescent sequence-related amplified polymorphism(FSRAP markers for the construction of a genetic linkage map of wheat(Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Zhao Lingbo

    2017-01-01

    Full Text Available Novel fluorescent sequence-related amplified polymorphism (FSRAP markers were developed based on the SRAP molecular marker. Then, the FSRAP markers were used to construct the genetic map of a wheat (Triticum aestivumL. recombinant inbred line population derived from a Chuanmai 42×Chuannong 16 cross. Reproducibility and polymorphism tests indicated that the FSRAP markers have repeatability and better reflect the polymorphism of wheat varieties compared with SRAP markers. A total of 430 polymorphic loci between Chuanmai 42 and Chuannong 16 were detected with 189 FSRAP primer combinations. A total of 281 FSARP markers and 39 SSR markers re classified into 20 linkage groups. The maps spanned a total length of 2499.3cM with an average distance of 7.81cM between markers. A total of 201 markers were mapped on the B genome and covered a distance of 1013cM. On the A genome, 84 markers were mapped and covered a distance of 849.6cM. On the D genome, however, only 35 markers were mapped and covered a distance of 636.7cM. No FSRAP markers were distributed on the 7D chromosome. The results of the present study revealed that the novel FSRAP markers can be used to generate dense, uniform genetic maps of wheat.

  11. Picosecond-resolved FRET on non-amplified DNA for identifying individuals genetically susceptible to type-1 diabetes

    Science.gov (United States)

    Nardo, Luca; Tosi, Giovanna; Bondani, Maria; Accolla, Roberto; Andreoni, Alessandra

    2012-06-01

    By tens-of-picosecond resolved fluorescence detection we study Förster resonance energy transfer between a donor and a black-hole-quencher bound at the 5'- and 3'-positions of an oligonucleotide probe matching the highly polymorphic region between codons 51 and 58 of the human leukocyte antigen DQB1 0201 allele, conferring susceptibility to type-1 diabetes. The probe is annealed with non-amplified genomic DNAs carrying either the 0201 sequence or other DQB1 allelic variants. We detect the longest-lived donor fluorescence in the case of hybridization with the 0201 allele and definitely faster and distinct decays for the other allelic variants, some of which are single-nucleotide polymorphic.

  12. Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, N. A.; Cappelli, M. A. [Stanford Plasma Physics Laboratory, Stanford University, Stanford, California 94305 (United States); Hargus, W. A. Jr. [Air Force Research Laboratory, Edwards AFB, California 93524 (United States)

    2012-11-15

    A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s{sup Prime }[1/2]{sub 1}{sup 0}-6p{sup Prime }[3/2]{sub 2} xenon atomic transition at {lambda}= 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

  13. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  14. Improved-Bandwidth Transimpedance Amplifier

    Science.gov (United States)

    Chapsky, Jacob

    2009-01-01

    The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

  15. Introducing inducible fluorescent split cholesterol oxidase to mammalian cells.

    Science.gov (United States)

    Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V

    2017-05-26

    Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Millimeter-wave power amplifiers

    CERN Document Server

    du Preez, Jaco

    2017-01-01

    This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

  17. Oscillators and operational amplifiers

    OpenAIRE

    Lindberg, Erik

    2005-01-01

    A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

  18. FLUIDIC AC AMPLIFIERS.

    Science.gov (United States)

    Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

  19. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  20. New cell line development for antibody-producing Chinese hamster ovary cells using split green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Kim Yeon-Gu

    2012-05-01

    Full Text Available Abstract Background The establishment of high producer is an important issue in Chinese hamster ovary (CHO cell culture considering increased heterogeneity by the random integration of a transfected foreign gene and the altered position of the integrated gene. Fluorescence-activated cell sorting (FACS-based cell line development is an efficient strategy for the selection of CHO cells in high therapeutic protein production. Results An internal ribosome entry site (IRES was introduced for using two green fluorescence protein (GFP fragments as a reporter to both antibody chains, the heavy chain and the light chain. The cells co-transfected with two GFP fragments showed the emission of green fluorescence by the reconstitution of split GFP. The FACS-sorted pool with GFP expression had a higher specific antibody productivity (qAb than that of the unsorted pool. The qAb was highly correlated with the fluorescence intensity with a high correlation coefficient, evidenced from the analysis of median GFP and qAb in individual selected clones. Conclusions This study proved that the fragment complementation for split GFP could be an efficient indication for antibody production on the basis of high correlation of qAb with reconstitution of GFP. Taken together, we developed an efficient FACS-based screening method for high antibody-producing CHO cells with the benefits of the split GFP system.

  1. Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers

    DEFF Research Database (Denmark)

    Li, Xiujuan; Zhu, Yaohong; Liu, Panqi

    2010-01-01

    on the list of the world’s threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all...... using Jaccard’s similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC = 0.674–0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC = 0.832), while white eared pheasant...

  2. Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

    Science.gov (United States)

    Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

    2015-11-01

    The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

  3. A CMOS current-mode operational amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1993-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  4. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  5. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  6. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  7. Modeling of semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

    We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

  8. NASA developments in solid state power amplifiers

    Science.gov (United States)

    Leonard, Regis F.

    1990-01-01

    Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

  9. HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

    International Nuclear Information System (INIS)

    2005-01-01

    Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

  10. Electrospun amplified fiber optics.

    Science.gov (United States)

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-03-11

    All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

  11. Metal Enhanced Fluorescence on Super-Hydrophobic Clusters of Gold Nanoparticles

    KAUST Repository

    Battista, Edmondo; Coluccio, Maria Laura; Alabastri, Alessandro; Barberio, Marianna; Causa, Filippo; Netti, Paolo Antonio; Di Fabrizio, Enzo M.; Gentile, Francesco

    2016-01-01

    We used optical lithography, electroless deposition and deep reactive ion etching techniques to realize arrays of super-hydrophobic gold nanoparticles arranged in a hierarchical structure. At the micro-scale, silicon-micro pillars in the chip permit to manipulate and concentrate biological solutions, at the nano-scale, gold nanoparticles enable metal enhanced fluorescence (MEF) effects, whereby fluorescence signal of fluorophores in close proximity to a rough metal surface is amplified by orders of magnitude. Here, we demonstrated the device in the analysis of fluorescein derived gold-binding peptides (GBP-FITC). While super-hydrophobic schemes and MEF effects have been heretofore used in isolation, their integration in a platform may advance the current state of fluorescence-based sensing technology in medical diagnostics and biotechnology. This scheme may be employed in protein microarrays where the increased sensitivity of the device may enable the early detection of cancer biomarkers or other proteins of biomedical interest.

  12. Metal Enhanced Fluorescence on Super-Hydrophobic Clusters of Gold Nanoparticles

    KAUST Repository

    Battista, Edmondo

    2016-12-15

    We used optical lithography, electroless deposition and deep reactive ion etching techniques to realize arrays of super-hydrophobic gold nanoparticles arranged in a hierarchical structure. At the micro-scale, silicon-micro pillars in the chip permit to manipulate and concentrate biological solutions, at the nano-scale, gold nanoparticles enable metal enhanced fluorescence (MEF) effects, whereby fluorescence signal of fluorophores in close proximity to a rough metal surface is amplified by orders of magnitude. Here, we demonstrated the device in the analysis of fluorescein derived gold-binding peptides (GBP-FITC). While super-hydrophobic schemes and MEF effects have been heretofore used in isolation, their integration in a platform may advance the current state of fluorescence-based sensing technology in medical diagnostics and biotechnology. This scheme may be employed in protein microarrays where the increased sensitivity of the device may enable the early detection of cancer biomarkers or other proteins of biomedical interest.

  13. Ball-milled nano-colloids of rare-earth compounds as liquid gain media for capillary optical amplifiers and lasers

    Science.gov (United States)

    Patel, Darayas; Blockmon, Avery; Ochieng, Vanesa; Lewis, Ashley; Wright, Donald M.; Lewis, Danielle; Valentine, Rueben; Valentine, Maucus; Wesley, Dennis; Sarkisov, Sergey S.; Darwish, Abdalla M.; Sarkisov, Avedik S.

    2017-02-01

    Nano-colloids and nano-crystals doped with ions of rare-earth elements have recently attracted a lot of attention in the scientific community due to their potential applications as biomarkers, fluorescent inks, gain media for lasers and optical amplifiers. Many rare-earth doped materials of different compositions, shapes and size distribution have been prepared by different synthetic methods, such as chemical vapor deposition, sol-gel process, micro-emulsion techniques, gas phase condensation methods, hydrothermal methods and laser ablation. In this paper micro-crystalline powder of the rare-earthdoped compound NaYF4:Yb3+, Er3+ was synthesized using a simple wet process followed by baking in open air. Under 980 nm diode laser excitation strong fluorescence in the 100 nm band around 1531-nm peak was observed from the synthesized micro-powder. The micro-powder was pulverized using a ball mill and prepared in the form of nano-colloids in different liquids. The particle size of the obtained nano-colloids was measured using an atomic force microscope and a dynamic light scatterometer. The size of the nano-particles was close to 100-nm. The nano-colloids were utilized as a filling media in capillary optical amplifiers and lasers. The gain of a 7-cm-long capillary optical amplifier (150-micron inner diameter) was as high as 6 dB at 200 mW pump power. The synthesized nano-colloids and the active optical components using them can be potentially used in optical communication, signal processing, optical computing, and other applications.

  14. Chemical characterization of archaeological ceramics fragments by X-ray (μ-XRF) micro fluorescence

    International Nuclear Information System (INIS)

    Silva, Richard Maximiliano da Cunha e; Nascimento Filho, Virgilio Franco do; Appoloni, Carlos Roberto; Perez, Carlos Alberto

    2002-01-01

    The concentrations of the inorganic chemical elements presents in archaeological ceramic samples and clay samples allows the study about the clay sources determination used in the ceramic production. The analyzed samples are fragments of Brazilian indigenous ceramic, found in the area of the city of Londrina, North of Parana, and they belong to the archaeological collection of the 'Padre Carlos Weiss' Historical Museum, of the State University of Londrina. The determination of the chemical elements in these fragments was performed by energy dispersive X-ray microfluorescence (μ-XRF), for being not destructive and multielementar. The analytic technique allowed the identification of the K, Ca, Ti, Mn, Fe minority elements, and the Cr, Ni, Cu, Zn and Rb trace elements. The cluster analysis for the method of the medium grouping was used, and it was obtained two different groups, taking to conclude that indigenous Tupiguaranis used two clay sources in the making of its ceramic. (author)

  15. Genetic barcoding with fluorescent proteins for multiplexed applications.

    Science.gov (United States)

    Smurthwaite, Cameron A; Williams, Wesley; Fetsko, Alexandra; Abbadessa, Darin; Stolp, Zachary D; Reed, Connor W; Dharmawan, Andre; Wolkowicz, Roland

    2015-04-14

    Fluorescent proteins, fluorescent dyes and fluorophores in general have revolutionized the field of molecular cell biology. In particular, the discovery of fluorescent proteins and their genes have enabled the engineering of protein fusions for localization, the analysis of transcriptional activation and translation of proteins of interest, or the general tracking of individual cells and cell populations. The use of fluorescent protein genes in combination with retroviral technology has further allowed the expression of these proteins in mammalian cells in a stable and reliable manner. Shown here is how one can utilize these genes to give cells within a population of cells their own biosignature. As the biosignature is achieved with retroviral technology, cells are barcoded 'indefinitely'. As such, they can be individually tracked within a mixture of barcoded cells and utilized in more complex biological applications. The tracking of distinct populations in a mixture of cells is ideal for multiplexed applications such as discovery of drugs against a multitude of targets or the activation profile of different promoters. The protocol describes how to elegantly develop and amplify barcoded mammalian cells with distinct genetic fluorescent markers, and how to use several markers at once or one marker at different intensities. Finally, the protocol describes how the cells can be further utilized in combination with cell-based assays to increase the power of analysis through multiplexing.

  16. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  17. Indocyanine Green-Loaded Polydopamine-Reduced Graphene Oxide Nanocomposites with Amplifying Photoacoustic and Photothermal Effects for Cancer Theranostics.

    Science.gov (United States)

    Hu, Dehong; Zhang, Jingnan; Gao, Guanhui; Sheng, Zonghai; Cui, Haodong; Cai, Lintao

    2016-01-01

    Photoacoustic (PA) imaging and photothermal therapy (PTT) as light-induced theranostic platforms have been attracted much attention in recent years. However, the development of highly efficient and integrated phototheranostic nanoagents for amplifying PA imaging and PTT treatments poses great challenges. Here, we report a novel phototheranostic nanoagent using indocyanine green-loaded polydopamine-reduced graphene oxide nanocomposites (ICG-PDA-rGO) with amplifying PA and PTT effects for cancer theranostics. The results demonstrate that the PDA layer coating on the surface of rGO could effectively absorb a large number of ICG molecules, quench ICG's fluorescence, and enhance the PDA-rGO's optical absorption at 780 nm. The obtained ICG-PDA-rGO exhibits stronger PTT effect and higher PA contrast than that of pure GO and PDA-rGO. After PA imaging-guided PTT treatments, the tumors in 4T1 breast subcutaneous and orthotopic mice models are suppressed completely and no treatment-induced toxicity being observed. It illustrates that the ICG-PDA-rGO nanocomposites constitute a new class of theranostic nanomedicine for amplifying PA imaging and PTT treatments.

  18. Fast pulse amplifier

    International Nuclear Information System (INIS)

    Lepetit, J.; Poussier, E.

    1984-01-01

    This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

  19. A fluidic/pneumatic interface amplifier

    Science.gov (United States)

    Limbert, D. E.; Kegel, T. M.

    The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

  20. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    Suarez Canner, E.

    1996-01-01

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  1. Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

    Science.gov (United States)

    Singh, Gurpreet; Singh, Maninder Lal

    2015-08-01

    A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

  2. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

    2002-01-01

    -power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

  3. NIF/LMJ prototype amplifier mechanical design

    International Nuclear Information System (INIS)

    Horvath, J.

    1996-10-01

    Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

  4. Cu2+-labeled dansyl compounds as fluorescent and PET probes for imaging apoptosis.

    Science.gov (United States)

    Han, Junyan; Wang, Xukui; Yu, MeiXiang

    2016-11-15

    Compound DNSTT-Cu 2+ , a novel chelate of Cu 2+ with DOTA conjugated to a fluorescent dansyl fragment, is developed for imaging cell apoptosis. Apoptotic U-87MG cells could be selectively visualized by the fluorescence of DNSTT-Cu 2+ from cytoplasm of cells, confirmed by the fluorescence of apoptosis cells co-labeled with Alexa Fluor 568-labeled annexin V, a conventional probe for selectively labeling membranes of apoptosis cells. A radioactive 64 Cu 2 + analog, DNSTT- 64 Cu 2+ , was easily synthesized, providing a potential PET probe for imaging apoptosis in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  6. Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

    International Nuclear Information System (INIS)

    Horvath, J. A.

    1998-01-01

    Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

  7. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  8. Amplified emission and modified spectral features in an opal hetero-structure mediated by passive defect mode localization

    Science.gov (United States)

    Rout, Dipak; Kumar, Govind; Vijaya, R.

    2018-01-01

    A photonic crystal hetero-structure consisting of a passive planar defect of SiO2 thin film sandwiched between two identical opals grown by inward growing self-assembly method using Rhodamine-B dye-doped polystyrene microspheres is studied for the characteristics of dye emission. The optical properties and the defect mode characteristics of the hetero-structure are studied from the reflection and transmission measurements. Laser-induced fluorescence from the hetero-structure showed amplified and spectrally narrowed emission compared to the photonic crystal emphasizing the role of the defect mode and distributed feedback. The enhanced emission is also complemented by the reduction in fluorescence decay time in the case of the hetero-structure in comparison to the 3D photonic crystals.

  9. Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

    2015-12-14

    Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

  10. [Construction of a low-pH-sensing system in Streptococcus mutans].

    Science.gov (United States)

    Di, Kang; Yuqing, Li; Xuedong, Zhou

    2017-06-01

    To construct a low-pH-sensing system in Streptococcus mutans (S. mutans) and to visually detect the pH in situ. Promoter of ureaseⅠ(PureⅠ) and green fluorescence protein (gfp) DNA fragments were amplified by polymerase chain reaction (PCR) from the genome of Streptococcus salivarius 57.I and S. mutans containing the gfp fragment. The two amplified DNA fragments were ligated together and further integrated into pDL278 to construct the recombinant plasmid pDL278-pureⅠ-gfp. This recombinant plasmid was then transformed into S. mutans UA159 cells. Subsequently, the intensity of the optical density per unit area of the low-pH-sensing system was measured and compared under different pH conditions and different processing times. PureⅠ and gfp DNA fragments were amplified successfully with the correct molecule sizes (450 and 717 bp, respectively). The recombinant plasmid pDL278-pureⅠ-gfp was constructed and further verified by PCR and sequencing. The intensity of the optical density per unit area of the low-pH-sensing system increased with decreasing pH and increasing processing time. A low-pH-sensing system was constructed successfully in S. mutans. Our research verified that pureⅠ of Streptococcus salivarius can function well in S. mutans as an acid induced promoter, and provided a new method of detecting the pH of plaque biofilms in situ.

  11. Adipose tissue-derived microvascular fragments from aged donors exhibit an impaired vascularisation capacity

    Directory of Open Access Journals (Sweden)

    MW Laschke

    2014-10-01

    Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.

  12. Fluorescence properties of Yb3+-Er3+ co-doped phosphate glasses containing silver nanoparticles

    Science.gov (United States)

    Martínez Gámez, Ma A.; Vallejo H, Miguel A.; Kiryanov, A. V.; Licea-Jiménez, L.; Lucio M, J. L.; Pérez-García, S. A.

    2018-04-01

    Er3+-Yb3+ co-doped phosphate glasses containing silver nitrate (SN), were fabricated. Transmission electron microscopy (TEM) and x-ray photoelectron spectroscopy (XPS) analyses were used to evidence the nucleation and presence of silver nanoparticles (SNP). The basic parameters of the glasses were inspected by means of absorption and fluorescence spectra, and fluorescence lifetimes under excitation at 916 nm (in-band of Yb3+), and at 406 nm (in-band of surface plasmon resonance given by the presence of SNP). The spectra as well as estimates for the basic parameters defining the lasing/amplifying potential of the glasses were studied as a function of SN concentration. The experimental results indicate that by increasing the SN content an enhancement of Er3+/Yb3+ fluorescence takes place.

  13. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. European Research on THz Vacuum Amplifiers

    DEFF Research Database (Denmark)

    Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

    2010-01-01

    The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

  15. Integrated amplifying circuit with MOS transistors

    Energy Technology Data Exchange (ETDEWEB)

    Baylac, B; Merckel, G; Meunier, P

    1974-01-25

    The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

  16. Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

    NARCIS (Netherlands)

    Acar, M.

    2011-01-01

    In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

  17. Enhanced performance CCD output amplifier

    Science.gov (United States)

    Dunham, Mark E.; Morley, David W.

    1996-01-01

    A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

  18. Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

    Science.gov (United States)

    Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

    2000-01-01

    Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

  19. Optimizing pulse compressibility in completely all-fibered Ytterbium chirped pulse amplifiers for in vivo two photon laser scanning microscopy.

    Science.gov (United States)

    Fernández, A; Grüner-Nielsen, L; Andreana, M; Stadler, M; Kirchberger, S; Sturtzel, C; Distel, M; Zhu, L; Kautek, W; Leitgeb, R; Baltuska, A; Jespersen, K; Verhoef, A

    2017-08-01

    A simple and completely all-fiber Yb chirped pulse amplifier that uses a dispersion matched fiber stretcher and a spliced-on hollow core photonic bandgap fiber compressor is applied in nonlinear optical microscopy. This stretching-compression approach improves compressibility and helps to maximize the fluorescence signal in two-photon laser scanning microscopy as compared with approaches that use standard single mode fibers as stretcher. We also show that in femtosecond all-fiber systems, compensation of higher order dispersion terms is relevant even for pulses with relatively narrow bandwidths for applications relying on nonlinear optical effects. The completely all-fiber system was applied to image green fluorescent beads, a stained lily-of-the-valley root and rat-tail tendon. We also demonstrated in vivo imaging in zebrafish larvae, where we simultaneously measure second harmonic and fluorescence from two-photon excited red-fluorescent protein. Since the pulses are compressed in a fiber, this source is especially suited for upgrading existing laser scanning (confocal) microscopes with multiphoton imaging capabilities in space restricted settings or for incorporation in endoscope-based microscopy.

  20. Archaeological pottery fragments analysis from Sambaqui do Bacanga (MA-Brazil) with a portable EDXRF system

    International Nuclear Information System (INIS)

    Ikeoka, Renato A.; Appoloni, Carlos R.; Parreira, Paulo S.; Lopes, Fabio; Bandeira, Arkley M.

    2009-01-01

    Sambaqui do Bacanga archaeological site is located in the Island of Sao Luis - Maranhao - Brazil, in the region bathed by the Bacanga River. A stratigraphic collection of 68 pottery fragments was collected during the years 2005 and 2006 to perform a qualitative analysis of the chemical elements employing a Portable System of Energy Dispersive X-ray Fluorescence (PXRF). The elements K, Ca, Ti, Mn, Fe, Zn, Br, Rb, Sr, Y, Zr and Pb were identified in the different fragments and only Fe, Ca, Sr, Zr, Mn, Ti and Zn were common elements for all of them, indicating that these elements are present in the raw material used in the manufacture of the fragments. Only one fragment presented remains of painting. A larger concentration of Fe was observed in this region compared to other areas. This indicates that a material with iron oxide was used to make the painting. The elements Fe, Sr, Mn, Ti and Zn are present, systematically, with larger intensities on concave and convex sides in relation to the ceramic paste for 43 among the 68 analyzed fragments, indicating a different surface treatment that leads to an enrichment of those elements. Cluster analysis was performed with the pottery fragments at three levels. The fragments were grouped in three different clusters, except for two fragments from the 132 cm level, which grouped with the fragments from 10-20 cm level. This result indicates three different sources of clay for the studied pottery fragments. (author)

  1. Transmission characteristics of acoustic amplifier in thermoacoustic engine

    International Nuclear Information System (INIS)

    Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

    2008-01-01

    Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

  2. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  3. Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

    Science.gov (United States)

    Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

    2017-08-15

    Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  5. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Science.gov (United States)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  6. Final amplifier design and mercury

    International Nuclear Information System (INIS)

    Rose, E.A.; Hanson, D.E.

    1991-01-01

    The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

  7. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  8. A pulse amplifier for nuclear instrumentation

    International Nuclear Information System (INIS)

    Martin, D.; Cliff, P.

    1987-01-01

    A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

  9. A 13-element Ge detector for fluorescence EXAFS

    International Nuclear Information System (INIS)

    Cramer, S.P.; Tench, O.; Yocum, M.; George, G.N.

    1988-01-01

    At low concentrations, recording X-ray absorption spectra in fluorescence excitation mode is more sensitive than transmission mode. For dilute samples, the fluorescence signal is often obscured by scattered X-rays, and matrix and filter fluorescence. To discriminate against this background, while maintaining a large angular acceptance and high count rate capability, we have constructed a new detection system based on an array of intrinsic Ge detectors. The device uses 13 individuall 11 mm diameter Ge detectors, clustered in a 1:3:5:3:1 pattern on a common cryostat, combined with Soller slits and filters to reduce the background signals. Pulsed optical feedback preamplifiers are followed by Gaussian-shaping amplifiers having fast discriminators to register the incoming count rate (ICR). Correction for dead time using the ICR signal allowed operation in the vicinity of 75 kHz per channel, with a 1 μs shaping time at 6 keV. For lower count rate applications, an average resolution of 160 eV at 5.9 keV was obtained with 8 μs shaping. Recent experience with this detector at the Stanford Synchrotron Radiation Laboratory is presented. The performance is illustrated using spectra obtained from phosphorus compounds and a thin iridium foil. The performance of this device is compared with previous fluorescence detection schemes, such as those using filter/slit combinations or barrel monochromators. (orig.)

  10. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2003-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

  11. Fast logarithmic amplifier

    International Nuclear Information System (INIS)

    Tai, I.; Hasegawa, K.

    1975-01-01

    This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

  12. Study of the transverse lasing in big size crystals of Ti:Sa. Application to the design of the peta-watt high-energy amplifier of the pilot laser of the LASERIX facility; Etude de l'amplification parasite transverse de la fluorescence dans les cristaux de Ti:Sa de grandes dimensions. Application a la realisation de l'amplificateur petawatt haute energie du laser pilote de la station LASERIX

    Energy Technology Data Exchange (ETDEWEB)

    Ple, F

    2007-11-15

    This manuscript presents experimental and theoretical works accomplished for the development of the LASERIX laser driver. The main goal of this thesis work was to design a high energy and high repetition rate titanium doped sapphire amplifier (Ti:Sa) allowing to reach an energy of 40 J at a repetition rate of 0.1 Hz before compression. After a general description of amplification in chirped pulse amplification Ti:Sa laser systems (Chapter 1), I present the two particular developments we made during this work for high energy amplification (Chapter 2). First, the spatial shaping and the homogenization based on micro-lens array (MLA) systems of the eight Nd-Glass pump lasers dedicated to the pumping of the last booster amplifier.Secondly, the suppression of parasitic effects due to transverse amplification of the fluorescence in the last booster amplifier Ti:Sa crystal. The developments performed as part of this thesis allowed us to amplify an impulsion of 2 J of energy up to 39 J in a crystal of 10 cm diameter. I also present the simulation program I developed (Chapter 3) in order to simulate the three dimensional parasitic lasing effect and fluorescence transverse amplification phenomena in large Ti:Sa crystals. A parametric study of these parasitic effects is also presented. Finally, the last part of this manuscript (Chapter 4) gives prospects of this work as part of the large future ELI and ILE projects. (author)

  13. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  14. Enhanced speed in fluorescence imaging using beat frequency multiplexing

    Science.gov (United States)

    Mikami, Hideharu; Kobayashi, Hirofumi; Wang, Yisen; Hamad, Syed; Ozeki, Yasuyuki; Goda, Keisuke

    2016-03-01

    Fluorescence imaging using radiofrequency-tagged emission (FIRE) is an emerging technique that enables higher imaging speed (namely, temporal resolution) in fluorescence microscopy compared to conventional fluorescence imaging techniques such as confocal microscopy and wide-field microscopy. It works based on the principle that it uses multiple intensity-modulated fields in an interferometric setup as excitation fields and applies frequency-division multiplexing to fluorescence signals. Unfortunately, despite its high potential, FIRE has limited imaging speed due to two practical limitations: signal bandwidth and signal detection efficiency. The signal bandwidth is limited by that of an acousto-optic deflector (AOD) employed in the setup, which is typically 100-200 MHz for the spectral range of fluorescence excitation (400-600 nm). The signal detection efficiency is limited by poor spatial mode-matching between two interfering fields to produce a modulated excitation field. Here we present a method to overcome these limitations and thus to achieve higher imaging speed than the prior version of FIRE. Our method achieves an increase in signal bandwidth by a factor of two and nearly optimal mode matching, which enables the imaging speed limited by the lifetime of the target fluorophore rather than the imaging system itself. The higher bandwidth and better signal detection efficiency work synergistically because higher bandwidth requires higher signal levels to avoid the contribution of shot noise and amplifier noise to the fluorescence signal. Due to its unprecedentedly high-speed performance, our method has a wide variety of applications in cancer detection, drug discovery, and regenerative medicine.

  15. Flashlamp excited fluid laser amplified

    International Nuclear Information System (INIS)

    1976-01-01

    The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

  16. Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

    NARCIS (Netherlands)

    Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

    2002-01-01

    This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

  17. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  18. Challenges in higher order mode Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

    2015-01-01

    A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

  19. S-band low noise amplifier and 40 kW high power amplifier subsystems of Japanese Deep Space Earth Station

    Science.gov (United States)

    Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.

    This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.

  20. Small signal microwave amplifier design

    CERN Document Server

    Grosch, Theodore

    2000-01-01

    This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

  1. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  2. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  3. Amplified spontaneous emissions in a high-gain laser amplifier

    International Nuclear Information System (INIS)

    Osada, Hidenori; Gamo, Hideya.

    1978-01-01

    The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

  4. Dual-range linearized transimpedance amplifier system

    Science.gov (United States)

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  5. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  6. Is there a role for amplifiers in sexual selection?

    Science.gov (United States)

    Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio

    2008-05-21

    The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information

  7. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2001-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

  8. Operational amplifiers theory and design

    CERN Document Server

    Huijsing, Johan

    2017-01-01

    This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

  9. Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

    NARCIS (Netherlands)

    Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

    2005-01-01

    Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

  10. Phase noise in RF and microwave amplifiers.

    Science.gov (United States)

    Boudot, Rodolphe; Rubiola, Enrico

    2012-12-01

    Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

  11. Separation of ballistic and diffusive fluorescence photons in confocal Light-Sheet Microscopy of Arabidopsis roots

    Science.gov (United States)

    Meinert, Tobias; Tietz, Olaf; Palme, Klaus J.; Rohrbach, Alexander

    2016-01-01

    Image quality in light-sheet fluorescence microscopy is strongly affected by the shape of the illuminating laser beam inside embryos, plants or tissue. While the phase of Gaussian or Bessel beams propagating through thousands of cells can be partly controlled holographically, the propagation of fluorescence light to the detector is difficult to control. With each scatter process a fluorescence photon loses information necessary for the image generation. Using Arabidopsis root tips we demonstrate that ballistic and diffusive fluorescence photons can be separated by analyzing the image spectra in each plane without a priori knowledge. We introduce a theoretical model allowing to extract typical scattering parameters of the biological material. This allows to attenuate image contributions from diffusive photons and to amplify the relevant image contributions from ballistic photons through a depth dependent deconvolution. In consequence, image contrast and resolution are significantly increased and scattering artefacts are minimized especially for Bessel beams with confocal line detection. PMID:27553506

  12. Separation of ballistic and diffusive fluorescence photons in confocal Light-Sheet Microscopy of Arabidopsis roots.

    Science.gov (United States)

    Meinert, Tobias; Tietz, Olaf; Palme, Klaus J; Rohrbach, Alexander

    2016-08-24

    Image quality in light-sheet fluorescence microscopy is strongly affected by the shape of the illuminating laser beam inside embryos, plants or tissue. While the phase of Gaussian or Bessel beams propagating through thousands of cells can be partly controlled holographically, the propagation of fluorescence light to the detector is difficult to control. With each scatter process a fluorescence photon loses information necessary for the image generation. Using Arabidopsis root tips we demonstrate that ballistic and diffusive fluorescence photons can be separated by analyzing the image spectra in each plane without a priori knowledge. We introduce a theoretical model allowing to extract typical scattering parameters of the biological material. This allows to attenuate image contributions from diffusive photons and to amplify the relevant image contributions from ballistic photons through a depth dependent deconvolution. In consequence, image contrast and resolution are significantly increased and scattering artefacts are minimized especially for Bessel beams with confocal line detection.

  13. Fluorescence Imaging of Fast Retrograde Axonal Transport in Living Animals

    Directory of Open Access Journals (Sweden)

    Dawid Schellingerhout

    2009-11-01

    Full Text Available Our purpose was to enable an in vivo imaging technology that can assess the anatomy and function of peripheral nerve tissue (neurography. To do this, we designed and tested a fluorescently labeled molecular probe based on the nontoxic C fragment of tetanus toxin (TTc. TTc was purified, labeled, and subjected to immunoassays and cell uptake assays. The compound was then injected into C57BL/6 mice (N = 60 for in vivo imaging and histologic studies. Image analysis and immunohistochemistry were performed. We found that TTc could be labeled with fluorescent moieties without loss of immunoreactivity or biologic potency in cell uptake assays. In vivo fluorescent imaging experiments demonstrated uptake and retrograde transport of the compound along the course of the sciatic nerve and in the spinal cord. Ex vivo imaging and immunohistochemical studies confirmed the presence of TTc in the sciatic nerve and spinal cord, whereas control animals injected with human serum albumin did not exhibit these features. We have demonstrated neurography with a fluorescently labeled molecular imaging contrast agent based on the TTc.

  14. Enhanced Gain in Photonic Crystal Amplifiers

    DEFF Research Database (Denmark)

    Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

    2012-01-01

    We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

  15. Novel (Phenylethynyl)pyrene-LNA Constructs for Fluorescence SNP Sensing in Polymorphic Nucleic Acid Targets

    DEFF Research Database (Denmark)

    Astakhova, Irina Kira; Samokhina, Evgeniya; Babu, B Ravindra

    2012-01-01

    We describe fluorescent oligonucleotide probes labeled with novel (phenylethynyl)pyrene dyes attached to locked nucleic acids. Furthermore, we prove the utility of these probes for the effective detection of single-nucleotide polymorphisms in natural nucleic acids. High-affinity hybridization......DNA and RNA gene fragments. Target sequences were obtained by analysis of 200 clinical samples from patients currently receiving anti-HIV/AIDS combination therapy at the Russian Federal AIDS Center. Using these fluorescent oligonucleotides, we were able to detect the target mutation despite all the challenges...

  16. Amplified Photon Upconversion by Photonic Shell of Cholesteric Liquid Crystals.

    Science.gov (United States)

    Kang, Ji-Hwan; Kim, Shin-Hyun; Fernandez-Nieves, Alberto; Reichmanis, Elsa

    2017-04-26

    As an effective platform to exploit triplet-triplet-annihilation-based photon upconversion (TTA-UC), microcapsules composed of a fluidic UC core and photonic shell are microfluidically prepared using a triple emulsion as the template. The photonic shell consists of cholesteric liquid crystals (CLCs) with a periodic helical structure, exhibiting a photonic band gap. Combined with planar anchoring at the boundaries, the shell serves as a resonance cavity for TTA-UC emission and enables spectral tuning of the UC under low-power-density excitation. The CLC shell can be stabilized by introducing a polymerizable mesogen in the LC host. Because of the microcapsule spherical symmetry, spontaneous emission of the delayed fluorescence is omnidirectionally amplified at the edge of the stop band. These results demonstrate the range of opportunities provided by TTA-UC systems for the future design of low-threshold photonic devices.

  17. First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

    Directory of Open Access Journals (Sweden)

    Carlos Scotto

    2013-09-01

    Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

  18. A system for biasing a differential amplifier

    International Nuclear Information System (INIS)

    Barbier, Daniel; Ittel, J.M.; Poujois, Robert

    1975-01-01

    This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

  19. Large-area, low-noise, high-speed, photodiode-based fluorescence detectors with fast overdrive recovery

    International Nuclear Information System (INIS)

    Bickman, S.; DeMille, D.

    2005-01-01

    Two large-area, low-noise, high-speed fluorescence detectors have been built. One detector consists of a photodiode with an area of 28 mmx28 mm and a low-noise transimpedance amplifier. This detector has a input light-equivalent spectral noise density of less than 3 pW/√(Hz), can recover from a large scattered light pulse within 10 μs, and has a bandwidth of at least 900 kHz. The second detector consists of a 16-mm-diam avalanche photodiode and a low-noise transimpedance amplifier. This detector has an input light-equivalent spectral noise density of 0.08 pW/√(Hz), also can recover from a large scattered light pulse within 10 μs, and has a bandwidth of 1 MHz

  20. Post-PCR detection of nucleic acids using metalloporphyrin labels and time-resolved fluorescence

    International Nuclear Information System (INIS)

    O'Shea, Desmond J.; O'Sullivan, Paul J.; Ponomarev, Gelii V.; Papkovsky, Dmitri B.

    2005-01-01

    Phosphorescent platinum(II)-coproporphyrin label (PtCP) was evaluated in post-PCR detection of nucleic acids by time-resolved fluorescence (TR-F) using three common formats. PtCP-labelled oligonucleotide primers and PtCP-dUTP were incorporated in a PCR to produce labelled amplified target -173 or 305 bp DNA. Alternatively, aminoallyl-dUTP was incorporated in a PCR and the product was subsequently labelled with PtCP. The resulting PCR mixtures containing labelled dsDNA were separated on 1.5% agarose gels and then analysed by ethidium bromide staining and by direct detection of PtCP label on a commercial TR-F plate reader Victor 2 (Perkin Elmer Life Sciences) used in scanning mode. In all cases label incorporation and high yields of amplified DNA were observed. Direct TR-F detection of PtCP-labelled DNA from a gel provided high sensitivity and signal to noise ratio, with limits of detection in the range of 9-22 pg for all three formats. The sensitivity achieved with PtCP label was considerably better than that achieved with ethidium bromide staining (∼1 ng of dsDNA) or with conventional fluorescent label FITC. Neither the FITC label nor ethidium bromide staining interfered with PtCP detection, thus allowing multiplexed detection

  1. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  2. Neratinib shows efficacy in the treatment of HER2/neu amplified uterine serous carcinoma in vitro and in vivo.

    Science.gov (United States)

    Schwab, Carlton L; English, Diana P; Roque, Dana M; Bellone, Stefania; Lopez, Salvatore; Cocco, Emiliano; Nicoletti, Roberta; Rutherford, Thomas J; Schwartz, Peter E; Santin, Alessandro D

    2014-10-01

    Uterine serous carcinoma (USC) represents an aggressive variant of endometrial cancer and accounts for a large proportion of deaths annually. HER2/neu amplification is associated with USC in approximately 30-35% of cases. The objective of this study was to determine the sensitivity of a panel of primary USC cell lines to the small tyrosine kinase inhibitor neratinib, an ErbB1 and HER2 inhibitor, both in vitro and in vivo. HER2/neu amplification was determined by immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) in 24 USC cell lines. Flow cytometry was used to determine the effects of neratinib on cell viability, cell cycle distribution and signaling in vitro. Mice harboring HER2/neu amplified xenografts were treated with neratinib to assess the efficacy of the drug in vivo. HER2/neu amplification was noted in 8/24 primary cell lines. Data regarding the efficacy of neratinib was determined using 4 HER2 amplified cell lines and 4 non-amplified cell lines with similar growth rates. Data revealed that cell lines with HER2/neu amplification were exquisitely more sensitive to neratinib compared to non-amplified cell lines (mean ± SEM IC50: 0.011μM ± 0.0008 vs. 0.312μM ± 0.0456 pNeratinib caused arrest in the G0/G1 phase of the cell cycle and resulted in decreased autophosphorylation of HER2 and activation of S6. Neratinib treated mice harboring xenografts of HER2/neu amplified USC showed delayed tumor growth and improved overall survival compared to vehicle (p=0.0019). Neratinib may be a potential treatment option for patients harboring HER2/neu amplified USC. Clinical trials for this subset of endometrial cancer patients are warranted. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Studying electron-PAG interactions using electron-induced fluorescence

    Science.gov (United States)

    Narasimhan, Amrit; Grzeskowiak, Steven; Ostrander, Jonathan; Schad, Jonathon; Rebeyev, Eliran; Neisser, Mark; Ocola, Leonidas E.; Denbeaux, Gregory; Brainard, Robert L.

    2016-03-01

    In extreme ultraviolet (EUV) lithography, 92 eV photons are used to expose photoresists. Typical EUV resists are organic-based and chemically amplified using photoacid generators (PAGs). Upon exposure, PAGs produce acids which catalyze reactions that result in changes in solubility. In EUV lithography, photo- and secondary electrons (energies of 10- 80 eV) play a large role in PAG acid-production. Several mechanisms for electron-PAG interactions (e.g. electron trapping, and hole-initiated chemistry) have been proposed. The aim of this study is to explore another mechanism - internal excitation - in which a bound PAG electron can be excited by receiving energy from another energetic electron, causing a reaction that produces acid. This paper explores the mechanism of internal excitation through the analogous process of electron-induced fluorescence, in which an electron loses energy by transferring that energy to a molecule and that molecule emits a photon rather than decomposing. We will show and quantify electron-induced fluorescence of several fluorophores in polymer films to mimic resist materials, and use this information to refine our proposed mechanism. Relationships between the molecular structure of fluorophores and fluorescent quantum yield may aid in the development of novel PAGs for EUV lithography.

  4. Solid-state disk amplifiers for fusion-laser systems

    Energy Technology Data Exchange (ETDEWEB)

    Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

    1981-09-01

    We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

  5. Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations

    Directory of Open Access Journals (Sweden)

    DiaS Edelberto S.

    1998-01-01

    Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

  6. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  7. Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

    International Nuclear Information System (INIS)

    Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

    1995-06-01

    MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

  8. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  9. Fluorescence Spectral Properties of All4261 Binding with Phycocyanobilin in E.Coli

    Science.gov (United States)

    Ma, Q.; Zheng, X. J.; Zhou, Z.; Zhou, N.; Zhao, K. H.; Zhou, M.

    2014-07-01

    Cyanobacteriochromes (CBCRs) are chromophorylated proteins that acting as sensory photoreceptors in cyanobacteria. Based on the bioinformatics of All4261 in Nostoc sp. PCC7120, All4261 is a CBCR apoprotein composed of GAF domains in the N-terminal region. Via polymerase chain reaction with specific primers, All4261 was amplified with genome DNA of Nostoc sp. PCC7120 as template and then subcloned into the expression vector pET30(a+). To survey the fluorescence spectral properties, All4261 was coexpressed with the plasmid that catalyzes phycocyanobilin (PCB) biosynthesis, pACYC-ho1-pcyA, in E.coli BL21. Fluorescence emission spectra and excitation spectra showed that chromophorylated cells containing All4261-PCB had a fluorescence emission peak at 645 nm and a fluorescence excitation peak at 550 nm, but no reversible photoconversion. In order to identify the binding site of PCB in All4261, we obtained three variants All4261(C296L), All4261(C328A), and All4261(C339L), via sitedirected mutagenesis. The binding site was identified as C339 based on the lack of PCB binding of All4261(C339L).

  10. Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2009-05-01

    Full Text Available Abstract Background Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Results Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. Conclusion We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology.

  11. Metastable Magnesium fluorescence spectroscopy using a frequency-stabilized 517 nm laser

    DEFF Research Database (Denmark)

    He, Ming; Jensen, Brian B; Therkildsen, Kasper T

    2009-01-01

    We present a laser operating at 517 nm for our Magnesium laser-cooling and atomic clock project. A two-stage Yb-doped fiber amplifier (YDFA) system generates more than 1.5 W of 1034 nm light when seeded with a 15 mW diode laser. Using a periodically poled lithium niobate (PPLN) waveguide, we obta...... obtained more than 40 mW of 517 nm output power by single pass frequency doubling. In addition, fluorescence spectroscopy of metastable magnesium atoms could be used to stabilize the 517 nm laser to an absolute frequency within 1 MHz.......We present a laser operating at 517 nm for our Magnesium laser-cooling and atomic clock project. A two-stage Yb-doped fiber amplifier (YDFA) system generates more than 1.5 W of 1034 nm light when seeded with a 15 mW diode laser. Using a periodically poled lithium niobate (PPLN) waveguide, we...

  12. Multi-pass amplifier architecture for high power laser systems

    Science.gov (United States)

    Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C

    2014-04-01

    A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.

  13. Design of an 1800nm Raman amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    2013-01-01

    We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

  14. Recombination-stable multimeric green fluorescent protein for characterization of weak promoter outputs in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Rugbjerg, Peter; Knuf, Christoph; Förster, Jochen

    2015-01-01

    a less leaky Cu2+-inducible promoter based on CUP1. The basal expression level of the new promoter was approx. 61% below the wild-type CUP1 promoter, thus expanding the absolute range of Cu2+-based gene control. The stability of 3vGFP towards direct-repeat recombination was assayed in S. cerevisiae......Green fluorescent proteins (GFPs) are widely used for visualization of proteins to track localization and expression dynamics. However, phenotypically important processes can operate at too low expression levels for routine detection, i.e. be overshadowed by autofluorescence noise. While GFP...... functions well in translational fusions, the use of tandem GFPs to amplify fluorescence signals is currently avoided in Saccharomyces cerevisiae and many other microorganisms due to the risk of loop-out by direct-repeat recombination. We increased GFP fluorescence by translationally fusing three different...

  15. Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

    Science.gov (United States)

    2012-01-01

    The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

  16. Analyses of Dynamics in Dairy Products and Identification of Lactic Acid Bacteria Population by Molecular Methods

    Directory of Open Access Journals (Sweden)

    Aytül Sofu

    2017-01-01

    Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.

  17. Remote Acquisition Amplifier For 50-Ohm Cable

    Science.gov (United States)

    Amador, Jose J.

    1995-01-01

    Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

  18. The use of fluorescent intrabodies to detect endogenous gankyrin in living cancer cells

    International Nuclear Information System (INIS)

    Rinaldi, Anne-Sophie; Freund, Guillaume; Desplancq, Dominique; Sibler, Annie-Paule; Baltzinger, Mireille; Rochel, Natacha; Mély, Yves; Didier, Pascal; Weiss, Etienne

    2013-01-01

    Expression of antibody fragments in mammalian cells (intrabodies) is used to probe the target protein or interfere with its biological function. We previously described the in vitro characterisation of a single-chain Fv (scFv) antibody fragment (F5) isolated from an intrabody library that binds to the oncoprotein gankyrin (GK) in solution. Here, we have isolated several other scFvs that interact with GK in the presence of F5 and tested whether they allow, when fused to fluorescent proteins, to detect by FRET endogenous GK in living cells. The binding of pairs of scFvs to GK was analysed by gel filtration and the ability of each scFv to mediate nuclear import/export of GK was determined. Binding between scFv-EGFP and RFP-labelled GK in living cells was detected by fluorescence lifetime imaging microscopy (FLIM). After co-transfection of two scFvs fused to EGFP and RFP, respectively, which form a tri-molecular complex with GK in vitro, FRET signal was measured. This system allowed us to observe that GK is monomeric and distributed throughout the cytoplasm and nucleus of several cancer cell lines. Our results show that pairs of fluorescently labelled intrabodies can be monitored by FLIM–FRET microscopy and that this technique allows the detection of lowly expressed endogenous proteins in single living cells. Highlights: ► Endogenous GK in living cells was targeted with pairs of fluorescently-tagged scFvs. ► Tri-molecular complexes containing two scFvs and one molecule GK were formed. ► GK was detected using fluorescence lifetime-based FRET imaging. ► GK is monomeric and homogeneously distributed in several cancer cell lines. ► This technique may have many applications in live-cell imaging of endogenous proteins

  19. The use of fluorescent intrabodies to detect endogenous gankyrin in living cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Rinaldi, Anne-Sophie; Freund, Guillaume; Desplancq, Dominique; Sibler, Annie-Paule; Baltzinger, Mireille [Ecole Supérieure de Biotechnologie de Strasbourg, UMR 7242, CNRS/Université de Strasbourg, boulevard Sébastien Brant, 67412 Illkirch (France); Rochel, Natacha [Institut de Génétique et de Biologie Moléculaire et Cellulaire, UMR 7104, CNRS/INSERM/Université de Strasbourg, rue Laurent Fries, 67404 Illkirch (France); Mély, Yves; Didier, Pascal [Faculté de Pharmacie, UMR 7213, CNRS/Université de Strasbourg, route du Rhin, 67401 Illkirch (France); Weiss, Etienne, E-mail: eweiss@unistra.fr [Ecole Supérieure de Biotechnologie de Strasbourg, UMR 7242, CNRS/Université de Strasbourg, boulevard Sébastien Brant, 67412 Illkirch (France)

    2013-04-01

    Expression of antibody fragments in mammalian cells (intrabodies) is used to probe the target protein or interfere with its biological function. We previously described the in vitro characterisation of a single-chain Fv (scFv) antibody fragment (F5) isolated from an intrabody library that binds to the oncoprotein gankyrin (GK) in solution. Here, we have isolated several other scFvs that interact with GK in the presence of F5 and tested whether they allow, when fused to fluorescent proteins, to detect by FRET endogenous GK in living cells. The binding of pairs of scFvs to GK was analysed by gel filtration and the ability of each scFv to mediate nuclear import/export of GK was determined. Binding between scFv-EGFP and RFP-labelled GK in living cells was detected by fluorescence lifetime imaging microscopy (FLIM). After co-transfection of two scFvs fused to EGFP and RFP, respectively, which form a tri-molecular complex with GK in vitro, FRET signal was measured. This system allowed us to observe that GK is monomeric and distributed throughout the cytoplasm and nucleus of several cancer cell lines. Our results show that pairs of fluorescently labelled intrabodies can be monitored by FLIM–FRET microscopy and that this technique allows the detection of lowly expressed endogenous proteins in single living cells. Highlights: ► Endogenous GK in living cells was targeted with pairs of fluorescently-tagged scFvs. ► Tri-molecular complexes containing two scFvs and one molecule GK were formed. ► GK was detected using fluorescence lifetime-based FRET imaging. ► GK is monomeric and homogeneously distributed in several cancer cell lines. ► This technique may have many applications in live-cell imaging of endogenous proteins.

  20. Multiple excitation regenerative amplifier inertial confinement system

    International Nuclear Information System (INIS)

    George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

    1980-01-01

    The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

  1. Spectral hole-burning and carrier-heating dynamics in quantum-dot amplifiers: Comparison with bulk amplifiers

    DEFF Research Database (Denmark)

    Borri, P.; Langbein, W.; Hvam, Jørn Märcher

    2001-01-01

    The ultrafast gain dynamics in an electrically pumped InAs/InGaAs/GaAs quantum-dot amplifier are measured at room temperature with femtosecond resolution, and compared with results on an InGaAsP bulk amplifier. The role of spectral hole burning and carrier heating in the recovery of the gain...

  2. Luminal epithelium in endometrial fragments affects their vascularization, growth and morphological development into endometriosis-like lesions in mice.

    Science.gov (United States)

    Feng, Dilu; Menger, Michael D; Wang, Hongbo; Laschke, Matthias W

    2014-02-01

    In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE(+)) and without luminal epithelium (LE(-)) were transplanted from transgenic green-fluorescent-protein-positive (GFP(+)) donor mice into the dorsal skinfold chamber of GFP(-) wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE(-) fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE(+) fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE(+) lesions compared with LE(-) lesions. In addition, we found that many GFP(+) microvessels grew outside the LE(-) lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.

  3. Luminal epithelium in endometrial fragments affects their vascularization, growth and morphological development into endometriosis-like lesions in mice

    Directory of Open Access Journals (Sweden)

    Dilu Feng

    2014-02-01

    Full Text Available In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE+ and without luminal epithelium (LE− were transplanted from transgenic green-fluorescent-protein-positive (GFP+ donor mice into the dorsal skinfold chamber of GFP− wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE− fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE+ fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE+ lesions compared with LE− lesions. In addition, we found that many GFP+ microvessels grew outside the LE− lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.

  4. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  5. Laser-induced-fluorescence studies of fragment ions: CH+ and CD+

    International Nuclear Information System (INIS)

    O'Keefe, A.

    1981-08-01

    The dynamics of ion-molecule interactions within a mass selective rf quadrupole ion trap are studied for several ion-molecule systems. Laser induced fluorescence is used as a probe of the internal energy distributions of molecular ions under collision free conditions and under controlled collision conditions. The effects of collisions at near thermal energies (0.3 to 0.5 eV) are easily understood in terms of processes such as charge transfer and other energy transfer mechanisms. The A 1 PI - X 1 Σ + system of CH + and CD + has been examined under collision free conditions. The ions were produced from methane through electron impact ionization/dissociation. The observed energy distributions reflect the dynamical partitioning of dissociation exothermicity, excepting short lived electronic states. Many new transitions belonging to this electronic system have been observed and a reliable vibrational frequency for the X 1 Σ + state has been obtained. The radiative lifetimes of CH + and CD + A 1 PI(v = 0) states have been measured and a revised oscillator strength for the A-X transition has been derived from this data

  6. The OPTHER Project: Progress toward the THz Amplifier

    DEFF Research Database (Denmark)

    Paoloni, C; Brunetti, F; Di Carlo, A

    2011-01-01

    This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....

  7. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    Science.gov (United States)

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications

    Directory of Open Access Journals (Sweden)

    José A. Centeno

    2014-01-01

    Full Text Available Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU, tungsten (W, lead (Pb, and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF, scanning electron microscopy (SEM, laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS, and confocal laser Raman

  9. Use of random amplified polymorphic DNA (RAPD) for generating specific DNA probes for oxyuroid species (Nematoda).

    Science.gov (United States)

    Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P

    1998-03-01

    Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.

  10. Spectroscopic amplifier for pin diode

    International Nuclear Information System (INIS)

    Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

    2014-10-01

    The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

  11. Automatic error compensation in dc amplifiers

    International Nuclear Information System (INIS)

    Longden, L.L.

    1976-01-01

    When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks

  12. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    Science.gov (United States)

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

  13. Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

    Science.gov (United States)

    Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

    2016-01-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  14. Copolymers containing meta-pyridylvinylene and para-arylenevinylene fragments: synthesis, quaternization reaction, and photophysical properties

    Science.gov (United States)

    Barashkov, Nikolay N.; Olivos, Hernando J.; Ferraris, John P.

    1997-12-01

    We report the Wittig reaction of the diphosphonium salt of 2,6-bis(chloromethyl)pyridine with terephthaldehyde, 2.5- dioctyloxyterephthaldehyde, or 9,10-anthracenedicarbaldehyde to form conjugated copolymers with fragments of 2,6 - pyridylene and para-arylenevinylene. The protonation reaction of poly(para-arylenevinylene)-co-(meta- pyridylvinylene) with hydrochloric acid and the quaternization reaction of poly(2,5-dioctyloxy-1,4- phenylenevinylene)-co-(2,6-pyridylvinylene) with methyl triflate have been investigated by spectrophotometric and fluorescent methods. The absorption, excitation and fluorescence spectra of these copolymers as well as their corresponding model compounds were studied and compared. The photophysical properties of the investigated polymers suggest that these materials could be good candidates for the fabrication of efficient blue and green light-emitting diodes.

  15. Quantum electronics maser amplifiers and oscillators

    CERN Document Server

    Fain, V M; Sanders, J H

    2013-01-01

    Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

  16. Class-E Amplifier Design Improvements for GSM Frequencies

    Directory of Open Access Journals (Sweden)

    Z. Nadir

    2011-06-01

    Full Text Available Efficient power amplifiers are essential in portable battery-operated systems such as mobile phones. Also, the power amplifier (PA is the most power-consuming building block in the transmitter of a portable system. This paper investigates how the efficiency of the power amplifier (which is beneficial for multiple applications in communcation sector can be improved by increasing the efficiency of switching mode class E power amplifiers for frequencies of 900 MHz and 1800 MHz. The paper tackles modeling, design improvements and verification through simulation for higher efficiencies. This is the continuation of previous work by the authors. These nonlinear power amplifiers can only amplify constant-envelope RF signals without introducing significant distortion. Mobile systems such as Advanced Mobile Phone System (AMPS and Global System for Mobile communications (GSM use modulation schemes which generate constant amplitude RF outputs in order to use efficient but nonlinear power amplifiers. Improvements in designs are suggested and higher efficiencies are achieved, to the tune of 67.1% (for 900 MHz and 67.0% (1800 MHz.

  17. Development of a portable system of X-ray fluorescence spectrometry

    International Nuclear Information System (INIS)

    Mantuano, Andrea; Crisostomo, Jose V.V.; Barros, Mariana J.; Oliveira, Luis F.; Barroso, Regina C.

    2009-01-01

    This paper develops a compact and portable spectrometry system that will be used at the Laboratory of Applied Physics to the Biomedical and Environmental Sciences of the Institute of Physics/UERJ, Rio de Janeiro, Brazil. The laboratory both prepares the samples and develops the X-ray spectrometry techniques. The techniques of X-ray diffraction and fluorescence on various samples (biological, industrial and environmental) are used, attending to pos-graduation and graduation students, with multidisciplinary characteristics. The Mini-X system consists of X-ray mini tube MINI-X from Amptek with tungsten (W) target, and a compact spectrometer X123, also from Amptek that includes a detector, pre-amplifier, digital pulse processor, and multichannel. All the system is controlled by dedicated microprocessor. This work will present both a methodology for alignment and calibration of the system as far the first measurements performed using the X-ray fluorescence technique on standard samples. The multi elementary analysis by X-ray fluorescence (XRF) is based on the measurements of the characteristic X-ray intensity emitted by the chemical elements components of the samples when excited. Therefore, from the development of this compact and versatile system it will be possible to obtain the fluorescent intensities of the analysed samples at the Laboratory, not only at the research area but at the teaching area. Besides, new laboratory practices are being developed for the discipline of medical physics

  18. Amplified OTDR Systems for Multipoint Corrosion Monitoring

    Science.gov (United States)

    Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.

    2012-01-01

    We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017

  19. Bandwidth tunable amplifier for recording biopotential signals.

    Science.gov (United States)

    Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer

    2010-01-01

    This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.

  20. Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

    Science.gov (United States)

    Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

    2018-03-01

    It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

  1. Wireless implantable electronic platform for chronic fluorescent-based biosensors.

    Science.gov (United States)

    Valdastri, Pietro; Susilo, Ekawahyu; Förster, Thilo; Strohhöfer, Christof; Menciassi, Arianna; Dario, Paolo

    2011-06-01

    The development of a long-term wireless implantable biosensor based on fluorescence intensity measurement poses a number of technical challenges, ranging from biocompatibility to sensor stability over time. One of these challenges is the design of a power efficient and miniaturized electronics, enabling the biosensor to move from bench testing to long term validation, up to its final application in human beings. In this spirit, we present a wireless programmable electronic platform for implantable chronic monitoring of fluorescent-based autonomous biosensors. This system is able to achieve extremely low power operation with bidirectional telemetry, based on the IEEE802.15.4-2003 protocol, thus enabling over three-year battery lifetime and wireless networking of multiple sensors. During the performance of single fluorescent-based sensor measurements, the circuit drives a laser diode, for sensor excitation, and acquires the amplified signals from four different photodetectors. In vitro functionality was preliminarily tested for both glucose and calcium monitoring, simply by changing the analyte-binding protein of the biosensor. Electronics performance was assessed in terms of timing, power consumption, tissue exposure to electromagnetic fields, and in vivo wireless connectivity. The final goal of the presented platform is to be integrated in a complete system for blood glucose level monitoring that may be implanted for at least one year under the skin of diabetic patients. Results reported in this paper may be applied to a wide variety of biosensors based on fluorescence intensity measurement.

  2. A highly sensitive fluorescence resonance energy transfer aptasensor for staphylococcal enterotoxin B detection based on exonuclease-catalyzed target recycling strategy

    International Nuclear Information System (INIS)

    Wu, Shijia; Duan, Nuo; Ma, Xiaoyuan; Xia, Yu; Wang, Hongxin; Wang, Zhouping

    2013-01-01

    Graphical abstract: -- Highlights: •An ultrasensitive FRET aptasensor was developed for staphylococcal enterotoxin B determination. •SEB was recognized by SEB aptamer with high affinity and specificity. •The Mn 2+ doped NaYF 4 :Yb/Er UCNPs used as donor to quencher dye (BHQ 3 ) in new FRET. •The fluorescence intensity was prominently amplified using an exonuclease-catalyzed target recycling strategy. -- Abstract: An ultrasensitive fluorescence resonance energy transfer (FRET) bioassay was developed to detect staphylococcal enterotoxin B (SEB), a low molecular exotoxin, using an aptamer-affinity method coupled with upconversion nanoparticles (UCNPs)-sensing, and the fluorescence intensity was prominently enhanced using an exonuclease-catalyzed target recycling strategy. To construct this aptasensor, both fluorescence donor probes (complementary DNA 1 –UCNPs) and fluorescence quencher probes (complementary DNA 2 –Black Hole Quencher 3 (BHQ 3 )) were hybridized to an SEB aptamer, and double-strand oligonucleotides were fabricated, which quenched the fluorescence of the UCNPs via FRET. The formation of an aptamer–SEB complex in the presence of the SEB analyte resulted in not only the dissociation of aptamer from the double-strand DNA but also both the disruption of the FRET system and the restoration of the UCNPs fluorescence. In addition, the SEB was liberated from the aptamer–SEB complex using exonuclease I, an exonuclease specific to single-stranded DNA, for analyte recycling by selectively digesting a particular DNA (SEB aptamer). Based on this exonuclease-catalyzed target recycling strategy, an amplified fluorescence intensity could be produced using different SEB concentrations. Using optimized experimental conditions produced an ultrasensitive aptasensor for the detection of SEB, with a wide linear range of 0.001–1 ng mL −1 and a lower detection limit (LOD) of 0.3 pg mL −1 SEB (at 3σ). The fabricated aptasensor was used to measure SEB in a

  3. BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

    DEFF Research Database (Denmark)

    2010-01-01

    Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

  4. A modular positive feedback-based gene amplifier

    Directory of Open Access Journals (Sweden)

    Bhalerao Kaustubh D

    2010-02-01

    Full Text Available Abstract Background Positive feedback is a common mechanism used in the regulation of many gene circuits as it can amplify the response to inducers and also generate binary outputs and hysteresis. In the context of electrical circuit design, positive feedback is often considered in the design of amplifiers. Similar approaches, therefore, may be used for the design of amplifiers in synthetic gene circuits with applications, for example, in cell-based sensors. Results We developed a modular positive feedback circuit that can function as a genetic signal amplifier, heightening the sensitivity to inducer signals as well as increasing maximum expression levels without the need for an external cofactor. The design utilizes a constitutively active, autoinducer-independent variant of the quorum-sensing regulator LuxR. We experimentally tested the ability of the positive feedback module to separately amplify the output of a one-component tetracycline sensor and a two-component aspartate sensor. In each case, the positive feedback module amplified the response to the respective inducers, both with regards to the dynamic range and sensitivity. Conclusions The advantage of our design is that the actual feedback mechanism depends only on a single gene and does not require any other modulation. Furthermore, this circuit can amplify any transcriptional signal, not just one encoded within the circuit or tuned by an external inducer. As our design is modular, it can potentially be used as a component in the design of more complex synthetic gene circuits.

  5. Realization of OFCC based Transimpedance Mode Instrumentation Amplifier

    Directory of Open Access Journals (Sweden)

    Neeta Pandey

    2016-01-01

    Full Text Available The paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three Operational Floating Current Conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematicThe paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three operational floating current conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematic.

  6. Quantum-Limited Directional Amplifiers with Optomechanics

    Science.gov (United States)

    Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

    2018-01-01

    Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

  7. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

  8. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  9. Integrated wide-band low-background amplifiers

    International Nuclear Information System (INIS)

    Il'yushchenko, I.I.

    1980-01-01

    Ways of increasing stability and reproduction of characteristics of wide-band integral amplifiers that would to the least extent increase their background noises, are discussed. Considered are some certain flowsheets of integral wide-band amplifiers with low background noise of foreign production which differ from one another by construction of inlet cascades as well as by the applied feedback type. The principal flowsheets of the amplifiers and their main performances are presented. The analysis of the data obtained has revealed that microcircuits made of cascades with a common emitter and local combined feedback are most wide-band among all the considered microcircuits [ru

  10. Advances in high-power rf amplifiers

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1979-01-01

    Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

  11. Class D audio amplifiers for high voltage capacitive transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis

    of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...

  12. Design of remote laser-induced fluorescence system's acquisition circuit

    Science.gov (United States)

    Wang, Guoqing; Lou, Yue; Wang, Ran; Yan, Debao; Li, Xin; Zhao, Xin; Chen, Dong; Zhao, Qi

    2017-10-01

    Laser-induced fluorescence system(LIfS) has been found its significant application in identifying one kind of substance from another by its properties even it's thimbleful, and becomes useful in plenty of fields. Many superior works have reported LIfS' theoretical analysis , designs and uses. However, the usual LIPS is always constructed in labs to detect matter quite closely, for the system using low-power laser as excitation source and charge coupled device (CCD) as detector. Promoting the detectivity of LIfS is of much concern to spread its application. Here, we take a high-energy narrow-pulse laser instead of commonly used continuous wave laser to operate sample, thus we can get strong fluorescent. Besides, photomultiplier (PMT) with high sensitivity is adopted in our system to detect extremely weak fluorescence after a long flight time from the sample to the detector. Another advantage in our system, as the fluorescence collected into spectroscopy, multiple wavelengths of light can be converted to the corresponding electrical signals with the linear array multichannel PMT. Therefore, at the cost of high-powered incentive and high-sensitive detector, a remote LIFS is get. In order to run this system, it is of importance to turn light signal to digital signal which can be processed by computer. The pulse width of fluorescence is deeply associated with excitation laser, at the nanosecond(ns) level, which has a high demand for acquisition circuit. We design an acquisition circuit including, I/V conversion circuit, amplifying circuit and peak-holding circuit. The simulation of circuit shows that peak-holding circuit can be one effective approach to reducing difficulty of acquisition circuit.

  13. Amplified Policymaking

    Science.gov (United States)

    Prince, Katherine; Woempner, Carolyn

    2010-01-01

    This brief examines the policy implications of two drivers of change presented in the "2020 Forecast: Creating the Future of Learning"-- Pattern Recognition and Amplified Organization. These drivers point toward a series of cultural shifts and illuminate how we are developing new ways of organizing, constructing, and managing knowledge.…

  14. Amplified spontaneous emission spectrum and gain characteristic of a two-electrode semiconductor optical amplifier

    International Nuclear Information System (INIS)

    Wang Hanchao; Huang Lirong; Shi Zhongwei

    2011-01-01

    A two-electrode multi-quantum-well semiconductor optical amplifier is designed and fabricated. The amplified spontaneous emission (ASE) spectrum and gain were measured and analyzed. It is shown that the ASE spectrum and gain characteristic are greatly influencedby the distribution of the injection current density. By changing the injection current density of two electrodes, the full width at half maximum, peak wavelength, peak power of the ASE spectrum and the gain characteristic can be easily controlled. (semiconductor devices)

  15. CARM and harmonic gyro-amplifier experiments at 17 GHz

    International Nuclear Information System (INIS)

    Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.

    1993-01-01

    Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed

  16. Characterization of a Common-Gate Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeod, Todd C.; Ho, Fat D.

    2011-01-01

    In this paper, the empirical data collected through experiments performed using a FeFET in the common-gate amplifier circuit is presented. The FeFET common-gate amplifier was characterized by varying all parameters in the circuit, such as load resistance, biasing of the transistor, and input voltages. Due to the polarization of the ferroelectric layer, the particular behavior of the FeFET common-gate amplifier presents interesting results. Furthermore, the differences between a FeFET common-gate amplifier and a MOSFET common-gate amplifier are examined.

  17. Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

    Science.gov (United States)

    Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

    2000-01-01

    An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214

  18. The design of high performance weak current integrated amplifier

    International Nuclear Information System (INIS)

    Chen Guojie; Cao Hui

    2005-01-01

    A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)

  19. vuv fluorescence from selective high-order multiphoton excitation of N2

    International Nuclear Information System (INIS)

    Coffee, Ryan N.; Gibson, George N.

    2004-01-01

    Recent fluorescence studies suggest that ultrashort pulse laser excitation may be highly selective. Selective high-intensity laser excitation holds important consequences for the physics of multiphoton processes. To establish the extent of this selectivity, we performed a detailed comparative study of the vacuum ultraviolet fluorescence resulting from the interaction of N 2 and Ar with high-intensity infrared ultrashort laser pulses. Both N 2 and Ar reveal two classes of transitions, inner-valence ns ' l ' . From their pressure dependence, we associate each transition with either plasma or direct laser excitation. Furthermore, we qualitatively confirm such associations with the time dependence of the fluorescence signal. Remarkably, only N 2 presents evidence of direct laser excitation. This direct excitation produces ionic nitrogen fragments with inner-valence (2s) holes, two unidentified transitions, and one molecular transition, the N 2 + :X 2 Σ g + 2 Σ u + . We discuss these results in the light of a recently proposed model for multiphoton excitation

  20. Quantum Dot Semiconductor Optical Amplifiers - Physics and Applications

    DEFF Research Database (Denmark)

    Berg, Tommy Winther

    2004-01-01

    This thesis describes the physics and applications of quantum dot semiconductor optical amplifiers based on numerical simulations. These devices possess a number of unique properties compared with other types of semiconductor amplifiers, which should allow enhanced performance of semiconductor...... respects is comparable to those of fiber amplifiers. The possibility of inverting the optically active states to a large degree is essential in order to achieve this performance. Optical signal processing through cross gain modulation and four wave mixing is modeled and described. For both approaches...... and QW devices and to experiments on quantum dot amplifiers. These comparisons outline the qualitative differences between the different types of amplifiers. In all cases focus is put on the physical processes responsible the differences....

  1. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  2. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Analog circuit design designing high performance amplifiers

    CERN Document Server

    Feucht, Dennis

    2010-01-01

    The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.

  4. High power X-band coaxial amplifier experiments

    International Nuclear Information System (INIS)

    Davis, T.J.; Nation, J.A.

    1991-01-01

    Studies are continuing on the development of X-band coaxial microwave amplifiers as a source for next generation linear colliders. Coaxial amplifiers employ an annular electron beam propagating between inner and outer drift tube conductors, a configuration which allows large increases in beam current over standard pencil beam amplifiers. Large average diameter systems may still be used without mode competition since TM mode cutoff frequencies are controlled by the separation between conductors. A number of amplifier configurations are being studied, all primed by a driven initial cavity which resonates around 9 GHz. Simple theory of coaxial systems and particle-in-cell simulations are presented, as well as initial experimental results using a 420 keV, 7-8 kA, 9 cm diameter annular beam

  5. Wideband multi-element Er-doped fiber amplifier

    International Nuclear Information System (INIS)

    Thipparapu, N K; Jain, S; May-Smith, T C; Sahu, J K

    2014-01-01

    A multi-element Er-doped fiber amplifier (MEEDFA) is demonstrated in which the gain profile is extended into the S and L bands. Each fiber element of the MEEDFA is found to provide a maximum gain of 37 dB and a noise figure of < 4 dB in the C-band. The gain profile of the amplifier is shifted towards longer wavelength by cascading fiber elements. The novel geometry of the multi-element fiber (MEF) could allow for the development of a broadband amplifier in a split-band configuration. The proposed amplifier can operate in the wavelength band of 1520 to 1595 nm (75 nm), with a minimum gain of 20 dB. (letter)

  6. A parallel input composite transimpedance amplifier

    Science.gov (United States)

    Kim, D. J.; Kim, C.

    2018-01-01

    A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

  7. Unconditionally stable microwave Si-IMPATT amplifiers

    International Nuclear Information System (INIS)

    Seddik, M.M.

    1986-07-01

    The purpose of this investigation has been the development of an improved understanding of the design and analysis of microwave reflection amplifiers employing the negative resistance property of the IMPATT devices. Unconditionally stable amplifier circuit using a Silicon IMPATT diode is designed. The problems associated with the design procedures and the stability criterion are discussed. A computer program is developed to perform the computations. The stable characteristics of a reflection-type Si-IMPATT amplifier, such as gain, frequency and bandwidth are examined. It was found that at large signal drive levels, 7 dB gain with bandwidth of 800 MHz at 22,5 mA was obtained. (author)

  8. Low noise amplifier for ZnS(Ag) scintillation chamber

    International Nuclear Information System (INIS)

    Do Hoang Cuong

    1998-01-01

    A new pulse amplifier that can be used with standard photomultiplier tubes coupled with Zn(Ag) scintillation chamber is presented. The amplifier based on an IC operational amplifier LF 356N consists of a low-noise charge sensitive preamplifier and pulse shaping circuits for optimization of signal to noise ratio. Temperature instability is ≤ 0.05%/ o C. Dynamic range for linear output signals is equal +7 V. The presented amplifier is used in a measuring head for 0.17 L Lucas chambers developed in Department of Nuclear Instruments and Methods of the INCT in laboratory investigations aimed to develop methods and instruments for measurement of radon concentration in the air. The amplifier can also be employed for measurement of ionizing radiation by means of other scintillators coupled to PM tube. The amplifier is followed by a pulse discriminator with adjustable discrimination level. The amplifier output signal and discriminator output pulses are fed to external devices. (author)

  9. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  10. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  11. Detection and Interpretation of Fluorescence Signals Generated by Excitable Cells and Tissues

    Science.gov (United States)

    Costantino, Anthony J.

    Part 1: High-Sensitivity Amplifiers for Detecting Fluorescence . Monitoring electrical activity and Cai 2+ transients in biological tissues and individual cells increasingly utilizes optical sensors based on voltage-dependent and Cai 2+-dependent fluorescent dyes. However, achieving satisfactory signal-to-noise ratios (SNR) often requires increased illumination intensities and/or dye concentrations, which results in photo-toxicity, photo-bleaching and other adverse effects limiting the utility of optical recordings. The most challenging are the recordings from individual cardiac myocytes and neurons. Here we demonstrate that by optimizing a conventional transimpedance topology one can achieve a 10-20 fold increase of sensitivity with photodiode-based recording systems (dependent on application). We provide a detailed comparative analysis of the dynamic and noise characteristics of different transimpedance amplifier topologies as well as the example(s) of their practical implementation. Part 2: Light-Scattering Models for Interpretation of Fluorescence Data. Current interest in understanding light transport in cardiac tissue has been motivated in part by increased use of voltage-sensitive and Ca i2+-sensitive fluorescent probes to map electrical impulse propagation and Cai2+-transients in the heart. The fluorescent signals are recorded using such probes represent contributions from different layers of myocardial tissue and are greatly affected by light scattering. The interpretation of these signals thus requires deconvolution which would not be possible without detailed models of light transport in the respective tissue. Which involves the experimental measurements of the absorption, scattering, and anisotropy coefficients, mua, mu s, and g respectively. The aim of the second part of our thesis was to derive a new method for deriving these parameters from high spatial resolution measurements of forward-directed flux (FDF). To this end, we carried out high spatial

  12. Transpermeance Amplifier Applied to Magnetic Bearings

    Directory of Open Access Journals (Sweden)

    Jossana Ferreira

    2017-02-01

    Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

  13. A high-power two stage traveling-wave tube amplifier

    International Nuclear Information System (INIS)

    Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.

    1991-01-01

    Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length

  14. Photonic-band-gap gyrotron amplifier with picosecond pulses

    Science.gov (United States)

    Nanni, Emilio A.; Jawla, Sudheer; Lewis, Samantha M.; Shapiro, Michael A.; Temkin, Richard J.

    2017-12-01

    We report the amplification of 250 GHz pulses as short as 260 ps without observation of pulse broadening using a photonic-band-gap circuit gyrotron traveling-wave-amplifier. The gyrotron amplifier operates with a device gain of 38 dB and an instantaneous bandwidth of 8 GHz. The operational bandwidth of the amplifier can be tuned over 16 GHz by adjusting the operating voltage of the electron beam and the magnetic field. The amplifier uses a 30 cm long photonic-band-gap interaction circuit to confine the desired TE03-like operating mode while suppressing lower order modes which can result in undesired oscillations. The circuit gain is >55 dB for a beam voltage of 23 kV and a current of 700 mA. These results demonstrate the wide bandwidths and a high gain achievable with gyrotron amplifiers. The amplification of picosecond pulses of variable lengths, 260-800 ps, shows good agreement with the theory using the coupled dispersion relation and the gain-spectrum of the amplifier as measured with quasi-CW input pulses.

  15. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  16. Characterization of a Common-Source Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeond, Todd C.; Ho, Pat D.

    2010-01-01

    This paper presents empirical data that was collected through experiments using a FeFET in the established common-source amplifier circuit. The unique behavior of the FeFET lends itself to interesting and useful operation in this widely used common-source amplifier. The paper examines the effect of using a ferroelectric transistor for the amplifier. It also examines the effects of varying load resistance, biasing, and input voltages on the output signal and gives several examples of the output of the amplifier for a given input. The difference between a commonsource amplifier using a ferroelectric transistor and that using a MOSFET is addressed.

  17. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  18. Class-D audio amplifiers with negative feedback

    OpenAIRE

    Cox, Stephen M.; Candy, B. H.

    2006-01-01

    There are many different designs for audio amplifiers. Class-D, or switching, amplifiers generate their output signal in the form of a high-frequency square wave of variable duty cycle (ratio of on time to off time). The square-wave nature of the output allows a particularly efficient output stage, with minimal losses. The output is ultimately filtered to remove components of the spectrum above the audio range. Mathematical models are derived here for a variety of related class-D amplifier de...

  19. Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

    Directory of Open Access Journals (Sweden)

    Nguyen-Hieu Tung

    2012-09-01

    Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

  20. Differential transimpedance amplifier circuit for correlated differential amplification

    Science.gov (United States)

    Gresham, Christopher A [Albuquerque, NM; Denton, M Bonner [Tucson, AZ; Sperline, Roger P [Tucson, AZ

    2008-07-22

    A differential transimpedance amplifier circuit for correlated differential amplification. The amplifier circuit increase electronic signal-to-noise ratios in charge detection circuits designed for the detection of very small quantities of electrical charge and/or very weak electromagnetic waves. A differential, integrating capacitive transimpedance amplifier integrated circuit comprising capacitor feedback loops performs time-correlated subtraction of noise.

  1. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  2. A novel, simple and efficient dye laser with low amplified spontaneous emission background for analytical fluorescence and ionization spectroscopy

    International Nuclear Information System (INIS)

    Matveev, Oleg I.; Omenetto, Nicolo'

    1995-01-01

    A new, simple, compact and efficient, grazing- incidence type of dye laser is suggested which has a low level of Amplified Spontaneous Emission. By using a Coumarin dye (LD 5000) pumped with a 20 mJ XeCl excimer laser, and a diffraction grating with 3000 grooves/mm, an efficiency of 11%, a spectral bandwidth of 0.6 cm -1 and a tuning range from 458 to 517 nm have been obtained

  3. Highly Enhanced Fluorescence of CdSeTe Quantum Dots Coated with Polyanilines via In-Situ Polymerization and Cell Imaging Application.

    Science.gov (United States)

    Xue, Jingjing; Chen, Xinyi; Liu, Shanglin; Zheng, Fenfen; He, Li; Li, Lingling; Zhu, Jun-Jie

    2015-09-02

    The polyaniline (PAN)-coated CdSeTe quantum dots (QDs) were prepared by in situ polymerization of aniline on the surface of CdSeTe QDs. The PAN-coated CdSeTe QDs has a tremendously enhanced fluorescence (∼40 times) and improved biocompatibility compared to the uncoated CdSeTe QDs. The fluorescence intensity of the PAN-coated CdSeTe QDs can be adjusted by controlling the construction parameters of the PAN shell. The kinetics of the in situ controllable polymerization process was studied by varying the temperature, and the apparent activation energy of polymerization was estimated. With the same method, a series of the PAN derivatives were also tested to coat the CdSeTe QDs in this study. All the QDs showed a significant enhancement of the fluorescence intensity and better biocompatibility. The significantly enhanced fluorescence can provide highly amplified signal for luminescence-based cell imaging.

  4. Ring cavity for a Raman capillary waveguide amplifier

    Science.gov (United States)

    Kurnit, N.A.

    1981-01-27

    A regenerative ring amplifier and regenerative ring oscillator are described which function to feed back a portion of the Stokes signal to complete the ring cavity. The ring cavity configuration allows the CO/sub 2/ laser pump signal and Stokes signal to copropagate through the Raman capillary waveguide amplifier. A Raman capillary waveguide amplifier is also provided in the return leg of the ring cavity to increase gain without increasing the round trip time. Additionally, the ring cavity can be designed such that the amplified Stokes signal is synchronous with the mode-locked spikes of the incoming CO/sub 2/ laser pump signal.

  5. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  6. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  7. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  8. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  9. A high-efficiency superconductor distributed amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)

    2010-02-15

    A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)

  10. Fundamentals of RF and microwave transistor amplifiers

    CERN Document Server

    Bahl, Inder J

    2009-01-01

    A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

  11. Design And Construction Of 300W Audio Power Amplifier For Classroom

    Directory of Open Access Journals (Sweden)

    Shune Lei Aung

    2015-07-01

    Full Text Available Abstract This paper describes the design and construction of 300W audio power amplifier for classroom. In the construction of this amplifier microphone preamplifier tone preamplifier equalizer line amplifier output power amplifier and sound level indicator are included. The output power amplifier is designed as O.C.L system and constructed by using Class B among many types of amplifier classes. There are two types in O.C.L system quasi system and complementary system. Between them the complementary system is used in the construction of 300W audio power amplifier. The Multisim software is utilized for the construction of audio power amplifier.

  12. Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

    Science.gov (United States)

    Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

    2014-10-01

    Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Self-pulsation in Raman fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

    2009-01-01

    Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

  14. Computer-Aided Design of Microstrip GaAs Mesfet Amplifiers

    DEFF Research Database (Denmark)

    Nielsen, Niels Ole

    1976-01-01

    Results on computer-aided design of broadband GaAs MESFET amplifiers in microstrip is presented. The analysis of an amplifier is based on measured scattering parameters and a model of the microstrip structure, which includes parasitics and junction effects. The optimized performance of one stage...... amplifiers with lossless distributed matching elements is presented. Realized amplifiers are in good agreement with the theory. One stage amplifiers with a 1 ¿m FET in chip form exhibit 5.8 dB of gain in the range 8-12 GHz, while a gain of 4.5 dB from 4-8 GHz has been obtained with a packaged 1 ¿m FET....

  15. Note: A high dynamic range, linear response transimpedance amplifier.

    Science.gov (United States)

    Eckel, S; Sushkov, A O; Lamoreaux, S K

    2012-02-01

    We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

  16. Higher order mode optical fiber Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

    2016-01-01

    We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

  17. Stimulated Brillouin scattering threshold in fiber amplifiers

    International Nuclear Information System (INIS)

    Liang Liping; Chang Liping

    2011-01-01

    Based on the wave coupling theory and the evolution model of the critical pump power (or Brillouin threshold) for stimulated Brillouin scattering (SBS) in double-clad fiber amplifiers, the influence of signal bandwidth, fiber-core diameter and amplifier gain on SBS threshold is simulated theoretically. And experimental measurements of SBS are presented in ytterbium-doped double-clad fiber amplifiers with single-frequency hundred nanosecond pulse amplification. Under different input signal pulses, the forward amplified pulse distortion is observed when the pulse energy is up to 660 nJ and the peak power is up to 3.3 W in the pulse amplification with pulse duration of 200 ns and repetition rate of 1 Hz. And the backward SBS narrow pulse appears. The pulse peak power equals to SBS threshold. Good agreement is shown between the modeled and experimental data. (authors)

  18. Low-cost amplifier for alpha detection with photodiode

    Energy Technology Data Exchange (ETDEWEB)

    Domienikan, Cláudio; Costa, Priscila; Genezini, Frederico A.; Zahn, Guilherme S., E-mail: clanikan@ipen.br, E-mail: pcosta@ipen.br, E-mail: fredzini@ipen.br, E-mail: gzahn@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    A low-cost amplifier for Hamamatsu S3590-09 PIN photodiode to be used in alpha detection is presented. This amplifier consists basically of two circuits: a pulse preamplifier and a shaper-driver. The PIN photodiode is reverse-biased and connected to a charge preamplifier input. Incident alpha particles generate a small current pulse in the photodiode. The integrating circuit of the low noise preamplifier transforms current pulse into a voltage pulse with amplitude proportional to the charge carried by the current pulse. The shaper-driver consists of a differentiator and an integrator and is responsible for filtering and further amplifying the preamplifier signal, generating a NIM-compatible energy pulse. The performance of the set photodiode-amplifier was successively tested through the use of a {sup 243}Am radioactive source. The low-cost photodiode amplifier was designed and constructed at IPEN - CNEN/SP using national components and expertise. (author)

  19. Simulations of longitudinally pumped dye laser amplifier

    International Nuclear Information System (INIS)

    Takehisa, Kiwamu; Takemori, Satoshi

    1995-01-01

    Simulations of a copper laser pumped dye laser amplifier and new designs of the longitudinally pumped dye laser amplifier are presented. The simulations take the consideration of the amplified spontaneous emission (ASE). The new designs utilize a center-hole reflector instead of a dichroic mirror. The simulation results indicate that the poor spatial overlap between the pump beam and the dye beam in the transverse pumping not only reduces the laser output power, but also generates ASE strongly. The results also indicate that the longitudinal pumping is as efficient as the transverse pumping. (author)

  20. Pulse shaping amplifier (PSA) for nuclear spectroscopy system

    International Nuclear Information System (INIS)

    Lombigit, L.; Maslina Mohd Ibrahim; Nolida Yusup; Nur Aira Abdul Rahman; Yong, C.F.

    2014-01-01

    Pulse Shaping Amplifier (PSA) is an essential components in nuclear spectroscopy system. This networks have two functions; to shape the output pulse and performs noise filtering. In this paper, we describes procedure for design and development of a pulse shaping amplifier which can be used for nuclear spectroscopy system. This prototype was developed using high performance electronics devices and assembled on a FR4 type printed circuit board. Performance of this prototype was tested by comparing it with an equivalent commercial spectroscopy amplifier (Model SILENA 7611). The test results show that the performance of this prototype is comparable to the commercial spectroscopic amplifier. (author)

  1. Fluorescence quantum yield of thioflavin T in rigid isotropic solution and incorporated into the amyloid fibrils.

    Directory of Open Access Journals (Sweden)

    Anna I Sulatskaya

    Full Text Available In this work, the fluorescence of thioflavin T (ThT was studied in a wide range of viscosity and temperature. It was shown that ThT fluorescence quantum yield varies from 0.0001 in water at room temperature to 0.28 in rigid isotropic solution (T/η→0. The deviation of the fluorescence quantum yield from unity in rigid isotropic solution suggests that fluorescence quantum yield depends not only on the ultra-fast oscillation of ThT fragments relative to each other in an excited state as was suggested earlier, but also depends on the molecular configuration in the ground state. This means that the fluorescence quantum yield of the dye incorporated into amyloid fibrils must depend on its conformation, which, in turn, depends on the ThT environment. Therefore, the fluorescence quantum yield of ThT incorporated into amyloid fibrils can differ from that in the rigid isotropic solution. In particular, the fluorescence quantum yield of ThT incorporated into insulin fibrils was determined to be 0.43. Consequently, the ThT fluorescence quantum yield could be used to characterize the peculiarities of the fibrillar structure, which opens some new possibilities in the ThT use for structural characterization of the amyloid fibrils.

  2. GaN-based Power amplifiers for microwave applications

    Directory of Open Access Journals (Sweden)

    Jorge Julián Moreno-Rubio

    2016-01-01

    Full Text Available This paper presents a discussion about the design strategies of different kind of power amplifiers for RF/Microwave appli- cations, such as the tuned load power amplifier, class F, class F-1 and Doherty. Furthermore, it is shown the continuous wave characterization of the amplifiers above mentioned. A comparison between the obtained results, in terms of gain, efficiency and output power is presented.

  3. Single-mode operation of a coiled multimode fiber amplifier

    International Nuclear Information System (INIS)

    Koplow, Jeffrey P.; Kliner, Dahv A. V.; Goldberg, Lew

    2000-01-01

    We report a new approach to obtaining single-transverse-mode operation of a multimode fiber amplifier in which the gain fiber is coiled to induce significant bend loss for all but the lowest-order mode. We demonstrated this method by constructing a coiled amplifier using Yb-doped, double-clad fiber with a core diameter of 25 μm and a numerical aperture of ∼0.1 (V≅7.4) . When the amplifier was operated as an amplified-spontaneous-emission source, the output beam had an M 2 value of 1.09±0.09 ; when seeded at 1064 nm, the slope efficiency was similar to that of an uncoiled amplifier. This technique will permit scaling of pulsed fiber lasers and amplifiers to significantly higher pulse energies and peak powers and cw fiber sources to higher average powers while maintaining excellent beam quality. (c) 2000 Optical Society of America

  4. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  5. Implantable neurotechnologies: a review of integrated circuit neural amplifiers.

    Science.gov (United States)

    Ng, Kian Ann; Greenwald, Elliot; Xu, Yong Ping; Thakor, Nitish V

    2016-01-01

    Neural signal recording is critical in modern day neuroscience research and emerging neural prosthesis programs. Neural recording requires the use of precise, low-noise amplifier systems to acquire and condition the weak neural signals that are transduced through electrode interfaces. Neural amplifiers and amplifier-based systems are available commercially or can be designed in-house and fabricated using integrated circuit (IC) technologies, resulting in very large-scale integration or application-specific integrated circuit solutions. IC-based neural amplifiers are now used to acquire untethered/portable neural recordings, as they meet the requirements of a miniaturized form factor, light weight and low power consumption. Furthermore, such miniaturized and low-power IC neural amplifiers are now being used in emerging implantable neural prosthesis technologies. This review focuses on neural amplifier-based devices and is presented in two interrelated parts. First, neural signal recording is reviewed, and practical challenges are highlighted. Current amplifier designs with increased functionality and performance and without penalties in chip size and power are featured. Second, applications of IC-based neural amplifiers in basic science experiments (e.g., cortical studies using animal models), neural prostheses (e.g., brain/nerve machine interfaces) and treatment of neuronal diseases (e.g., DBS for treatment of epilepsy) are highlighted. The review concludes with future outlooks of this technology and important challenges with regard to neural signal amplification.

  6. Laser-Induced Photofragmentation Fluorescence Imaging of Alkali Compounds in Flames.

    Science.gov (United States)

    Leffler, Tomas; Brackmann, Christian; Aldén, Marcus; Li, Zhongshan

    2017-06-01

    Laser-induced photofragmentation fluorescence has been investigated for the imaging of alkali compounds in premixed laminar methane-air flames. An ArF excimer laser, providing pulses of wavelength 193 nm, was used to photodissociate KCl, KOH, and NaCl molecules in the post-flame region and fluorescence from the excited atomic alkali fragment was detected. Fluorescence emission spectra showed distinct lines of the alkali atoms allowing for efficient background filtering. Temperature data from Rayleigh scattering measurements together with simulations of potassium chemistry presented in literature allowed for conclusions on the relative contributions of potassium species KOH and KCl to the detected signal. Experimental approaches for separate measurements of these components are discussed. Signal power dependence and calculated fractions of dissociated molecules indicate the saturation of the photolysis process, independent on absorption cross-section, under the experimental conditions. Quantitative KCl concentrations up to 30 parts per million (ppm) were evaluated from the fluorescence data and showed good agreement with results from ultraviolet absorption measurements. Detection limits for KCl photofragmentation fluorescence imaging of 0.5 and 1.0 ppm were determined for averaged and single-shot data, respectively. Moreover, simultaneous imaging of KCl and NaCl was demonstrated using a stereoscope with filters. The results indicate that the photofragmentation method can be employed for detailed studies of alkali chemistry in laboratory flames for validation of chemical kinetic mechanisms crucial for efficient biomass fuel utilization.

  7. The Nike electron-beam-pumped KrF laser amplifiers

    International Nuclear Information System (INIS)

    Sethian, J.D.; Pawley, C.J.; Obenschain, S.P.

    1997-01-01

    Nike is a recently completed multikilojoule krypton-fluoride (KrF) laser that has been built to study the physics of direct-drive inertial confinement fusion. The two final amplifiers of the Nike laser are both electron-beam-pumped systems. This paper describes these two amplifiers, with an emphasis on the pulsed power. The smaller of the two has a 20 x 20 cm aperture, and produces an output laser beam energy in excess of 100 J. This 20 cm Amplifier uses a single 12 kJ Marx generator to inject two 300 kV, 75 kA, 140 ns flat-top electron beams into opposite sides of the laser cell. The larger amplifier in Nike has a 60 x 60 cm aperture, and amplifies the laser beam up to 5 kJ. This 60 cm amplifier has two independent electron beam systems. Each system has a 170 kJ Marx generator that produces a 670 kV, 540 kA, 240 ns flat-top electron beam. Both amplifiers are complete, fully integrated into the laser, meet the Nike system requirements, and are used routinely for laser-target experiments

  8. msap: a tool for the statistical analysis of methylation-sensitive amplified polymorphism data.

    Science.gov (United States)

    Pérez-Figueroa, A

    2013-05-01

    In this study msap, an R package which analyses methylation-sensitive amplified polymorphism (MSAP or MS-AFLP) data is presented. The program provides a deep analysis of epigenetic variation starting from a binary data matrix indicating the banding pattern between the isoesquizomeric endonucleases HpaII and MspI, with differential sensitivity to cytosine methylation. After comparing the restriction fragments, the program determines if each fragment is susceptible to methylation (representative of epigenetic variation) or if there is no evidence of methylation (representative of genetic variation). The package provides, in a user-friendly command line interface, a pipeline of different analyses of the variation (genetic and epigenetic) among user-defined groups of samples, as well as the classification of the methylation occurrences in those groups. Statistical testing provides support to the analyses. A comprehensive report of the analyses and several useful plots could help researchers to assess the epigenetic and genetic variation in their MSAP experiments. msap is downloadable from CRAN (http://cran.r-project.org/) and its own webpage (http://msap.r-forge.R-project.org/). The package is intended to be easy to use even for those people unfamiliar with the R command line environment. Advanced users may take advantage of the available source code to adapt msap to more complex analyses. © 2013 Blackwell Publishing Ltd.

  9. 47 CFR 97.315 - Certification of external RF power amplifiers.

    Science.gov (United States)

    2010-10-01

    .... (2) The amplifier was manufactured before April 28, 1978, and has been issued a marketing waiver by... that operator's station. (3) The amplifier is sold to an amateur radio operator or to a dealer, the amplifier is purchased in used condition by a dealer, or the amplifier is sold to an amateur radio operator...

  10. Pump to signal noise transfer in parametric fiber amplifiers

    DEFF Research Database (Denmark)

    Lund-Hansen, Toke; Rottwitt, Karsten; Peucheret, Christophe

    2010-01-01

    Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal.......Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal....

  11. Method for reducing snap in magnetic amplifiers

    Science.gov (United States)

    Fischer, R. L. E.; Word, J. L.

    1968-01-01

    Method of reducing snap in magnetic amplifiers uses a degenerative feedback circuit consisting of a resistor and a separate winding on a magnetic core. The feedback circuit extends amplifier range by allowing it to be used at lower values of output current.

  12. Amplifier Design for Proportional Ionization Chambers

    Energy Technology Data Exchange (ETDEWEB)

    Baker, W. H.

    1950-08-24

    This paper presents the requirements of a nuclear amplifier of short resolving time, designed to accept pulses of widely varying amplitudes. Data are given which show that a proportional ionization chamber loaded with a 1,000-ohm resistor develops pulses of 0.5 microsecond duration and several volts amplitude. Results indicate that seven basic requirements are imposed on the amplifier when counting soft beta and gamma radiation in the presence of alpha particles, without absorbers. It should, (1) have a fast recovery time, (2) have a relatively good low frequency response, (3) accept pulses of widely varying heights without developing spurious pulsed, (4) have a limiting output stage, (5) preserve the inherently short rise time of the chamber, (6) minimize pulse integration, and (7) have sufficient gain to detect the weak pulses well below the chamber voltage at which continuous discharge takes place. The results obtained with an amplifier which meets these requirements is described. A formula is derived which indicates that redesign of the proportional ionization chamber might eliminate the need for an amplifier. This may be possible if the radioactive particles are collimated parallel to the collecting electrode.

  13. Power Amplifier Design for E-band Wireless System Communications

    DEFF Research Database (Denmark)

    Hadziabdic, Dzenan; Krozer, Viktor; Johansen, Tom Keinicke

    2008-01-01

    E-band wireless communications will become important as the microwave backhaul for high-speed data transmission. One of the most critical components is the front-end power amplifier in this system. The paper analyzes different technologies with potential in the E-band frequency range and present...... a power amplifier design satisfying the E-band system specifications. The designed power amplifier achieves a maximum output power of ges 20 dBm with a state-of-the-art power-added efficiency of 15%. The power is realized using InP DHBT technology. To the best of our knowledge it is the highest output...... power and efficiency reported for an InP HBT power amplifier in this frequency range. The predicted power-added efficiency is higher than that of power amplifiers based on SiGe HBT and GaAs pHEMT technologies. The design shows the capabilities of InP DHBT for power amplifier applications...

  14. A new semicustom integrated bipolar amplifier for silicon strip detectors

    International Nuclear Information System (INIS)

    Zimmerman, T.

    1989-01-01

    The QPA02 is a four channel DC coupled two stage transimpedance amplifier designed at Fermilab on a semicustom linear array (Quickchip 2S) manufactured by Tektronix. The chip was developed as a silicon strip amplifier but may have other applications as well. Each channel consists of a preamplifier and a second stage amplifier/sharper with differential output which can directly drive a transmission line (90 to 140 ohms). External bypass capacitors are the only discrete components required. QPA02 has been tested and demonstrated to be an effective silicon strip amplifier. Other applications may exist which can use this amplifier or a modified version of this amplifier. For example, another design is now in progress for a wire chamber amplifier, QPA03, to be reported later. Only a relatively small effort was required to modify the design and layout for this application. 11 figs

  15. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  16. Deteksi dan Identifikasi Fitoplasma yang Berasosiasi dengan Penyakit Layu Kelapa Di Pulau Derawan, Kalimantan Timur

    Directory of Open Access Journals (Sweden)

    Agus Eko Prasetyo

    2017-09-01

    Full Text Available Coconut is a major commodity in Derawan island as source of additional income for the farmers. Research was conducted to detect and identify phytoplasmas associated with coconut wilt disease in Derawan island. Coconut wilt disease was indicated by the typical symptoms, i.e.  leaf yellowing, shorten of coconut sheaths and leaves, necrosis and collapse of old leaves, and also nut fall.  The presence of phytoplasmas in phloem tissues of coconut stem was observed using fluorescence and electron microscope.  Identification of phytoplasmas was carried out by nested-PCR and sequencing of the 16S rRNA gene.  DNA fragment of phytoplasma with the size of 1.25 kbp was successfully amplified using primer pairs P1/P7, followed by primer pairs R16F2n/R16R2.  Sequence analysis of the amplified fragments showed that phytoplasma associated with coconut wilt disease in Derawan island belongs to 16SrII (witches broom phytoplasma and 16SrXI (ca. Phytoplasma oryzae groups.

  17. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  18. Pulse amplifier with high 'common mode rejection'

    International Nuclear Information System (INIS)

    Ijlst, P.

    1987-01-01

    The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)

  19. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  20. Behavior of MOSFET Amplifier in Radiation Fields

    International Nuclear Information System (INIS)

    Sharshar, K.A.A.; Ashry, M.

    2000-01-01

    MOSFET type 2 N 3823 characteristics and its application as an amplifier are analyzed including the effects of gamma, electron beam 1.5 MeV 25 m A and neutron flux. The 1-V characteristics, transfer curve, and the frequency response of the amplifier, and the amplification factor(A v 0 are discussed with MOSFET circuit parameters. The drain current and the amplitude of the output signal decrease as the absorbed dose increases. The measured values of the amplified signal are attenuated by 30% and 6% after exposing the MOSFET to gamma radiation and electron beam at the same dose respectively. Also for exposure to 4x10 13 N/cm 3 neutrons decreased the measured value of the amplified signal by 73% of the initial values. The decrease in the gain of the MOSFET is due to the degradation of the transconductance. It is also noticed that percentage of the decrease depends on the type of radiation

  1. Low-noise audio amplifiers and preamplifier for use with intrinsic thermocouples

    International Nuclear Information System (INIS)

    Langner, G.C.; Sachs, R.D.; Stewart, F.L.

    1979-03-01

    Two simple, low-noise audio amplifiers and one low-noise preamplifier for use with intrinsic thermocouples were designed, built, and tested. The amplifiers and the preamplifier have different front end designs. One amplifier uses ultralow-noise operational amplifiers; the other amplifier uses a hybrid component. The preamplifier uses ultralow-noise discrete components. The amplifiers' equivalent noise inputs, at maximum gain, are 4.09 nV and 50 nV; the preamplifier's input is 4.05 μV. Their bandwidths are 15 600 Hz, 550 Hz, and 174 kHz, respectively. the amplifiers' equivalent noise inputs were measured from approx. 0 to 100 Hz, whereas the preamplifier's equivalent noise input was measured from approx. 0 to 174 kHz

  2. Free-electron laser system with Raman amplifier outcoupling

    Energy Technology Data Exchange (ETDEWEB)

    Linford, G.J.

    1988-05-03

    A free-electron laser system is described comprising: a free-electron laser pump beam generator producing a high-power optical output beam in a vacuum environement; a Raman amplifier cell located in the path of the output beam from the pump beam generator; means for generating and introducing a Stokes seed beam into the Raman amplifier cell, a pair of gaseous windows through which the output beam enters and leaves the Raman amplifier cell, each window having a stream of gas moving continuously in a direction generally perpendicular to the beam; and a mirror positioned in the path of the output beam from the Raman amplifier, the mirror functioning to reflect and further direct the output beam, but not the unwanted spectral components.

  3. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  4. Modeling and design techniques for RF power amplifiers

    CERN Document Server

    Raghavan, Arvind; Laskar, Joy

    2008-01-01

    The book covers RF power amplifier design, from device and modeling considerations to advanced circuit design architectures and techniques. It focuses on recent developments and advanced topics in this area, including numerous practical designs to back the theoretical considerations. It presents the challenges in designing power amplifiers in silicon and helps the reader improve the efficiency of linear power amplifiers, and design more accurate compact device models, with faster extraction routines, to create cost effective and reliable circuits.

  5. Efficient trigger signal generation from wasted backward amplified stimulated emission at optical amplifiers for optical coherence tomography

    Directory of Open Access Journals (Sweden)

    Kim Seung Taek

    2015-01-01

    Full Text Available This paper propose an optical structure to generate trigger signals for optical coherence tomography (OCT using backward light which is usually disposed. The backward light is called backward amplified stimulated emission generated from semiconductor optical amplifier (SOA when using swept wavelength tunable laser (SWTL. A circulator is applied to block undesirable lights in the SWTL instead of an isolator in common SWTL. The circulator also diverts backward amplified spontaneous lights, which finally bring out trigger signals for a high speed digitizer. The spectra of the forward lights at SOA and the waveform of the backward lights were measured to check the procedure of the trigger formation in the experiment. The results showed that the trigger signals from the proposed SWTL with the circulator was quite usable in OCT.

  6. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  7. Experimentally studied laser fluorescence method for remote sensing of plant stress situation induced by improper plants watering

    Directory of Open Access Journals (Sweden)

    Yu. V. Fedotov

    2014-01-01

    Full Text Available Stressful situations of plants can be caused by a lack of nutrients; mechanical damages; diseases; low or high temperatures; lack of illumination; insufficient or excess humidity of the soil; soil salinization; soil pollution by oil products or heavy metals; the increased acidity of the soil; use of pesticides, herbicides, insecticides, etc.At early stages it is often difficult to detect seemingly that the plants are in stressful situations caused by adverse external factors. However, the fluorescent analysis potentially allows detection of the stressful situations of plants by deformation of laser-induced fluorescence spectra. The paper conducts experimental investigations to learn the capabilities of the laser fluorescent method to monitor plant situations at 532nm wavelength of fluorescence excitation in the stressful situations induced by improper watering (at excess of moisture in the soil and at a lack of moisture.Researches of fluorescence spectra have been conducted using a created laboratory installation. As a source to excite fluorescence radiation the second harmonica of YAG:Nd laser is used. The subsystem to record fluorescence radiation is designed using a polychromator and a highly sensitive matrix detector with the amplifier of brightness.Experimental investigations have been conducted for fast-growing and unpretentious species of plants, namely different sorts of salad.Experimental studies of laser-induced fluorescence spectra of plants for 532nm excitement wavelength show that the impact of stressful factors on a plant due to the improper watering, significantly distorts a fluorescence spectrum of plants. Influence of a stressful factor can be shown as a changing profile of a fluorescence spectrum (an identifying factor, here, is a relationship of fluorescence intensities at two wavelengths, namely 685 nm and 740 nm or (and as a changing level of fluorescence that can be the basis for the laser method for monitoring the plant

  8. SPS RF System Amplifier plant

    CERN Multimedia

    1977-01-01

    The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

  9. Identification, genetic localization, and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.).

    Science.gov (United States)

    Witsenboer, H; Michelmore, R W; Vogel, J

    1997-12-01

    Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.

  10. X-ray fluorescence analysis of ancient and medieval brass artifacts from south Moravia

    International Nuclear Information System (INIS)

    Hložek, M.; Komoróczy, B.; Trojek, T.

    2012-01-01

    This paper deals with an investigation of archeological finds using X-ray fluorescence analysis and microanalysis. The main aim of the investigation was to prove the production of brass in the South Moravian Region (part of the Czech Republic) in former times. The probable brass production technology is described. Various objects dating back to Antiquity and to the Middle Ages were investigated using two X-ray fluorescence systems, and the results of the analyses are discussed. The measurements showed, e.g., that fragments of Roman scale armor and a belt fitting dating back to Antiquity were made of brass. Brass was also identified on the surfaces of various ancient and medieval molds and melting pots. - Highlights: ► Semiquantitative X-ray fluorescence analysis of archeological finds. ► Two different gilding techniques of a brass belt terminal found in Brno. ► Use of brass before the Great Moravian period. ► Evidence of brass casting in the 12th century in Brno.

  11. Fluorescent Labeling and Biodistribution of Latex Nanoparticles Formed by Surfactant-Free RAFT Emulsion Polymerization.

    Science.gov (United States)

    Poon, Cheuk Ka; Tang, Owen; Chen, Xin-Ming; Kim, Byung; Hartlieb, Matthias; Pollock, Carol A; Hawkett, Brian S; Perrier, Sébastien

    2017-10-01

    The authors report the preparation of a novel range of functional polyacrylamide stabilized polystyrene nanoparticles, obtained by surfactant-free reversible addition-fragmentation chain transfer (RAFT) emulsion polymerization, their fluorescent tagging, cellular uptake, and biodistribution. The authors show the versatility of the RAFT emulsion process for the design of functional nanoparticles of well-defined size that can be used as drug delivery vectors. Functionalization with a fluorescent tag offers a useful visualization tool for tracing, localization, and clearance studies of these carriers in biological models. The studies are carried out by labeling the sterically stabilized latex particles chemically with rhodamine B. The fluorescent particles are incubated in a healthy human renal proximal tubular cell line model, and intravenously injected into a mouse model. Cellular localization and biodistribution of these particles on the biological models are explored. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Wideband pulse amplifiers for the NECTAr chip

    International Nuclear Information System (INIS)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J-F.; Naumann, C.L.; Nayman, P.; Ribó, M.

    2012-01-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1–3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  13. Wideband pulse amplifiers for the NECTAr chip

    Science.gov (United States)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.

    2012-12-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  14. High-power piezo drive amplifier for large stack and PFC applications

    Science.gov (United States)

    Clingman, Dan J.; Gamble, Mike

    2001-08-01

    This paper describes the continuing development of Boeing High Power Piezo Drive Amplifiers. Described is the development and testing of a 1500 Vpp, 8 amp switching amplifier. This amplifier is used to drive a piezo stack driven rotor blade trailing edge flap on a full size helicopter. Also discuss is a switching amplifier designed to drive a Piezo Fiber Composite (PFC) active twist rotor blade. This amplifier was designed to drive the PFC material at 2000 Vpp and 0.5 amps. These amplifiers recycle reactive energy, allowing for a power and weight efficient amplifier design. This work was done in conjunction with the DARPA sponsored Phase II Smart Rotor Blade program and the NASA Langley Research Center sponsored Active Twist Rotor (ATR) blade program.

  15. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  16. Traveling-Wave Tube Amplifier for THz Frequencies

    DEFF Research Database (Denmark)

    Kotiranta, Mikko; Krozer, Viktor; Zhurbenko, Vitaliy

    tubes and gas lasers, but the ones available are too expensive or large for many applications. This work is related to the European project OPTHER (Optically driven terahertz amplifiers) which aims to realise a compact, powerful and efficient vacuum tube amplifier for the frequency range of 0.3 – 2...

  17. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  18. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-11-15

    The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

  19. Introduction to RF power amplifier design and simulation

    CERN Document Server

    Eroglu, Abdullah

    2015-01-01

    Introduction to RF Power Amplifier Design and Simulation fills a gap in the existing literature by providing step-by-step guidance for the design of radio frequency (RF) power amplifiers, from analytical formulation to simulation, implementation, and measurement. Featuring numerous illustrations and examples of real-world engineering applications, this book:Gives an overview of intermodulation and elaborates on the difference between linear and nonlinear amplifiersDescribes the high-frequency model and transient characteristics of metal-oxide-semiconductor field-effect transistorsDetails activ

  20. Distributed CMOS Bidirectional Amplifiers Broadbanding and Linearization Techniques

    CERN Document Server

    El-Khatib, Ziad; Mahmoud, Samy A

    2012-01-01

    This book describes methods to design distributed amplifiers useful for performing circuit functions such as duplexing, paraphrase amplification, phase shifting power splitting and power combiner applications.  A CMOS bidirectional distributed amplifier is presented that combines for the first time device-level with circuit-level linearization, suppressing the third-order intermodulation distortion. It is implemented in 0.13μm RF CMOS technology for use in highly linear, low-cost UWB Radio-over-Fiber communication systems. Describes CMOS distributed amplifiers for optoelectronic applications such as Radio-over-Fiber systems, base station transceivers and picocells; Presents most recent techniques for linearization of CMOS distributed amplifiers; Includes coverage of CMOS I-V transconductors, as well as CMOS on-chip inductor integration and modeling; Includes circuit applications for UWB Radio-over-Fiber networks.

  1. Resistor-less charge sensitive amplifier for semiconductor detectors

    Energy Technology Data Exchange (ETDEWEB)

    Pelczar, K., E-mail: krzysztof.pelczar@doctoral.uj.edu.pl; Panas, K.; Zuzel, G.

    2016-11-01

    A new concept of a Charge Sensitive Amplifier without a high-value resistor in the feedback loop is presented. Basic spectroscopic parameters of the amplifier coupled to a coaxial High Purity Germanium detector (HPGe) are discussed. The amplifier signal input is realized with an n-channel J-FET transistor. The feedback capacitor is discharged continuously by the second, forward biased n-channel J-FET, driven by an RC low–pass filter. Both the analog—with a standard spectroscopy amplifier and a multi-channel analyzer—and the digital—by applying a Flash Analog to Digital Converter—signal readouts were tested. The achieved resolution in the analog and the digital readouts was 0.17% and 0.21%, respectively, at the Full Width at Half Maximum of the registered {sup 60}Co 1332.5 keV gamma line.

  2. Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

    Science.gov (United States)

    Gouge, Michael F.

    2011-01-01

    Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

  3. Stress-induced filament fragmentation of Calothrix elenkiniiI (Cyanobacteria) is facilitated by death of high-fluorescence cells

    Czech Academy of Sciences Publication Activity Database

    Adamec, František; Kaftan, David; Nedbal, Ladislav

    2005-01-01

    Roč. 41, - (2005), s. 835-839 ISSN 0022-3646 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z6087904 Keywords : cyanobacteria * high-fluorescence cells Subject RIV: EE - Microbiology, Virology Impact factor: 2.502, year: 2005

  4. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    Science.gov (United States)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  5. Gyrocon: a deflection-modulated, high-power microwave amplifier

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1977-10-01

    A large-signal, relativistic theory of the electron-field interaction in a new class of microwave amplifiers is presented and applied to the analysis of a high-power, 450-MHz amplifier for accelerator applications. The analysis indicates that electronic efficiencies in excess of 90 percent are obtainable and that overall efficiencies of 90 percent are possible. The amplifier is unique in several respects; the electron velocity is perpendicular to the circuit energy flow, the device uses a fast-wave circuit, and the electron beam is deflection modulated

  6. External Peltier Cooler For Low-Noise Amplifier

    Science.gov (United States)

    Soper, Terry A.

    1990-01-01

    Inexpensive Peltier-effect cooling module made of few commercially available parts used to reduce thermal noise in microwave amplifier. Retrofitted to almost any microwave low-noise amplifier or receiver preamplifier used in communication, telemetry, or radar. Includes copper or aluminum cold plate held tightly against unit to be cooled by strap-type worm-gear clamps.

  7. Submicron polymer particles containing fluorescent semiconductor nanocrystals CdSe/ZnS for bioassays.

    Science.gov (United States)

    Generalova, Alla N; Sizova, Svetlana V; Zdobnova, Tatiana A; Zarifullina, Margarita M; Artemyev, Michail V; Baranov, Alexander V; Oleinikov, Vladimir A; Zubov, Vitaly P; Deyev, Sergey M

    2011-02-01

    This study aimed to design a panel of uniform particulate biochemical reagents and to test them in specific bioassays. These reagents are polymer particles of different sizes doped with semiconductor nanocrystals and conjugated with either full-size antibodies or recombinant mini-antibodies (4D5 scFv fragment) designed by genetic engineering approaches. A panel of highly fluorescent polymer particles (150-800 nm) were formed by embedding CdSe/ZnS nanocrystals (quantum dots) into preformed polyacrolein and poly(acrolein-co-styrene) particles. Morphology, content and fluorescence characteristics of the prepared materials were studied by laser correlation spectroscopy, spectrophotometry, optical and fluorescent microscopy and fluorimetry. The obtained fluorescent particles sensitized by anti-Yersinia pestis antibodies were used for rapid agglutination glass test suitable for screening analysis of Y. pestis antigen and for microtiter particle agglutination, which, owing to its speed and simplicity, is very beneficial for diagnostic detection of Y. pestis antigen. Recombinant 4D5 scFv antibodies designed and conjugated with polymer particles containing quantum dots provide multipoint highly specific binding with cancer marker HER2/neu on the surface of SKOV-3 cell.

  8. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  9. Chimeric recombinant antibody fragments in cardiac troponin I immunoassay.

    Science.gov (United States)

    Hyytiä, Heidi; Heikkilä, Taina; Brockmann, Eeva-Christine; Kekki, Henna; Hedberg, Pirjo; Puolakanaho, Tarja; Lövgren, Timo; Pettersson, Kim

    2015-03-01

    To introduce a novel nanoparticle-based immunoassay for cardiac troponin I (cTnI) utilizing chimeric antibody fragments and to demonstrate that removal of antibody Fc-part and antibody chimerization decrease matrix related interferences. A sandwich-type immunoassay for cTnI based on recombinant chimeric (mouse variable/human constant) antigen binding (cFab) antibodies and intrinsically fluorescent nanoparticles was developed. To test whether using chimeric antibody fragments helps to avoid matrix related interferences, samples (n=39) with known amounts of triglycerides, bilirubin, rheumatoid factor (RF) or human anti-mouse antibodies (HAMAs) were measured with the novel assay, along with a previously published nanoparticle-based research assay with the same antibody epitopes. The limit of detection (LoD) was 3.30ng/L. Within-laboratory precision for 29ng/L and 2819ng/L cTnI were 13.7% and 15.9%, respectively. Regression analysis with Siemens ADVIA Centaur® yielded a slope (95% confidence intervals) of 0.18 (0.17-1.19) and a y-intercept of 1.94 (-1.28-3.91) ng/L. When compared to a previously published nanoparticle-based assay, the novel assay showed substantially reduced interference in the tested interference prone samples, 15.4 vs. 51.3%. A rheumatoid factor containing sample was decreased from 241ng/L to fragments enabled the development of a sensitive (LoD=3.3ng/L) immunoassay for the detection of cTnI and decreased matrix related interferences, thus resulting in a lower number of falsely elevated cTnI-values. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  10. [Development of a Fluorescence Probe for Live Cell Imaging].

    Science.gov (United States)

    Shibata, Aya

    2017-01-01

     Probes that detect specific biological materials are indispensable tools for deepening our understanding of various cellular phenomena. In live cell imaging, the probe must emit fluorescence only when a specific substance is detected. In this paper, we introduce a new probe we developed for live cell imaging. Glutathione S-transferase (GST) activity is higher in tumor cells than in normal cells and is involved in the development of resistance to various anticancer drugs. We previously reported the development of a general strategy for the synthesis of probes for detection of GST enzymes, including fluorogenic, bioluminogenic, and 19 F-NMR probes. Arylsulfonyl groups were used as caging groups during probe design. The fluorogenic probes were successfully used to quantitate very low levels of GST activity in cell extracts and were also successfully applied to the imaging of microsomal MGST1 activity in living cells. The bioluminogenic and 19 F-NMR probes were able to detect GST activity in Escherichia coli cells. Oligonucleotide-templated reactions are powerful tools for nucleic acid sensing. This strategy exploits the target strand as a template for two functionalized probes and provides a simple molecular mechanism for multiple turnover reactions. We developed a nucleophilic aromatic substitution reaction-triggered fluorescent probe. The probe completed its reaction within 30 s of initiation and amplified the fluorescence signal from 0.5 pM target oligonucleotide by 1500 fold under isothermal conditions. Additionally, we applied the oligonucleotide-templated reaction for molecular releasing and peptide detection.

  11. Conversion of the random amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

  12. Efficiency Optimization in Class-D Audio Amplifiers

    DEFF Research Database (Denmark)

    Yamauchi, Akira; Knott, Arnold; Jørgensen, Ivan Harald Holger

    2015-01-01

    This paper presents a new power efficiency optimization routine for designing Class-D audio amplifiers. The proposed optimization procedure finds design parameters for the power stage and the output filter, and the optimum switching frequency such that the weighted power losses are minimized under...... the given constraints. The optimization routine is applied to minimize the power losses in a 130 W class-D audio amplifier based on consumer behavior investigations, where the amplifier operates at idle and low power levels most of the time. Experimental results demonstrate that the optimization method can...... lead to around 30 % of efficiency improvement at 1.3 W output power without significant effects on both audio performance and the efficiency at high power levels....

  13. Wideband pulse amplifiers for the NECTAr chip

    Energy Technology Data Exchange (ETDEWEB)

    Sanuy, A., E-mail: asanuy@ecm.ub.es [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Delagnes, E. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Gascon, D. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Sieiro, X. [Departament d' Electronica, Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Bolmont, J.; Corona, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Feinstein, F. [LUPM, Universite Montpellier II and IN2P3/CNRS, CC072, bat. 13, place Eugene Bataillon, 34095 Montpellier (France); Glicenstein, J-F. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Naumann, C.L.; Nayman, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Ribo, M. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); and others

    2012-12-11

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  14. The Dynamics of Semiconductor Optical Amplifiers – Modeling and Applications

    DEFF Research Database (Denmark)

    Mørk, Jesper; Nielsen, Mads Lønstrup; Berg, Tommy Winther

    2003-01-01

    The importance of semiconductor optical amplifiers is discussed. A semiconductor optical amplifier (SOA) is a semiconductor laser with anti-reflection coated facets that amplifies an injected light signal by means of stimulated emission. SOAs have a number of unique properties that open up...

  15. Noise and saturation properties of semiconductor quantum dot optical amplifiers

    DEFF Research Database (Denmark)

    Berg, Tommy Winther; Mørk, Jesper

    2002-01-01

    We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved.......We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved....

  16. Manhattan equation for the operational amplifier

    OpenAIRE

    Mishonov, Todor M.; Danchev, Victor I.; Petkov, Emil G.; Gourev, Vassil N.; Dimitrova, Iglika M.; Varonov, Albert M.

    2018-01-01

    A differential equation relating the voltage at the output of an operational amplifier $U_0$ and the difference between the input voltages ($U_{+}$ and $U_{-}$) has been derived. The crossover frequency $f_0$ is a parameter in this operational amplifier master equation. The formulas derived as a consequence of this equation find applications in thousands of specifications for electronic devices but as far as we know, the equation has never been published. Actually, the master equation of oper...

  17. Integrated circuit amplifiers for multi-electrode intracortical recording.

    Science.gov (United States)

    Jochum, Thomas; Denison, Timothy; Wolf, Patrick

    2009-02-01

    Significant progress has been made in systems that interpret the electrical signals of the brain in order to control an actuator. One version of these systems senses neuronal extracellular action potentials with an array of up to 100 miniature probes inserted into the cortex. The impedance of each probe is high, so environmental electrical noise is readily coupled to the neuronal signal. To minimize this noise, an amplifier is placed close to each probe. Thus, the need has arisen for many amplifiers to be placed near the cortex. Commercially available integrated circuits do not satisfy the area, power and noise requirements of this application, so researchers have designed custom integrated-circuit amplifiers. This paper presents a comprehensive survey of the neural amplifiers described in publications prior to 2008. Methods to achieve high input impedance, low noise and a large time-constant high-pass filter are reviewed. A tutorial on the biological, electrochemical, mechanical and electromagnetic phenomena that influence amplifier design is provided. Areas for additional research, including sub-nanoampere electrolysis and chronic cortical heating, are discussed. Unresolved design concerns, including teraohm circuitry, electrical overstress and component failure, are identified.

  18. Series-Tuned High Efficiency RF-Power Amplifiers

    DEFF Research Database (Denmark)

    Vidkjær, Jens

    2008-01-01

    An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits.......An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits....

  19. Molecular characterization of Vulmar1, a complete mariner transposon of sugar beet and diversity of mariner- and En/Spm-like sequences in the genus Beta.

    Science.gov (United States)

    Jacobs, Gunnar; Dechyeva, Daryna; Menzel, Gerhard; Dombrowski, Cora; Schmidt, Thomas

    2004-12-01

    Transposons of the Tc1-mariner superfamily are widespread in eukaryotic genomes. We have isolated the mariner element Vulmar1 from Beta vulgaris L., which is 3909 bp long and bordered by perfect terminal inverted repeats of 32 bp with homology to terminal inverted repeats of transposons from soybean and rice. According to a characteristic amino acid signature, Vulmar1 can be assigned to the DD39D group of mariner transposons. Vulmar1 is flanked by a 5'-TA-3' target site duplication that is typical for mariner transposons. Southern hybridization revealed that mariner-like copies are highly abundant in Beta species, and sequence analysis of 10 transposase fragments from representative species of the four Beta sections revealed an identity between 34% and 100% after conceptual translation. By fluorescent in situ hybridization, Vulmar1 was detected in distal euchromatin as well as in some intercalary and pericentromeric regions of all B. vulgaris chromosomes. In addition, using PCR, we were able to amplify fragments of the transposase gene of En/Spm-like transposons in the genus Beta. En/Spm-like transposase sequences are highly amplified in four Beta sections and showed a considerable degree of conservation (88.5-100%) at the protein level, while the homology to corresponding regions of En/Spm transposons of other plant species ranges from 49.5% to 62.5%. By fluorescent in situ hybridization, En/Spm-like transposon signals of strong intensity were detected on all chromosomes of B. vulgaris.

  20. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Science.gov (United States)

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  1. Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

    Directory of Open Access Journals (Sweden)

    R. Sarman

    1997-04-01

    Full Text Available The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

  2. Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

    OpenAIRE

    R. Sarman; R. Prokop; T. Dostal

    1997-01-01

    The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

  3. Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

    Directory of Open Access Journals (Sweden)

    S. C. Oukouomi Noutchie

    2014-01-01

    Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

  4. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  5. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  6. Using MEMS Capacitive Switches in Tunable RF Amplifiers

    OpenAIRE

    Danson John; Plett Calvin; Tait Niall

    2006-01-01

    A MEMS capacitive switch suitable for use in tunable RF amplifiers is described. A MEMS switch is designed, fabricated, and characterized with physical and RF measurements for inclusion in simulations. Using the MEMS switch models, a dual-band low-noise amplifier (LNA) operating at GHz and GHz, and a tunable power amplifier (PA) at GHz are simulated in m CMOS. MEMS switches allow the LNA to operate with 11 dB of isolation between the two bands while maintaining dB of gain and sub- dB no...

  7. Criterion of transverse coherence of self-amplified spontaneous emission in high gain free electron laser amplifiers

    International Nuclear Information System (INIS)

    Xie, M.; Kim, K.J.

    1995-01-01

    In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY

  8. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  9. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Pulsed hydrogen fluoride laser oscillator-amplifier experiments

    International Nuclear Information System (INIS)

    Schott, G.L.

    1975-01-01

    Pulsed HF chemical laser oscillator energies were scaled from millijoules to several kilojoules over the period 1970-1974, reaching approximately 10 J with SF 6 and transverse discharges, and using electron-beam initiation and elemental F 2 above 1000J. This demonstrated scalability to large energy with acceptable electrical efficiency is only one prerequisite for application of this gas laser in fusion; equally important matters are achievement of focusable, approximately 1 ns pulses, couplable to light-element targets, all from an affordable system. Exploratory MOPA experiments are reported which address control of HF laser beam focusability and pulse duration, using SF 6 -based experimental oscillator--amplifier sequences and Pockels' cell switching. Simultaneous multiline lasing with 2.6 less than or equal to lambda less than or equal to 3.1 μm and high specific gain and energy density are particularly important factors encountered with HF, where amplifier pumping and lasing occur in a substantially cw temporal relationship, even in less than 100 ns bursts. Time-resolved SF 6 --HI oscillator spectra contain 27 simultaneous lines from six vibrational bands. An apertured, SF 6 -hydrocarbon pin-discharge oscillator generates approximately 10 mJ of TEM 00 radiation, which is amplified to approximately 1 J in approximately 150 ns by a TEA amplifier and p []opagated tens of meters. A three-stage system coupling these elements through an approximately 1 ns electrooptic gate to a greater than 10 J, e-beam energized amplifier is under development. (auth)

  11. Cascade energy amplifier

    International Nuclear Information System (INIS)

    Barzilov, A.P.; Gulevich, A.V.; Kukharchuk, O.F.

    2000-01-01

    The technical problem of long-life fission product and minor actinide incineration and production of plutonium fuel in the prospective nuclear systems will arise at significant scales of nuclear power industry development. Subcritical nuclear reactors driven by extemal neutron sources (energy amplifiers) are considered as incinerators of toxicity of complete nuclear industry. In the frames of this concept, the subcritical reactor part consisting of two coupled blanket regions (inner fast neutron spectrum core and outer thermal core) driven by extemal neutron source is discussed. Two types of source are studied: spallation target and 14-MeV fusion bum of micropellets. Liquid metal Pb-Bi is considered as target material and coolant of inner fast core. Thermal core is a heavy-water subcritical reactor of the Candu-type. The fast core is protected from thermal neutrons influence with the boron shield. All reactor technologies used in this concept are tested during years of operation and commercially available. Thus, the cascade energy amplifiers have a set of advantages in comparison with traditional concepts: in energy production, in transmutation efficiency, and in economics. (authors)

  12. Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

    Science.gov (United States)

    Sekar, Sandhya; Karanth, Praveen

    2013-01-01

    High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

  13. Power neodymium-glass amplifier of a repetitively pulsed laser

    Energy Technology Data Exchange (ETDEWEB)

    Vinogradov, Aleksandr V; Gaganov, V E; Garanin, Sergey G; Zhidkov, N V; Krotov, V A; Martynenko, S P; Pozdnyakov, E V; Solomatin, I I [Russian Federal Nuclear Center ' All-Russian Research Institute of Experimental Physics' , Sarov, Nizhnii Novgorod region (Russian Federation)

    2011-11-30

    A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 Multiplication-Sign 25 mm and a {approx}40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 {mu}s. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass {approx}3.2, the linear gain {approx}0.031 cm{sup -1} with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 - 0.21 J cm{sup -3}. The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4{lambda} ({lambda} = 0.63 {mu}m is the probing radiation wavelength).

  14. Power neodymium-glass amplifier of a repetitively pulsed laser

    International Nuclear Information System (INIS)

    Vinogradov, Aleksandr V; Gaganov, V E; Garanin, Sergey G; Zhidkov, N V; Krotov, V A; Martynenko, S P; Pozdnyakov, E V; Solomatin, I I

    2011-01-01

    A neodymium-glass diode-pumped amplifier with a zigzag laser beam propagation through the active medium was elaborated; the amplifier is intended for operation in a repetitively pulsed laser. An amplifier unit with an aperture of 20 × 25 mm and a ∼40-cm long active medium was put to a test. The energy of pump radiation amounts to 140 J at a wavelength of 806 nm for a pump duration of 550 μs. The energy parameters of the amplifier were experimentally determined: the small-signal gain per pass ∼3.2, the linear gain ∼0.031 cm -1 with a nonuniformity of its distribution over the aperture within 15%, the stored energy of 0.16 - 0.21 J cm -3 . The wavefront distortions in the zigzag laser-beam propagation through the active element of the amplifier did not exceed 0.4λ (λ = 0.63 μm is the probing radiation wavelength).

  15. GAME EDUKASI PERAKITAN AMPLIFIER BERBASIS ANDROID UNTUK USER UMUM

    Directory of Open Access Journals (Sweden)

    Fundhi Fanju Hafili

    2015-04-01

    Full Text Available ABSTRAK Seiring dengan perkembangan dan kebutuhan teknologi saat ini pembelajaran elektro dapat dibuat menjadi lebih praktis dan menarik di ponsel berbasis android Mempelajari elektronika juga memerlukan usaha-usaha nyata yang ber-kesinambungan dan mengarah kepada tumbuhnya kesadaran untuk menjadikan elektronika sebagai perkembangan teknologi. Dengan adanya metode game, merupakan salah satu metode belajar merakit amplifier yang disusun secara praktis dan sistematis sehingga memudahkan setiap orang untuk belajar maupun mengajarkan merancang amplifier. Sementara itu metode pembelajaran yang ada saat ini yaitu melalui buku maupun dengan cara bertatap muka langsung dengan tentor dirasa masih kurang efektif. Untuk mengatasi masalah tersebut maka penulis membuat game edukasi elektro merancang amplifier, karena mudah dipahami dan memudahkan para calon teknisi elektro dalam belajar merancang amplifier. Perancangan ini dilakukan dengan pendekatan metode Research and Development adalah metode penelitian yang digunakan untuk menghasilkan produk tertentu dan menguji keefektifan produk tersebut. Dengan aplikasi ini diharapkan dapat membantu para pengguna yang ingin belajar merakit amplifier berbasis android. . Kata kunci: elektro, game, research and development.

  16. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. InP Heterojunction Bipolar Transistor Amplifiers to 255 GHz

    Science.gov (United States)

    Radisic, Vesna; Sawdai, Donald; Scott, Dennis; Deal, William; Dang, Linh; Li, Danny; Cavus, Abdullah; To, Richard; Lai, Richard

    2009-01-01

    Two single-stage InP heterojunction bipolar transistor (HBT) amplifiers operate at 184 and 255 GHz, using Northrop Grumman Corporation s InP HBT MMIC (monolithic microwave integrated circuit) technology. At the time of this reporting, these are reported to be the highest HBT amplifiers ever created. The purpose of the amplifier design is to evaluate the technology capability for high-frequency designs and verify the model for future development work.

  18. Bevalac injector final stage RF amplifier upgrades

    International Nuclear Information System (INIS)

    Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

    1991-01-01

    With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

  19. Effects of entanglement in an ideal optical amplifier

    Science.gov (United States)

    Franson, J. D.; Brewster, R. A.

    2018-04-01

    In an ideal linear amplifier, the output signal is linearly related to the input signal with an additive noise that is independent of the input. The decoherence of a quantum-mechanical state as a result of optical amplification is usually assumed to be due to the addition of quantum noise. Here we show that entanglement between the input signal and the amplifying medium can produce an exponentially-large amount of decoherence in an ideal optical amplifier even when the gain is arbitrarily close to unity and the added noise is negligible. These effects occur for macroscopic superposition states, where even a small amount of gain can leave a significant amount of which-path information in the environment. Our results show that the usual input/output relation of a linear amplifier does not provide a complete description of the output state when post-selection is used.

  20. Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

    Science.gov (United States)

    Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

    2015-06-01

    A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

  1. Attomolar detection of proteins via cascade strand-displacement amplification and polystyrene nanoparticle enhancement in fluorescence polarization aptasensors.

    Science.gov (United States)

    Huang, Yong; Liu, Xiaoqian; Huang, Huakui; Qin, Jian; Zhang, Liangliang; Zhao, Shulin; Chen, Zhen-Feng; Liang, Hong

    2015-08-18

    Extremely sensitive and accurate measurements of protein markers for early detection and monitoring of diseases pose a formidable challenge. Herein, we develop a new type of amplified fluorescence polarization (FP) aptasensor based on allostery-triggered cascade strand-displacement amplification (CSDA) and polystyrene nanoparticle (PS NP) enhancement for ultrasensitive detection of proteins. The assay system consists of a fluorescent dye-labeled aptamer hairpin probe and a PS NP-modified DNA duplex (assistant DNA/trigger DNA duplex) probe with a single-stranded part and DNA polymerase. Two probes coexist stably in the absence of target, and the dye exhibits relatively low FP background. Upon recognition and binding with a target protein, the stem of the aptamer hairpin probe is opened, after which the opened hairpin probe hybridizes with the single-stranded part in the PS NP-modified DNA duplex probe and triggers the CSDA reaction through the polymerase-catalyzed recycling of both target protein and trigger DNA. Throughout this CSDA process, numerous massive dyes are assembled onto PS NPs, which results in a substantial FP increase that provides a readout signal for the amplified sensing process. Our newly proposed amplified FP aptasensor enables the quantitative measurement of proteins with the detection limit in attomolar range, which is about 6 orders of magnitude lower than that of traditional homogeneous aptasensors. Moreover, this sensing method also exhibits high specificity for target proteins and can be performed in homogeneous solutions. In addition, the suitability of this method for the quantification of target protein in biological samples has also been shown. Considering these distinct advantages, the proposed sensing method can be expected to provide an ultrasensitive platform for the analysis of various types of target molecules.

  2. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  3. Establishment of a novel immunoassay system for rapid detection of 2,4-dichlorophenoxyacetic acid residues based on magnetic-fluorescent probes

    Directory of Open Access Journals (Sweden)

    WANG Yuanfeng

    2014-12-01

    Full Text Available A novel immunoassay system based on magnetic-fluorescent probes was established to detect 2.4-dichlorophenoxyacetic acid (2,4-D residue in liquid system in food and agricultural products.The composites of anti-2,4-D antibody bound to Fe3O4@SiO2-NH2 was employed as the solid phase as well as magnetic probe.The composites composed of 2,4-D-OVA labeled with CdTe@SiO2-NH2 as the fluorescent probe was used to produce fluorescent signal.2,4-D and its fluorescent probe competed binding the antibody on the surface of the magnetic probe.The optimization of 2,4-D-OVA dosage,coupling PH and reaction time in preparing the fluorescent probe were investigated.It showed that in the synthesis of fluorescent probe 8.2 was the optimal pH,70 min was the optimal coupling time,500 μL amount of 2,4-D-OVA.The standard curve was obtained with the concentration of 2,4-D and the maximum fluorescence intensity.The detection limit of the assay was gotten and it was 3.55×10-8.One reaction step and one washing step were needed.The assay significantly shortened the testing time and amplified the detection signal compared with classic ELISA.

  4. Design of a high-gain laser diode-array pumped Nd:YAG Alternating Precessive Slab Amplifier (APS-Amplifier)

    Science.gov (United States)

    Coyle, D. Barry

    1991-01-01

    In the design of space qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.

  5. Design of a high-gain laser diode-array pumped Nd:YAG alternating precessive slab amplifier (APS amplifier)

    Science.gov (United States)

    Coyle, D. B.

    1991-01-01

    In the design of space-qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.

  6. A CMOS Integrating Amplifier for the PHENIX Ring Imaging Cherenkov detector

    International Nuclear Information System (INIS)

    Wintenberg, A.L.; Jones, J.P. Jr.; Young, G.R.; Moscone, C.G.

    1997-11-01

    A CMOS integrating amplifier has been developed for use in the PHENIX Ring Imaging Cherenkov (RICH) detector. The amplifier, consisting of a charge-integrating amplifier followed by a variable gain amplifier (VGA), is an element of a photon measurement system comprising a photomultiplier tube, a wideband, gain of 10 amplifier, the integrating amplifier, and an analog memory followed by an ADC and double correlated sampling implemented in software. The integrating amplifier is designed for a nominal full scale input of 160 pC with a gain of 20 mV/pC and a dynamic range of 1000:1. The VGA is used for equalizing gains prior to forming analog sums for trigger purposes. The gain of the VGA is variable over a 3:1 range using a 5 bits digital control, and the risetime is held to approximately 20 ns using switched compensation in the VGA. Details of the design and results from several prototype devices fabricated in 1.2 microm Orbit CMOS are presented. A complete noise analysis of the integrating amplifier and the correlated sampling process is included as well as a comparison of calculated, simulated and measured results

  7. A CMOS Integrating Amplifier for the PHENIX Ring Imaging Cherenkov detector

    Energy Technology Data Exchange (ETDEWEB)

    Wintenberg, A.L.; Jones, J.P. Jr.; Young, G.R. [Oak Ridge National Lab., TN (United States); Moscone, C.G. [Tennessee Univ., Knoxville, TN (United States)

    1997-11-01

    A CMOS integrating amplifier has been developed for use in the PHENIX Ring Imaging Cherenkov (RICH) detector. The amplifier, consisting of a charge-integrating amplifier followed by a variable gain amplifier (VGA), is an element of a photon measurement system comprising a photomultiplier tube, a wideband, gain of 10 amplifier, the integrating amplifier, and an analog memory followed by an ADC and double correlated sampling implemented in software. The integrating amplifier is designed for a nominal full scale input of 160 pC with a gain of 20 mV/pC and a dynamic range of 1000:1. The VGA is used for equalizing gains prior to forming analog sums for trigger purposes. The gain of the VGA is variable over a 3:1 range using a 5 bits digital control, and the risetime is held to approximately 20 ns using switched compensation in the VGA. Details of the design and results from several prototype devices fabricated in 1.2 {micro}m Orbit CMOS are presented. A complete noise analysis of the integrating amplifier and the correlated sampling process is included as well as a comparison of calculated, simulated and measured results.

  8. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  9. Amplified spontaneous emission in solar-pumped iodine laser

    Science.gov (United States)

    Cho, Yong S.; Hwang, In H.; Han, Kwang S.; Lee, Ja H.

    1992-01-01

    The amplified spontaneous emission (ASE) from a long pulse, solar-simulating radiation pumped iodine laser amplifier is studied. The ASE threshold pump intensity is almost proportional to the inverse of the laser gain length when the gas pressure is constant in the laser tube.

  10. Ultrafast Dynamics of Quantum-Dot Semiconductor Optical Amplifiers

    DEFF Research Database (Denmark)

    Poel, Mike van der; Hvam, Jørn Märcher

    2007-01-01

    We report on a series of experiments on the dynamical properties of quantum-dot semiconductor optical amplifiers. We show how the amplifier responds to one or several ultrafast (170 fs) pulses in rapid succession and our results demonstrate applicability and ultimate limitations to application...

  11. Fragment informatics and computational fragment-based drug design: an overview and update.

    Science.gov (United States)

    Sheng, Chunquan; Zhang, Wannian

    2013-05-01

    Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

  12. Self-oscillating modulators for direct energy conversion audio power amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.; Andersen, Michael A.E.

    2005-07-01

    Direct energy conversion audio power amplifier represents total integration of switching-mode power supply and Class D audio power amplifier into one compact stage, achieving high efficiency, high level of integration, low component count and eventually low cost. This paper presents how self-oscillating modulators can be used with the direct switching-mode audio power amplifier to improve its performance by providing fast hysteretic control with high power supply rejection ratio, open-loop stability and high bandwidth. Its operation is thoroughly analyzed and simulated waveforms of a prototype amplifier are presented. (au)

  13. Design and development of digital seismic amplifier recorder

    Energy Technology Data Exchange (ETDEWEB)

    Samsidar, Siti Alaa; Afuar, Waldy; Handayani, Gunawan, E-mail: gunawanhandayani@gmail.com [Department of Physics, ITB (Indonesia)

    2015-04-16

    A digital seismic recording is a recording technique of seismic data in digital systems. This method is more convenient because it is more accurate than other methods of seismic recorders. To improve the quality of the results of seismic measurements, the signal needs to be amplified to obtain better subsurface images. The purpose of this study is to improve the accuracy of measurement by amplifying the input signal. We use seismic sensors/geophones with a frequency of 4.5 Hz. The signal is amplified by means of 12 units of non-inverting amplifier. The non-inverting amplifier using IC 741 with the resistor values 1KΩ and 1MΩ. The amplification results were 1,000 times. The results of signal amplification converted into digital by using the Analog Digital Converter (ADC). Quantitative analysis in this study was performed using the software Lab VIEW 8.6. The Lab VIEW 8.6 program was used to control the ADC. The results of qualitative analysis showed that the seismic conditioning can produce a large output, so that the data obtained is better than conventional data. This application can be used for geophysical methods that have low input voltage such as microtremor application.

  14. Operational amplifier circuits analysis and design

    CERN Document Server

    Nelson, J C C

    1995-01-01

    This book, a revised and updated version of the author's Basic Operational Amplifiers (Butterworths 1986), enables the non-specialist to make effective use of readily available integrated circuit operational amplifiers for a range of applications, including instrumentation, signal generation and processing.It is assumed the reader has a background in the basic techniques of circuit analysis, particularly the use of j notation for reactive circuits, with a corresponding level of mathematical ability. The underlying theory is explained with sufficient but not excessive, detail. A range of compu

  15. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  16. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  17. Spaceflight 2 um Tm Fiber MOPA Amplifier, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Fibertek proposes to design, develop, and test a spaceflight prototype 2051 nm thulium (Tm)-doped fiber amplifier (TDFA) optical master oscillator power amplifier...

  18. Compact solid state radio frequency amplifiers in kW regime for ...

    Indian Academy of Sciences (India)

    RF amplifier; solid state amplifier; power combiner and divider; .... was designed using planar and coaxial transmission line baluns with minimum lumped variable ..... Cripps S C 1999 RF power amplifiers for wireless communication. Norwood: ...

  19. Distributed amplifier using Josephson vortex flow transistors

    International Nuclear Information System (INIS)

    McGinnis, D.P.; Beyer, J.B.; Nordman, J.E.

    1986-01-01

    A wide-band traveling wave amplifier using vortex flow transistors is proposed. A vortex flow transistor is a long Josephson junction used as a current controlled voltage source. The dual nature of this device to the field effect transistor is exploited. A circuit model of this device is proposed and a distributed amplifier utilizing 50 vortex flow transistors is predicted to have useful gain to 100 GHz

  20. PHEMT Distributed Power Amplifier Adopting Broadband Impedance Transformer

    DEFF Research Database (Denmark)

    Narendra, K.; Limiti, E.; Paoloni, C.

    2013-01-01

    A non-uniform drain line distributed power amplifier (DPA) employing a broadband impedance transformer is presented. The DPA is based on GaAs PHEMT technology. The impedance transformer employs asymmetric coupled lines and transforms a low output impedance of the amplifier to a standard 50 Ω...

  1. Dissociation dynamics of anionic and excited neutral fragments of gaseous SiCl4 following Cl 2p and Si 2p core-level excitations

    International Nuclear Information System (INIS)

    Chen, J M; Lu, K T; Lee, J M; Chou, T L; Chen, H C; Chen, S A; Haw, S C; Chen, T H

    2008-01-01

    The state-selective dissociation dynamics for anionic and excited neutral fragments of gaseous SiCl 4 following Cl 2p and Si 2p core-level excitations were characterized by combining measurements of the photon-induced anionic dissociation, x-ray absorption and UV/visible dispersed fluorescence. The transitions of core electrons to high Rydberg states/doubly excited states in the vicinity of both Si 2p and Cl 2p ionization thresholds of gaseous SiCl 4 lead to a remarkably enhanced production of anionic, Si - and Cl - , fragments and excited neutral atomic, Si*, fragments. This enhancement via core-level excitation near the ionization threshold of gaseous SiCl 4 is explained in terms of the contributions from the Auger decay of doubly excited states, shake-modified resonant Auger decay, or/and post-collision interaction. These complementary results provide insight into the state-selective anionic and excited neutral fragmentation of gaseous molecules via core-level excitation.

  2. Development and energization of IOT based RF amplifier

    International Nuclear Information System (INIS)

    Mandal, A.; Som, S.; Raj, P.R.; Manna, S.K.; Ghosh, S.; Seth, S.; Thakurta, S.; Thakur, S.K.; Saha, S.; Panda, U.S.

    2013-01-01

    A 704 MHz IOT based CW RF amplifier has been developed in VECC. It can also be used with proper tuning to power cavity modules operating at 650 MHz in high energy high intensity proton linear accelerator proposed to be built for ADSS/SNS programme in India and Project-X at Fermilab, USA. This IOT based amplifier provides up to 60 kW continuous wave RF power at 700 MHz. It required various power supplies, LCW cooling and forced air cooling for its operation. The auxiliary power supplies like Grid, Filament and Ion-pump, are floated and mounted on an isolated frame, i.e., HV deck. The mains inputs are electrically isolated by means of isolation transformer. Also, a Programmable Logic Controller (PLC) based interlocks along with high voltage collector power supply has been designed and developed for the safe operation of the RF amplifier. This paper discusses about various developments and energization of the IOT based RF amplifier with high power dummy load. (author)

  3. Amplifiers dedicated for large area SiC photodiodes

    Science.gov (United States)

    Doroz, P.; Duk, M.; Korwin-Pawlowski, M. L.; Borecki, M.

    2016-09-01

    Large area SiC photodiodes find applications in optoelectronic sensors working at special conditions. These conditions include detection of UV radiation in harsh environment. Moreover, the mentioned sensors have to be selective and resistant to unwanted signals. For this purpose, the modulation of light at source unit and the rejection of constant current and low frequency component of signal at detector unit are used. The popular frequency used for modulation in such sensor is 1kHz. The large area photodiodes are characterized by a large capacitance and low shunt resistance that varies with polarization of the photodiode and can significantly modify the conditions of signal pre-amplification. In this paper two pre-amplifiers topology are analyzed: the transimpedance amplifier and the non-inverting voltage to voltage amplifier with negative feedback. The feedback loops of both pre-amplifiers are equipped with elements used for initial constant current and low frequency signals rejections. Both circuits are analyzed and compared using simulation and experimental approaches.

  4. Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

    Science.gov (United States)

    Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

    2014-08-30

    The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Conversion of Beckman DK-2A spectrophotometer into an automatic single-photon counting fluorescence spectrophotometer

    International Nuclear Information System (INIS)

    Chikkur, G.C.; Lagare, M.T.; Umakantha, N.

    1981-01-01

    Details of how a DK-2A spectrophotometer can be modified into an automatic single-photon counting fluorescence spectrophotometer for recording a low intensity spectrum, are reported. The single-photon count-rate converted into a DC voltage is applied at the appropriate stage in the sample channel amplifier circuit of a DK-2A to get the pen deflection proportional to the count-rate. A high intensity spectrum may be recorded in the usual way by merely turning the shaft of the mirror motor by 180 degrees. (author)

  6. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  7. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    Directory of Open Access Journals (Sweden)

    Bartoš Jan

    2008-06-01

    Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which

  8. Spatial chirp in Ti:sapphire multipass amplifier

    International Nuclear Information System (INIS)

    Li Wenkai; Lu Jun; Li Yanyan; Guo Xiaoyang; Wu Fenxiang; Yu Linpeng; Wang Pengfei; Xu Yi; Leng Yuxin

    2017-01-01

    The spatial chirp generated in the Ti:sapphire multipass amplifier is numerically investigated based on the one-dimensional (1D) and two-dimensional (2D) Frantz–Nodvik equations. The simulation indicates that the spatial chirp is induced by the spatially inhomogeneous gain, and it can be almost eliminated by utilization of proper beam profiles and spot sizes of the signal and pump pulses, for example, the pump pulse has a top-hatted beam profile and the signal pulse has a super-Gaussian beam profile with a relatively larger spot size. In this way, a clear understanding of spatial chirp mechanisms in the Ti:sapphire multipass amplifier is proposed, therefore we can effectively almost eliminate the spatial chirp and improve the beam quality of a high-power Ti:sapphire chirped pulse amplifier system. (paper)

  9. An automated test facility for neutronic amplifiers

    International Nuclear Information System (INIS)

    Beattie, W.J.

    1997-01-01

    Neutronic amplifiers are used at the Chalk River Laboratory in applications such as neutron flux monitoring and reactor control systems. Routine preventive maintenance of control and safety systems included annual calibration and characterization of the neutronic amplifiers. An investigation into the traditional methods of annual routine maintenance of amplifiers concluded that frequency and phase response measurements in particular were labour intensive and subject to non-repeatable errors. A decision was made to upgrade testing methods and facilities by using programmable test equipment under the control of a computer. In order to verify the results of the routine measurements, expressions for the transfer functions were derived from the circuit diagrams. Frequency and phase responses were then calculated and plotted thus providing a bench-mark to which the test results can be compared. (author)

  10. A method for measurements of neutral fragments kinetic energies released to a specific dissociation threshold: optical translational spectroscopy

    International Nuclear Information System (INIS)

    Roney, A.; Frigon, C.; Larzilliere, M.

    1999-01-01

    The optical translational spectroscopy technique, based on the principles of fast ion beam laser spectroscopy (FIBLAS) and translational spectroscopy, allows the kinetic energies study of neutral fragments released through free dissociation of a neutral molecule. This method presents interesting features such as near-threshold energy measurements and selection of a specific dissociation limit. The fragments resulting from free dissociation (not induced) of neutral molecules, produced by charge exchange processes with a fast ion beam, are probed by laser radiation. Monitoring of the laser-induced fluorescence allows high-resolution spectra due to the kinematic compression of the velocity spread. Measurements of kinetic energies released to the second limit of dissociation H(1s) + H(2l) of H 2 are put forth and compared with those obtained by means of off-axis translational spectroscopy

  11. A Novel Molecular Diagnostic of Glioblastomas: Detection of an Extracellular Fragment of Protein Tyrosine Phosphatase μ

    Directory of Open Access Journals (Sweden)

    Susan M. Burden-Gulley

    2010-04-01

    Full Text Available We recently found that normal human brain and low-grade astrocytomas express the receptor protein tyrosine phosphatase mu (PTPμ and that the more invasive astrocytomas, glioblastoma multiforme (GBM, downregulate full-length PTPμ expression. Loss of PTPμ expression in GBMs is due to proteolytic cleavage that generates an intracellular and potentially a cleaved and released extracellular fragment of PTPμ. Here, we identify that a cleaved extracellular fragment containing the domains required for PTPμ-mediated adhesion remains associated with GBM tumor tissue. We hypothesized that detection of this fragment would make an excellent diagnostic tool for the localization of tumor tissue within the brain. To this end, we generated a series of fluorescently tagged peptide probes that bind the PTPμ fragment. The peptide probes specifically recognize GBM cells in tissue sections of surgically resected human tumors. To test whether the peptide probes are able to detect GBM tumors in vivo, the PTPμ peptide probes were tested in both mouse flank and intracranial xenograft human glioblastoma tumor model systems. The glial tumors were molecularly labeled with the PTPμ peptide probes within minutes of tail vein injection using the Maestro FLEX In Vivo Imaging System. The label was stable for at least 3 hours. Together, these results indicate that peptide recognition of the PTPμ extracellular fragment provides a novel molecular diagnostic tool for detection of human glioblastomas. Such a tool has clear translational applications and may lead to improved surgical resections and prognosis for patients with this devastating disease.

  12. Dynamic range meter for radiofrequency amplifiers

    Directory of Open Access Journals (Sweden)

    Drozd S. S.

    2009-04-01

    Full Text Available The new measurement setup having increased on 20…30 dB the own dynamic range in comparison with the standard circuit of the dynamic range meter is offered and the rated value of an error bringing by setup in the worst case does not exceed ± 2,8 dB. The measurement setup can be applied also to determinate levels of intermodulation components average power amplifiers and powerful amplifiers of a low-frequency at replacement of the quartz filter on meeting low-frequency the LC-filter and the spectrum analyzer.

  13. Cavity enhanced rephased amplified spontaneous emission

    International Nuclear Information System (INIS)

    A Williamson, Lewis; J Longdell, Jevon

    2014-01-01

    Amplified spontaneous emission is usually treated as an incoherent noise process. Recent theoretical and experimental work using rephasing optical pulses has shown that rephased amplified spontaneous emission (RASE) is a potential source of wide bandwidth time-delayed entanglement. Due to poor echo efficiency the plain RASE protocol does not in theory achieve perfect entanglement. Experiments done to date show a very small amount of entanglement at best. Here we show that RASE can, in principle, produce perfect multimode time-delayed two mode squeezing when the active medium is placed inside a Q-switched cavity. (paper)

  14. Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

    Science.gov (United States)

    Lirman

    2000-08-23

    Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

  15. Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

    Science.gov (United States)

    Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

    2016-01-01

    Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

  16. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  17. Pulse GaAs field transistor amplifier with subnanosecond time transient

    International Nuclear Information System (INIS)

    Sidnev, A.N.

    1987-01-01

    Pulse amplifier on fast field effect GaAs transistors with Schottky barrier is described. The amplifier contains four cascades, the first three of which are made on combined transistors on the common-drain circuit. The last cascade is made on high-power field effect GaAs transistor for coordination with 50 ohm load. The amplifier operates within the range of input signals from 0.5 up to 100 mV with repetition frequency up to 16 Hz, The gain of the amplifier is ≅ 20 dB. The setting time at output pulses amplitude up to 1 V constitutes ∼ 0.2 ns

  18. X-ray fluorescence analysis of ancient and medieval brass artifacts from south Moravia

    Energy Technology Data Exchange (ETDEWEB)

    Hlozek, M. [Methodical Centre of Conservation-Technical Museum in Brno, Purkynova 105, 612 00 Brno (Czech Republic); Komoroczy, B. [Institute of Archeology of the Academy of Science of the Czech Republic, Kralovopolska 147, 612 00 Brno (Czech Republic); Trojek, T., E-mail: tomas.trojek@fjfi.cvut.cz [Department of Dosimetry and Application of Ionizing Radiation, Czech Technical University in Prague, Brehova 7, 115 19 Praha 1 (Czech Republic)

    2012-07-15

    This paper deals with an investigation of archeological finds using X-ray fluorescence analysis and microanalysis. The main aim of the investigation was to prove the production of brass in the South Moravian Region (part of the Czech Republic) in former times. The probable brass production technology is described. Various objects dating back to Antiquity and to the Middle Ages were investigated using two X-ray fluorescence systems, and the results of the analyses are discussed. The measurements showed, e.g., that fragments of Roman scale armor and a belt fitting dating back to Antiquity were made of brass. Brass was also identified on the surfaces of various ancient and medieval molds and melting pots. - Highlights: Black-Right-Pointing-Pointer Semiquantitative X-ray fluorescence analysis of archeological finds. Black-Right-Pointing-Pointer Two different gilding techniques of a brass belt terminal found in Brno. Black-Right-Pointing-Pointer Use of brass before the Great Moravian period. Black-Right-Pointing-Pointer Evidence of brass casting in the 12th century in Brno.

  19. Designing and development of a synchronous analogic amplifier

    International Nuclear Information System (INIS)

    De la Hoz, E.; Ortiz, A.

    1989-01-01

    A large number of electronic systems used in the measurement and analysis of weak signals involve a ''lock-in'' amplifier, because it provides an effective method for the recovery of signals buried below a considerable high level of noise. The use of the ''lock-in'' amplifier in our institutions is very limited due to the high expense and the lack of warranties for its maintenance. The purpose of the present work is to design and build a low cost ''lock-in'' amplifier using components available in the local market. Its optimization has allowed us to increase the sensitivity and linearity of the systems, making it very versatile for dedicated applications

  20. Metal-enhanced fluorescence of mixed coumarin dyes by silver and gold nanoparticles: Towards plasmonic thin-film luminescent solar concentrator

    Energy Technology Data Exchange (ETDEWEB)

    El-Bashir, S.M., E-mail: elbashireg@yahoo.com [Department of Physics and Astronomy, Science College, King Saud University, Riyadh, KSA (Saudi Arabia); Department of Physics Faculty of Science, Benha University (Egypt); Barakat, F.M.; AlSalhi, M.S. [Department of Physics and Astronomy, Science College, King Saud University, Riyadh, KSA (Saudi Arabia)

    2013-11-15

    Poly(methyl methacrylate) (PMMA) nanocomposite films doped with mixed coumarin dyestuffs and noble metal nanoparticles (60 nm silver and 100 nm gold) were prepared by spin coating technique. The effect of silver and gold nanoparticles on the film properties was studied by Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC), transmission electron microscopy (TEM), scanning electron microscopy (SEM), UV–vis absorption and fluorescence spectroscopy measurements. DSC measurements indicated the increase of the glass transition temperature of the films by increasing nanogold concentration, recommending their promising thermal stability towards hot climates. It was found that the fluorescence signals of the mixed coumarin dyes were amplified by 5.4 and 7.15 folds as a result of metal enhanced fluorescence (MEF). The research outcomes offered a potential application of these films in solar energy conversion by plasmonic thin film luminescent solar concentrator (PTLSC). -- Graphical abstract: Plasmonic thin film luminescent solar concentrators. Highlights: • Metal enhanced fluorescence was achieved for mixed coumarin dyes doped in PMMA nanocomposite films. • The amplification of the fluorescence signals is dependent on the concentration of silver and gold nanoparticles. • These films is considered as potential candidates for plasmonic thin film luminescent solar concentrators (PTLSCs)

  1. On the unlimited gain of a nonlinear parametric amplifier

    DEFF Research Database (Denmark)

    Sorokin, Vladislav

    2014-01-01

    The present paper is concerned with analysis of the response of a nonlinear parametric amplifier in abroad range of system parameters, particularly beyond resonance. Such analysis is of particular interestfor micro- and nanosystems, since many small-scale parametric amplifiers exhibit a distinctly...... nonlinearbehavior when amplitude of their response is sufficiently large. The modified method of direct separa-tion of motions is employed to study the considered system. As the result it is obtained that steady-stateamplitude of the nonlinear parametric amplifier response can reach large values in the case...... of arbitrarilysmall amplitude of external excitation, so that the amplifier gain tends to infinity. Very large amplifiergain can be achieved in a broad range of system parameters, in particular when the amplitude of para-metric excitation is comparatively small. The obtained results clearly demonstrate that very...

  2. Rare-Earth Doped Photonic Crystal Fibre Lasers and Amplifiers

    DEFF Research Database (Denmark)

    Hougaard, Kristian G.

    2005-01-01

    In this thesis, a theoretical and numerical study of the use of rare-earthdoped photonic crystal fibres as optical amplifiers and lasers, has been performed. Photonic crystal fibres or microstructured optical fibres is a new kind of optical fibre in which the cladding region typically consist....... Their novel properties allow for design of optical fibre amplifiers and fibre lasers with superior performance, compared to solutions based on conventional fibres. The primary applications considered are high efficiency fibre amplifiers based on index guiding photonic crystal fibres, and cladding pumped....... The thesis also presents the basic properties of optical amplification, and describes the numerical model developed to model the behaviour of lasers and amplifiers based on photonic crystal fibres. The developed numerical tools are then used to investigate specific applications of photonic crystal fibres...

  3. BET bromodomain inhibition of MYC-amplified medulloblastoma.

    Science.gov (United States)

    Bandopadhayay, Pratiti; Bergthold, Guillaume; Nguyen, Brian; Schubert, Simone; Gholamin, Sharareh; Tang, Yujie; Bolin, Sara; Schumacher, Steven E; Zeid, Rhamy; Masoud, Sabran; Yu, Furong; Vue, Nujsaubnusi; Gibson, William J; Paolella, Brenton R; Mitra, Siddhartha S; Cheshier, Samuel H; Qi, Jun; Liu, Kun-Wei; Wechsler-Reya, Robert; Weiss, William A; Swartling, Fredrik J; Kieran, Mark W; Bradner, James E; Beroukhim, Rameen; Cho, Yoon-Jae

    2014-02-15

    MYC-amplified medulloblastomas are highly lethal tumors. Bromodomain and extraterminal (BET) bromodomain inhibition has recently been shown to suppress MYC-associated transcriptional activity in other cancers. The compound JQ1 inhibits BET bromodomain-containing proteins, including BRD4. Here, we investigate BET bromodomain targeting for the treatment of MYC-amplified medulloblastoma. We evaluated the effects of genetic and pharmacologic inhibition of BET bromodomains on proliferation, cell cycle, and apoptosis in established and newly generated patient- and genetically engineered mouse model (GEMM)-derived medulloblastoma cell lines and xenografts that harbored amplifications of MYC or MYCN. We also assessed the effect of JQ1 on MYC expression and global MYC-associated transcriptional activity. We assessed the in vivo efficacy of JQ1 in orthotopic xenografts established in immunocompromised mice. Treatment of MYC-amplified medulloblastoma cells with JQ1 decreased cell viability associated with arrest at G1 and apoptosis. We observed downregulation of MYC expression and confirmed the inhibition of MYC-associated transcriptional targets. The exogenous expression of MYC from a retroviral promoter reduced the effect of JQ1 on cell viability, suggesting that attenuated levels of MYC contribute to the functional effects of JQ1. JQ1 significantly prolonged the survival of orthotopic xenograft models of MYC-amplified medulloblastoma (P < 0.001). Xenografts harvested from mice after five doses of JQ1 had reduced the expression of MYC mRNA and a reduced proliferative index. JQ1 suppresses MYC expression and MYC-associated transcriptional activity in medulloblastomas, resulting in an overall decrease in medulloblastoma cell viability. These preclinical findings highlight the promise of BET bromodomain inhibitors as novel agents for MYC-amplified medulloblastoma. ©2013 AACR

  4. Fluorescence lidar measurements at the archaeological site House of Augustus at Palatino, Rome

    Science.gov (United States)

    Raimondi, Valentina; Alisi, Chiara; Barup, Kerstin; Bracciale, Maria Paola; Broggi, Alessandra; Conti, Cinzia; Hällström, Jenny; Lognoli, David; Palombi, Lorenzo; Santarelli, Maria Laura; Sprocati, Anna Rosa

    2013-10-01

    Early diagnostics and documentation fulfill an essential role for an effective planning of conservation and restoration of cultural heritage assets. In particular, remote sensing techniques that do not require the use of scaffolds or lifts, such as fluoresence lidar, can provide useful information to obtain an overall assessment of the status of the investigated surfaces and can be exploited to address analytical studies in selected areas. Here we present the results of a joint Italian-Swedish project focused on documenting and recording the status of some sections of the part closed to the public by using fluorescence hyperspectral imaging lidar. The lidar used a tripled-frequency Nd:YAG laser emitting at 355 nm as excitation source and an intensified, gated 512x512-pixel CCD as detector. The lidar had imaging capabilities thanks to a computer-controlled scanning mirror. The fluorescence characteristics of fresco wall paintings were compared to those of fresco fragments found at the same archaeological site and separately examined in the lab using FT-IR and Raman techniques for the identification of pigments. The fluorescence lidar was also used to remotely detect the growth of phototrophic biodeteriogens on the walls. The fluorescence lidar data were compared with results from biological sampling, cultivation and laboratory analysis by molecular techniques.

  5. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  6. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  7. Investigation of switching frequency variations in self-oscillating class D amplifiers

    OpenAIRE

    Nielsen, Dennis; Knott, Arnold; Pfaffinger, Gerhard; Andersen, Michael A. E.

    2009-01-01

    Class D audio amplifiers have gained significant influence in sound reproduction due to their high efficiency. One of the most commonly used control methods in class D amplifiers is known as self-oscillation. An parameter of key interest in self-oscillating class D amplifiers is the switching frequency, which can be directly related to the performance of the amplifier. This paper will clearify the myth of the switching frequency through investigation of its dependency on modulation index and ...

  8. Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

    Science.gov (United States)

    Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

    2011-01-01

    In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic

  9. Model of pulse extraction from a copper laser amplifier

    International Nuclear Information System (INIS)

    Boley, C.D.; Warner, B.E.

    1997-03-01

    A computational model of pulse propagation through a copper laser amplifier has been developed. The model contains a system of 1-D (in the axial direction), time-dependent equations for the laser intensity and amplified spontaneous emission (ASE), coupled to rate equations for the atomic levels. Detailed calculations are presented for a high-power amplifier at Lawrence Livermore National Laboratory. The extracted power agrees with experiment near saturation. At lower input power the calculation overestimates experiment, probably because of increased ASE effects. 6 refs., 6 figs

  10. Efficient performance simulation of class D amplifier output stages

    DEFF Research Database (Denmark)

    Nyboe, Flemming; Risbo, Lars; Andreani, Pietro

    2005-01-01

    Straightforward simulation of amplifier distortion involves transient simulation of operation on a sine wave input signal, and a subsequent FFT of the output voltage. This approach is very slow on class D amplifiers, since the switching behavior forces simulation time steps that are many orders...... of magnitude smaller than the duration of one period of an audio sine wave. This work presents a method of simulating the amplifier transfer characteristic using a minimum amount of simulation time, and then deriving THD from the results....

  11. Fission times studies of the Z=124 superheavy nucleus by X-ray fluorescence

    International Nuclear Information System (INIS)

    Airiau, Maud

    2016-01-01

    Since the 1960's nuclear structure model have predicted the existence of an island of stability of superheavy elements. It should be located around the next magic numbers expected at N=172 or 184 and between Z=114 and 126 depending on the model. Very high fission barrier of a few MeV are predicted to be generated by microscopic effects for those nuclei for which large fission times distributions extended to very high fission times are induced. Fission time measurements of the superheavy element Z=124 have been made by us using the X-ray fluorescence technique, a method based on the filling of inner-shell electronic vacancies created during the collision leading to the formation of the compound nucleus. The aim of this experiment was to detect in coincidence both fission fragments and characteristic X-rays from the Z=124, created by the reaction 238 U+ 70,76 Ge. The main difficulty was to identify those X-rays due to the fact that gamma-rays from fission fragments were emitted in the same energy range, which affected our photon multiplicities for any fragment selection. This new difficulty brings an important limitation to the study of some particular superheavy elements by the X-ray fluorescence method. K X-rays spectra have been simulated using MCDF (Multi-Configuration-Dirac-Fock) and then compared to the experimental ones in order to get a maximal K X-ray multiplicity compatible with our data. The extracted results were about 6-7% for 76 Ge and from 12 to 14% for 70 Ge. Those values remain compatible with the experimental signature of long lifetime component observed for the same system but using a blocking technique in single crystals. (author) [fr

  12. Ripple compensation for a class-D amplifier

    OpenAIRE

    Cox, Stephen M.; du Toit Mouton, Hendrik

    2015-01-01

    This paper presents the first detailed mathematical analysis of the ripple compensation technique for reducing audio distortion in a class-D amplifier with negative feedback. The amplifier converts a relatively low-frequency audio signal to a high-frequency train of rectangular pulses whose widths are slowly modulated according to the audio signal (pulse-width modulation, PWM). Distortion manifests itself through unwanted audio-frequency harmonics that arise in the output due to nonlinearitie...

  13. Progress on the gyrocon deflection-modulated amplifier

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1982-01-01

    The gyrocon is a high-power deflection-modulated amplifier that can have excellent spatial bunching and, hence, high dc-to-rf conversion efficiency. A program to design and build a prototype amplifier at 450 MHz is discussed. Peak powers of 150 kW and conversion efficiencies of 23% have been measured; the testing program is being pursued to improve this performance. Some possible mechanisms for the difference between the experimental and calculated performance are discussed

  14. A high-power compact regenerative amplifier FEL

    International Nuclear Information System (INIS)

    Nguyen, D.C.; Sheffield, R.L.; Fortgang, C.M.; Kinross-Wright, J.M.; Ebrahim, N.A.; Goldstein, J.C.

    1997-01-01

    The Regenerative Amplifier FEL (RAFEL) is a new FEL approach aimed at achieving the highest optical power from a compact rf-linac FEL. The key idea is to feed back a small fraction ( 5 in single pass) wiggler to enable the FEL to reach saturation in a few passes. This paper summarizes the design of a high-power compact regenerative amplifier FEL and describes the first experimental demonstration of the RAFEL concept

  15. Quantitative evaluation of stone fragments in extracorporeal shock wave lithotripsy using a time reversal operator

    Science.gov (United States)

    Wang, Jen-Chieh; Zhou, Yufeng

    2017-03-01

    Extracorporeal shock wave lithotripsy (ESWL) has been used widely in the noninvasive treatment of kidney calculi. The fine fragments less than 2 mm in size can be discharged by urination, which determines the success of ESWL. Although ultrasonic and fluorescent imaging are used to localize the calculi, it's challenging to monitor the stone comminution progress, especially at the late stage of ESWL when fragments spread out as a cloud. The lack of real-time and quantitative evaluation makes this procedure semi-blind, resulting in either under- or over-treatment after the legal number of pulses required by FDA. The time reversal operator (TRO) method has the ability to detect point-like scatterers, and the number of non-zero eigenvalues of TRO is equal to that of the scatterers. In this study, the validation of TRO method to identify stones was illustrated from both numerical and experimental results for one to two stones with various sizes and locations. Furthermore, the parameters affecting the performance of TRO method has also been investigated. Overall, TRO method is effective in identifying the fragments in a stone cluster in real-time. Further development of a detection system and evaluation of its performance both in vitro and in vivo during ESWL is necessary for application.

  16. Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

    Science.gov (United States)

    Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

    2015-01-01

    Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

  17. Radiation hardening techniques for rare-earth based optical fibers and amplifiers

    International Nuclear Information System (INIS)

    Girard, Sylvain; Marcandella, Claude; Vivona, Marilena; Prudenzano, Luciano Mescia F.; Laurent, Arnaud; Robin, Thierry; Cadier, Benoit; Pinsard, Emmanuel; Ouerdane, Youcef; Boukenter, Aziz; Cannas, Marco; Boscaino, Roberto

    2012-01-01

    Er/Yb doped fibers and amplifiers have been shown to be very radiation sensitive, limiting their integration in space. We present an approach including successive hardening techniques to enhance their radiation tolerance. The efficiency of our approach is demonstrated by comparing the radiation responses of optical amplifiers made with same lengths of different rare-earth doped fibers and exposed to gamma-rays. Previous studies indicated that such amplifiers suffered significant degradation for doses exceeding 10 krad. Applying our techniques significantly enhances the amplifier radiation resistance, resulting in a very limited degradation up to 50 krad. Our optimization techniques concern the fiber composition, some possible pre-treatments and the interest of simulation tools used to harden by design the amplifiers. We showed that adding cerium inside the fiber phospho-silicate-based core strongly decreases the fiber radiation sensitivity compared to the standard fiber. For both fibers, a pre-treatment with hydrogen permits to enhance again the fiber resistance. Furthermore, simulations tools can also be used to improve the tolerance of the fiber amplifier by helping identifying the best amplifier configuration for operation in the radiative environment. (authors)

  18. Effects of gamma radiation on commercial operational amplifiers

    International Nuclear Information System (INIS)

    Claro, Luiz H.; Santos, Jose A. dos

    2009-01-01

    The operational amplifiers are widely used in nuclear instrumentation. Their applications span the signal conditioning circuits, analog instrumentation, amplifiers, converters, oscillators and others. If an operational amplifier is used to work in a radiation environment, the device suffers degradation in its performance leading to the bad work in the systems. Some of these devices are designed as rad-hard components and therefore the effects of radiation damage are minimized, however its main disadvantage is the high cost and difficult to find in the market. As an alternative one can use the conventional electronic components available in the market and named COTS (Commercially Available Off-The-Shelf) but they must be tested under a radiation environment. In this work the effect of the radiation damage is studied in two typical operational amplifiers. Some electric parameters of these devices were measured for different gamma radiation doses and they were working at different input signal frequencies. A 60 Co isotopic radiation source was used and the results show that there is a certain degradation of the device depending on the radiation absorbed dose. (author)

  19. Spatial discrimination against background with different optical systems for collection of fluorescence in laser-excited atomic fluorescence spectrometry with a graphite tube electrothermal atomizer.

    Science.gov (United States)

    Yuzefovsky, A I; Lonardo, R F; Michel, R G

    1995-07-01

    A single 90 degrees off-axis ellipsoidal mirror fragment was used in a dispersive detection system for electrothermal atomization laser-excited atomic fluorescence spectrometry. The performance of the new optical arrangement was compared with those of optical arrangements that employed a plane mirror in combination with biconvex or plano-convex lenses. All the optical arrangements collected fluorescence in a scheme called front surface illustration. BEAM-4, an optical ray tracing program, was used for calculations of spatial ray distributions and optical collection efficiency for the various optical configurations. Experimentally, the best collection efficiency was obtained by use of the ellipsoidal mirror, in qualitative agreement with simulations done by use of the BEAM-4 software. The best detection limit for cobalt with the new optical arrangement was 20 fg, which was a factor of 5 better than that obtained with conventional optical arrangements with otherwise the same instrumentation. The signal-to-background ratio and the fluorescence collection efficiency were also studied as a function of position of the optical components for the various optical arrangements. For both cobalt and phosphorus, the signal-to-background ratio with the new optical arrangement remained stable within 10-20% during +/- 8 mm shifts in the position of the detection system from the focal plane of the optics. Overall, the new optical arrangement offered high collection efficiency, excellent sensitivity, and facile optical alignment due to efficient spatial separation between the fluorescence signal and the background radiation. The advantages of the new optical arrangement were particularly important during measurements in the presence of high levels of blackbody radiation.

  20. Bandwidth limitations in current mode and voltage mode integrated feedback amplifiers

    DEFF Research Database (Denmark)

    Bruun, Erik

    1995-01-01

    loop bandwidth remains constant for a feedback amplifier. The constant-bandwidth relations of such amplifier designs are reviewed in this paper and they are combined with the constraints imposed by technology when the feedback amplifier is to be designed in an integrated technology. From this analysis...