WorldWideScience

Sample records for fluorescent amplified fragment

  1. Fluorescence and amplified spontaneous emission of glass forming compounds containing styryl-4H-pyran-4-ylidene fragment

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)

    2012-09-15

    Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.

  2. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  3. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  4. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  5. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  6. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  7. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  8. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  9. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...

  10. Amplifier channel for a fission fragment semiconductor detector

    International Nuclear Information System (INIS)

    Tyurin, G.P.

    1981-01-01

    To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

  11. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  12. Plasmonically amplified fluorescence bioassay with microarray format

    Science.gov (United States)

    Gogalic, S.; Hageneder, S.; Ctortecka, C.; Bauch, M.; Khan, I.; Preininger, Claudia; Sauer, U.; Dostalek, J.

    2015-05-01

    Plasmonic amplification of fluorescence signal in bioassays with microarray detection format is reported. A crossed relief diffraction grating was designed to couple an excitation laser beam to surface plasmons at the wavelength overlapping with the absorption and emission bands of fluorophore Dy647 that was used as a label. The surface of periodically corrugated sensor chip was coated with surface plasmon-supporting gold layer and a thin SU8 polymer film carrying epoxy groups. These groups were employed for the covalent immobilization of capture antibodies at arrays of spots. The plasmonic amplification of fluorescence signal on the developed microarray chip was tested by using interleukin 8 sandwich immunoassay. The readout was performed ex situ after drying the chip by using a commercial scanner with high numerical aperture collecting lens. Obtained results reveal the enhancement of fluorescence signal by a factor of 5 when compared to a regular glass chip.

  13. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  14. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  15. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

    Science.gov (United States)

    Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

  16. Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Angen, Øystein

    2007-01-01

    Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

  17. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  18. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  19. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  20. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

  1. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  2. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  3. Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

    1999-01-01

    The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

  4. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  5. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  6. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  7. Mass amplifying probe for sensitive fluorescence anisotropy detection of small molecules in complex biological samples.

    Science.gov (United States)

    Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James

    2012-07-03

    Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective

  8. RNA signal amplifier circuit with integrated fluorescence output.

    Science.gov (United States)

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  9. O-GlcNAcase Fragment Discovery with Fluorescence Polarimetry.

    Science.gov (United States)

    Borodkin, Vladimir S; Rafie, Karim; Selvan, Nithya; Aristotelous, Tonia; Navratilova, Iva; Ferenbach, Andrew T; van Aalten, Daan M F

    2018-05-18

    The attachment of the sugar N-acetyl-D-glucosamine (GlcNAc) to specific serine and threonine residues on proteins is referred to as protein O-GlcNAcylation. O-GlcNAc transferase (OGT) is the enzyme responsible for carrying out the modification, while O-GlcNAcase (OGA) reverses it. Protein O-GlcNAcylation has been implicated in a wide range of cellular processes including transcription, proteostasis, and stress response. Dysregulation of O-GlcNAc has been linked to diabetes, cancer, and neurodegenerative and cardiovascular disease. OGA has been proposed to be a drug target for the treatment of Alzheimer's and cardiovascular disease given that increased O-GlcNAc levels appear to exert a protective effect. The search for specific, potent, and drug-like OGA inhibitors with bioavailability in the brain is therefore a field of active research, requiring orthogonal high-throughput assay platforms. Here, we describe the synthesis of a novel probe for use in a fluorescence polarization based assay for the discovery of inhibitors of OGA. We show that the probe is suitable for use with both human OGA, as well as the orthologous bacterial counterpart from Clostridium perfringens, CpOGA, and the lysosomal hexosaminidases HexA/B. We structurally characterize CpOGA in complex with a ligand identified from a fragment library screen using this assay. The versatile synthesis procedure could be adapted for making fluorescent probes for the assay of other glycoside hydrolases.

  10. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

  11. Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

    Science.gov (United States)

    Johnsen, G; Kruse, H; Hofshagen, M

    2006-12-01

    We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

  12. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  13. Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

    Science.gov (United States)

    K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

    1994-01-01

    A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

  14. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  15. Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

    International Nuclear Information System (INIS)

    Zhao, B.; Zheng, X.Z.

    2015-01-01

    Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

  16. Technique for Increasing the Selectivity of the Method of Laser Fragmentation/Laser-Induced Fluorescence

    Science.gov (United States)

    Bobrovnikov, S. M.; Gorlov, E. V.; Zharkov, V. I.

    2018-05-01

    A technique for increasing the selectivity of the method of detecting high-energy materials (HEMs) based on laser fragmentation of HEM molecules with subsequent laser excitation of fluorescence of the characteristic NO fragments from the first vibrational level of the ground state is suggested.

  17. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    Science.gov (United States)

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  18. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  19. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  20. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  1. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  2. Amplified fluorescent aptasensor through catalytic recycling for highly sensitive detection of ochratoxin A.

    Science.gov (United States)

    Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang

    2015-03-15

    This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  4. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  5. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  6. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  7. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  8. Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

    Science.gov (United States)

    Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

    2016-06-01

    To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

  9. Fluorescent hydroxylamine derived from the fragmentation of PAMAM dendrimers for intracellular hypochlorite recognition.

    Science.gov (United States)

    Wu, Te-Haw; Liu, Ching-Ping; Chien, Chih-Te; Lin, Shu-Yi

    2013-08-26

    Herein, a promising sensing approach based on the structure fragmentation of poly(amidoamine) (PAMAM) dendrimers for the selective detection of intracellular hypochlorite (OCl(-)) is reported. PAMAM dendrimers were easily disrupted by a cascade of oxidations in the tertiary amines of the dendritic core to produce an unsaturated hydroxylamine with blue fluorescence. Specially, the novel fluorophore was only sensitive to OCl(-), one of reactive oxygen species (ROS), resulting in an irreversible fluorescence turn-off. The fluorescent hydroxylamine was selectively oxidised by OCl(-) to form a labile oxoammonium cation that underwent further degradation. Without using any troublesomely synthetic steps, the novel sensing platform based on the fragmentation of PAMAM dendrimers, can be applied to detect OCl(-) in macrophage cells. The results suggest that the sensing approach may be useful for the detection of intracellular OCl(-) with minimal interference from biological matrixes. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Qiu, T; Jiang, L L; Yang, Y F

    2016-08-19

    The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

  12. Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bernander, S

    2000-01-01

    The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

  13. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  14. Enhanced 1.32 μm fluorescence and broadband amplifying for O-band optical amplifier in Nd3+-doped tellurite glass

    Science.gov (United States)

    Zhou, Zi-zhong; Zhou, Ming-han; Su, Xiu-e.; Cheng, Pan; Zhou, Ya-xun

    2017-01-01

    WO3 oxides with relatively high phonon energy and different concentrations were introduced into the Nd3+-doped tellurite-based glasses of TeO2-ZnO-Na2O to improve the 1.32 μm band fluorescence emission. The absorption spectra, Raman spectra, 1.32 μm band fluorescence spectra and differential scanning calorimeter (DSC) curves were measured, together with the Judd-Ofelt intensity parameters, stimulated emission and gain parameters were calculated to evaluate the effects of WO3 amount on the glass structure and spectroscopic properties of 1.32 μm band fluorescence. It is shown that the introduction of an appropriate amount of WO3 oxide can effectively improve the 1.32 μm band fluorescence intensity through the enhanced multi-phonon relaxation (MPR) processes between the excited levels of Nd3+. The results indicate that the prepared Nd3+-doped tellurite glass with an appropriate amount of WO3 oxide is a potential gain medium applied for the O-band broad and high-gain fiber amplifier.

  15. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  16. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  17. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

  18. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  19. A recombinant estrogen receptor fragment-based homogeneous fluorescent assay for rapid detection of estrogens.

    Science.gov (United States)

    Wang, Dan; Xie, Jiangbi; Zhu, Xiaocui; Li, Jinqiu; Zhao, Dongqin; Zhao, Meiping

    2014-05-15

    In this work, we demonstrate a novel estrogenic receptor fragment-based homogeneous fluorescent assay which enables rapid and sensitive detection of 17β-estradiol (E2) and other highly potent estrogens. A modified human estrogenic receptor fragment (N-His × 6-hER270-595-C-Strep tag II) has been constructed that contains amino acids 270-595 of wild-type human estrogenic receptor α (hER270-595) and two specific tags (6 × His and Strep tag II) fused to the N and C terminus, respectively. The designed receptor protein fragment could be easily produced by prokaryotic expression with high yield and high purity. The obtained protein exhibits high binding affinity to E2 and the two tags greatly facilitate the application of the recombinant protein. Taking advantage of the unique spectroscopic properties of coumestrol (CS), a fluorescent phytoestrogen, a CS/hER270-595-based fluorescent assay has been developed which can sensitively respond to E2 within 1.0 min with a linear working range from 0.1 to 20 ng/mL and a limit of detection of 0.1 ng/mL. The assay was successfully applied for rapid detection of E2 in the culture medium of rat hippocampal neurons. The method also holds great potential for high-throughput monitoring the variation of estrogen levels in complex biological fluids, which is crucial for investigation of the molecular basis of various estrogen-involved processes. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Scanning force microscopy and fluorescence microscopy of microcontact printed antibodies and antibody fragments.

    Science.gov (United States)

    LaGraff, John R; Chu-LaGraff, Quynh

    2006-05-09

    Unlabeled primary immunoglobulin G (IgG) antibodies and its F(ab')2 and Fc fragments were attached to oxygen-plasma-cleaned glass substrates using either microcontact printing (MCP) or physical adsorption during bath application from dilute solutions. Fluorescently labeled secondary IgGs were then bound to surface-immobilized IgG, and the relative surface coverage was determined by measuring the fluorescence intensity. Results indicated that the surface coverage of IgG increased with increasing protein solution concentration for both MCP and bath-applied IgG and that a greater concentration of IgG was transferred to a glass substrate using MCP than during physisorption during bath applications. Scanning force microscopy (SFM) showed that patterned MCP IgG monolayers were 5 nm in height, indicating that IgG molecules lie flat on the substrate. After incubation with a secondary IgG, the overall line thickness increased to around 15 nm, indicating that the secondary IgG was in a more vertical orientation with respect to the substrate. The surface roughness of these MCP patterned IgG bilayers as measured by SFM was observed to increase with increasing surface coverage. Physisorption of IgG to both unmodified patterned polydimethylsiloxane (PDMS) stamps and plasma-cleaned glass substrates was modeled by Langmuir adsorption kinetics yielding IgG binding constants of K(MCP) = 1.7(2) x 10(7) M(-1) and K(bath) = 7.8(7) x 10(5) M(-1), respectively. MCP experiments involving primary F(ab')2 and Fc fragments incubated in fluorescently labeled fragment-specific secondary IgGs were carried out to test for the function and orientation of IgG. Finally, possible origins of MCP stamping defects such as pits, pull outs, droplets, and reverse protein transfer are discussed.

  1. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  2. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  3. Fluorescent Random Amplified Microsatellites (F-RAMS) analysis of mushrooms as a forensic investigative tool

    Czech Academy of Sciences Publication Activity Database

    Kallifatidis, B.; Borovička, Jan; Stránská, J.; Drábek, J.; Mills, D. K.

    2014-01-01

    Roč. 9, MAR (2014), s. 25-32 ISSN 1872-4973 Institutional support: RVO:61389005 Keywords : random amplified microsatellites * hallucinogenic mashrooms * DNA profiling Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.604, year: 2014

  4. Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

    Science.gov (United States)

    Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

    2006-07-01

    The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

  5. KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Emma Suryati

    2013-03-01

    Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

  6. Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Brouat, C; McKey, D; Douzery, E J P

    2004-05-01

    Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

  7. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  8. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  9. Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

    Science.gov (United States)

    Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

    2000-01-01

    Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

  10. High-efficiency electroluminescence and amplified spontaneous emission from a thermally activated delayed fluorescent near-infrared emitter

    Science.gov (United States)

    Kim, Dae-Hyeon; D'Aléo, Anthony; Chen, Xian-Kai; Sandanayaka, Atula D. S.; Yao, Dandan; Zhao, Li; Komino, Takeshi; Zaborova, Elena; Canard, Gabriel; Tsuchiya, Youichi; Choi, Eunyoung; Wu, Jeong Weon; Fages, Frédéric; Brédas, Jean-Luc; Ribierre, Jean-Charles; Adachi, Chihaya

    2018-02-01

    Near-infrared organic light-emitting diodes and semiconductor lasers could benefit a variety of applications including night-vision displays, sensors and information-secured displays. Organic dyes can generate electroluminescence efficiently at visible wavelengths, but organic light-emitting diodes are still underperforming in the near-infrared region. Here, we report thermally activated delayed fluorescent organic light-emitting diodes that operate at near-infrared wavelengths with a maximum external quantum efficiency of nearly 10% using a boron difluoride curcuminoid derivative. As well as an effective upconversion from triplet to singlet excited states due to the non-adiabatic coupling effect, this donor-acceptor-donor compound also exhibits efficient amplified spontaneous emission. By controlling the polarity of the active medium, the maximum emission wavelength of the electroluminescence spectrum can be tuned from 700 to 780 nm. This study represents an important advance in near-infrared organic light-emitting diodes and the design of alternative molecular architectures for photonic applications based on thermally activated delayed fluorescence.

  11. Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2009-05-01

    Full Text Available Abstract Background Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Results Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. Conclusion We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology.

  12. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  13. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  14. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  15. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  16. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  17. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  18. A high degree of genetic diversity is revealed in Isatis spp. (dyer's woad) by amplified fragment length polymorphism (AFLP).

    Science.gov (United States)

    Gilbert (nee Stoker), G.; Garton, S.; Karam, A.; Arnold, M.; Karp, A.; Edwards, J.; Cooke, T.; Barker, A.

    2002-05-01

    Genetic diversity in 38 genotypes, representing 28 individual genotypes from five landraces of Isatis tinctoria (three German: Tubingen, Potsdam and Erfurt, one Swiss and one English), five genotypes of Isatis indigotica (Chinese woad) and five genotypes of Isatis glauca, were investigated using AFLP analysis. Five primer combinations detected a total of 502 fragments of which 436 (86.9%) were polymorphic. The level of polymorphism recorded within each species was 29.8, 86.9 and 35.8% for I. indigotica, I. tinctoria and I. glauca, respectively. Clearly, genetic diversity within I. tinctoria was greater than that observed in I. indigotica or I. glauca. Cluster analyses of the AFLP data using UPGMA and PCO revealed the complete separation of the genotypes of each species into distinct groups. I. indigotica separated as an entirely independent group, whereas I. glauca formed a separate cluster within the I. tinctoria group. Indeed, I. tinctoria and I. glauca are more closely related to each other than either is to I. indigotica. In addition, the genotypes of each landrace, apart from one from the English group, were clearly discriminated. However, the anomalous genotype did associate with the rest of its group when it was linked with the Erfurt group. These results provide new and useful information about the make-up of the Isatis genome, which has not previously been evaluated. They will be useful in the selection of plant material for variety development and conservation of the gene-pool.

  19. Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

    OpenAIRE

    Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

    2001-01-01

    Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

  20. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  1. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  2. NONINVASIVE OPTICAL IMAGING OF STAPHYLOCOCCUS AUREUS INFECTION IN VIVO USING AN ANTIMICROBIAL PEPTIDE FRAGMENT BASED NEAR-INFRARED FLUORESCENT PROBES

    Directory of Open Access Journals (Sweden)

    CUICUI LIU

    2013-07-01

    Full Text Available The diagnosis of bacterial infections remains a major challenge in medicine. Optical imaging of bacterial infection in living animals is usually conducted with genetic reporters such as light-emitting enzymes or fluorescent proteins. However, there are many circumstances where genetic reporters are not applicable, and there is an urgent need for exogenous synthetic probes that can selectively target bacteria. Optical imaging of bacteria in vivo is much less developed than methods such as radioimaging and MRI. Furthermore near-infrared (NIR dyes with emission wavelengths in the region of 650–900 nm can propagate through two or more centimeters of tissue and may enable deeper tissue imaging if sensitive detection techniques are employed. Here we constructed an antimicrobial peptide fragment UBI29-41-based near-infrared fluorescent imaging probe. The probe is composed of UBI29-41 conjugated to a near infrared dye ICG-Der-02. UBI29-41 is a cationic antimicrobial peptide that targets the anionic surfaces of bacterial cells. The probe allows detection of Staphylococcus aureus infection (5 × 107 cells in a mouse local infection model using whole animal near-infrared fluorescence imaging. Furthermore, we demonstrate that the UBI29-41-based imaging probe can selectively accumulate within bacteria. The significantly higher accumulation in bacterial infection suggests that UBI29-41-based imaging probe may be a promising imaging agent to detect bacterial infections.

  3. An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

    Science.gov (United States)

    Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

    2013-04-15

    An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  5. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  6. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    Science.gov (United States)

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  7. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  8. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  9. Chemical characterization of archaeological ceramics fragments by X-ray (μ-XRF) micro fluorescence

    International Nuclear Information System (INIS)

    Silva, Richard Maximiliano da Cunha e; Nascimento Filho, Virgilio Franco do; Appoloni, Carlos Roberto; Perez, Carlos Alberto

    2002-01-01

    The concentrations of the inorganic chemical elements presents in archaeological ceramic samples and clay samples allows the study about the clay sources determination used in the ceramic production. The analyzed samples are fragments of Brazilian indigenous ceramic, found in the area of the city of Londrina, North of Parana, and they belong to the archaeological collection of the 'Padre Carlos Weiss' Historical Museum, of the State University of Londrina. The determination of the chemical elements in these fragments was performed by energy dispersive X-ray microfluorescence (μ-XRF), for being not destructive and multielementar. The analytic technique allowed the identification of the K, Ca, Ti, Mn, Fe minority elements, and the Cr, Ni, Cu, Zn and Rb trace elements. The cluster analysis for the method of the medium grouping was used, and it was obtained two different groups, taking to conclude that indigenous Tupiguaranis used two clay sources in the making of its ceramic. (author)

  10. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  11. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  12. Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bergmans, A

    2002-01-01

    The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

  13. A novel, simple and efficient dye laser with low amplified spontaneous emission background for analytical fluorescence and ionization spectroscopy

    International Nuclear Information System (INIS)

    Matveev, Oleg I.; Omenetto, Nicolo'

    1995-01-01

    A new, simple, compact and efficient, grazing- incidence type of dye laser is suggested which has a low level of Amplified Spontaneous Emission. By using a Coumarin dye (LD 5000) pumped with a 20 mJ XeCl excimer laser, and a diffraction grating with 3000 grooves/mm, an efficiency of 11%, a spectral bandwidth of 0.6 cm -1 and a tuning range from 458 to 517 nm have been obtained

  14. Laser-induced-fluorescence studies of fragment ions: CH+ and CD+

    International Nuclear Information System (INIS)

    O'Keefe, A.

    1981-08-01

    The dynamics of ion-molecule interactions within a mass selective rf quadrupole ion trap are studied for several ion-molecule systems. Laser induced fluorescence is used as a probe of the internal energy distributions of molecular ions under collision free conditions and under controlled collision conditions. The effects of collisions at near thermal energies (0.3 to 0.5 eV) are easily understood in terms of processes such as charge transfer and other energy transfer mechanisms. The A 1 PI - X 1 Σ + system of CH + and CD + has been examined under collision free conditions. The ions were produced from methane through electron impact ionization/dissociation. The observed energy distributions reflect the dynamical partitioning of dissociation exothermicity, excepting short lived electronic states. Many new transitions belonging to this electronic system have been observed and a reliable vibrational frequency for the X 1 Σ + state has been obtained. The radiative lifetimes of CH + and CD + A 1 PI(v = 0) states have been measured and a revised oscillator strength for the A-X transition has been derived from this data

  15. Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

    2015-12-14

    Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

  16. Fiber Amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten

    2017-01-01

    The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

  17. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  18. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  19. Novel fluorescent sequence-related amplified polymorphism(FSRAP markers for the construction of a genetic linkage map of wheat(Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Zhao Lingbo

    2017-01-01

    Full Text Available Novel fluorescent sequence-related amplified polymorphism (FSRAP markers were developed based on the SRAP molecular marker. Then, the FSRAP markers were used to construct the genetic map of a wheat (Triticum aestivumL. recombinant inbred line population derived from a Chuanmai 42×Chuannong 16 cross. Reproducibility and polymorphism tests indicated that the FSRAP markers have repeatability and better reflect the polymorphism of wheat varieties compared with SRAP markers. A total of 430 polymorphic loci between Chuanmai 42 and Chuannong 16 were detected with 189 FSRAP primer combinations. A total of 281 FSARP markers and 39 SSR markers re classified into 20 linkage groups. The maps spanned a total length of 2499.3cM with an average distance of 7.81cM between markers. A total of 201 markers were mapped on the B genome and covered a distance of 1013cM. On the A genome, 84 markers were mapped and covered a distance of 849.6cM. On the D genome, however, only 35 markers were mapped and covered a distance of 636.7cM. No FSRAP markers were distributed on the 7D chromosome. The results of the present study revealed that the novel FSRAP markers can be used to generate dense, uniform genetic maps of wheat.

  20. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  1. Operation amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2008-01-01

    To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

  2. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  3. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  4. Stress-induced filament fragmentation of Calothrix elenkiniiI (Cyanobacteria) is facilitated by death of high-fluorescence cells

    Czech Academy of Sciences Publication Activity Database

    Adamec, František; Kaftan, David; Nedbal, Ladislav

    2005-01-01

    Roč. 41, - (2005), s. 835-839 ISSN 0022-3646 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z6087904 Keywords : cyanobacteria * high-fluorescence cells Subject RIV: EE - Microbiology, Virology Impact factor: 2.502, year: 2005

  5. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  6. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2011-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

  7. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, S.; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

  8. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  9. Amplifier Distortion

    Science.gov (United States)

    Keeports, David

    2006-12-01

    By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

  10. Probing the binding of Cu(2+) ions to a fragment of the Aβ(1-42) polypeptide using fluorescence spectroscopy, isothermal titration calorimetry and molecular dynamics simulations.

    Science.gov (United States)

    Makowska, Joanna; Żamojć, Krzysztof; Wyrzykowski, Dariusz; Żmudzińska, Wioletta; Uber, Dorota; Wierzbicka, Małgorzata; Wiczk, Wiesław; Chmurzyński, Lech

    2016-09-01

    Steady-state and time-resolved fluorescence quenching measurements supported by isothermal titration calorimetry (ITC) and molecular dynamics simulations (MD), with the NMR-derived restraints, were used to investigate the interactions of Cu(2+) ions with a fragment of the Aβ(1-42) polypeptide, Aβ(5-16) with the following sequence: Ac-Arg-His-Asp-Ser-Gly-Tyr-Glu-Val-His-His-Gln-Lys-NH2, denoted as HZ1. The studies presented in this paper, when compared with our previous results (Makowska et al., Spectrochim. Acta A 153: 451-456), show that the affinity of the peptide to metal ions is conformation-dependent. All the measurements were carried out in 20mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution, pH6.0. The Stern-Volmer equations, along with spectroscopic observations, were used to determine the quenching and binding parameters. The obtained results unequivocally suggest that Cu(2+) ions quench the fluorescence of HZ1 only through a static quenching mechanism, in contrast to the fragment from the N-terminal part of the FPB28 protein, with sequence Ac-Tyr-Lys-Thr-Ala-Asp-Gly-Lys-Thr-Tyr- NH2 (D9) and its derivative with a single point mutation: Ac-Tyr-Lys-Thr-Ala-Asn-Gly-Lys-Thr-Tyr- NH2 (D9_M), where dynamic quenching occurred. The thermodynamic parameters (ΔITCH, ΔITCS) for the interactions between Cu(2+) ions and the HZ1 peptide were determined from the calorimetric data. The conditional thermodynamic parameters suggest that, under the experimental conditions, the formation of the Cu(2+)-HZ1 complex is both an enthalpy and entropy driven process. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Fragments analysis of Marajoara pubic covers using a portable system of X-ray fluorescence and multivariate statistics

    International Nuclear Information System (INIS)

    Freitas, Renato; Rabello, Angela; Lima, Tania

    2011-01-01

    Full text: In this work it was characterized the elemental composition of 102 fragments of Marajoara pubic covers, belonging to the National Museum collection, using EDXRF and multivariate statistics analysis. The objective was to identify possible groups of samples that presented similar characteristics. This information will be useful in the development of a systematic classification of these artifacts. Provenance studies of ancient ceramics are based on the assumption that pottery produced from a specific clay will present a similar chemical composition, which will distinguish them from pottery produced from a different clay. In this way, the pottery is assigned to particular production groups, which are then correlated with their respective origins. EDXRF measurements were carried out with a portable system, developed in the Nuclear Instrumentation Laboratory, consisting of an X-ray tube Oxford TF3005 with tungsten (W) anode, operating at 25 kV and 100 μA, and a Si-PIN XR-100CR detector from Amptek. In each one of the 102 fragments, six points were analyzed (three in the front part and three in the reverse) with an acquisition time of 600 s and a beam collimation of 2 mm. The spectra were processed and analyzed using the software QXAS-AXIL from IAEA. PCA was applied to the XRF results revealing a clear cluster separation to the samples. (author)

  12. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  13. MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

    Science.gov (United States)

    Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

    2012-05-01

    MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

  14. Amplified Policymaking

    Science.gov (United States)

    Prince, Katherine; Woempner, Carolyn

    2010-01-01

    This brief examines the policy implications of two drivers of change presented in the "2020 Forecast: Creating the Future of Learning"-- Pattern Recognition and Amplified Organization. These drivers point toward a series of cultural shifts and illuminate how we are developing new ways of organizing, constructing, and managing knowledge.…

  15. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  16. Amplified fragment length polymorphism (AFLP) and genealogy ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

  17. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  18. Detection of land mines by amplified fluorescence quenching of polymer films: a man-portable chemical sniffer for detection of ultratrace concentrations of explosives emanating from land mines

    Science.gov (United States)

    la Grone, Marcus J.; Cumming, Colin J.; Fisher, Mark E.; Fox, Michael J.; Jacob, Sheena; Reust, Dennis; Rockley, Mark G.; Towers, Eric

    2000-08-01

    The explosive charge within a landmine is the source for a mixture of chemical vapors that form a distinctive 'chemical signature' indicative of a landmine. The concentration of these compounds in the air over landmines is extremely low, well below the minimum detection limits of most field- portable chemical sensors. Described in this paper is a man- portable landmine detection system that has for the first time demonstrated the ability to detect landmines by direct sensing of the vapors of signature compounds in the air over landmines. The system utilizes fluorescent polymers developed by collaborators at the MIT. The sensor can detect ultra-trace concentrations of TNT vapor and other nitroaromatic compounds found in many landmine explosives. Thin films of the polymers exhibit intense fluorescence, but when exposed to vapors of nitroaromatic explosives the intensity of the light emitted from the films decreases. A single molecule of TNT binding to a receptor site quenches the fluorescence from many polymer repeat units, increasing the sensitivity by orders of magnitude. A sensor prototype has been develop that response in near real-time to low femtogram quantities of nitroaromatic explosives. The prototype is portable, lightweight, has low power consumption, is simple to operate, and is relatively inexpensive. Simultaneous field testing of the sensor and experienced canine landmine detection teams was recently completed. Although the testing was limited in scope, the performance of the senor met or exceeded that of the canines against buried landmines.

  19. Construction of a high-density genetic map using specific length amplified fragment markers and identification of a quantitative trait locus for anthracnose resistance in walnut (Juglans regia L.).

    Science.gov (United States)

    Zhu, Yufeng; Yin, Yanfei; Yang, Keqiang; Li, Jihong; Sang, Yalin; Huang, Long; Fan, Shu

    2015-08-18

    Walnut (Juglans regia, 2n = 32, approximately 606 Mb per 1C genome) is an economically important tree crop. Resistance to anthracnose, caused by Colletotrichum gloeosporioides, is a major objective of walnut genetic improvement in China. The recently developed specific length amplified fragment sequencing (SLAF-seq) is an efficient strategy that can obtain large numbers of markers with sufficient sequence information to construct high-density genetic maps and permits detection of quantitative trait loci (QTLs) for molecular breeding. SLAF-seq generated 161.64 M paired-end reads. 153,820 SLAF markers were obtained, of which 49,174 were polymorphic. 13,635 polymorphic markers were sorted into five segregation types and 2,577 markers of them were used to construct genetic linkage maps: 2,395 of these fell into 16 linkage groups (LGs) for the female map, 448 markers for the male map, and 2,577 markers for the integrated map. Taking into account the size of all LGs, the marker coverage was 2,664.36 cM for the female map, 1,305.58 cM for the male map, and 2,457.82 cM for the integrated map. The average intervals between two adjacent mapped markers were 1.11 cM, 2.91 cM and 0.95 cM for three maps, respectively. 'SNP_only' markers accounted for 89.25% of the markers on the integrated map. Mapping markers contained 5,043 single nucleotide polymorphisms (SNPs) loci, which corresponded to two SNP loci per SLAF marker. According to the integrated map, we used interval mapping (Logarithm of odds, LOD > 3.0) to detect our quantitative trait. One QTL was detected for anthracnose resistance. The interval of this QTL ranged from 165.51 cM to 176.33 cM on LG14, and ten markers in this interval that were above the threshold value were considered to be linked markers to the anthracnose resistance trait. The phenotypic variance explained by each marker ranged from 16.2 to 19.9%, and their LOD scores varied from 3.22 to 4.04. High-density genetic maps for walnut containing 16

  20. Genetic diversity of nifH gene sequences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing gradiënt gel electrophoresis of PCR-amplified gene fragments

    NARCIS (Netherlands)

    Rosado, A.S.; Duarte, G.F.; Seldin, L.; Elsas, van J.D.

    1998-01-01

    The diversity of dinitrogenase reductase gene (nifH) fragments in Paenibacillus azotofixans strains was investigated by using molecular methods. The partial nifH gene sequences of eight P. azotofixans strains, as well as one strain each of the close relatives Paenibacillus durum, Paenibacillus

  1. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  2. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  4. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS)

    Science.gov (United States)

    Abraham, Jerrold L.; Chandra, Subhash; Agrawal, Anoop

    2014-01-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease (CBD) from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water, and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry (SIMS) instrument, CAMECA IMS 3f SIMS ion microscope. The beryllium content of shrapnel (~100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (~25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y-and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (~0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either present in an

  5. Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS).

    Science.gov (United States)

    Abraham, J L; Chandra, S; Agrawal, A

    2014-11-01

    Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry instrument, CAMECA IMS 3f secondary ion mass spectrometry ion microscope. The beryllium content of shrapnel (∼100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (∼25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y- and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (∼0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either

  6. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    Suarez Canner, E.

    1996-01-01

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  7. Portable musical instrument amplifier

    Science.gov (United States)

    Christian, David E.

    1990-07-24

    The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

  8. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  9. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  10. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  11. Oscillators and operational amplifiers

    OpenAIRE

    Lindberg, Erik

    2005-01-01

    A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

  12. FLUIDIC AC AMPLIFIERS.

    Science.gov (United States)

    Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

  13. Antares laser power amplifier

    International Nuclear Information System (INIS)

    Stine, R.D.; Ross, G.F.; Silvernail, C.

    1979-01-01

    The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

  14. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  15. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  16. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  17. Auto-Zero Differential Amplifier

    Science.gov (United States)

    Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

    2017-01-01

    An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

  18. X-ray image amplifying tube

    International Nuclear Information System (INIS)

    1977-01-01

    The photo electrons from the picture on the fluorescent input screen are amplified by an electron optical system and produce an intensified image on the output screen. This can be photographed and shown on a TV screen. The effects of stray magnetic fields are reduced by covering the input screen with a grating made of strips of ferromagnetic material such as μ metal. (T.S.E.T.)

  19. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  20. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  1. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  2. Study of the transverse lasing in big size crystals of Ti:Sa. Application to the design of the peta-watt high-energy amplifier of the pilot laser of the LASERIX facility; Etude de l'amplification parasite transverse de la fluorescence dans les cristaux de Ti:Sa de grandes dimensions. Application a la realisation de l'amplificateur petawatt haute energie du laser pilote de la station LASERIX

    Energy Technology Data Exchange (ETDEWEB)

    Ple, F

    2007-11-15

    This manuscript presents experimental and theoretical works accomplished for the development of the LASERIX laser driver. The main goal of this thesis work was to design a high energy and high repetition rate titanium doped sapphire amplifier (Ti:Sa) allowing to reach an energy of 40 J at a repetition rate of 0.1 Hz before compression. After a general description of amplification in chirped pulse amplification Ti:Sa laser systems (Chapter 1), I present the two particular developments we made during this work for high energy amplification (Chapter 2). First, the spatial shaping and the homogenization based on micro-lens array (MLA) systems of the eight Nd-Glass pump lasers dedicated to the pumping of the last booster amplifier.Secondly, the suppression of parasitic effects due to transverse amplification of the fluorescence in the last booster amplifier Ti:Sa crystal. The developments performed as part of this thesis allowed us to amplify an impulsion of 2 J of energy up to 39 J in a crystal of 10 cm diameter. I also present the simulation program I developed (Chapter 3) in order to simulate the three dimensional parasitic lasing effect and fluorescence transverse amplification phenomena in large Ti:Sa crystals. A parametric study of these parasitic effects is also presented. Finally, the last part of this manuscript (Chapter 4) gives prospects of this work as part of the large future ELI and ILE projects. (author)

  3. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  4. Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    Keywords: AFLP, wheat, stem rust, genetic diversity, population differentiation ... the method described by Vos et al (1995), with little modification, i.e., 1 µl genomic ..... Agriculture, Veterinary Science, Nutrition and Natural Resources, 1, 1- 13.

  5. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... 2University School of Environment Management, Guru Gobind Singh Indraprastha University, New Delhi-100 075, India. Accepted 15 April .... Technologies following principle developed by Zabeau and Vos. (1993). Genomic ...

  6. Amplified fragment length polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...

  7. Electrospun amplified fiber optics.

    Science.gov (United States)

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-03-11

    All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

  8. Generation and characterization of a stable red fluorescent ...

    African Journals Online (AJOL)

    An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...

  9. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  10. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  11. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  12. Fast pulse amplifier

    International Nuclear Information System (INIS)

    Lepetit, J.; Poussier, E.

    1984-01-01

    This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

  13. Fast logarithmic amplifier

    International Nuclear Information System (INIS)

    Tai, I.; Hasegawa, K.

    1975-01-01

    This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

  14. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  15. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  16. Flashlamp excited fluid laser amplified

    International Nuclear Information System (INIS)

    1976-01-01

    The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

  17. Improved-Bandwidth Transimpedance Amplifier

    Science.gov (United States)

    Chapsky, Jacob

    2009-01-01

    The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

  18. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  19. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  20. Wideband amplifier design

    CERN Document Server

    Hollister, Allen L

    2007-01-01

    In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

  1. Building valve amplifiers

    CERN Document Server

    Jones, Morgan

    2013-01-01

    Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

  2. Superconducting digital logic amplifier

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper describes a superconducting digital logic amplifier for interfacing between a Josephson junction logic circuit having output current and a higher voltage semiconductor circuit input. The amplifier comprising: an input terminal for connection to a; an output terminal for connection to a semiconductor circuit input; an input, lower critical current, Josephson junction having first and second terminals; a first series string of at least three lower critical current Josephson junctions. The first series string being connected to the first terminal of the input Josephson junction such that the first series string is in series with the input Josephson junction to provide a series combination. The input terminal being connected to the first terminal of the input Josephson junction, and with the critical current of the lower critical current Josephson junctions of the input Josephson junction and the first series Josephson junctions being less than the output current of the low voltage Josephson junction circuit; a second series string of at least four higher critical current Josephson junctions. The second string being connected in parallel with the series combination to provide parallel strings having an upper common connection and a lower common connection. The lower common connection being connected to the second terminal of the input Josephson junction and the upper common connection being connected to the output terminal; and a pulsed DC current source connected the parallel strings at the upper common connection. The DC current source having a current at least equal to the critical current of the higher critical current Josephson junctions

  3. Cascade energy amplifier

    International Nuclear Information System (INIS)

    Barzilov, A.P.; Gulevich, A.V.; Kukharchuk, O.F.

    2000-01-01

    The technical problem of long-life fission product and minor actinide incineration and production of plutonium fuel in the prospective nuclear systems will arise at significant scales of nuclear power industry development. Subcritical nuclear reactors driven by extemal neutron sources (energy amplifiers) are considered as incinerators of toxicity of complete nuclear industry. In the frames of this concept, the subcritical reactor part consisting of two coupled blanket regions (inner fast neutron spectrum core and outer thermal core) driven by extemal neutron source is discussed. Two types of source are studied: spallation target and 14-MeV fusion bum of micropellets. Liquid metal Pb-Bi is considered as target material and coolant of inner fast core. Thermal core is a heavy-water subcritical reactor of the Candu-type. The fast core is protected from thermal neutrons influence with the boron shield. All reactor technologies used in this concept are tested during years of operation and commercially available. Thus, the cascade energy amplifiers have a set of advantages in comparison with traditional concepts: in energy production, in transmutation efficiency, and in economics. (authors)

  4. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  5. Nanoscale electromechanical parametric amplifier

    Science.gov (United States)

    Aleman, Benjamin Jose; Zettl, Alexander

    2016-09-20

    This disclosure provides systems, methods, and apparatus related to a parametric amplifier. In one aspect, a device includes an electron source electrode, a counter electrode, and a pumping electrode. The electron source electrode may include a conductive base and a flexible conductor. The flexible conductor may have a first end and a second end, with the second end of the flexible conductor being coupled to the conductive base. A cross-sectional dimension of the flexible conductor may be less than about 100 nanometers. The counter electrode may be disposed proximate the first end of the flexible conductor and spaced a first distance from the first end of the flexible conductor. The pumping electrode may be disposed proximate a length of the flexible conductor and spaced a second distance from the flexible conductor.

  6. Linear pulse amplifier

    International Nuclear Information System (INIS)

    Tjutju, R.L.

    1977-01-01

    Pulse amplifier is standard significant part of spectrometer. Apart from other type of amplification, it's a combination of amplification and pulse shaping. Because of its special purpose the device should fulfill the following : High resolution is desired to gain a high yield comparable to its actual state of condition. High signal to noise is desired to nhν resolution. High linearity to facilitate calibration. A good overload recovery, in order to the device will capable of analizing a low energy radiation which appear joinly on the high energy fields. Other expections of the device are its economical and practical use its extentive application. For that reason it's built on a standard NIM principle. Taking also into account the above mentioned considerations. High quality component parts are used throughout, while its availability in the domestic market is secured. (author)

  7. Use of single-enzyme amplified fragment length polymorphism for typing Clostridium perfringens isolated from diarrheic piglets Uso do polimorfismo do comprimento de fragmentos amplificados para tipagem de Clostridium perfringens isolados de suínos com diarréia

    Directory of Open Access Journals (Sweden)

    Luciane Tieko Shinya

    2006-09-01

    Full Text Available Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal to 0.97. Partial correlation between the origin of the isolates and groups was drawn, and correlation was possible in only 18.5% of the samples. Characterization of the strains in biotypes (A, B, C, D and E, production of beta-2 toxin and enterotoxin were performed by means of the polymerase chain reaction (PCR. Biotypes A, C and D were observed among the strains analyzed. All samples were positive for presence of the gene encoding beta-2 toxin and negative for the gene encoding enterotoxin. AFLP have shown to be a simple, fast, low cost method with high discriminative power and good reproducibility, presenting a great potential in epidemiological studies involving C. perfringens strains of animal origin.Clostridium perfringens é um importante agente infeccioso em medicina veterinária e humana. Em suínos, o agente é responsável pela enterite necrótica e enterotoxemia, caracterizadas por diarréia, perda de peso, atraso no desenvolvimento e morte. No presente estudo foi utilizado o polimorfismo do comprimento de fragmentos amplificados (AFLP, para caracterizar 54 isolados de C. perfringens obtidos de suínos com diarréia. A análise dos resultados do AFLP demonstrou 29 perfis distintos com índice discriminatório igual a 0,97. A correlação entre a origem dos isolados e os agrupamentos obtidos foi parcial, sendo apenas possível a correlação total de 18,5% das amostras estudadas. A caracterização das cepas em biotipos (A, B, C, D e E, produ

  8. Modeling of semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

    We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

  9. CERN: Energy amplifier

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Even under the heavy burden of responsibility as CERN's Director General from 1989-3 the fertile mind of Carlo Rubbia the scientist was never still. A long-time Rubbia 'hobby' has been the search for new sources of nuclear energy, exploiting knowledge and skills from high energy physics. An initial objective was to adopt heavy ion techniques to induce controlled thermonuclear fusion, but in 1994 this quest changed direction. Putting the problems of thermonuclear fusion aside, Rubbia began to explore an alternative route to energy production through controlled nuclear fission. The idea is to use a particle accelerator producing neutrons by spallation (interaction of particles with a target) to feed a fuel/moderator assembly where the neutrons multiply by fission chain reactions. If the energy liberated becomes substantially greater than that needed to drive the accelerator, the process has a net gain and becomes selfsupporting. Hence the name ''Energy Amplifier'' (EA). Similar systems for energy production or for nuclear waste incineration have been proposed at Los Alamos and in Japan and Russia, but appear to require the prior development of innovative linear accelerators. For Rubbia's Amplifier, the requisite accelerator is a reasonable extrapolation of an existing cyclotron such that at the Swiss Paul Scherrer Institute. Moreover, the EA would require fuel rods very similar to those of conventional reactors, rather than demand-ing new technology using liquid fuel loops (molten salts) with on-line separation of radioactive products. Unlike a reactor, the EA's fission reaction is not self-sustaining: it is sub-critical and needs a continuous supply of neutrons from the accelerator. This makes Chernobyl-type meltdowns unlikely: if the accelerator stops, the reaction stops too. Another major advantage is that the old dream of using thorium as a fuel is now made possible. Thorium is not itself fissile, but under neutron

  10. Millimeter-wave power amplifiers

    CERN Document Server

    du Preez, Jaco

    2017-01-01

    This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

  11. TRANSGENIC STRATEGY FOR IDENTIFYING SYNAPTIC CONNECTIONS IN MICE BY FLUORESCENCE COMPLEMENTATION (GRASP

    Directory of Open Access Journals (Sweden)

    Masahito eYamagata

    2012-02-01

    Full Text Available In the "GFP reconstitution across synaptic partners" (GRASP method, non-fluorescent fragments of GFP are expressed in two different neurons; the fragments self-assemble at synapses between the two to form a fluorophore. GRASP has proven useful for light microscopic identification of synapses in two invertebrate species, Caenorhabditis elegans and Drosophila melanogaster, but has not yet been applied to vertebrates. Here, we describe GRASP constructs that function in mammalian cells and implement a transgenic strategy in which a Cre-dependent gene switch leads to expression of the two fragments in mutually exclusive neuronal subsets in mice. Using a transgenic line that expresses Cre selectively in rod photoreceptors, we demonstrate labeling of synapses in the outer plexiform layer of the retina. Labeling is specific, in that synapses made by rods remain labeled for at least 6 months whereas nearby synapses made by intercalated cone photoreceptors on many of the same interneurons remain unlabeled. We also generated antisera that label reconstituted GFP but neither fragment in order to amplify the GRASP signal and thereby increase the sensitivity of the method.

  12. Small signal microwave amplifier design

    CERN Document Server

    Grosch, Theodore

    2000-01-01

    This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

  13. Final amplifier design and mercury

    International Nuclear Information System (INIS)

    Rose, E.A.; Hanson, D.E.

    1991-01-01

    The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

  14. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  15. New Packaging for Amplifier Slabs

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Thorsness, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Suratwala, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Steele, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rogowski, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-03-18

    The following memo provides a discussion and detailed procedure for a new finished amplifier slab shipping and storage container. The new package is designed to maintain an environment of <5% RH to minimize weathering.

  16. Operational amplifiers theory and design

    CERN Document Server

    Huijsing, Johan

    2017-01-01

    This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

  17. Enhanced performance CCD output amplifier

    Science.gov (United States)

    Dunham, Mark E.; Morley, David W.

    1996-01-01

    A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

  18. Fluorescence spectroscopy

    DEFF Research Database (Denmark)

    Bagatolli, Luis

    2016-01-01

    Fluorescence spectroscopy is a powerful experimental tool used by scientists from many disciplines. During the last decades there have been important developments on distinct fluorescence methods, particularly those related to the study of biological phenomena. This chapter discusses the foundati......Fluorescence spectroscopy is a powerful experimental tool used by scientists from many disciplines. During the last decades there have been important developments on distinct fluorescence methods, particularly those related to the study of biological phenomena. This chapter discusses...

  19. Scanning fluorescence detector for high-throughput DNA genotyping

    Science.gov (United States)

    Rusch, Terry L.; Petsinger, Jeremy; Christensen, Carl; Vaske, David A.; Brumley, Robert L., Jr.; Luckey, John A.; Weber, James L.

    1996-04-01

    A new scanning fluorescence detector (SCAFUD) was developed for high-throughput genotyping of short tandem repeat polymorphisms (STRPs). Fluorescent dyes are incorporated into relatively short DNA fragments via polymerase chain reaction (PCR) and are separated by electrophoresis in short, wide polyacrylamide gels (144 lanes with well to read distances of 14 cm). Excitation light from an argon laser with primary lines at 488 and 514 nm is introduced into the gel through a fiber optic cable, dichroic mirror, and 40X microscope objective. Emitted fluorescent light is collected confocally through a second fiber. The confocal head is translated across the bottom of the gel at 0.5 Hz. The detection unit utilizes dichroic mirrors and band pass filters to direct light with 10 - 20 nm bandwidths to four photomultiplier tubes (PMTs). PMT signals are independently amplified with variable gain and then sampled at a rate of 2500 points per scan using a computer based A/D board. LabView software (National Instruments) is used for instrument operation. Currently, three fluorescent dyes (Fam, Hex and Rox) are simultaneously detected with peak detection wavelengths of 543, 567, and 613 nm, respectively. The detection limit for fluorescein-labeled primers is about 100 attomoles. Planned SCAFUD upgrades include rearrangement of laser head geometry, use of additional excitation lasers for simultaneous detection of more dyes, and the use of detector arrays instead of individual PMTs. Extensive software has been written for automatic analysis of SCAFUD images. The software enables background subtraction, band identification, multiple- dye signal resolution, lane finding, band sizing and allele calling. Whole genome screens are currently underway to search for loci influencing such complex diseases as diabetes, asthma, and hypertension. Seven production SCAFUDs are currently in operation. Genotyping output for the coming year is projected to be about one million total genotypes (DNA

  20. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  1. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  2. Spectroscopic amplifier for pin diode

    International Nuclear Information System (INIS)

    Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

    2014-10-01

    The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

  3. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  4. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  5. Dielectric waveguide amplifiers and lasers

    NARCIS (Netherlands)

    Pollnau, Markus

    The performance of semiconductor amplifiers and lasers has made them the preferred choice for optical gain on a micro-chip. In the past few years, we have demonstrated that also rare-earth-ion-doped dielectric waveguides show remarkable performance, ranging from a small-signal gain per unit length

  6. CMOS Current-mode Operational Amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1992-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  7. A CMOS current-mode operational amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1993-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  8. Amplified spontaneous emissions in a high-gain laser amplifier

    International Nuclear Information System (INIS)

    Osada, Hidenori; Gamo, Hideya.

    1978-01-01

    The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

  9. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  10. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

  11. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  12. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  13. Analog circuit design designing high performance amplifiers

    CERN Document Server

    Feucht, Dennis

    2010-01-01

    The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.

  14. Higher order mode optical fiber Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

    2016-01-01

    We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

  15. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    Science.gov (United States)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  16. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  17. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  18. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  19. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  20. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  1. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  2. SPS RF System Amplifier plant

    CERN Multimedia

    1977-01-01

    The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

  3. Challenges in higher order mode Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

    2015-01-01

    A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

  4. European Research on THz Vacuum Amplifiers

    DEFF Research Database (Denmark)

    Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

    2010-01-01

    The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

  5. Integrated amplifying circuit with MOS transistors

    Energy Technology Data Exchange (ETDEWEB)

    Baylac, B; Merckel, G; Meunier, P

    1974-01-25

    The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

  6. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  7. NASA developments in solid state power amplifiers

    Science.gov (United States)

    Leonard, Regis F.

    1990-01-01

    Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

  8. A pulse amplifier for nuclear instrumentation

    International Nuclear Information System (INIS)

    Martin, D.; Cliff, P.

    1987-01-01

    A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

  9. Remote Acquisition Amplifier For 50-Ohm Cable

    Science.gov (United States)

    Amador, Jose J.

    1995-01-01

    Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

  10. Protein subcellular localization assays using split fluorescent proteins

    Science.gov (United States)

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2009-09-08

    The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

  11. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2003-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

  12. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

    2002-01-01

    -power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

  13. CMOS Current-mode Operational Amplifier

    OpenAIRE

    Kaulberg, Thomas

    1992-01-01

    A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

  14. NIF/LMJ prototype amplifier mechanical design

    International Nuclear Information System (INIS)

    Horvath, J.

    1996-10-01

    Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

  15. HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

    International Nuclear Information System (INIS)

    2005-01-01

    Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

  16. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  17. Audio power amplifier design handbook

    CERN Document Server

    Self, Douglas

    2013-01-01

    This book is essential for audio power amplifier designers and engineers for one simple reason...it enables you as a professional to develop reliable, high-performance circuits. The Author Douglas Self covers the major issues of distortion and linearity, power supplies, overload, DC-protection and reactive loading. He also tackles unusual forms of compensation and distortion produced by capacitors and fuses. This completely updated fifth edition includes four NEW chapters including one on The XD Principle, invented by the author, and used by Cambridge Audio. Cro

  18. Cathode-follower power amplifier

    International Nuclear Information System (INIS)

    Giordano, S.; Puglisi, M.

    1983-01-01

    In circular accelerators and particularly in storage rings it is essential that the total impedance, as seen by the beam, be kept below some critical value. A model of the accelerating system was built using a single-ended cathode-follower amplifier driving a ferrite-loaded cavity. The system operated at 234.5 kHz with a peak output voltage of +-10 kV on the gap. The dynamic output impedance, as measured on the gap, was < 15 ohms

  19. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  20. Fluorescence microscopy.

    Science.gov (United States)

    Sanderson, Michael J; Smith, Ian; Parker, Ian; Bootman, Martin D

    2014-10-01

    Fluorescence microscopy is a major tool with which to monitor cell physiology. Although the concepts of fluorescence and its optical separation using filters remain similar, microscope design varies with the aim of increasing image contrast and spatial resolution. The basics of wide-field microscopy are outlined to emphasize the selection, advantages, and correct use of laser scanning confocal microscopy, two-photon microscopy, scanning disk confocal microscopy, total internal reflection, and super-resolution microscopy. In addition, the principles of how these microscopes form images are reviewed to appreciate their capabilities, limitations, and constraints for operation. © 2014 Cold Spring Harbor Laboratory Press.

  1. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  2. Gain measurement in a CW medium-power diode pumped Nd:YAG laser amplifier by ASE analysis

    International Nuclear Information System (INIS)

    Razzaghi, D; Hajiesmaeilbaigi, F; Ruzbehani, M

    2014-01-01

    Using the relation between amplified spontaneous emission intensity and gain, a set of formulas is derived for gain evaluation by comparing fluorescence yield in two different lengths of the active medium. Experimental measurements are carried out and gain is calculated by solving the derived formula. For comparison, measurements are also carried out using the probe beam method, which shows good agreement between the two methods in a typical CW medium-power diode pumped Nd:YAG amplifier. (paper)

  3. PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.

    2013-01-01

    An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target

  4. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  6. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  7. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  8. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  9. A system for biasing a differential amplifier

    International Nuclear Information System (INIS)

    Barbier, Daniel; Ittel, J.M.; Poujois, Robert

    1975-01-01

    This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

  10. Enhanced Gain in Photonic Crystal Amplifiers

    DEFF Research Database (Denmark)

    Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

    2012-01-01

    We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

  11. Very broad bandwidth klystron amplifiers

    Science.gov (United States)

    Faillon, G.; Egloff, G.; Farvet, C.

    Large surveillance radars use transmitters at peak power levels of around one MW and average levels of a few kW, and possibly several tens of kW, in S band, or even C band. In general, the amplification stage of these transmitters is a microwave power tube, frequently a klystron. Although designers often turn to klystrons because of their good peak and average power capabilities, they still see them as narrow band amplifiers, undoubtedly because of their resonant cavities which, at first sight, would seem highly selective. But, with the progress of recent years, it has now become quite feasible to use these tubes in installations requiring bandwidths in excess of 10 - 12 percent, and even 15 percent, at 1 MW peak for example, in S-band.

  12. Hydraulically amplified PZT mems actuator

    Science.gov (United States)

    Miles, Robin R.

    2004-11-02

    A hydraulically amplified microelectromechanical systems actuator. A piece of piezoelectric material or stacked piezo bimorph is bonded or deposited as a thin film. The piece is operatively connected to a primary membrane. A reservoir is operatively connected to the primary membrane. The reservoir contains a fluid. A membrane is operatively connected to the reservoir. In operation, energizing the piezoelectric material causing the piezoelectric material to bow. Bowing of the piezoelectric material causes movement of the primary membrane. Movement of the primary membrane results in a force in being transmitted to the liquid in the reservoir. The force in the liquid causes movement of the membrane. Movement of the membrane results in an operating actuator.

  13. Transverse pumped laser amplifier architecture

    Science.gov (United States)

    Bayramian, Andrew James; Manes, Kenneth; Deri, Robert; Erlandson, Al; Caird, John; Spaeth, Mary

    2013-07-09

    An optical gain architecture includes a pump source and a pump aperture. The architecture also includes a gain region including a gain element operable to amplify light at a laser wavelength. The gain region is characterized by a first side intersecting an optical path, a second side opposing the first side, a third side adjacent the first and second sides, and a fourth side opposing the third side. The architecture further includes a dichroic section disposed between the pump aperture and the first side of the gain region. The dichroic section is characterized by low reflectance at a pump wavelength and high reflectance at the laser wavelength. The architecture additionally includes a first cladding section proximate to the third side of the gain region and a second cladding section proximate to the fourth side of the gain region.

  14. Design of an 1800nm Raman amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    2013-01-01

    We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

  15. Reflection amplifiers in self-regulated learning

    NARCIS (Netherlands)

    Verpoorten, Dominique

    2012-01-01

    Verpoorten, D. (2012). Reflection amplifiers in self-regulated learning. Doctoral thesis. November, 9, 2012, Heerlen, The Netherlands: Open Universiteit (CELSTEC). Datawyse / Universitaire Pers Maastricht.

  16. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

  17. Fragmentation of atomic systems

    International Nuclear Information System (INIS)

    Bohn, J.L.; Fano, U.

    1996-01-01

    We report recent progress toward a nonperturbative formulation of many-body quantum dynamics that treats all constituent particles on an equal footing. This formulation is capable of detailing the evolution of a system toward the diverse fragments into which it can break up. We illustrate the general concept with the simple example of the simultaneous excitation of both electrons in a helium atom. copyright 1996 The American Physical Society

  18. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  19. Hot nuclei and fragmentation

    International Nuclear Information System (INIS)

    Guerreau, D.

    1993-01-01

    A review is made of the present status concerning the production of nuclei above 5 MeV temperature. Considerable progress has been made recently on the understanding of the formation and the fate of such hot nuclei. It appears that the nucleus seems more stable against temperature than predicted by static calculations. However, the occurrence of multifragment production at high excitation energies is now well established. The various experimental features of the fragmentation process are discussed. (author) 59 refs., 12 figs

  20. Excited nuclei fragmentation

    International Nuclear Information System (INIS)

    Ngo, C.

    1986-11-01

    Experimental indications leading to the thought of a very excited nucleus fragmentation are resumed. Theoretical approaches are briefly described; they are used to explain the phenomenon in showing off they are based on a minimum information principle. This model is based on time dependent Thomas-Fermi calculation which allows the mean field effect description, and with a site-bound percolation model which allows the fluctuation description [fr

  1. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  2. Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

    DEFF Research Database (Denmark)

    Wang, Z.; Durhuus, T.; Mikkelsen, Benny

    1994-01-01

    A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

  3. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  4. Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

    2014-10-21

    Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

  5. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  6. Self-pulsation in Raman fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

    2009-01-01

    Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

  7. Pulse amplifier with high 'common mode rejection'

    International Nuclear Information System (INIS)

    Ijlst, P.

    1987-01-01

    The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)

  8. BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

    DEFF Research Database (Denmark)

    2010-01-01

    Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

  9. Bevalac injector final stage RF amplifier upgrades

    International Nuclear Information System (INIS)

    Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

    1991-01-01

    With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

  10. Method for reducing snap in magnetic amplifiers

    Science.gov (United States)

    Fischer, R. L. E.; Word, J. L.

    1968-01-01

    Method of reducing snap in magnetic amplifiers uses a degenerative feedback circuit consisting of a resistor and a separate winding on a magnetic core. The feedback circuit extends amplifier range by allowing it to be used at lower values of output current.

  11. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  12. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  13. A fluidic/pneumatic interface amplifier

    Science.gov (United States)

    Limbert, D. E.; Kegel, T. M.

    The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

  14. Amplified OTDR Systems for Multipoint Corrosion Monitoring

    Science.gov (United States)

    Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.

    2012-01-01

    We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017

  15. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2001-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

  16. Bandwidth tunable amplifier for recording biopotential signals.

    Science.gov (United States)

    Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer

    2010-01-01

    This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.

  17. Dual-range linearized transimpedance amplifier system

    Science.gov (United States)

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  18. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  19. Ultrafast disk lasers and amplifiers

    Science.gov (United States)

    Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha

    2012-03-01

    Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.

  20. System for Gamma an X rays fluorescence spectrometric

    International Nuclear Information System (INIS)

    Alonso Abad, D.; Arista Romeu, E.; Bolanos Perez, L. and others

    1997-01-01

    A system for spectrometry of gamma or fluorescence X rays is presented. It sis composed by a Si(Li) semiconductors detector, a charge sensitive preamplifier, a high voltage power supply, a spectrometric amplifier and a monolithic 1024 channels multichannel analyzers or an IBM compatible 4096 channels add - on- card multichannel analyzer. The system can be configured as a 1024 or 4096 channels gamma or fluorescent X rays spectrometer

  1. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  2. An Archeology of Fragments

    Directory of Open Access Journals (Sweden)

    Gerald L. Bruns

    2014-10-01

    Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.

  3. Resonantly enhanced production of excited fragments of gaseous molecules following core-level excitation

    International Nuclear Information System (INIS)

    Chen, J.M.; Lu, K.T.; Lee, J.M.; Ho, S.C.; Chang, H.W.; Lee, Y.Y.

    2005-01-01

    State-selective dissociation dynamics for the excited fragments of gaseous Si(CH 3 ) 2 Cl 2 following Cl 2p and Si 2p core-level excitations have been investigated by resonant photoemission spectroscopy and dispersed UV/optical fluorescence spectroscopy. The main features in the gaseous Si(CH 3 ) 2 Cl 2 fluorescence spectrum are identified as the emission from excited Si*, Si + *, CH* and H*. The core-to-Rydberg excitations at both Si 2p and Cl 2p edges lead to a noteworthy production of not only the excited atomic fragments, neutral and ionic (Si*, Si + *) but also the excited diatomic fragments (CH*). In particular, the excited neutral atomic fragments Si* are significantly reinforced. The experimental results provide deeper insight into the state-selective dissociation dynamics for the excited fragments of molecules via core-level excitation

  4. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  5. Evaluation of chemical fluorescent dyes as a protein conjugation partner for live cell imaging.

    Directory of Open Access Journals (Sweden)

    Yoko Hayashi-Takanaka

    Full Text Available To optimize live cell fluorescence imaging, the choice of fluorescent substrate is a critical factor. Although genetically encoded fluorescent proteins have been used widely, chemical fluorescent dyes are still useful when conjugated to proteins or ligands. However, little information is available for the suitability of different fluorescent dyes for live imaging. We here systematically analyzed the property of a number of commercial fluorescent dyes when conjugated with antigen-binding (Fab fragments directed against specific histone modifications, in particular, phosphorylated H3S28 (H3S28ph and acetylated H3K9 (H3K9ac. These Fab fragments were conjugated with a fluorescent dye and loaded into living HeLa cells. H3S28ph-specific Fab fragments were expected to be enriched in condensed chromosomes, as H3S28 is phosphorylated during mitosis. However, the degree of Fab fragment enrichment on mitotic chromosomes varied depending on the conjugated dye. In general, green fluorescent dyes showed higher enrichment, compared to red and far-red fluorescent dyes, even when dye:protein conjugation ratios were similar. These differences are partly explained by an altered affinity of Fab fragment after dye-conjugation; some dyes have less effect on the affinity, while others can affect it more. Moreover, red and far-red fluorescent dyes tended to form aggregates in the cytoplasm. Similar results were observed when H3K9ac-specific Fab fragments were used, suggesting that the properties of each dye affect different Fab fragments similarly. According to our analysis, conjugation with green fluorescent dyes, like Alexa Fluor 488 and Dylight 488, has the least effect on Fab affinity and is the best for live cell imaging, although these dyes are less photostable than red fluorescent dyes. When multicolor imaging is required, we recommend the following dye combinations for optimal results: Alexa Fluor 488 (green, Cy3 (red, and Cy5 or CF640 (far-red.

  6. Fragmentation of random trees

    International Nuclear Information System (INIS)

    Kalay, Z; Ben-Naim, E

    2015-01-01

    We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

  7. Amplified Photon Upconversion by Photonic Shell of Cholesteric Liquid Crystals.

    Science.gov (United States)

    Kang, Ji-Hwan; Kim, Shin-Hyun; Fernandez-Nieves, Alberto; Reichmanis, Elsa

    2017-04-26

    As an effective platform to exploit triplet-triplet-annihilation-based photon upconversion (TTA-UC), microcapsules composed of a fluidic UC core and photonic shell are microfluidically prepared using a triple emulsion as the template. The photonic shell consists of cholesteric liquid crystals (CLCs) with a periodic helical structure, exhibiting a photonic band gap. Combined with planar anchoring at the boundaries, the shell serves as a resonance cavity for TTA-UC emission and enables spectral tuning of the UC under low-power-density excitation. The CLC shell can be stabilized by introducing a polymerizable mesogen in the LC host. Because of the microcapsule spherical symmetry, spontaneous emission of the delayed fluorescence is omnidirectionally amplified at the edge of the stop band. These results demonstrate the range of opportunities provided by TTA-UC systems for the future design of low-threshold photonic devices.

  8. Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

    Science.gov (United States)

    Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

    2016-05-01

    Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

  9. Signal recognition particle assembly in relation to the function of amplified nucleoli of Xenopus oocytes.

    Science.gov (United States)

    Sommerville, John; Brumwell, Craig L; Politz, Joan C Ritland; Pederson, Thoru

    2005-03-15

    The signal recognition particle (SRP) is a ribonucleoprotein machine that controls the translation and intracellular sorting of membrane and secreted proteins. The SRP contains a core RNA subunit with which six proteins are assembled. Recent work in both yeast and mammalian cells has identified the nucleolus as a possible initial site of SRP assembly. In the present study, SRP RNA and protein components were identified in the extrachromosomal, amplified nucleoli of Xenopus laevis oocytes. Fluorescent SRP RNA microinjected into the oocyte nucleus became specifically localized in the nucleoli, and endogenous SRP RNA was also detected in oocyte nucleoli by RNA in situ hybridization. An initial step in the assembly of SRP involves the binding of the SRP19 protein to SRP RNA. When green fluorescent protein (GFP)-tagged SRP19 protein was injected into the oocyte cytoplasm it was imported into the nucleus and became concentrated in the amplified nucleoli. After visiting the amplified nucleoli, GFP-tagged SRP19 protein was detected in the cytoplasm in a ribonucleoprotein complex, having a sedimentation coefficient characteristic of the SRP. These results suggest that the amplified nucleoli of Xenopus oocytes produce maternal stores not only of ribosomes, the classical product of nucleoli, but also of SRP, presumably as a global developmental strategy for stockpiling translational machinery for early embryogenesis.

  10. Phase noise in RF and microwave amplifiers.

    Science.gov (United States)

    Boudot, Rodolphe; Rubiola, Enrico

    2012-12-01

    Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

  11. Simulations of longitudinally pumped dye laser amplifier

    International Nuclear Information System (INIS)

    Takehisa, Kiwamu; Takemori, Satoshi

    1995-01-01

    Simulations of a copper laser pumped dye laser amplifier and new designs of the longitudinally pumped dye laser amplifier are presented. The simulations take the consideration of the amplified spontaneous emission (ASE). The new designs utilize a center-hole reflector instead of a dichroic mirror. The simulation results indicate that the poor spatial overlap between the pump beam and the dye beam in the transverse pumping not only reduces the laser output power, but also generates ASE strongly. The results also indicate that the longitudinal pumping is as efficient as the transverse pumping. (author)

  12. A parallel input composite transimpedance amplifier

    Science.gov (United States)

    Kim, D. J.; Kim, C.

    2018-01-01

    A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

  13. Fundamentals of RF and microwave transistor amplifiers

    CERN Document Server

    Bahl, Inder J

    2009-01-01

    A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

  14. Quantum electronics maser amplifiers and oscillators

    CERN Document Server

    Fain, V M; Sanders, J H

    2013-01-01

    Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

  15. Unconditionally stable microwave Si-IMPATT amplifiers

    International Nuclear Information System (INIS)

    Seddik, M.M.

    1986-07-01

    The purpose of this investigation has been the development of an improved understanding of the design and analysis of microwave reflection amplifiers employing the negative resistance property of the IMPATT devices. Unconditionally stable amplifier circuit using a Silicon IMPATT diode is designed. The problems associated with the design procedures and the stability criterion are discussed. A computer program is developed to perform the computations. The stable characteristics of a reflection-type Si-IMPATT amplifier, such as gain, frequency and bandwidth are examined. It was found that at large signal drive levels, 7 dB gain with bandwidth of 800 MHz at 22,5 mA was obtained. (author)

  16. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  17. Genetic Characterization Of Syrian Erwinia Amylovora Strains By Amplified Fragment Length Polymorphism Technique

    International Nuclear Information System (INIS)

    Ammouneh, H.; Arabi, M.; Shoaib, A.

    2011-01-01

    Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)

  18. Amplified fragment length polymorphism analysis of human clinical isolates of Mycobacterium haemophilum from different continents

    NARCIS (Netherlands)

    Bruijnesteijn van Coppenraet, L. E. S.; Savelkoul, P. H. M.; Buffing, N.; van der Bijl, M. W.; Woudenberg, J.; Lindeboom, J. A.; Kiehn, T. E.; Haverkort, F.; Samra, Z.; Kuijper, E. J.

    2009-01-01

    The role of the species Mycobacterium haemophilum as a pathogenic non-tuberculous microorganism is becoming better defined with the use of specific detection methods. However, epidemiological investigations of this species are still scarce. We analysed the genetic diversity of M. haemophilum by

  19. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  20. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  1. A preliminary amplified fragment length polymorphism (AFLP) primers selection for spathoglottis species

    NARCIS (Netherlands)

    Ginibun, F.C.; Bhassu, S.; Khalid, N.; Arens, P.; Vosman, B.; Othman, R.Y.

    2015-01-01

    Spathoglottis is a native terrestrial orchid that attracting horticultural interest as a landscaping plant. Distinguishing orchid at species level based on morphological characteristics is unconvincing as some characteristic may sensitive to environmental. Therefore, molecular characterization

  2. Automatic error compensation in dc amplifiers

    International Nuclear Information System (INIS)

    Longden, L.L.

    1976-01-01

    When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks

  3. Stimulated Brillouin scattering threshold in fiber amplifiers

    International Nuclear Information System (INIS)

    Liang Liping; Chang Liping

    2011-01-01

    Based on the wave coupling theory and the evolution model of the critical pump power (or Brillouin threshold) for stimulated Brillouin scattering (SBS) in double-clad fiber amplifiers, the influence of signal bandwidth, fiber-core diameter and amplifier gain on SBS threshold is simulated theoretically. And experimental measurements of SBS are presented in ytterbium-doped double-clad fiber amplifiers with single-frequency hundred nanosecond pulse amplification. Under different input signal pulses, the forward amplified pulse distortion is observed when the pulse energy is up to 660 nJ and the peak power is up to 3.3 W in the pulse amplification with pulse duration of 200 ns and repetition rate of 1 Hz. And the backward SBS narrow pulse appears. The pulse peak power equals to SBS threshold. Good agreement is shown between the modeled and experimental data. (authors)

  4. Behavior of MOSFET Amplifier in Radiation Fields

    International Nuclear Information System (INIS)

    Sharshar, K.A.A.; Ashry, M.

    2000-01-01

    MOSFET type 2 N 3823 characteristics and its application as an amplifier are analyzed including the effects of gamma, electron beam 1.5 MeV 25 m A and neutron flux. The 1-V characteristics, transfer curve, and the frequency response of the amplifier, and the amplification factor(A v 0 are discussed with MOSFET circuit parameters. The drain current and the amplitude of the output signal decrease as the absorbed dose increases. The measured values of the amplified signal are attenuated by 30% and 6% after exposing the MOSFET to gamma radiation and electron beam at the same dose respectively. Also for exposure to 4x10 13 N/cm 3 neutrons decreased the measured value of the amplified signal by 73% of the initial values. The decrease in the gain of the MOSFET is due to the degradation of the transconductance. It is also noticed that percentage of the decrease depends on the type of radiation

  5. Quantum-Limited Directional Amplifiers with Optomechanics

    Science.gov (United States)

    Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

    2018-01-01

    Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

  6. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  7. Manhattan equation for the operational amplifier

    OpenAIRE

    Mishonov, Todor M.; Danchev, Victor I.; Petkov, Emil G.; Gourev, Vassil N.; Dimitrova, Iglika M.; Varonov, Albert M.

    2018-01-01

    A differential equation relating the voltage at the output of an operational amplifier $U_0$ and the difference between the input voltages ($U_{+}$ and $U_{-}$) has been derived. The crossover frequency $f_0$ is a parameter in this operational amplifier master equation. The formulas derived as a consequence of this equation find applications in thousands of specifications for electronic devices but as far as we know, the equation has never been published. Actually, the master equation of oper...

  8. Distributed amplifier using Josephson vortex flow transistors

    International Nuclear Information System (INIS)

    McGinnis, D.P.; Beyer, J.B.; Nordman, J.E.

    1986-01-01

    A wide-band traveling wave amplifier using vortex flow transistors is proposed. A vortex flow transistor is a long Josephson junction used as a current controlled voltage source. The dual nature of this device to the field effect transistor is exploited. A circuit model of this device is proposed and a distributed amplifier utilizing 50 vortex flow transistors is predicted to have useful gain to 100 GHz

  9. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  10. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  11. Multiple excitation regenerative amplifier inertial confinement system

    International Nuclear Information System (INIS)

    George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

    1980-01-01

    The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

  12. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  13. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  14. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  15. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  16. Detection of chromosomal aberrations by fluorescence in situ hybridization in the first three postirradiation divisions of human lymphocytes

    International Nuclear Information System (INIS)

    Boei, J.J.W.A.; Vermeulen, S.; Natarajan, A.T.

    1996-01-01

    Chromosomal aberrations in human lymphocytes were analyzed by fluorescence in situ hybridization (FISH) in the first 3 postirradiation (0 and 2 Gy) divisions. Cells were grown in the presence of BrdU, collected at different sampling times (47, 70 and 91 h) and analyzed using an alphoid centromeric probe and PCR amplified DNA libraries for chromosomes 2 and 8. Following differential staining of sister chromatids, the analyzed cells were identified to be either in the first, second or third mitosis after irradiation. The frequencies of both dicentrics and fragments showed a reduction of about 50% after each cell generation, whereas translocations were more persistent. Cells within the same postirradiation division showed higher aberration frequencies when derived from later sampling times, indicating a delay in progression of aberrant cells. As a result, the frequencies for dicentrics and fragments remained rather constant at different sampling times if the cell cycle parameter was not taken into account. Thus, the average generation time of the lymphocytes had a clear effect on the obtained aberration frequencies. The described method allows the study of the persistence of chromosome damage using the FISH technique during 3 subsequent cell divisions in vitro

  17. Thermodynamical string fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

    2017-01-31

    The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

  18. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  19. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  20. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  1. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  2. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  3. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  4. Advances in high-power rf amplifiers

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1979-01-01

    Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

  5. Transpermeance Amplifier Applied to Magnetic Bearings

    Directory of Open Access Journals (Sweden)

    Jossana Ferreira

    2017-02-01

    Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

  6. Resonance Fluorescence from an Artificial Atom in Squeezed Vacuum

    Directory of Open Access Journals (Sweden)

    D. M. Toyli

    2016-07-01

    Full Text Available We present an experimental realization of resonance fluorescence in squeezed vacuum. We strongly couple microwave-frequency squeezed light to a superconducting artificial atom and detect the resulting fluorescence with high resolution enabled by a broadband traveling-wave parametric amplifier. We investigate the fluorescence spectra in the weak and strong driving regimes, observing up to 3.1 dB of reduction of the fluorescence linewidth below the ordinary vacuum level and a dramatic dependence of the Mollow triplet spectrum on the relative phase of the driving and squeezed vacuum fields. Our results are in excellent agreement with predictions for spectra produced by a two-level atom in squeezed vacuum [Phys. Rev. Lett. 58, 2539 (1987], demonstrating that resonance fluorescence offers a resource-efficient means to characterize squeezing in cryogenic environments.

  7. Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

    NARCIS (Netherlands)

    Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

    2005-01-01

    Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

  8. Solid-state disk amplifiers for fusion-laser systems

    Energy Technology Data Exchange (ETDEWEB)

    Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

    1981-09-01

    We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

  9. The design of high performance weak current integrated amplifier

    International Nuclear Information System (INIS)

    Chen Guojie; Cao Hui

    2005-01-01

    A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)

  10. Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

    NARCIS (Netherlands)

    Acar, M.

    2011-01-01

    In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

  11. Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

    NARCIS (Netherlands)

    Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

    2002-01-01

    This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

  12. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  13. Wideband pulse amplifiers for the NECTAr chip

    Science.gov (United States)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.

    2012-12-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  14. Wideband pulse amplifiers for the NECTAr chip

    International Nuclear Information System (INIS)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J-F.; Naumann, C.L.; Nayman, P.; Ribó, M.

    2012-01-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1–3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  15. Wideband pulse amplifiers for the NECTAr chip

    Energy Technology Data Exchange (ETDEWEB)

    Sanuy, A., E-mail: asanuy@ecm.ub.es [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Delagnes, E. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Gascon, D. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Sieiro, X. [Departament d' Electronica, Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Bolmont, J.; Corona, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Feinstein, F. [LUPM, Universite Montpellier II and IN2P3/CNRS, CC072, bat. 13, place Eugene Bataillon, 34095 Montpellier (France); Glicenstein, J-F. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Naumann, C.L.; Nayman, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Ribo, M. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); and others

    2012-12-11

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  16. An automated test facility for neutronic amplifiers

    International Nuclear Information System (INIS)

    Beattie, W.J.

    1997-01-01

    Neutronic amplifiers are used at the Chalk River Laboratory in applications such as neutron flux monitoring and reactor control systems. Routine preventive maintenance of control and safety systems included annual calibration and characterization of the neutronic amplifiers. An investigation into the traditional methods of annual routine maintenance of amplifiers concluded that frequency and phase response measurements in particular were labour intensive and subject to non-repeatable errors. A decision was made to upgrade testing methods and facilities by using programmable test equipment under the control of a computer. In order to verify the results of the routine measurements, expressions for the transfer functions were derived from the circuit diagrams. Frequency and phase responses were then calculated and plotted thus providing a bench-mark to which the test results can be compared. (author)

  17. A high-efficiency superconductor distributed amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)

    2010-02-15

    A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)

  18. Noise figure of amplified dispersive Fourier transformation

    International Nuclear Information System (INIS)

    Goda, Keisuke; Jalali, Bahram

    2010-01-01

    Amplified dispersive Fourier transformation (ADFT) is a powerful tool for fast real-time spectroscopy as it overcomes the limitations of traditional optical spectrometers. ADFT maps the spectrum of an optical pulse into a temporal waveform using group-velocity dispersion and simultaneously amplifies it in the optical domain. It greatly simplifies spectroscopy by replacing the diffraction grating and detector array in the conventional spectrometer with a dispersive fiber and single-pixel photodetector, enabling ultrafast real-time spectroscopic measurements. Following our earlier work on the theory of ADFT, here we study the effect of noise on ADFT. We derive the noise figure of ADFT and discuss its dependence on various parameters.

  19. Predistortion of a Bidirectional Cuk Audio Amplifier

    DEFF Research Database (Denmark)

    Birch, Thomas Hagen; Nielsen, Dennis; Knott, Arnold

    2014-01-01

    Some non-linear amplifier topologies are capable of providing a larger voltage gain than one from a DC source, which could make them suitable for various applications. However, the non-linearities introduce a significant amount of harmonic distortion (THD). Some of this distortion could be reduced...... using predistortion. This paper suggests linearizing a nonlinear bidirectional Cuk audio amplifier using an analog predistortion approach. A prototype power stage was built and results show that a voltage gain of up to 9 dB and reduction in THD from 6% down to 3% was obtainable using this approach....

  20. Cryogenic transimpedance amplifier for micromechanical capacitive sensors.

    Science.gov (United States)

    Antonio, D; Pastoriza, H; Julián, P; Mandolesi, P

    2008-08-01

    We developed a cryogenic transimpedance amplifier that works at a broad range of temperatures, from room temperature down to 4 K. The device was realized with a standard complementary metal oxide semiconductor 1.5 mum process. Measurements of current-voltage characteristics, open-loop gain, input referred noise current, and power consumption are presented as a function of temperature. The transimpedance amplifier has been successfully applied to sense the motion of a polysilicon micromechanical oscillator at low temperatures. The whole device is intended to serve as a magnetometer for microscopic superconducting samples.

  1. Dynamic range meter for radiofrequency amplifiers

    Directory of Open Access Journals (Sweden)

    Drozd S. S.

    2009-04-01

    Full Text Available The new measurement setup having increased on 20…30 dB the own dynamic range in comparison with the standard circuit of the dynamic range meter is offered and the rated value of an error bringing by setup in the worst case does not exceed ± 2,8 dB. The measurement setup can be applied also to determinate levels of intermodulation components average power amplifiers and powerful amplifiers of a low-frequency at replacement of the quartz filter on meeting low-frequency the LC-filter and the spectrum analyzer.

  2. Optimization of a high efficiency FEL amplifier

    International Nuclear Information System (INIS)

    Schneidmiller, E.A.; Yurkov, M.V.

    2014-10-01

    The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.

  3. Operational amplifier circuits analysis and design

    CERN Document Server

    Nelson, J C C

    1995-01-01

    This book, a revised and updated version of the author's Basic Operational Amplifiers (Butterworths 1986), enables the non-specialist to make effective use of readily available integrated circuit operational amplifiers for a range of applications, including instrumentation, signal generation and processing.It is assumed the reader has a background in the basic techniques of circuit analysis, particularly the use of j notation for reactive circuits, with a corresponding level of mathematical ability. The underlying theory is explained with sufficient but not excessive, detail. A range of compu

  4. Cavity enhanced rephased amplified spontaneous emission

    International Nuclear Information System (INIS)

    A Williamson, Lewis; J Longdell, Jevon

    2014-01-01

    Amplified spontaneous emission is usually treated as an incoherent noise process. Recent theoretical and experimental work using rephasing optical pulses has shown that rephased amplified spontaneous emission (RASE) is a potential source of wide bandwidth time-delayed entanglement. Due to poor echo efficiency the plain RASE protocol does not in theory achieve perfect entanglement. Experiments done to date show a very small amount of entanglement at best. Here we show that RASE can, in principle, produce perfect multimode time-delayed two mode squeezing when the active medium is placed inside a Q-switched cavity. (paper)

  5. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  6. Archaeological pottery fragments analysis from Sambaqui do Bacanga (MA-Brazil) with a portable EDXRF system

    International Nuclear Information System (INIS)

    Ikeoka, Renato A.; Appoloni, Carlos R.; Parreira, Paulo S.; Lopes, Fabio; Bandeira, Arkley M.

    2009-01-01

    Sambaqui do Bacanga archaeological site is located in the Island of Sao Luis - Maranhao - Brazil, in the region bathed by the Bacanga River. A stratigraphic collection of 68 pottery fragments was collected during the years 2005 and 2006 to perform a qualitative analysis of the chemical elements employing a Portable System of Energy Dispersive X-ray Fluorescence (PXRF). The elements K, Ca, Ti, Mn, Fe, Zn, Br, Rb, Sr, Y, Zr and Pb were identified in the different fragments and only Fe, Ca, Sr, Zr, Mn, Ti and Zn were common elements for all of them, indicating that these elements are present in the raw material used in the manufacture of the fragments. Only one fragment presented remains of painting. A larger concentration of Fe was observed in this region compared to other areas. This indicates that a material with iron oxide was used to make the painting. The elements Fe, Sr, Mn, Ti and Zn are present, systematically, with larger intensities on concave and convex sides in relation to the ceramic paste for 43 among the 68 analyzed fragments, indicating a different surface treatment that leads to an enrichment of those elements. Cluster analysis was performed with the pottery fragments at three levels. The fragments were grouped in three different clusters, except for two fragments from the 132 cm level, which grouped with the fragments from 10-20 cm level. This result indicates three different sources of clay for the studied pottery fragments. (author)

  7. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  8. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  9. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  10. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  11. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  12. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  13. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  14. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  15. Hybrid amplifier for calorimetry with photodiode readout

    Energy Technology Data Exchange (ETDEWEB)

    Sushkov, V V

    1994-12-31

    A hybrid surface mounted amplifier for the photodiode readout of the EM calorimeter has been developed. The main technical characteristics of the design are presented. The design able to math readout constraints for a high luminosity collider experiment is discussed. 10 refs., 2 tabs., 8 figs.

  16. Amplifier Design for Proportional Ionization Chambers

    Energy Technology Data Exchange (ETDEWEB)

    Baker, W. H.

    1950-08-24

    This paper presents the requirements of a nuclear amplifier of short resolving time, designed to accept pulses of widely varying amplitudes. Data are given which show that a proportional ionization chamber loaded with a 1,000-ohm resistor develops pulses of 0.5 microsecond duration and several volts amplitude. Results indicate that seven basic requirements are imposed on the amplifier when counting soft beta and gamma radiation in the presence of alpha particles, without absorbers. It should, (1) have a fast recovery time, (2) have a relatively good low frequency response, (3) accept pulses of widely varying heights without developing spurious pulsed, (4) have a limiting output stage, (5) preserve the inherently short rise time of the chamber, (6) minimize pulse integration, and (7) have sufficient gain to detect the weak pulses well below the chamber voltage at which continuous discharge takes place. The results obtained with an amplifier which meets these requirements is described. A formula is derived which indicates that redesign of the proportional ionization chamber might eliminate the need for an amplifier. This may be possible if the radioactive particles are collimated parallel to the collecting electrode.

  17. Methylation sensitive amplified polymorphism (MSAP) reveals that ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... Key words: Salt stress, alkali stress, Gossypium hirsutum L., DNA methylation, methylation sensitive amplified polymorphism (MSAP). INTRODUCTION. DNA methylation is one of the key epigenetic mecha- nisms among eukaryotes that can modulate gene expression without the changes of DNA sequence.

  18. Enhanced timing channel for spectroscopy amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Ianakiev, K; Grigorov, N [Inst. for Nuclear Research and Nuclear Energy, Sofia (Bulgaria)

    1996-12-31

    Purpose of this paper is to analyze noise and timing performance of some methods of filtering in the fast channel. Implementation of RLC-filter into a semi-Gaussian amplifier allows to obtain the time resolution of 420 ns. 5 refs.

  19. Optimization of Pr3+:ZBLAN fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, B.; Miniscalco, J. W.; Quimby, R. S.

    1992-01-01

    Experimental parameters have been measured and used in a quantitative model of Pr3+-doped fluorozirconate fiber amplifiers. The optimum cutoff wavelength was determined to be 800 nm and the gain for 400 mW of pump was found to increase from 12 to 34 dB if the NA was increased from 0.15 to 0...

  20. Reducing Switching Artifacts in Chopper Amplifiers

    NARCIS (Netherlands)

    Kusuda, Y.

    2018-01-01

    This thesis describes the theory, design, and implementation of chopper operational amplifiers (op-amps) in CMOS integrated circuits (ICs). The chopping technique periodically corrects DC errors of such op-amps, so that low 1/f noise and stable, microvolt-level offset can be achieved. However,

  1. High-Performance Operational and Instrumentation Amplifiers

    NARCIS (Netherlands)

    Shahi, B.

    2015-01-01

    This thesis describes techniques to reduce the offset error in precision instrumentation and operational amplifiers. The offset error which is considered a major error source associated with gain blocks, together with other errors are reviewed. Conventional and newer approaches to remove offset and

  2. SINGLE CONVERSION ISOLATED IMPEDANCE TRANSFORMATION AMPLIFIER

    DEFF Research Database (Denmark)

    2003-01-01

    The invention relates to a switch mode power amplifier. A first and a second change-over switch are inserted between a DC voltage supply and a primary side of an isolation transformer. Two secondary windings are connected to a power output terminal. A first and a second secondary side power switc...

  3. Feedback analysis of transimpedance operational amplifier circuits

    DEFF Research Database (Denmark)

    Bruun, Erik

    1993-01-01

    The transimpedance or current feedback operational amplifier (CFB op-amp) is reviewed and compared to a conventional voltage mode op-amp using an analysis emphasizing the basic feedback characteristics of the circuit. With this approach the paradox of the constant bandwidth obtained from CFB op...

  4. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  5. Compensation techniques for operational amplifier bias current

    International Nuclear Information System (INIS)

    Silva, M.S.

    1981-01-01

    Two techniques are proposed for the compensation of the input current on operational amplifiers that can be used on inverting and non-inverting configurations. A qualitative analysis of temperature drift problems is made, and as a practical application, the construction of a voltage follower for high impedance measurements is presented. (Author) [pt

  6. Application of randomly amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Jane

    2011-10-10

    Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...

  7. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. X-ray fluorescence in geology

    International Nuclear Information System (INIS)

    Dutra, C.V.; Gomes, C.B.

    1990-01-01

    This work is about the X-ray fluorescence aplication in geology. It's showing the X-ray origin and excitation. About the instrumentation this work shows the following: X-ray tubes, colimators, analysers crystals, detectors, amplifiers, pulse height selector, and others electronic components. By X-ray fluorescente are done quantitative and qualitative geological analysis and this work shows this analysis and its detection limits. The problems determination is the example. In this work was done yet the comparative analysis of the various instrumental methods in geochemistry. (C.G.) [pt

  9. QGP and Modified Jet Fragmentation

    International Nuclear Information System (INIS)

    Wang, Xin-Nian

    2005-01-01

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

  10. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  11. Multi-pass amplifier architecture for high power laser systems

    Science.gov (United States)

    Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C

    2014-04-01

    A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.

  12. Transmission characteristics of acoustic amplifier in thermoacoustic engine

    International Nuclear Information System (INIS)

    Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

    2008-01-01

    Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

  13. Gold and silver nanoparticles based superquenching of fluorescence: A review

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Debanjana; Chattopadhyay, Nitin, E-mail: nitin.chattopadhyay@yahoo.com

    2015-04-15

    The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K{sub SV}~10{sup 7}–10{sup 10} mol{sup −1} dm{sup 3}) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10{sup 2} mol{sup −1} dm{sup 3}). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors.

  14. Gold and silver nanoparticles based superquenching of fluorescence: A review

    International Nuclear Information System (INIS)

    Ghosh, Debanjana; Chattopadhyay, Nitin

    2015-01-01

    The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K SV ~10 7 –10 10 mol −1 dm 3 ) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10 2 mol −1 dm 3 ). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors

  15. Reviews in fluorescence 2010

    CERN Document Server

    Geddes, Chris D

    2011-01-01

    ""Reviews in Fluorescence 2010"", the seventh volume of the book serial from Springer, serves as a comprehensive collection of current trends and emerging hot topics in the field of fluorescence and closely related disciplines. It summarizes the year's progress in fluorescence and its applications, with authoritative analytical reviews specialized enough to be attractive to professional researchers, yet also appealing to the wider audience of scientists in related disciplines of fluorescence. ""Reviews in Fluorescence"" offers an essential reference material for any lab working in the fluoresc

  16. Principles of fluorescence techniques

    CERN Document Server

    2016-01-01

    Fluorescence techniques are being used and applied increasingly in academics and industry. The Principles of Fluorescence Techniques course will outline the basic concepts of fluorescence techniques and the successful utilization of the currently available commercial instrumentation. The course is designed for students who utilize fluorescence techniques and instrumentation and for researchers and industrial scientists who wish to deepen their knowledge of fluorescence applications. Key scientists in the field will deliver theoretical lectures. The lectures will be complemented by the direct utilization of steady-state and lifetime fluorescence instrumentation and confocal microscopy for FLIM and FRET applications provided by leading companies.

  17. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  18. Is there a role for amplifiers in sexual selection?

    Science.gov (United States)

    Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio

    2008-05-21

    The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information

  19. Amplification of the Signal Intensity of Fluorescence-Based Fiber-Optic Biosensors Using a Fabry-Perot Resonator Structure

    Directory of Open Access Journals (Sweden)

    Meng-Chang Hsieh

    2015-02-01

    Full Text Available Fluorescent biosensors have been widely used in biomedical applications. To amplify the intensity of fluorescence signals, this study developed a novel structure for an evanescent wave fiber-optic biosensor by using a Fabry-Perot resonator structure. An excitation light was coupled into the optical fiber through a laser-drilled hole on the proximal end of the resonator. After entering the resonator, the excitation light was reflected back and forth inside the resonator, thereby amplifying the intensity of the light in the fiber. Subsequently, the light was used to excite the fluorescent molecules in the reactive region of the sensor. The experimental results showed that the biosensor signal was amplified eight-fold when the resonator reflector was formed using a 92% reflective coating. Furthermore, in a simulation, the biosensor signal could be amplified 20-fold by using a 99% reflector.

  20. Use of random amplified polymorphic DNA (RAPD) for generating specific DNA probes for oxyuroid species (Nematoda).

    Science.gov (United States)

    Jobet, E; Bougnoux, M E; Morand, S; Rivault, C; Cloarec, A; Hugot, J P

    1998-03-01

    Random amplified DNA markers (RAPD; Williams et al., 1990) were used to obtained specific RAPD fragments characterising different species of oxyuroids. We tested six species of worms parasitizing vertebrates or invertebrates: Passalurus ambiguus Rudolphi, 1819, parasite of Leporids; Syphacia obvelata (Rudolphi, 1802) Seurat, 1916, a parasite of rodents; Blatticola blattae (Graeffe, 1860) Chitwood, 1932 parasite of the cockroach Blattella germanica; Hammerschmidtiella diesingi (Hammerschmidt, 1838) Chitwood, 1932 and Thelastoma bulhoesi (Magalhaes, 1990) Travassos, 1929, parasites of the cockroach Periplaneta americana, and an undescribed parasite species of a passalid insect from New Caledonia. Among 15 oligonucleotides tested, nine produced several specific bands allowing the interspecific discrimination.

  1. Amplified spontaneous emission spectrum and gain characteristic of a two-electrode semiconductor optical amplifier

    International Nuclear Information System (INIS)

    Wang Hanchao; Huang Lirong; Shi Zhongwei

    2011-01-01

    A two-electrode multi-quantum-well semiconductor optical amplifier is designed and fabricated. The amplified spontaneous emission (ASE) spectrum and gain were measured and analyzed. It is shown that the ASE spectrum and gain characteristic are greatly influencedby the distribution of the injection current density. By changing the injection current density of two electrodes, the full width at half maximum, peak wavelength, peak power of the ASE spectrum and the gain characteristic can be easily controlled. (semiconductor devices)

  2. Reviews in fluorescence 2008

    CERN Document Server

    Geddes, Chris D

    2010-01-01

    This volume serves as a comprehensive collection of current trends and emerging hot topics in the field of fluorescence spectroscopy. It summarizes the year's progress in fluorescence and its applications as well as includes authoritative analytical reviews.

  3. Fluorescent optical position sensor

    Science.gov (United States)

    Weiss, Jonathan D.

    2005-11-15

    A fluorescent optical position sensor and method of operation. A small excitation source side-pumps a localized region of fluorescence at an unknown position along a fluorescent waveguide. As the fluorescent light travels down the waveguide, the intensity of fluorescent light decreases due to absorption. By measuring with one (or two) photodetectors the attenuated intensity of fluorescent light emitted from one (or both) ends of the waveguide, the position of the excitation source relative to the waveguide can be determined by comparing the measured light intensity to a calibrated response curve or mathematical model. Alternatively, excitation light can be pumped into an end of the waveguide, which generates an exponentially-decaying continuous source of fluorescent light along the length of the waveguide. The position of a photodetector oriented to view the side of the waveguide can be uniquely determined by measuring the intensity of the fluorescent light emitted radially at that location.

  4. Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

    International Nuclear Information System (INIS)

    Horvath, J. A.

    1998-01-01

    Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

  5. Fluorescence in situ hybridization on human metaphase chromosomes detected by near-field scanning optical microscopy

    NARCIS (Netherlands)

    Moers, M.H.P.; Moers, M.H.P.; Kalle, W.H.J.; Kalle, W.H.J.; Ruiter, A.G.T.; Wiegant, J.C.A.G.; Raap, A.K.; Greve, Jan; de Grooth, B.G.; van Hulst, N.F.

    1996-01-01

    Fluorescence in situ hybridization o­n human metaphase chromosomes is detected by near-field scanning optical microscopy. This combination of cytochemical and scanning probe techniques enables the localization and identification of several fluorescently labelled genomic DNA fragments o­n a single

  6. Safe biodegradable fluorescent particles

    Science.gov (United States)

    Martin, Sue I [Berkeley, CA; Fergenson, David P [Alamo, CA; Srivastava, Abneesh [Santa Clara, CA; Bogan, Michael J [Dublin, CA; Riot, Vincent J [Oakland, CA; Frank, Matthias [Oakland, CA

    2010-08-24

    A human-safe fluorescence particle that can be used for fluorescence detection instruments or act as a safe simulant for mimicking the fluorescence properties of microorganisms. The particle comprises a non-biological carrier and natural fluorophores encapsulated in the non-biological carrier. By doping biodegradable-polymer drug delivery microspheres with natural or synthetic fluorophores, the desired fluorescence can be attained or biological organisms can be simulated without the associated risks and logistical difficulties of live microorganisms.

  7. Optimization of fluorescent proteins

    NARCIS (Netherlands)

    Bindels, D.S.; Goedhart, J.; Hink, M.A.; van Weeren, L.; Joosen, L.; Gadella (jr.), T.W.J.; Engelborghs, Y.; Visser, A.J.W.G.

    2014-01-01

    Nowadays, fluorescent protein (FP) variants have been engineered to fluoresce in all different colors; to display photoswitchable, or photochromic, behavior; or to show yet other beneficial properties that enable or enhance a still growing set of new fluorescence spectroscopy and microcopy

  8. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  9. Transport in coherently absorbing or amplifying media

    International Nuclear Information System (INIS)

    Sen, A.K.

    1995-11-01

    We study electronic transport in a one-dimensional ordered chain in the presence of either absorption or amplification at each site (the site-potential having an imaginary positive or negative part) within a single-band tightbinding Hamiltonian. The spectrum in either case for the isolated (closed) quantum system is found to become broader compared to the regular Bloch case where there is no absorption or amplification at any site. Interestingly for the transport through an infinitely long ordered chain (open quantum system), the reflectance saturates to a value greater (lesser) than unity in the amplifying (absorbing) case and the transmittance decays to zero in either case. This fact implies that the transmittance does not grow indefinitely even for an ordered, amplifying (active or lasing) medium and that it is not necessary to have any disorder or interaction induced confining mechanism on the transmitted wave, so as to achieve an amplification in the backscattered wave. (author). 8 refs, 2 figs

  10. Amplified music exposure carries risks to hearing.

    Science.gov (United States)

    da Silva, Valéria Gomes; de Oliveira, Carlos Augusto Costa Pires; Tauil, Pedro Luíz; de Castro Silva, Isabella Monteiro; Sampaio, André Luiz Lopes

    2017-02-01

    To investigate the association between changes in the outer hair cells and exposure to amplified music in a group of high-school students. In this retrospective, case-control study, 86 subjects underwent audiometry, immittance audiometry, and distortion-product otoacoustic emission tests. The subjects were questioned about their listening habits and divided into 2 groups: exposed and unexposed. Most of the subjects had reduced function in their outer hair cells, mainly beginning at 8 kHz. Among 60 subjects-30 cases and 30 controls-75% were considered exposed and 25% unexposed. The exposed subjects were 9.33 times more likely to have altered outer hair cells than the unexposed subjects were. Exposure to amplified music is associated with reduced function in the hair cells. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  11. Cryogenic cooling for high power laser amplifiers

    Directory of Open Access Journals (Sweden)

    Perin J.P.

    2013-11-01

    Full Text Available Using DPSSL (Diode Pumped Solid State Lasers as pumping technology, PW-class lasers with enhanced repetition rates are developed. Each of the Yb YAG amplifiers will be diode-pumped at a wavelength of 940 nm. This is a prerequisite for achieving high repetition rates (light amplification duration 1 millisecond and repetition rate 10 Hz. The efficiency of DPSSL is inversely proportional to the temperature, for this reason the slab amplifier have to be cooled at a temperature in the range of 100 K–170 K with a heat flux of 1 MW*m−2. This paper describes the thermo-mechanical analysis for the design of the amplification laser head, presents a preliminary proposal for the required cryogenic cooling system and finally outlines the gain of cryogenic operation for the efficiency of high pulsed laser.

  12. Spaceflight 2 um Tm Fiber MOPA Amplifier, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Fibertek proposes to design, develop, and test a spaceflight prototype 2051 nm thulium (Tm)-doped fiber amplifier (TDFA) optical master oscillator power amplifier...

  13. Conversion of the random amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

  14. Electrically Pumped Vertical-Cavity Amplifiers

    DEFF Research Database (Denmark)

    Greibe, Tine

    2007-01-01

    In this work, the design of electrically pumped vertical cavity semiconductor optical amplifiers (eVCAs) for use in a mode-locked external-cavity laser has been developed, investigated and analysed. Four different eVCAs, one top-emitting and three bottom emitting structures, have been designed...... and discussed. The thesis concludes with recommendations for further work towards the realisation of compact electrically pumped mode-locked vertical externalcavity surface emitting lasers....

  15. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Fast Electrocardiogram Amplifier Recovery after Defibrillation Shock

    Directory of Open Access Journals (Sweden)

    Ivan Dotsinsky

    2005-04-01

    Full Text Available A procedure for fast ECG amplifier recovery after defibrillation shocks was developed and simulated in the MATLAB environment. Exponentially decaying post-shock voltages have been recorded. Signals from the AHA database are taken and mixed with the recorded exponential disturbances. The algorithm applies moving averaging (comb filter on the compound input signal, thereby obtaining the samples of the disturbance. They are currently subtracted from the input signal. The results obtained show that its recovery is practically instantaneous.

  17. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  18. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  19. Prototype disc amplifier for Iskra-6 facility

    International Nuclear Information System (INIS)

    Grigorovich, S.V.; Eroshenko, V.F.; Krotov, V.A.; Demidov, V.L.; Kalinin, N.V.; Kurunov, R.F.; Smirnov, V.G.; Fomin, V.M.

    2006-01-01

    Eight-channel disk amplifiers of the ISKRA-6 facility are made up of sections. An amplifier section consists of eight active elements (2*4) made of KGSS-0180/35-grade neodymium phosphate glass 400*690*40 mm in size located in frames at the Brewster angle. Twenty flash-lamps are arranged in one amplifier module. The flash-lamps have an inter electrode distance of 1600 mm, the tube is 40 mm in inner diameter. The results of numerical investigations into the dynamics of high-current pulse radiation discharge are presented. The investigations were carried out by the 1-dimensional RMHD-model. This model takes into account the transient processes in the electric circuit and the physical processes in the discharge plasma: ionization, Joule heating, thermal conductivity, radiation transfer and plasma motion caused by the non-uniformity of energy introduction into the discharge in case of a non-uniform initial ionization of gas in the pumping lamp. The experimental results of spectral measurements and light efficiency of the flash-lamps depending on specific power and value of energy contribution are presented

  20. Charge sensitive amplifies. The state of arts

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Kunishiro [Clear Pulse Co., Tokyo (Japan)

    1996-07-01

    In the radiation detectors, signals are essentially brought with charges produced by radiation, then it is naturally the best way to use a charge sensitive amplifier (CSA) system to extract those signals. The CSA is thought to be the best amplifier suitable to almost all the radiation detectors, if neglecting economical points of view. The CSA has been only applied to special fields like radiation detection because the concept of `charges` is not so universal against the concepts of `voltage` and `current`. The CSA, however, is low in noise and a high speed amplifier and may be applicable not only to radiation measurement but also piezoelectric devices and also bolometers. In this article, noise in the CSA, basic circuit on the CSA, concepts of `equivalent noise charge` (ENC), a method for the ENC, and importance of the `open-loop gain` in the CSA to achieve better performance of it and how to realize in a practical CSA were described. And, characteristics on a counting rate of the CSA, various circuit used in the CSA, and CSAs which are commercially available at present and special purpose CSAs were also introduced. (G.K.)

  1. Memory effects in nuclear fragmentation?

    International Nuclear Information System (INIS)

    Colonna, M.; Di Toro, M.; Guarnera, A.

    1994-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

  2. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  3. Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

    Science.gov (United States)

    Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

    2015-11-01

    The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

  4. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  5. Pump to signal noise transfer in parametric fiber amplifiers

    DEFF Research Database (Denmark)

    Lund-Hansen, Toke; Rottwitt, Karsten; Peucheret, Christophe

    2010-01-01

    Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal.......Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal....

  6. Noise and saturation properties of semiconductor quantum dot optical amplifiers

    DEFF Research Database (Denmark)

    Berg, Tommy Winther; Mørk, Jesper

    2002-01-01

    We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved.......We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved....

  7. The OPTHER Project: Progress toward the THz Amplifier

    DEFF Research Database (Denmark)

    Paoloni, C; Brunetti, F; Di Carlo, A

    2011-01-01

    This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....

  8. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  9. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  10. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

  11. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  12. Refolding Technologies for Antibody Fragments

    Directory of Open Access Journals (Sweden)

    Tsutomu Arakawa

    2014-05-01

    Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.

  13. Differential transimpedance amplifier circuit for correlated differential amplification

    Science.gov (United States)

    Gresham, Christopher A [Albuquerque, NM; Denton, M Bonner [Tucson, AZ; Sperline, Roger P [Tucson, AZ

    2008-07-22

    A differential transimpedance amplifier circuit for correlated differential amplification. The amplifier circuit increase electronic signal-to-noise ratios in charge detection circuits designed for the detection of very small quantities of electrical charge and/or very weak electromagnetic waves. A differential, integrating capacitive transimpedance amplifier integrated circuit comprising capacitor feedback loops performs time-correlated subtraction of noise.

  14. Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

    OpenAIRE

    R. Sarman; R. Prokop; T. Dostal

    1997-01-01

    The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

  15. The Dynamics of Semiconductor Optical Amplifiers – Modeling and Applications

    DEFF Research Database (Denmark)

    Mørk, Jesper; Nielsen, Mads Lønstrup; Berg, Tommy Winther

    2003-01-01

    The importance of semiconductor optical amplifiers is discussed. A semiconductor optical amplifier (SOA) is a semiconductor laser with anti-reflection coated facets that amplifies an injected light signal by means of stimulated emission. SOAs have a number of unique properties that open up...

  16. Fragmentation of atomic clusters: A theoretical study

    International Nuclear Information System (INIS)

    Lopez, M.J.; Jellinek, J.

    1994-01-01

    Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

  17. Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

    Science.gov (United States)

    Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

    2017-08-01

    Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  18. Electron Detachment Dissociation (EDD) of Fluorescently Labeled Sialylated Oligosaccharides

    Science.gov (United States)

    Zhou, Wen; Håkansson, Kristina

    2012-01-01

    We explored the application of electron detachment dissociation (EDD) and infrared multiphoton dissociation (IRMPD) tandem mass spectrometry to fluorescently labeled sialylated oligosaccharides. Standard sialylated oligosaccharides and a sialylated N-linked glycan released from human transferrin were investigated. EDD yielded extensive glycosidic cleavages and cross-ring cleavages in all cases studied, consistently providing complementary structural information compared to IRMPD. Neutral losses and satellite ions such as C – 2H ions were also observed following EDD. In addition, we examined the influence of different fluorescent labels. The acidic label 2-aminobenzoic acid (2-AA) enhanced signal abundance in negative-ion mode. However, few cross-ring fragments were observed for 2-AA labeled oligosaccharides. The neutral label 2-aminobenzamide (2-AB) resulted in more cross-ring cleavages compared to 2-AA labeled species, but not as extensive fragmentation as for native oligosaccharides, likely resulting from altered negative charge locations from introduction of the fluorescent tag. PMID:22120881

  19. Theoretical Investigation of Oxazine 170 Perchlorate Doped Polymeric Optical Fiber Amplifier

    Directory of Open Access Journals (Sweden)

    Piotr Miluski

    2017-01-01

    Full Text Available Optical signal amplification in the waveguiding structure of optical fibers can be used for optical telecommunication systems and new light sources constructions. Organic dyes doped materials are interesting for new applications in polymeric optical fibers technology due to their benefits (efficient fluorescence, high absorption cross section, and easy processing. This article presents a numerical simulation of gain in poly(methyl methacrylate optical fiber doped by Oxazine 170 Perchlorate. The calculated gain characteristic for the used dye molar concentration (0.2·10-6–1.4·10-6 and pump power (1–10 kW is presented. The fabricated fluorescent polymeric optical fiber is also shown. The presented analysis can be used for optical amplifier construction based on dye-doped polymeric optical fiber (POF.

  20. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  2. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  3. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  4. Fission fragment driven neutron source

    Science.gov (United States)

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  5. Developments in SPR Fragment Screening.

    Science.gov (United States)

    Chavanieu, Alain; Pugnière, Martine

    2016-01-01

    Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

  6. Nuclear fragmentation by nucleation approach

    International Nuclear Information System (INIS)

    Chung, K.C.

    1992-01-01

    The nucleation model is used to simulate nuclear fragmentation processes. The critical value of the effective interaction radius is shown to vary linearly with the expansion factor α. The calculated mass and charge distributions are compared with some experimental data. (author)

  7. Neutron multiplicity of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)

    1995-10-01

    The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.

  8. Fragmented nature: consequences for biodiversity

    NARCIS (Netherlands)

    Olff, H.; Ritchie, M.E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  9. Fragmented nature : consequences for biodiversity

    NARCIS (Netherlands)

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  10. Research of nuclear fragmentation characteristics

    International Nuclear Information System (INIS)

    Richert, J.

    1989-01-01

    Motivations for the study of nuclear fragmentation are presented. Different models and methods which were developed in the past are reviewed, critically discussed and confronted in connection with the experimental information gathered over the past years. Specific aspects related to the onset of the process, its characteristics and the mechanism which governs it are discussed [fr

  11. FRAGMENTED IDENTITIES: THE CULTURAL COLLISION ...

    African Journals Online (AJOL)

    User

    Born in the former French and German colony of. Togo, Komla-Ebri ... of how cultural barriers not only lead to isolation and fragmented identities, but also ..... and, in recreating bits of Italy, in the form of music, cinema and food, absorbs parts of ...

  12. Phthalocyanides sensitized fragmentation of proteins

    Czech Academy of Sciences Publication Activity Database

    Klementová, S.; Tothová, D.; Revaková, R.; Kasková, M.; Wagnerová, Dana Marie

    2001-01-01

    Roč. 5, č. 1 (2001), s. 13-18 ISSN 0972-0626 R&D Projects: GA ČR GA203/96/1322 Institutional research plan: CEZ:AV0Z4032918 Keywords : phthalocyanides * photosensitied fragmentation of proteins Subject RIV: CA - Inorganic Chemistry

  13. In vivo fluorescent detection of Fe-S clusters coordinated by human GRX2.

    Science.gov (United States)

    Hoff, Kevin G; Culler, Stephanie J; Nguyen, Peter Q; McGuire, Ryan M; Silberg, Jonathan J; Smolke, Christina D

    2009-12-24

    A major challenge to studying Fe-S cluster biosynthesis in higher eukaryotes is the lack of simple tools for imaging metallocluster binding to proteins. We describe the first fluorescent approach for in vivo detection of 2Fe2S clusters that is based upon the complementation of Venus fluorescent protein fragments via human glutaredoxin 2 (GRX2) coordination of a 2Fe2S cluster. We show that Escherichia coli and mammalian cells expressing Venus fragments fused to GRX2 exhibit greater fluorescence than cells expressing fragments fused to a C37A mutant that cannot coordinate a metallocluster. In addition, we find that maximal fluorescence in the cytosol of mammalian cells requires the iron-sulfur cluster assembly proteins ISCU and NFS1. These findings provide evidence that glutaredoxins can dimerize within mammalian cells through coordination of a 2Fe2S cluster as observed with purified recombinant proteins. Copyright 2009 Elsevier Ltd. All rights reserved.

  14. Note: A high dynamic range, linear response transimpedance amplifier.

    Science.gov (United States)

    Eckel, S; Sushkov, A O; Lamoreaux, S K

    2012-02-01

    We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

  15. Characterization of a Common-Source Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeond, Todd C.; Ho, Pat D.

    2010-01-01

    This paper presents empirical data that was collected through experiments using a FeFET in the established common-source amplifier circuit. The unique behavior of the FeFET lends itself to interesting and useful operation in this widely used common-source amplifier. The paper examines the effect of using a ferroelectric transistor for the amplifier. It also examines the effects of varying load resistance, biasing, and input voltages on the output signal and gives several examples of the output of the amplifier for a given input. The difference between a commonsource amplifier using a ferroelectric transistor and that using a MOSFET is addressed.

  16. Characterization of a Common-Gate Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeod, Todd C.; Ho, Fat D.

    2011-01-01

    In this paper, the empirical data collected through experiments performed using a FeFET in the common-gate amplifier circuit is presented. The FeFET common-gate amplifier was characterized by varying all parameters in the circuit, such as load resistance, biasing of the transistor, and input voltages. Due to the polarization of the ferroelectric layer, the particular behavior of the FeFET common-gate amplifier presents interesting results. Furthermore, the differences between a FeFET common-gate amplifier and a MOSFET common-gate amplifier are examined.

  17. The VERDI fission fragment spectrometer

    Directory of Open Access Journals (Sweden)

    Frégeau M.O.

    2013-12-01

    Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

  18. Class D audio amplifiers for high voltage capacitive transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis

    of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...

  19. Low noise amplifier for ZnS(Ag) scintillation chamber

    International Nuclear Information System (INIS)

    Do Hoang Cuong

    1998-01-01

    A new pulse amplifier that can be used with standard photomultiplier tubes coupled with Zn(Ag) scintillation chamber is presented. The amplifier based on an IC operational amplifier LF 356N consists of a low-noise charge sensitive preamplifier and pulse shaping circuits for optimization of signal to noise ratio. Temperature instability is ≤ 0.05%/ o C. Dynamic range for linear output signals is equal +7 V. The presented amplifier is used in a measuring head for 0.17 L Lucas chambers developed in Department of Nuclear Instruments and Methods of the INCT in laboratory investigations aimed to develop methods and instruments for measurement of radon concentration in the air. The amplifier can also be employed for measurement of ionizing radiation by means of other scintillators coupled to PM tube. The amplifier is followed by a pulse discriminator with adjustable discrimination level. The amplifier output signal and discriminator output pulses are fed to external devices. (author)

  20. A new semicustom integrated bipolar amplifier for silicon strip detectors

    International Nuclear Information System (INIS)

    Zimmerman, T.

    1989-01-01

    The QPA02 is a four channel DC coupled two stage transimpedance amplifier designed at Fermilab on a semicustom linear array (Quickchip 2S) manufactured by Tektronix. The chip was developed as a silicon strip amplifier but may have other applications as well. Each channel consists of a preamplifier and a second stage amplifier/sharper with differential output which can directly drive a transmission line (90 to 140 ohms). External bypass capacitors are the only discrete components required. QPA02 has been tested and demonstrated to be an effective silicon strip amplifier. Other applications may exist which can use this amplifier or a modified version of this amplifier. For example, another design is now in progress for a wire chamber amplifier, QPA03, to be reported later. Only a relatively small effort was required to modify the design and layout for this application. 11 figs

  1. High sensitivity amplifier/discriminator for PWC's

    International Nuclear Information System (INIS)

    Hansen, S.

    1983-01-01

    The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design

  2. Numerical simulation of cross field amplifiers

    International Nuclear Information System (INIS)

    Eppley, K.

    1990-01-01

    Cross field amplifiers (CFA) have been used in many applications where high power, high frequency microwaves are needed. Although these tubes have been manufactured for decades, theoretical analysis of their properties is not as highly developed as for other microwave devices such as klystrons. One feature distinguishing cross field amplifiers is that the operating current is produced by secondary emission from a cold cathode. This removes the need for a heater and enables the device to act as a switch tube, drawing no power until the rf drive is applied. However, this method of generating the current does complicate the simulation. We are developing a simulation model of cross field amplifiers using the PIC code CONDOR. We simulate an interaction region, one traveling wavelength long, with periodic boundary conditions. An electric field with the appropriate phase velocity is imposed on the upper boundary of the problem. Evaluation of the integral of E·J gives the power interchanged between the wave and the beam. Given the impedance of the structure, we then calculate the change in the traveling wave field. Thus we simulate the growth of the wave through the device. The main advance of our model over previous CFA simulations is the realistic tracking of absorption and secondary emission. The code uses experimental curves to calculate secondary production as a function of absorbed energy, with a theoretical expression for the angular dependence. We have used this code to model the 100 MW X-band CFA under construction at SLAC, as designed by Joseph Feinstein and Terry Lee. We are examining several questions of practical interest, such as the power and spectrum of absorbed electrons, the minimum traveling wave field needed to initiate spoke formation, and the variation of output power with dc voltage, anode-cathode gap, and magnetic field. 5 refs., 8 figs

  3. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    International Nuclear Information System (INIS)

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  4. A study on a portable fluorescence imaging system

    Science.gov (United States)

    Chang, Han-Chao; Wu, Wen-Hong; Chang, Chun-Li; Huang, Kuo-Cheng; Chang, Chung-Hsing; Chiu, Shang-Chen

    2011-09-01

    The fluorescent reaction is that an organism or dye, excited by UV light (200-405 nm), emits a specific frequency of light; the light is usually a visible or near infrared light (405-900 nm). During the UV light irradiation, the photosensitive agent will be induced to start the photochemical reaction. In addition, the fluorescence image can be used for fluorescence diagnosis and then photodynamic therapy can be given to dental diseases and skin cancer, which has become a useful tool to provide scientific evidence in many biomedical researches. However, most of the methods on acquiring fluorescence biology traces are still stay in primitive stage, catching by naked eyes and researcher's subjective judgment. This article presents a portable camera to obtain the fluorescence image and to make up a deficit from observer competence and subjective judgment. Furthermore, the portable camera offers the 375nm UV-LED exciting light source for user to record fluorescence image and makes the recorded image become persuasive scientific evidence. In addition, when the raising the rate between signal and noise, the signal processing module will not only amplify the fluorescence signal up to 70 %, but also decrease the noise significantly from environmental light on bill and nude mouse testing.

  5. Waveguide harmonic damper for klystron amplifier

    International Nuclear Information System (INIS)

    Kang, Y.

    1998-01-01

    A waveguide harmonic damper was designed for removing the harmonic frequency power from the klystron amplifiers of the APS linac. Straight coaxial probe antennas are used in a rectangular waveguide to form a damper. A linear array of the probe antennas is used on a narrow wall of the rectangular waveguide for damping klystron harmonics while decoupling the fundamental frequency in dominent TE 01 mode. The klystron harmonics can exist in the waveguide as waveguide higher-order modes above cutoff. Computer simulations are made to investigate the waveguide harmonic damping characteristics of the damper

  6. Active isotropic slabs: conditions for amplified reflection

    Science.gov (United States)

    Perez, Liliana I.; Matteo, Claudia L.; Etcheverry, Javier; Duplaá, María Celeste

    2012-12-01

    We analyse in detail the necessary conditions to obtain amplified reflection (AR) in isotropic interfaces when a plane wave propagates from a transparent medium towards an active one. First, we demonstrate analytically that AR is not possible if a single interface is involved. Then, we study the conditions for AR in a very simple configuration: normal incidence on an active slab immersed in transparent media. Finally, we develop an analysis in the complex plane in order to establish a geometrical method that not only describes the behaviour of active slabs but also helps to simplify the calculus.

  7. Active isotropic slabs: conditions for amplified reflection

    International Nuclear Information System (INIS)

    Perez, Liliana I; Duplaá, María Celeste; Matteo, Claudia L; Etcheverry, Javier

    2012-01-01

    We analyse in detail the necessary conditions to obtain amplified reflection (AR) in isotropic interfaces when a plane wave propagates from a transparent medium towards an active one. First, we demonstrate analytically that AR is not possible if a single interface is involved. Then, we study the conditions for AR in a very simple configuration: normal incidence on an active slab immersed in transparent media. Finally, we develop an analysis in the complex plane in order to establish a geometrical method that not only describes the behaviour of active slabs but also helps to simplify the calculus. (paper)

  8. Sm 3+-doped polymer optical waveguide amplifiers

    Science.gov (United States)

    Huang, Lihui; Tsang, Kwokchu; Pun, Edwin Yue-Bun; Xu, Shiqing

    2010-04-01

    Trivalent samarium ion (Sm 3+) doped SU8 polymer materials were synthesized and characterized. Intense red emission at 645 nm was observed under UV laser light excitation. Spectroscopic investigations show that the doped materials are suitable for realizing planar optical waveguide amplifiers. About 100 μm wide multimode Sm 3+-doped SU8 channel waveguides were fabricated using a simple UV exposure process. At 250 mW, 351 nm UV pump power, a signal enhancement of ˜7.4 dB at 645 nm was obtained for a 15 mm long channel waveguide.

  9. Fragments

    Science.gov (United States)

    Moreira, Claudio

    2008-01-01

    This performance autoethnography shows the author's struggle in finding his place, scholarship, voice, and body, into the academic setting. Mixing together memories of his lived experience with sugar cane workers, notes, and leftovers of different fieldworks, plus 6 years of life as grad student at the University of Illinois, the author looks for…

  10. Fragmentation

    Science.gov (United States)

    K.H. Riitters

    2009-01-01

    Effective resource management takes into account the administrative and biophysical settings within which natural resources occur. A setting may be described in many ways; for example, by forest land ownership, by reserved and roadless designation, or by the distribution of human populations in relation to forest (chapter 3). The physical arrangement of forest in a...

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

    Science.gov (United States)

    Tan, Ming-pu

    2010-01-01

    Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  13. Energy production using fission fragment rockets

    International Nuclear Information System (INIS)

    Chapline, G.; Matsuda, Y.

    1991-08-01

    Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

  14. Atomic-fluorescence spectrophotometry

    International Nuclear Information System (INIS)

    Bakhturova, N.F.; Yudelevich, I.G.

    1975-01-01

    Atomic-fluorescence spectrophotometry, a comparatively new method for the analysis of trace quantities, has developed rapidly in the past ten years. Theoretical and experimental studies by many workers have shown that atomic-fluorescence spectrophotometry (AFS) is capable of achieving a better limit than atomic absorption for a large number of elements. The present review examines briefly the principles of atomic-fluorescence spectrophotometry and the types of fluorescent transition. The excitation sources, flame and nonflame atomizers, used in AFS are described. The limits of detection achieved up to the present, using flame and nonflame methods of atomization are given

  15. Fluorescence of irradiated hydrocarbons

    International Nuclear Information System (INIS)

    Gulis, I.G.; Evdokimenko, V.M.; Lapkovskij, M.P.; Petrov, P.T.; Gulis, I.M.; Markevich, S.V.

    1977-01-01

    A visible fluorescence has been found out in γ-irradiated aqueous of carbohydrates. Two bands have been distinguished in fluorescence spectra of the irradiated solution of dextran: a short-wave band lambdasub(max)=140 nm (where lambda is a wave length) at lambdasub(β)=380 nm and a long-wave band with lambdasub(max)=540 nm at lambdasub(β)=430 nm. A similar form of the spectrum has been obtained for irradiated solutions of starch, amylopectin, lowmolecular glucose. It has been concluded that a macromolecule of polysaccharides includes fluorescent centres. A relation between fluorescence and α-oxiketon groups formed under irradiation has been pointed out

  16. Laser-induced fluorescence detection strategies for sodium atoms and compounds in high-pressure combustors

    Science.gov (United States)

    Weiland, Karen J. R.; Wise, Michael L.; Smith, Gregory P.

    1993-01-01

    A variety of laser-induced fluorescence schemes were examined experimentally in atmospheric pressure flames to determine their use for sodium atom and salt detection in high-pressure, optically thick environments. Collisional energy transfer plays a large role in fluorescence detection. Optimum sensitivity, at the parts in 10 exp 9 level for a single laser pulse, was obtained with the excitation of the 4p-3s transition at 330 nm and the detection of the 3d-3p fluorescence at 818 nm. Fluorescence loss processes, such as ionization and amplified spontaneous emission, were examined. A new laser-induced atomization/laser-induced fluorescence detection technique was demonstrated for NaOH and NaCl. A 248-nm excimer laser photodissociates the salt molecules present in the seeded flames prior to atom detection by laser-induced fluorescence.

  17. Trial manufacture of an insulated amplifier

    International Nuclear Information System (INIS)

    Okuno, Shigeo; Matsuura, Kiyokata.

    1978-10-01

    Trial manufacture of an insulated amplifier was carried out. The input signals are divided by filters Th and Tl into high frequency component and low frequency component. The high frequency component drives a transformer T 1 , and secondary signals are induced. The low frequency component drives a transformer T 2 through a buffer and a modulator. The secondary signals from both transformers are recombined to make the output signals. Compensation for the frequency characteristics of the high frequency transformer and that for the effect of a filter in the demodulation circuit for low frequency component are considered. The time constant of output signals for rectangular input signals was 30 microsec, when only the low frequency part is operated. The drift of the direct current level is within 5 mV. The characteristic features of the high frequency part was also investigated. The overall characteristic features of this amplifier were good for the frequency range of 0 to 500 kHz. (Kato, T.)

  18. Mechanical Amplifier for a Piezoelectric Transducer

    Science.gov (United States)

    Moore, James; Swain, Mark; Lawson, Peter; Calvet, Robert

    2003-01-01

    A mechanical amplifier has been devised to multiply the stroke of a piezoelectric transducer (PZT) intended for use at liquid helium temperatures. Interferometry holds the key to high angular resolution imaging and astrometry in space. Future space missions that will detect planets around other solar systems and perform detailed studies of the evolution of stars and galaxies will use new interferometers that observe at mid- and far-infrared wavelengths. Phase-measurement interferometry is key to many aspects of astronomical interferometry, and PZTs are ideal modulators for most methods of phase measurement, but primarily at visible wavelengths. At far infrared wavelengths of 150 to 300 m, background noise is a severe problem and all optics must be cooled to about 4 K. Under these conditions, piezos are ill-suited as modulators, because their throw is reduced by as much as a factor of 2, and even a wavelength or two of modulation is beyond their capability. The largest commercially available piezo stacks are about 5 in. (12.7 cm) long and have a throw of about 180 m at room temperature and only 90 m at 4 K. It would seem difficult or impossible to use PZTs for phase measurements in the far infrared were it not for the new mechanical amplifier that was designed and built.

  19. Direct solar-pumped iodine laser amplifier

    Science.gov (United States)

    Han, Kwang S.; Hwang, In Heon

    1990-01-01

    The optimum conditions of a solar pumped iodine laser are found in this research for the case of a continuous wave operation and a pulsed operation. The optimum product of the pressure(p) inside the laser tube and the tube diameter(d) was pd=40 approx. 50 torr-cm on the contrary to the case of a high intensity flashlamp pumped iodine laser where the optimum value of the product is known to be pd=150 torr-cm. The pressure-diameter product is less than 1/3 of that of the high power iodine laser. During the research period, various laser materials were also studied for solar pumping. Among the laser materials, Nd:YAG is found to have the lowest laser threshold pumping intensity of about 200 solar constant. The Rhodamine 6G was also tested as the solar pumped laser material. The threshold pumping power was measured to be about 20,000 solar constant. The amplification experiment for a continuously pumped iodine laser amplifier was performed using Vortek solar simulator and the amplification factors were measured for single pass amplification and triple pass amplification of the 15 cm long amplifier tube. The amplification of 5 was obtained for the triple pass amplification.

  20. Discretization analysis of bifurcation based nonlinear amplifiers

    Science.gov (United States)

    Feldkord, Sven; Reit, Marco; Mathis, Wolfgang

    2017-09-01

    Recently, for modeling biological amplification processes, nonlinear amplifiers based on the supercritical Andronov-Hopf bifurcation have been widely analyzed analytically. For technical realizations, digital systems have become the most relevant systems in signal processing applications. The underlying continuous-time systems are transferred to the discrete-time domain using numerical integration methods. Within this contribution, effects on the qualitative behavior of the Andronov-Hopf bifurcation based systems concerning numerical integration methods are analyzed. It is shown exemplarily that explicit Runge-Kutta methods transform the truncated normalform equation of the Andronov-Hopf bifurcation into the normalform equation of the Neimark-Sacker bifurcation. Dependent on the order of the integration method, higher order terms are added during this transformation.A rescaled normalform equation of the Neimark-Sacker bifurcation is introduced that allows a parametric design of a discrete-time system which corresponds to the rescaled Andronov-Hopf system. This system approximates the characteristics of the rescaled Hopf-type amplifier for a large range of parameters. The natural frequency and the peak amplitude are preserved for every set of parameters. The Neimark-Sacker bifurcation based systems avoid large computational effort that would be caused by applying higher order integration methods to the continuous-time normalform equations.

  1. Quantum dots for lasers, amplifiers and computing

    International Nuclear Information System (INIS)

    Bimberg, Dieter

    2005-01-01

    For InAs-GaAs based quantum dot lasers emitting at 1300 nm, digital modulation showing an open eye pattern up to 12 Gb s -1 at room temperature is demonstrated, at 10 Gb s -1 the bit error rate is below 10 -12 at -2 dB m receiver power. Cut-off frequencies up to 20 GHz are realised for lasers emitting at 1.1 μm. Passively mode-locked QD lasers generate optical pulses with repetition frequencies between 5 and 50 GHz, with a minimum Fourier limited pulse length of 3 ps. The uncorrelated jitter is below 1 ps. We use here deeply etched narrow ridge waveguide structures which show excellent performance similar to shallow mesa structures, but a circular far field at a ridge width of 1 μm, improving coupling efficiency into fibres. No beam filamentation of the fundamental mode, low a-factors and strongly reduced sensitivity to optical feedback are observed. QD lasers are thus superior to QW lasers for any system or network. Quantum dot semiconductor optical amplifier (QD SOAs) demonstrate gain recovery times of 120-140 fs, 4-7 times faster than bulk/QW SOAs, and a net gain larger than 0.4 dB/(mm*QD-layer) providing us with novel types of booster amplifiers and Mach-Zehnder interferometers. These breakthroughs became possible due to systematic development of self-organized growth technologies

  2. Development of FIR arrays with integrating amplifiers

    Science.gov (United States)

    Young, Erick T.

    1988-08-01

    The development of optimized photoconductor arrays suitable for far infrared space astronomical applications are described. Although the primary impetus is the production of a 16 by 16 element Ge:Ga demonstration array for SIRTF, the extension of this technology to Large Deployable Reflector (LDR) is considered. The optimization of Ge:Ga and Ge:Be photoconductor materials is discussed. In collaboration with Lawrence Berkeley Laboratory, measurements of FIR photoconductors with quantum efficiencies greater than 20 percent at 100 micrometers, and dark currents below 300 electrons/s are presented. Integrating J-FET amplifier technology is discussed. The current generation of integrating amplifiers has a demonstrated read noise of less than 20 electrons for an integration time of 100 s. The design is shown for a stackable 16 x n Ge:Ga array that utilizes a 16-channel monolithic version of the J-FET integrator. A part of the design is the use of a thin, thermally insulating substrate that allows the electronics to operate at the optimum temperature of 50 K while maintaining thermal and optical isolation from the detectors at 2 K. The power dissipation for the array is less than 16 mW. The array design may particularly be applicable to high resolution imaging spectrometers for LDR.

  3. Multipath interference test method for distributed amplifiers

    Science.gov (United States)

    Okada, Takahiro; Aida, Kazuo

    2005-12-01

    A method for testing distributed amplifiers is presented; the multipath interference (MPI) is detected as a beat spectrum between the multipath signal and the direct signal using a binary frequency shifted keying (FSK) test signal. The lightwave source is composed of a DFB-LD that is directly modulated by a pulse stream passing through an equalizer, and emits the FSK signal of the frequency deviation of about 430MHz at repetition rate of 80-100 kHz. The receiver consists of a photo-diode and an electrical spectrum analyzer (ESA). The base-band power spectrum peak appeared at the frequency of the FSK frequency deviation can be converted to amount of MPI using a calibration chart. The test method has improved the minimum detectable MPI as low as -70 dB, compared to that of -50 dB of the conventional test method. The detailed design and performance of the proposed method are discussed, including the MPI simulator for calibration procedure, computer simulations for evaluating the error caused by the FSK repetition rate and the fiber length under test and experiments on singlemode fibers and distributed Raman amplifier.

  4. Fragmentation of suddenly heated liquids

    International Nuclear Information System (INIS)

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion

  5. Fragment separator momentum compression schemes

    Energy Technology Data Exchange (ETDEWEB)

    Bandura, Laura, E-mail: bandura@anl.gov [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Erdelyi, Bela [Argonne National Laboratory, Argonne, IL 60439 (United States); Northern Illinois University, DeKalb, IL 60115 (United States); Hausmann, Marc [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Kubo, Toshiyuki [RIKEN Nishina Center, RIKEN, Wako (Japan); Nolen, Jerry [Argonne National Laboratory, Argonne, IL 60439 (United States); Portillo, Mauricio [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Sherrill, Bradley M. [National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States)

    2011-07-21

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  6. Fragment separator momentum compression schemes

    International Nuclear Information System (INIS)

    Bandura, Laura; Erdelyi, Bela; Hausmann, Marc; Kubo, Toshiyuki; Nolen, Jerry; Portillo, Mauricio; Sherrill, Bradley M.

    2011-01-01

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  7. Asymmetry effects in fragment production

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet [Sri Guru Granth Sahib World University, Fatehgarh Sahib-140406, Punjab (India); Kaur, Varinderjit, E-mail: drvarinderjit@gmail.com [Mata Gujri College, Fatehgarh Sahib-140406, Punjab (India)

    2016-05-06

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping At{sub otal} fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of {sup 197}Au+{sup 27}Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  8. Fragmentation of percolation cluster perimeters

    Science.gov (United States)

    Debierre, Jean-Marc; Bradley, R. Mark

    1996-05-01

    We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

  9. A high gain energy amplifier operated with fast neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Rubbia, C. [CERN, Geneva (Switzerland)

    1995-10-01

    The basic concept and the main practical considerations of an Energy Amplifier (EA) have been exhaustively described elsewhere. Here the concept of the EA is further explored and additional schemes are described which offer a higher gain, a larger maximum power density and an extended burn-up. All these benefits stem from the use of fast neutrons, instead of thermal or epithermal ones, which was the case in the original study. The higher gain is due both to a more efficient high energy target configuration and to a larger, practical value of the multiplication factor. The higher power density results from the higher permissible neutron flux, which in turn is related to the reduced rate of {sup 233}Pa neutron captures (which, as is well known, suppress the formation of the fissile {sup 233}U fuel) and the much smaller k variations after switch-off due to {sup 233}Pa decays for a given burn-up rate. Finally a longer integrated burn-up is made possible by reduced capture rate by fission fragments of fast neutrons. In practice a 20 MW proton beam (20 mA @ 1 GeV) accelerated by a cyclotron will suffice to operate a compact EA at the level of {approx} 1 GW{sub e}. The integrated fuel burn-up can be extended in excess of 100 GW d/ton, limited by the mechanical survival of the fuel elements. Radio-Toxicity accumulated at the end of the cycle is found to be largely inferior to the one of an ordinary Reactor for the same energy produced. Schemes are proposed which make a {open_quotes}melt-down{close_quotes} virtually impossible. The conversion ratio, namely the rate of production of {sup 233}U relative to consumption is generally larger than unity, which permits production of fuel for other uses. Alternatively the neutron excess can be used to transform unwanted {open_quotes}ashes{close_quotes} into more acceptable elements.

  10. Fragmented nature: consequences for biodiversity

    OpenAIRE

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species with different size and mobility can be regulated by different processes at the same spatial scale, a principle that may contribute to diversity. Differences in species richness between local commu...

  11. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  12. Intermittency in 197Au fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs

  13. Residual Fragments after Percutaneous Nephrolithotomy

    Directory of Open Access Journals (Sweden)

    Kaan Özdedeli

    2012-09-01

    Full Text Available Clinically insignificant residual fragments (CIRFs are described as asymptomatic, noninfectious and nonobstructive stone fragments (≤4 mm remaining in the urinary system after the last session of any intervention (ESWL, URS or PCNL for urinary stones. Their insignificance is questionable since CIRFs could eventually become significant, as their presence may result in recurrent stone growth and they may cause pain and infection due to urinary obstruction. They may become the source of persistent infections and a significant portion of the patients will have a stone-related event, requiring auxilliary interventions. CT seems to be the ultimate choice of assessment. Although there is no concensus about the timing, recent data suggests that it may be performed one month after the procedure. However, imaging can be done in the immediate postoperative period, if there are no tubes blurring the assessment. There is some evidence indicating that selective medical therapy may have an impact on decreasing stone formation rates. Retrograde intrarenal surgery, with its minimally invasive nature, seems to be the best way to deal with residual fragments.

  14. Fragmentation measurement using image processing

    Directory of Open Access Journals (Sweden)

    Farhang Sereshki

    2016-12-01

    Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

  15. Geometrical scaling of jet fragmentation photons

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

    2016-12-15

    We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

  16. Interactions between colloidal silver and photosynthetic pigments located in cyanobacteria fragments and in solution.

    Science.gov (United States)

    Siejak, Przemysław; Frackowiak, Danuta

    2007-09-25

    Changes in the yield of the fluorescence emitted by pigments of photosynthetic organisms could be used for the establishment of the presence of some toxic substances. The presence of colloidal metals can be indicated by enhancement of pigments' emission as a result of plasmons generation. The spectra of the pigments of cyanobacterium Synechocystis located in the bacterium fragments and in solutions with and without colloidal silver additions have been measured. The quantum yield of the pigments' fluorescence in solution has been observed to increase at some wavelength of excitation, while the fluorescence of the pigments in the bacteria fragments has been only quenched as a consequence of interactions with colloidal silver particles. Close contact between pigment molecules located in bacteria fragments and silver particles is probably not possible. We plan in future to investigate the influence of other, more typical metal pollutants of water, using similar spectral methods and several other photosynthetic bacteria pigments, in solution, in cell fragments and in the whole bacteria organisms.

  17. Membranes and Fluorescence microscopy

    DEFF Research Database (Denmark)

    Bagatolli, Luis

    2009-01-01

    Fluorescence spectroscopy-based techniques using conventional fluorimeters have been extensively applied since the late 1960s to study different aspects of membrane-related phenomena, i.e., mainly relating to lipid-lipid and lipid-protein (peptide) interactions. Even though fluorescence...

  18. Multimodal fluorescence imaging spectroscopy

    NARCIS (Netherlands)

    Stopel, Martijn H W; Blum, Christian; Subramaniam, Vinod; Engelborghs, Yves; Visser, Anthonie J.W.G.

    2014-01-01

    Multimodal fluorescence imaging is a versatile method that has a wide application range from biological studies to materials science. Typical observables in multimodal fluorescence imaging are intensity, lifetime, excitation, and emission spectra which are recorded at chosen locations at the sample.

  19. Evolution equations for extended dihadron fragmentation functions

    International Nuclear Information System (INIS)

    Ceccopieri, F.A.; Bacchetta, A.

    2007-03-01

    We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

  20. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  1. Direct coupled amplifiers using field effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, E P [Control and Instrumentation Division, Atomic Energy Establishment, Winfrith, Dorchester, Dorset (United Kingdom)

    1964-03-15

    The concept of the uni-polar field effect transistor (P.E.T.) was known before the invention of the bi-polar transistor but it is only recently that they have been made commercially. Being produced as yet only in small quantities, their price imposes a restriction on use to circuits where their peculiar properties can be exploited to the full. One such application is described here where the combination of low voltage drift and relatively low input leakage current are necessarily used together. One of the instruments used to control nuclear reactors has a logarithmic response to the mean output current from a polarised ionisation chamber. The logarithmic signal is then differentiated electrically, the result being displayed on a meter calibrated to show the reactor divergence or doubling time. If displayed in doubling time the scale is calibrated reciprocally. Because of the wide range obtained in the logarithmic section and the limited supply voltage, an output of 1 volt per decade change in ionisation current is used. Differentiating this gives a current of 1.5 x 10{sup -8} A for p.s.D. (20 sec. doubling time) in the differentiating amplifier. To overcome some of the problems of noise due to statistical variations in input current, the circuit design necessitates a resistive path to ground at the amplifier input of 20 M.ohms. A schematic diagram is shown. 1. It is evident that a zero drift of 1% can be caused by a leakage current of 1.5 x 10{sup -10} A or an offset voltage of 3 mV at the amplifier input. Although the presently used electrometer valve is satisfactory from the point of view of grid current, there have been sudden changes in grid to grid voltage (the valve is a double triode) of up to 10 m.V. It has been found that a pair of F.E.T's. can be used to replace the electrometer valve so long as care is taken in correct balance of the two devices. An investigation has been made into the characteristics of some fourteen devices to see whether those with

  2. Single-mode operation of a coiled multimode fiber amplifier

    International Nuclear Information System (INIS)

    Koplow, Jeffrey P.; Kliner, Dahv A. V.; Goldberg, Lew

    2000-01-01

    We report a new approach to obtaining single-transverse-mode operation of a multimode fiber amplifier in which the gain fiber is coiled to induce significant bend loss for all but the lowest-order mode. We demonstrated this method by constructing a coiled amplifier using Yb-doped, double-clad fiber with a core diameter of 25 μm and a numerical aperture of ∼0.1 (V≅7.4) . When the amplifier was operated as an amplified-spontaneous-emission source, the output beam had an M 2 value of 1.09±0.09 ; when seeded at 1064 nm, the slope efficiency was similar to that of an uncoiled amplifier. This technique will permit scaling of pulsed fiber lasers and amplifiers to significantly higher pulse energies and peak powers and cw fiber sources to higher average powers while maintaining excellent beam quality. (c) 2000 Optical Society of America

  3. Realization of OFCC based Transimpedance Mode Instrumentation Amplifier

    Directory of Open Access Journals (Sweden)

    Neeta Pandey

    2016-01-01

    Full Text Available The paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three Operational Floating Current Conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematicThe paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three operational floating current conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematic.

  4. Protein- protein interaction detection system using fluorescent protein microdomains

    Science.gov (United States)

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  5. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  6. Photon-hadron fragmentation: theoretical situation

    International Nuclear Information System (INIS)

    Peschanski, R.

    1983-07-01

    Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

  7. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  8. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  9. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  10. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  11. Neighbouring charge fragmentations in low energy fission

    International Nuclear Information System (INIS)

    Montoya, M.

    1986-10-01

    Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

  12. Modeling and design techniques for RF power amplifiers

    CERN Document Server

    Raghavan, Arvind; Laskar, Joy

    2008-01-01

    The book covers RF power amplifier design, from device and modeling considerations to advanced circuit design architectures and techniques. It focuses on recent developments and advanced topics in this area, including numerous practical designs to back the theoretical considerations. It presents the challenges in designing power amplifiers in silicon and helps the reader improve the efficiency of linear power amplifiers, and design more accurate compact device models, with faster extraction routines, to create cost effective and reliable circuits.

  13. GaN-based Power amplifiers for microwave applications

    Directory of Open Access Journals (Sweden)

    Jorge Julián Moreno-Rubio

    2016-01-01

    Full Text Available This paper presents a discussion about the design strategies of different kind of power amplifiers for RF/Microwave appli- cations, such as the tuned load power amplifier, class F, class F-1 and Doherty. Furthermore, it is shown the continuous wave characterization of the amplifiers above mentioned. A comparison between the obtained results, in terms of gain, efficiency and output power is presented.

  14. InP Heterojunction Bipolar Transistor Amplifiers to 255 GHz

    Science.gov (United States)

    Radisic, Vesna; Sawdai, Donald; Scott, Dennis; Deal, William; Dang, Linh; Li, Danny; Cavus, Abdullah; To, Richard; Lai, Richard

    2009-01-01

    Two single-stage InP heterojunction bipolar transistor (HBT) amplifiers operate at 184 and 255 GHz, using Northrop Grumman Corporation s InP HBT MMIC (monolithic microwave integrated circuit) technology. At the time of this reporting, these are reported to be the highest HBT amplifiers ever created. The purpose of the amplifier design is to evaluate the technology capability for high-frequency designs and verify the model for future development work.

  15. Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

    Directory of Open Access Journals (Sweden)

    R. Sarman

    1997-04-01

    Full Text Available The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

  16. Adipose tissue-derived microvascular fragments from aged donors exhibit an impaired vascularisation capacity

    Directory of Open Access Journals (Sweden)

    MW Laschke

    2014-10-01

    Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.

  17. Compressed magnetic flux amplifier with capacitive load

    International Nuclear Information System (INIS)

    Stuetzer, O.M.

    1980-03-01

    A first-order analysis is presented for a compressed magnetic flux (CMF) current amplifier working into a load with a capacitive component. Since the purpose of the investigation was to gain a general understanding of the arrangement, a number of approximations and limitations were accepted. The inductance of the transducer varies with time; the inductance/resistance/capacitance (LRC) circuit therefore is parametric and solutions are different for the stable regime (high C), the oscillation regime (low C), and the transition case. Solutions and performance depend strongly on circuit boundary conditions, i.e., energization of the circuit by either an injected current or by an applied capacitor charge. The behavior of current and energy amplification for the various cases are discussed in detail. A number of experiments with small CMF devices showed that the first-order theory presented predicts transducer performance well in the linear regime

  18. Noise-driven neuromorphic tuned amplifier

    Science.gov (United States)

    Fanelli, Duccio; Ginelli, Francesco; Livi, Roberto; Zagli, Niccoló; Zankoc, Clement

    2017-12-01

    We study a simple stochastic model of neuronal excitatory and inhibitory interactions. The model is defined on a directed lattice and internodes couplings are modulated by a nonlinear function that mimics the process of synaptic activation. We prove that such a system behaves as a fully tunable amplifier: the endogenous component of noise, stemming from finite size effects, seeds a coherent (exponential) amplification across the chain generating giant oscillations with tunable frequencies, a process that the brain could exploit to enhance, and eventually encode, different signals. On a wider perspective, the characterized amplification process could provide a reliable pacemaking mechanism for biological systems. The device extracts energy from the finite size bath and operates as an out of equilibrium thermal machine, under stationary conditions.

  19. Rippled beam free electron laser amplifier

    Science.gov (United States)

    Carlsten, Bruce E.

    1999-01-01

    A free electron laser amplifier provides a scalloping annular electron beam that interacts with the axial electric field of a TM.sub.0n mode. A waveguide defines an axial centerline and, a solenoid arranged about the waveguide produces an axial constant magnetic field within the waveguide. An electron beam source outputs a annular electron beam that interacts with the axial magnetic field to have an equilibrium radius and a ripple radius component having a variable radius with a ripple period along the axial centerline. An rf source outputs an axial electric field that propagates within the waveguide coaxial with the electron beam and has a radial mode that interacts at the electron beam at the equilibrium radius component of the electron beam.

  20. Current feedback operational amplifiers and their applications

    CERN Document Server

    Senani, Raj; Singh, A K; Singh, V K

    2013-01-01

    This book describes a variety of current feedback operational amplifier (CFOA) architectures and their applications in analog signal processing/generation. Coverage includes a comprehensive survey of commercially available, off-the-shelf integrated circuit CFOAs, as well as recent advances made on the design of CFOAs, including design innovations for bipolar and CMOS CFOAs.  This book serves as a single-source reference to the topic, as well as a catalog of over 200 application circuits which would be useful not only for students, educators and researchers in apprising them about the recent developments in the area but would also serve as a comprehensive repertoire of useful circuits for practicing engineers who might be interested in choosing an appropriate CFOA-based topology for use in a given application.

  1. A highly linear power amplifier for WLAN

    International Nuclear Information System (INIS)

    Jin Jie; Shi Jia; Ai Baoli; Zhang Xuguang

    2016-01-01

    A three-stage power amplifier (PA) for WLAN application in 2.4-2.5 GHz is presented. The proposed PA employs an adaptive bias circuit to adjust the operating point of the PA to improve the linearity of the PA. Two methods to short the 2nd harmonic circuit are compared in the area of efficiency and gain of the PA. The PA is taped out in the process of 2 μm InGaP/GaAs HBT and is tested by the evaluation board. The measured results show that 31.5 dB power gain and 29.3 dBm P 1dB with an associated 40.4% power added efficiency (PAE) under the single tone stimulus. Up to 26.5 dBm output power can be achieved with an error vector magnitude (EVM) of lower than 3% under the 64QAM/OFDM WLAN stimulus. (paper)

  2. New developments in relativistic klystron amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Friedman, M; Colombant, D; Fernsler, R; Hubbard, R; Lampe, M; Serlin, V; Slinker, S [Naval Research Lab., Washington, DC (United States). Plasma Physics Div.

    1997-12-31

    A relativistic klystron amplifier that employed cavities with inductively loaded wide gaps and a novel converter has achieved 50% energy efficiency, a significant advance over the previous state of the art of 20%. The new device was immersed in a 3 kG magnetic field and contained two innovations: (1) Wide gaps which include an inductively loaded return current structure that was opaque to the unmodulated beam space charge but transparent to the RF field. (2) A novel converter that was made of a `leaky` cavity with a radially-converging inductively-loaded structure that was inserted in the output wide-gap. This structure reduced the potential energy residing in the electron beam and maximized RF output energy. (author). 4 figs., 13 refs.

  3. Optical oscillator-amplifier laser configuration

    International Nuclear Information System (INIS)

    McAllister, G.L.

    1975-01-01

    A laser is described that has incorporated therein an oscillator formed by a pair of mirrors, at least one of the mirrors being positioned outside of the envelope. The mirrors are dimensioned and spaced from each other so that the resonator has a relatively low Fresnel number and is operated unstably. The entire surface of one of these mirrors is convex and diffracts a portion of the energy outside of the oscillator region. Also incorporated into the laser is an amplifier region defined by a separate pair of mirrors which receive the energy diffracted from the oscillator region. The second pair of mirrors form an optical system with a high Fresnel number. A filter, modulator or other control for the laser signal may be placed outside the laser envelope in the optical path of the oscillator

  4. Coherent combination of ultrafast fiber amplifiers

    International Nuclear Information System (INIS)

    Hanna, Marc; Guichard, Florent; Druon, Frédéric; Georges, Patrick; Zaouter, Yoann; Papadopoulos, Dimitris N

    2016-01-01

    We review recent progress in coherent combining of femtosecond pulses amplified in optical fibers as a way to scale the peak and average power of ultrafast sources. Different methods of achieving coherent pulse addition in space (beam combining) and time (divided pulse amplification) domains are described. These architectures can be widely classified into active methods, where the relative phases between pulses are subject to a servomechanism, and passive methods, where phase matching is inherent to the geometry. Other experiments that combine pulses with different spectral contents, pulses that have been nonlinearly broadened or successive pulses from a mode-locked laser oscillator, are then presented. All these techniques allow access to unprecedented parameter range for fiber ultrafast sources. (topical review)

  5. Pulse shaping amplifier (PSA) for nuclear spectroscopy system

    International Nuclear Information System (INIS)

    Lombigit, L.; Maslina Mohd Ibrahim; Nolida Yusup; Nur Aira Abdul Rahman; Yong, C.F.

    2014-01-01

    Pulse Shaping Amplifier (PSA) is an essential components in nuclear spectroscopy system. This networks have two functions; to shape the output pulse and performs noise filtering. In this paper, we describes procedure for design and development of a pulse shaping amplifier which can be used for nuclear spectroscopy system. This prototype was developed using high performance electronics devices and assembled on a FR4 type printed circuit board. Performance of this prototype was tested by comparing it with an equivalent commercial spectroscopy amplifier (Model SILENA 7611). The test results show that the performance of this prototype is comparable to the commercial spectroscopic amplifier. (author)

  6. Ring cavity for a Raman capillary waveguide amplifier

    Science.gov (United States)

    Kurnit, N.A.

    1981-01-27

    A regenerative ring amplifier and regenerative ring oscillator are described which function to feed back a portion of the Stokes signal to complete the ring cavity. The ring cavity configuration allows the CO/sub 2/ laser pump signal and Stokes signal to copropagate through the Raman capillary waveguide amplifier. A Raman capillary waveguide amplifier is also provided in the return leg of the ring cavity to increase gain without increasing the round trip time. Additionally, the ring cavity can be designed such that the amplified Stokes signal is synchronous with the mode-locked spikes of the incoming CO/sub 2/ laser pump signal.

  7. GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

    International Nuclear Information System (INIS)

    Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

    2008-01-01

    Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

  8. Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

    International Nuclear Information System (INIS)

    Gartia, Manas Ranjan; Hsiao, Austin; Logan Liu, G; Sivaguru, Mayandi; Chen Yi

    2011-01-01

    We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

  9. Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

    Energy Technology Data Exchange (ETDEWEB)

    Gartia, Manas Ranjan [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois, Urbana, IL 61801 (United States); Hsiao, Austin; Logan Liu, G [Department of Bioengineering, University of Illinois, Urbana, IL 61801 (United States); Sivaguru, Mayandi [Institute for Genomic Biology, University of Illinois, Urbana, IL 61801 (United States); Chen Yi, E-mail: loganliu@illinois.edu [Department of Electrical and Computer Engineering, University of Illinois, Urbana, IL 61801 (United States)

    2011-09-07

    We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

  10. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  11. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  12. Fission fragment excited laser system

    Science.gov (United States)

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  13. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  14. Velocity distribution of fragments of catastrophic impacts

    Science.gov (United States)

    Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

    1992-01-01

    Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

  15. Neratinib shows efficacy in the treatment of HER2/neu amplified uterine serous carcinoma in vitro and in vivo.

    Science.gov (United States)

    Schwab, Carlton L; English, Diana P; Roque, Dana M; Bellone, Stefania; Lopez, Salvatore; Cocco, Emiliano; Nicoletti, Roberta; Rutherford, Thomas J; Schwartz, Peter E; Santin, Alessandro D

    2014-10-01

    Uterine serous carcinoma (USC) represents an aggressive variant of endometrial cancer and accounts for a large proportion of deaths annually. HER2/neu amplification is associated with USC in approximately 30-35% of cases. The objective of this study was to determine the sensitivity of a panel of primary USC cell lines to the small tyrosine kinase inhibitor neratinib, an ErbB1 and HER2 inhibitor, both in vitro and in vivo. HER2/neu amplification was determined by immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) in 24 USC cell lines. Flow cytometry was used to determine the effects of neratinib on cell viability, cell cycle distribution and signaling in vitro. Mice harboring HER2/neu amplified xenografts were treated with neratinib to assess the efficacy of the drug in vivo. HER2/neu amplification was noted in 8/24 primary cell lines. Data regarding the efficacy of neratinib was determined using 4 HER2 amplified cell lines and 4 non-amplified cell lines with similar growth rates. Data revealed that cell lines with HER2/neu amplification were exquisitely more sensitive to neratinib compared to non-amplified cell lines (mean ± SEM IC50: 0.011μM ± 0.0008 vs. 0.312μM ± 0.0456 pNeratinib caused arrest in the G0/G1 phase of the cell cycle and resulted in decreased autophosphorylation of HER2 and activation of S6. Neratinib treated mice harboring xenografts of HER2/neu amplified USC showed delayed tumor growth and improved overall survival compared to vehicle (p=0.0019). Neratinib may be a potential treatment option for patients harboring HER2/neu amplified USC. Clinical trials for this subset of endometrial cancer patients are warranted. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Fluorescence and Spectral Imaging

    Directory of Open Access Journals (Sweden)

    Ralph S. DaCosta

    2007-01-01

    Full Text Available Early identification of dysplasia remains a critical goal for diagnostic endoscopy since early discovery directly improves patient survival because it allows endoscopic or surgical intervention with disease localized without lymph node involvement. Clinical studies have successfully used tissue autofluorescence with conventional white light endoscopy and biopsy for detecting adenomatous colonic polyps, differentiating benign hyperplastic from adenomas with acceptable sensitivity and specificity. In Barrett's esophagus, the detection of dysplasia remains problematic because of background inflammation, whereas in the squamous esophagus, autofluorescence imaging appears to be more dependable. Point fluorescence spectroscopy, although playing a crucial role in the pioneering mechanistic development of fluorescence endoscopic imaging, does not seem to have a current function in endoscopy because of its nontargeted sampling and suboptimal sensitivity and specificity. Other point spectroscopic modalities, such as Raman spectroscopy and elastic light scattering, continue to be evaluated in clinical studies, but still suffer the significant disadvantages of being random and nonimaging. A recent addition to the fluorescence endoscopic imaging arsenal is the use of confocal fluorescence endomicroscopy, which provides real-time optical biopsy for the first time. To improve detection of dysplasia in the gastrointestinal tract, a new and exciting development has been the use of exogenous fluorescence contrast probes that specifically target a variety of disease-related cellular biomarkers using conventional fluorescent dyes and novel potent fluorescent nanocrystals (i.e., quantum dots. This is an area of great promise, but still in its infancy, and preclinical studies are currently under way.

  17. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  18. Models of fragmentation with composite power laws

    Science.gov (United States)

    Tavassoli, Z.; Rodgers, G. J.

    1999-06-01

    Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

  19. Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications

    Directory of Open Access Journals (Sweden)

    José A. Centeno

    2014-01-01

    Full Text Available Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU, tungsten (W, lead (Pb, and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF, scanning electron microscopy (SEM, laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS, and confocal laser Raman

  20. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....