Role of Pectoral Fin Flexibility in Robotic Fish Performance

Science.gov (United States)

Bazaz Behbahani, Sanaz; Tan, Xiaobo

2017-08-01

Pectoral fins play a vital role in the maneuvering and locomotion of fish, and they have become an important actuation mechanism for robotic fish. In this paper, we explore the effect of flexibility of robotic fish pectoral fins on the robot locomotion performance and mechanical efficiency. A dynamic model for the robotic fish is presented, where the flexible fin is modeled as multiple rigid elements connected via torsional springs and dampers. Blade element theory is used to capture the hydrodynamic force on the fin. The model is validated with experimental results obtained on a robotic fish prototype, equipped with 3D-printed fins of different flexibility. The model is then used to analyze the impacts of fin flexibility and power/recovery stroke speed ratio on the robot swimming speed and mechanical efficiency. It is found that, in general, flexible fins demonstrate advantages over rigid fins in speed and efficiency at relatively low fin-beat frequencies, while rigid fins outperform flexible fins at higher frequencies. For a given fin flexibility, the optimal frequency for speed performance differs from the optimal frequency for mechanical efficiency. In addition, for any given fin, there is an optimal power/recovery stroke speed ratio, typically in the range of 2-3, that maximizes the speed performance. Overall, the presented model offers a promising tool for fin flexibility and gait design, to achieve speed and efficiency objectives for robotic fish actuated with pectoral fins.

Multiconformation, Density Functional Theory-Based pKa Prediction in Application to Large, Flexible Organic Molecules with Diverse Functional Groups.

Science.gov (United States)

Bochevarov, Art D; Watson, Mark A; Greenwood, Jeremy R; Philipp, Dean M

2016-12-13

We consider the conformational flexibility of molecules and its implications for micro- and macro-pK a . The corresponding formulas are derived and discussed against the background of a comprehensive scientific and algorithmic description of the latest version of our computer program Jaguar pK a , a density functional theory-based pK a predictor, which is now capable of acting on multiple conformations explicitly. Jaguar pK a is essentially a complex computational workflow incorporating research and technologies from the fields of cheminformatics, molecular mechanics, quantum mechanics, and implicit solvation models. The workflow also makes use of automatically applied empirical corrections which account for the systematic errors resulting from the neglect of explicit solvent interactions in the algorithm's implicit solvent model. Applications of our program to large, flexible organic molecules representing several classes of functional groups are shown, with a particular emphasis in illustrations laid on drug-like molecules. It is demonstrated that a combination of aggressive conformational search and an explicit consideration of multiple conformations nearly eliminates the dependence of results on the initially chosen conformation. In certain cases this leads to unprecedented accuracy, which is sufficient for distinguishing stereoisomers that have slightly different pK a values. An application of Jaguar pK a to proton sponges, the pK a of which are strongly influenced by steric effects, showcases the advantages that pK a predictors based on quantum mechanical calculations have over similar empirical programs.

Novel roles for immune molecules in neural development: Implications for neurodevelopmental disoders

Directory of Open Access Journals (Sweden)

Paula A Garay

2010-09-01

Full Text Available Although the brain has classically been considered "immune-privileged," current research suggests extensive communication between the nervous and the immune systems in both health and disease. Recent studies demonstrate that immune molecules are present at the right place and time to modulate the development and function of the healthy and diseased CNS. Indeed, immune molecules play integral roles in the CNS throughout neural development, including affecting neurogenesis, neuronal migration, axon guidance, synapse formation, activity-dependent refinement of circuits, and synaptic plasticity. Moreover, the roles of individual immune molecules in the nervous system may change over development. This review focuses on the effects of immune molecules on neuronal connections in the mammalian central nervous system—specifically the roles for MHCI and its receptors, complement, and cytokines on the function, refinement, and plasticity of cortical and hippocampal synapses and their relationship to neurodevelopmental disorders. These functions for immune molecules during neural development suggest that they could also mediate pathological responses to chronic elevations of cytokines in neurodevelopmental disorders, including autism spectrum disorders (ASD and schizophrenia.

Molecular-dynamics simulation of lateral friction in contact-mode atomic force microscopy of alkane films: The role of molecular flexibility

DEFF Research Database (Denmark)

Soza, P.; Hansen, Flemming Yssing; Taub, H.

2011-01-01

than on a surface of molecules with the long axis perpendicular to the surface, in agreement with experimental results. A major dissipation mechanism is the molecular flexibility as manifested in the torsional motion about the molecules' C-C bonds. The generation of gauche defects as a result...

A role for adhesion molecules in contact-dependent T help for B cells

DEFF Research Database (Denmark)

Owens, T

1991-01-01

The role of cell contact in T-dependent B cell activation was examined. Small resting B cells from C57BL/6 mice were cultured with CBA-derived, non-alloreactive cloned T helper cells in anti-T cell receptor V beta 8-coated microwells. This induced polyclonal B cell activation to enter cell cycle...... that continued cell contact involving adhesion/accessory molecules induces B cells to proliferate and to respond to T cell lymphokines. A signaling role for cell interaction molecules on B cells is proposed, similar to the role of these and analogous molecules on T cells....

Temporal flexibility and careers: The role of large-scale organizations for physicians

OpenAIRE

Forrest Briscoe

2006-01-01

Temporal flexibility and careers: The role of large-scale organizations for physicians. Forrest Briscoe Briscoe This study investigates how employment in large-scale organizations affects the work lives of practicing physicians. Well-established theory associates larger organizations with bureaucratic constraint, loss of workplace control, and dissatisfaction, but this author finds that large scale is also associated with greater schedule and career flexibility. Ironically, the bureaucratic p...

Flexible Bronchoscopy.

Science.gov (United States)

Miller, Russell J; Casal, Roberto F; Lazarus, Donald R; Ost, David E; Eapen, George A

2018-03-01

Flexible bronchoscopy has changed the course of pulmonary medicine. As technology advances, the role of the flexible bronchoscope for both diagnostic and therapeutic indications is continually expanding. This article reviews the historical development of the flexible bronchoscopy, fundamental uses of the flexible bronchoscope as a tool to examine the central airways and obtain diagnostic tissue, and the indications, complications, and contraindications to flexible bronchoscopy. Copyright © 2017 Elsevier Inc. All rights reserved.

Energy Flexibility in Retail Buildings

DEFF Research Database (Denmark)

Ma, Zheng; Billanes, Joy Dalmacio; Kjærgaard, Mikkel Baun

2017-01-01

Retail buildings has an important role for demand side energy flexibility because of their high energy consumption, variety of energy flexibility resources, and centralized control via building control systems. Energy flexibility requires agreements and collaborations among different actors......), with the discussion of the stakeholders’ roles and their interrelation in delivering energy flexibility with the influential factors to the actual implementation of energy flexible operation of their buildings. Based on a literature analysis, the results cover stakeholders’ types and roles, perceptions (drivers......, barriers, and benefits), energy management activities and technology adoptions, and the stakeholders’ interaction for the energy flexibility in retail buildings....

The Role of Immunoglobulin Superfamily Cell Adhesion Molecules in Cancer Metastasis

Directory of Open Access Journals (Sweden)

Chee Wai Wong

2012-01-01

Full Text Available Metastasis is a major clinical problem and results in a poor prognosis for most cancers. The metastatic pathway describes the process by which cancer cells give rise to a metastatic lesion in a new tissue or organ. It consists of interconnecting steps all of which must be successfully completed to result in a metastasis. Cell-cell adhesion is a key aspect of many of these steps. Adhesion molecules belonging to the immunoglobulin superfamily (Ig-SF commonly play a central role in cell-cell adhesion, and a number of these molecules have been associated with cancer progression and a metastatic phenotype. Surprisingly, the contribution of Ig-SF members to metastasis has not received the attention afforded other cell adhesion molecules (CAMs such as the integrins. Here we examine the steps in the metastatic pathway focusing on how the Ig-SF members, melanoma cell adhesion molecule (MCAM, L1CAM, neural CAM (NCAM, leukocyte CAM (ALCAM, intercellular CAM-1 (ICAM-1 and platelet endothelial CAM-1 (PECAM-1 could play a role. Although much remains to be understood, this review aims to raise the profile of Ig-SF members in metastasis formation and prompt further research that could lead to useful clinical outcomes.

Quantum atom-heteronuclear molecule dark state: Role of population imbalance

International Nuclear Information System (INIS)

Jing Hui; Cui Shuai

2010-01-01

Recently, the finite-number effect of initial atoms in coherent atom-molecule conversion was investigated by Zhao et al. [Phys. Rev. Lett. 101, 010401 (2008)]. Here, by extending to the atom-heteronuclear molecule dark state, we find that the initial populations imbalance of the atoms plays a significant role in quantum conversion rate and adiabatic fidelity. In particular, even for the finite total number of imbalanced two-species atoms, the mean-field conversion rate, contrary to the general belief, still can be remarkably close to the exact quantum results.

Reversible flexible structural changes in multidimensional MOFs by guest molecules (I{sub 2}, NH{sub 3}) and thermal stimulation

Energy Technology Data Exchange (ETDEWEB)

Chen, Yang; Li, Libo; Yang, Jiangfeng; Wang, Shuang; Li, Jinping, E-mail: Jpli211@hotmail.com

2015-03-15

Three metal–organic frameworks (MOFs), [Cu(INA){sub 2}], [Cu(INA){sub 2}I{sub 2}] and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}], were synthesized with 3D, 2D, and 0D structures, respectively. Reversible flexible structural changes of these MOFs were reported. Through high temperature (60–100 °C) stimulation of I{sub 2} or ambient temperature stimulation of NH{sub 3}, [Cu(INA){sub 2}] (3D) converted to [Cu(INA){sub 2}I{sub 2}] (2D) and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}] (0D); as the temperature increased to 150 °C, the MOFs changed back to their original form. In this way, this 3D MOF has potential application in the capture of I{sub 2} and NH{sub 3} from polluted water and air. XRD, TGA, SEM, NH{sub 3}-TPD, and the measurement of gas adsorption were used to describe the changes in processes regarding the structure, morphology, and properties. - Graphical abstract: Through I{sub 2}, NH{sub 3} molecules and thermal stimulation, the three MOFs can achieve reversible flexible structural changes. Different methods were used to prove the flexible reversible changes. - Highlights: • [Cu(INA){sub 2}] can flexible transform to [Cu(INA){sub 2}I{sub 2}] and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}] by adsorbing I{sub 2} or NH{sub 3}. • The reversible flexible transformation related to material source, temperature and concentration. • Potential applications for the capture of I{sub 2} and NH{sub 3} from polluted water or air.

Flexible molecular-scale electronic devices composed of diarylethene photoswitching molecules

KAUST Repository

Kim, Dongku; Jeong, Hyunhak; Lee, Hanki; Hwang, Wangtaek; Wolf, Jannic Sebastian; Scheer, Elke; Huhn, Thomas; Jeong, Heejun; Lee, Takhee

2014-01-01

The electrical properties of diarylethene photoswitching molecular devices on flexible substrates are studied. When exposed to UV or visible light, diarylethene molecular devices show two electrical states (a high and a low conductance state) with a discrepancy of an order of magnitude in the level of current between the two states. The diarylethene flexible molecular devices exhibit excellent long-time stability and reliable electrical characteristics in both conductance states when subjected to various mechanical stresses. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Flexible molecular-scale electronic devices composed of diarylethene photoswitching molecules

KAUST Repository

Kim, Dongku

2014-03-31

The electrical properties of diarylethene photoswitching molecular devices on flexible substrates are studied. When exposed to UV or visible light, diarylethene molecular devices show two electrical states (a high and a low conductance state) with a discrepancy of an order of magnitude in the level of current between the two states. The diarylethene flexible molecular devices exhibit excellent long-time stability and reliable electrical characteristics in both conductance states when subjected to various mechanical stresses. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Role of Vitamin D in the Immune System as a Pro-survival Molecule.

Science.gov (United States)

Chirumbolo, Salvatore; Bjørklund, Geir; Sboarina, Andrea; Vella, Antonio

2017-05-01

Vitamin D is a fascinating and attractive molecule that has gained particular attention in medicine in recent years. Its immunomodulatory and anti-inflammatory potential might resemble the activity of many nature-derived molecules (eg, flavonoids), but its role in biology was selected during a long evolutionary pathway to dampen the damaging effect of cell stress response and of the immune reaction. In this sense, this molecule can be considered an ancient hormone that serves, in its primary role, as a pro-survival agent. The goal of this review was to elucidate this topic. The article reviews current literature on the field, focusing on issues regarding the role of vitamin D in immunity. Vitamin D participates in the survival machinery used by the cell, and in particular it plays a major role in synchronizing calcium oscillatory signaling to allow cell autophagy or apoptosis during a stress response. Vitamin D should be better highlighted in its molecular action and vitamin D receptor genomics to conceive a more suited therapeutic supplementation protocol in clinics. Copyright © 2017 Elsevier HS Journals, Inc. All rights reserved.

Managing the Work and Family Roles. Does Flexibility Reduce the Negative Interference? An Exploratory Study

Directory of Open Access Journals (Sweden)

Cătălina CICEI

2015-12-01

Full Text Available Balancing work and family demands has become a great challenge for employees. By providing flexible benefits, organizations actively engage in endeavours aimed at reducing the negative interference between the two life spheres. Even if some empirical studies have examined the effects of family supportive initiatives, focusing on flexibility, however, the findings tend to lack consistency. If flexible benefits are traditionally associated with reduced levels of work-family conflict, in some studies no significant results have been reported. Another line of research suggests that flexibility can actually increase the negative work-family interface. From this perspective, the current study examines the relationship between the flexibility benefits used and work-family conflict, focusing especially on the role flextime and telecommuting. Using flexible benefits is negatively associated with time and strain-based conflict, the effects of flextime and telecommuting varying accordingly to the type of conflict examined. Limitations of the current study andfuture research directions are examined.

Linking meters and markets: Roles and incentives to support a flexible demand side

DEFF Research Database (Denmark)

Katz, Jonas

2014-01-01

wholesale market participants to the demand side is mostly infeasible, resulting in flexibility tasks being aggregated and delegated to balancing responsible wholesale traders. This analysis focuses on whether current incentives and roles are appropriate and where the design could be improved to establish......Present trends in the development of electricity systems are expected to generate a growing need for flexibility in decentralised resources, including demand response. In order to enable decentralised actors to create value, the organisation of markets and incentives should incorporate these new...... a flexible demand side with a particular focus on the Danish case. Design-related barriers are identified that affect expected value, associated risks, and the distribution of responsibilities. This serves as a basis to define policy options in the context of Nordic electricity markets. © 2014 Elsevier Ltd...

The role of water molecules in computational drug design.

Science.gov (United States)

de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

2010-01-01

Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

The Role of Cell Adhesion Molecule Genes Regulating Neuroplasticity in Addiction

Directory of Open Access Journals (Sweden)

Dawn E. Muskiewicz

2018-01-01

Full Text Available A variety of genetic approaches, including twin studies, linkage studies, and candidate gene studies, has established a firm genetic basis for addiction. However, there has been difficulty identifying the precise genes that underlie addiction liability using these approaches. This situation became especially clear in genome-wide association studies (GWAS of addiction. Moreover, the results of GWAS brought into clarity many of the shortcomings of those early genetic approaches. GWAS studies stripped away those preconceived notions, examining genes that would not previously have been considered in the study of addiction, consequently creating a shift in our understanding. Most importantly, those studies implicated a class of genes that had not previously been considered in the study of addiction genetics: cell adhesion molecules (CAMs. Considering the well-documented evidence supporting a role for various CAMs in synaptic plasticity, axonal growth, and regeneration, it is not surprising that allelic variation in CAM genes might also play a role in addiction liability. This review focuses on the role of various cell adhesion molecules in neuroplasticity that might contribute to addictive processes and emphasizes the importance of ongoing research on CAM genes that have been implicated in addiction by GWAS.

Flexibility and conformational change of IgG molecule

International Nuclear Information System (INIS)

Alpert, Y.; Ostanevich, Yu.M.

1982-12-01

The dynamic behaviour of pig anti-Dnp-immunoglobulin (IgG) investigated by the neutron spin echo technique gave evidence of internal motion of a biological macromolecule. It is suggested that this motion belongs to the wobbling of the Fab parts of the investigated IgG molecule around its so called hinge region. (author)

Scaling of the dynamics of flexible Lennard-Jones chains

DEFF Research Database (Denmark)

Veldhorst, Arno; Dyre, J. C.; Schrøder, Thomas

2014-01-01

functions of excess entropy) which has been observed in simulations of both molecular and polymeric systems. Doing molecular dynamics simulations of flexible Lennard-Jones chains (LJC) with rigid bonds, we here provide the first detailed test of the isomorph theory applied to flexible chain molecules. We...

In Silico Mechanistic Profiling to Probe Small Molecule Binding to Sulfotransferases

Science.gov (United States)

Martiny, Virginie Y.; Carbonell, Pablo; Lagorce, David; Villoutreix, Bruno O.; Moroy, Gautier; Miteva, Maria A.

2013-01-01

Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug–drug interactions. We focus on sulfotransferases (SULTs), a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD) simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands’ binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes. PMID:24039991

In silico mechanistic profiling to probe small molecule binding to sulfotransferases.

Directory of Open Access Journals (Sweden)

Virginie Y Martiny

Full Text Available Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug-drug interactions. We focus on sulfotransferases (SULTs, a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands' binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes.

Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

Science.gov (United States)

Spyrakis, Francesca; Cavasotto, Claudio N

2015-10-01

Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

Skill Flexibility among Schoolteachers: Operationalization and Organizational Implications.

Science.gov (United States)

Rosenblatt, Zehava; Inbal, Batia

1999-01-01

Investigates effects of skill flexibility on Israeli secondary teachers' work attitudes and job performance. Both role and functional flexibility were associated with improved teachers' work performance; role flexibility is linked to high organizational commitment and low powerlessness. Principals appreciate skill flexibility, but organizational…

Single molecule detection, thermal fluctuation and life

Science.gov (United States)

YANAGIDA, Toshio; ISHII, Yoshiharu

2017-01-01

Single molecule detection has contributed to our understanding of the unique mechanisms of life. Unlike artificial man-made machines, biological molecular machines integrate thermal noises rather than avoid them. For example, single molecule detection has demonstrated that myosin motors undergo biased Brownian motion for stepwise movement and that single protein molecules spontaneously change their conformation, for switching to interactions with other proteins, in response to thermal fluctuation. Thus, molecular machines have flexibility and efficiency not seen in artificial machines. PMID:28190869

Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

Science.gov (United States)

Meisel, Jayda E; Chang, Mayland

2017-11-01

The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

Flexibility within Fidelity

Science.gov (United States)

Kendall, Philip C.; Gosch, Elizabeth; Furr, Jami M.; Sood, Erica

2008-01-01

The authors address concerns regarding manual-based treatments, highlighting the role of flexibility and creativity. A cognitive-behavioral therapy for youth anxiety called the Coping Cat program demonstrates the flexible application of manuals and emphasizes the importance of a child-centered, personalized approach that involves the child in the…

How does emotion influence different creative performances? The mediating role of cognitive flexibility.

Science.gov (United States)

Lin, Wei-Lun; Tsai, Ping-Hsun; Lin, Hung-Yu; Chen, Hsueh-Chih

2014-01-01

Cognitive flexibility is proposed to be one of the factors underlying how positive emotions can improve creativity. However, previous works have seldom set up or empirically measured an independent index to demonstrate its mediating effect, nor have they investigated its mediating role on different types of creative performances, which involve distinct processes. In this study, 120 participants were randomly assigned to positive, neutral or negative affect conditions. Their levels of cognitive flexibility were then measured by a switch task. Finally, their creative performances were calibrated by either an open-ended divergent thinking test or a closed-ended insight problem-solving task. The results showed that positive emotional states could reduce switch costs and enhance both types of creative performances. However, cognitive flexibility exhibited a full mediating effect only on the relationship between positive emotion and insight problem solving, but not between positive emotion and divergent thinking. Divergent thinking was instead more associated with arousal level. These results suggest that emotions might influence different creative performances through distinct mechanisms.

Role of chrysin on expression of insulin signaling molecules

Directory of Open Access Journals (Sweden)

Kottireddy Satyanarayana

2015-01-01

Full Text Available Background: Currently available drugs are unsuccessful for the treatment of tye-2 diabetes due to their adverseside-effects. Hence, a search for novel drugs, especially ofplant origin, continues. Chrysin (5,7-dihydroxyflavone is a flavonoid, natural component of traditional medicinal herbs, present in honey, propolis and many plant extracts that hasbeen used in traditional medicine around the world to treat numerous ailments. Objective: The present study was aimed to identify the protective role of chrysin on the expression of insulin-signaling molecules in the skeletal muscle of high fat and sucrose-induced type-2 diabetic adult male rats. Materials and Methods: The oral effective dose of chrysin (100 mg/kg body weight was given once a day until the end of the study (30 days post-induction of diabetes to high fat diet-induced diabetic rats.At the end of the experimental period, fasting blood glucose, oral glucose tolerance, serum lipid profile, lipid peroxidation (LPO and free radical generation, as well as the levels of insulin signaling molecules and tissue glycogen in the gastrocnemius muscle were assessed. Results: Diabetic rats showed impaired glucose tolerance and impairment in insulin signaling molecules (IR, IRS-1, p-IRS-1Tyr 632 , p- Akt Thr308 , glucose transporter subtype 4 [GLUT4] proteins and glycogen concentration. Serum insulin, lipid profile, LPO and free radical generation were found to be increased in diabetic control rats.The treatment with chrysin normalized the altered levels of blood glucose, serum insulin, lipid profile, LPO and insulin signaling molecules as well as GLUT4 proteins. Conclusion: Our present findings indicate that chrysin improves glycemic control through activation of insulin signal transduction in the gastrocnemius muscle of high fat and sucrose-induced type-2 diabetic male rats.

Designing structural supply chain flexibility

NARCIS (Netherlands)

Mulinski, Ksawery Jan

2012-01-01

In a continuously changing business environment the role of supply chain flexibility is constantly increasing. A flexible supply chain can ensure survival in quickly changing market conditions as well as enable sustainable growth. This thesis explores the topic of supply chain flexibility with focus

The Role of Representations in Executive Function: Investigating a Developmental Link Between Flexibility and Abstraction

Directory of Open Access Journals (Sweden)

Maria eKharitonova

2011-11-01

Full Text Available Young children often perseverate, engaging in previously correct, but no longer appropriate behaviors. One account posits that such perseveration results from the use of stimulus-specific representations of a situation, which are distinct from abstract, generalizable representations that support flexible behavior. Previous findings supported this account, demonstrating that only children who flexibly switch between rules could generalize their behavior to novel stimuli. However, this link between flexibility and generalization might reflect general cognitive abilities, or depend upon similarities across the measures or their temporal order. The current work examined these issues by testing the specificity and generality of this link. In two experiments with three-year-old children, flexibility was measured in terms of switching between rules in a card-sorting task, while abstraction was measured in terms of selecting which stimulus did not belong in an odd-one-out task. The link between flexibility and abstraction was general across (1 abstraction dimensions similar to or different from those in the card-sorting task and (2 abstraction tasks that preceded or followed the switching task. Good performance on abstraction and flexibility measures did not extend to all cognitive tasks, including an IQ measure, and dissociated from children’s ability to gaze at the correct stimulus in the odd-one-out task, suggesting that the link between flexibility and abstraction is specific to such measures, rather than reflecting general abilities that affect all tasks. We interpret these results in terms of the role that developing prefrontal cortical regions play in processes such as working memory, which can support both flexibility and abstraction.

Role of adhesion molecules and inflammation in Venezuelan equine encephalitis virus infected mouse brain

Directory of Open Access Journals (Sweden)

Honnold Shelley P

2011-04-01

Full Text Available Abstract Background Neuroinvasion of Venezuelan equine encephalitis virus (VEEV and subsequent initiation of inflammation in the brain plays a crucial role in the outcome of VEEV infection in mice. Adhesion molecules expressed on microvascular endothelial cells in the brain have been implicated in the modulation of the blood brain barrier (BBB and inflammation in brain but their role in VEEV pathogenesis is not very well understood. In this study, we evaluated the expression of extracellular matrix and adhesion molecules genes in the brain of VEEV infected mice. Findings Several cell to cell adhesion molecules and extracellular matrix protein genes such as ICAM-1, VCAM-1, CD44, Cadherins, integrins, MMPs and Timp1 were differentially regulated post-VEEV infection. ICAM-1 knock-out (IKO mice infected with VEEV had markedly reduced inflammation in the brain and demonstrated a delay in the onset of clinical symptoms of disease. A differential regulation of inflammatory genes was observed in the IKO mice brain compared to their WT counterparts. Conclusions These results improve our present understanding of VEEV induced inflammation in mouse brain.

THE ROLE OF WORK AND LABOUR MARKET FLEXIBILITY IN WORKING LIFE PROLONGATION: CASE SLOVENIA

Directory of Open Access Journals (Sweden)

Klemen, SIROK

2014-11-01

Full Text Available Building upon the premise that the prolongation of working life presents an adequate approach to address the fast approaching challenges of population ageing, the paper presents labour market outcomes of older workers in Slovenia in order to explore the role of social system and labour market flexibility in retirement behaviour. By applying bivariate graphic analysis and series of logistic models, paper finds that decisions of older workers (aged 50 - 69 of whether to retire or to continue working up to legal retirement age is being predominately shaped by the pension system parameters. Economic activity beyond this age (or when retired on the other hand predominately correlates with flexible work arrangements and work motivation. Thus, the future policies in Slovenia aiming to prolong working careers within formal or informal sector should simultaneously do both; change pension system parameters and significantly expand the system flexibility stimulating willing and capable elderly to continue working within the formal sector.

Flexibility in change practices and job outcomes for nurses: exploring the role of subjective fit.

Science.gov (United States)

Newton, Cameron; Teo, Stephen T T; Pick, David; Yeung, Melissa; Salamonson, Yenna

2013-12-01

To integrate existing theoretical perspectives on change management, subjective fit and occupational stress to better understand the effects of change on employee adjustment. Although subjective fit with organizational goals and objectives has been shown to have positive effects on employee adjustment, its role in the organizational change-occupational stress context is not understood. This represents a caveat in research when considering the notion that those who feel that they fit with the organization's goals may be better equipped to reconcile and deal with change. A cross-sectional survey of nurses from public and non-profit sector hospitals was conducted. Data were collected from 252 public and non-profit sector nurses via online surveys. Data were collected from June-October in 2010. Structural equation modelling was used to test the direct and indirect effects among the focal variables. The results showed that public and non-profit nurses experience flexibility-limiting and flexibility-promoting change initiatives and that these are differentially related to the perception of administrative stressors and adjustment with these relationships directly and indirectly influenced by perceptions of subjective fit. Flexibility-limiting change initiatives led to lower levels of subjective fit, higher levels of administrative stressors and less favourable adjustment. On the other hand, flexibility-promoting change practices led to higher levels of subjective fit, lower levels of administrative stressors and ultimately better adjustment. The results further the theoretical understanding of the role of subjective fit in organizational change and occupational stress theories. © 2013 John Wiley & Sons Ltd.

Role of transnasal flexible laryngo-oesophagoscopy (TNFLO) in investigating patients with globus symptoms.

Science.gov (United States)

Mohammed, H; Coates, M; Masterson, L; Chan, W Y; Hassan, Y; Nassif, R

2017-12-01

To explore the rationale for investigating patients presenting with globus symptoms. In this regard, we also assess the efficacy and safety of transnasal flexible laryngo-oesophagoscopy (TNFLO). A prospective study in a head and neck cancer centre of patients with persistent globus symptoms with normal flexible nasoendoscopy/indirect mirror laryngoscopy and failure of first-line medical treatment. The role of TNFLO in investigating these patients was assessed. A total of 218 patients were recruited in this study. Positive findings included upper aerodigestive cancers in two patients, other pathologies included reflux (four patients), cricopharyngeus-related pathologies (19 patients), candida (five patients). There were only five re-referrals of patients who were discharged following normal examination with TNFLO. In nine patients, TNFLO could not be completed and they went on to have other diagnostic procedures CONCLUSION: This article is the largest to date in the UK to assess the role of TNFLO in investigating patients with globus symptoms. TNFLO is equal to rigid endoscopy as a diagnostic tool. However, it is superior in terms of image clarity, ability to record video images and safety. © 2017 John Wiley & Sons Ltd.

Adsorption of metalorganic molecules on metal-semiconductor systems

Energy Technology Data Exchange (ETDEWEB)

Brand, Christian; Schmeidel, Jedrzej; Chen, Wei; Tegenkamp, Christoph; Pfnuer, Herbert [Institut fuer Festkoerperphysik, Leibniz Universitaet Hannover (Germany)

2011-07-01

The controlled implementation of single molecules in appropriate contact assemblies is the ultimate realization of an ultra-small device structure. Besides extremely high integration densities the functionalities of the devices are adjustable by chemical synthesis. However, the interaction of the molecule with its environment is decisive. The adsorption of ferrocene-1,1'-dithiol (FDT) on Ag-{radical}(3) reconstructions on nominally flat and vicinal Si(111) substrates has been studied. The FDT was chosen because of its large conductance and high structural flexibility with respect to rotation of the two cyclopentadienyl (Cp) rings. The reconstruction is a prototype of a highly conductive low dimensional electron gas on a technologically relevant substrate. The adsorption of intact molecules takes place predominantly at defect sites, e.g. vacancy and step structures. Submolecular resolution showing the Cp-ring structure was obtained at perfect terrace sites. Due to chemisorption of the S-atoms at hollow sites the molecule axis is oriented parallel to the substrate. The initial rotational flexibility is frozen and only tow different rotated configurations were found. The adsorption geometry is confirmed by VASP calculations. Recently, Ag reconstructions on Si(557) substrates have been used. The effect of the uniaxial step configuration towards the adsorption of the FDT molecules is discussed.

Consumer Central Energy Flexibility in Office Buildings

DEFF Research Database (Denmark)

Billanes, Joy Dalmacio; Ma, Zheng; Jørgensen, Bo Nørregaard

2017-01-01

Energy flexibility in buildings will play an important role in the smart energy system. Office buildings have more potentials to provide energy flexibility to the grid compared to other types of buildings, due to the existing building management, control systems and large energy consumption....... Consumers in office buildings (building owners/managers and occupants) take a main role for adopting and engaging in building energy flexibility. In this paper provides a systematic review of consumer central energy flexibility in office buildings with the discussion of social, technical and business...... can boost energy flexibility in the office buildings....

Structure and phase behavior of a confined nanodroplet composed of the flexible chain molecules.

Science.gov (United States)

Kim, Soon-Chul; Kim, Eun-Young; Seong, Baek-Seok

2011-04-28

A polymer density functional theory has been employed for investigating the structure and phase behaviors of the chain polymer, which is modelled as the tangentially connected sphere chain with an attractive interaction, inside the nanosized pores. The excess free energy of the chain polymer has been approximated as the modified fundamental measure-theory for the hard spheres, the Wertheim's first-order perturbation for the chain connectivity, and the mean-field approximation for the van der Waals contribution. For the value of the chemical potential corresponding to a stable liquid phase in the bulk system and a metastable vapor phase, the flexible chain molecules undergo the liquid-vapor transition as the pore size is reduced; the vapor is the stable phase at small volume, whereas the liquid is the stable phase at large volume. The wide liquid-vapor coexistence curve, which explains the wide range of metastable liquid-vapor states, is observed at low temperature. The increase of temperature and decrease of pore size result in a narrowing of liquid-vapor coexistence curves. The increase of chain length leads to a shift of the liquid-vapor coexistence curve towards lower values of chemical potential. The coexistence curves for the confined phase diagram are contained within the corresponding bulk liquid-vapor coexistence curve. The equilibrium capillary phase transition occurs at a higher chemical potential than in the bulk phase.

The role of adhesive molecules in endometrial cancer: part II

Directory of Open Access Journals (Sweden)

Andrzej Malinowski

2010-12-01

Full Text Available The carcinogenesis is a result of both functional and structural disorders in the tissue. It initiates as a mutationin a gene encoding protein that is essential for cellular function. The subsequent cascade of eventsleads to accumulation of mutations and loss of cellular function. The cell loses its tissue-specific morphology,disconnects from other cells and extracellular matrix and migrates – the invasion begins. It is now clear thatadhesive molecules are a key player in this cascade. These proteins of the cell membrane surface are responsiblefor attachment of the cells to each other and to the extracellular matrix. These interactions are crucial forboth structural and functional tissue organization. Lack of this homeostasis destroys the tissue architectureand impairs its function and results in invasion. Abnormal expression of adhesive molecules was reported in allexamined cancers, including endometrial cancer.Endometrial cancer is the most common gynaecological cancer in developed countries. Although in many casesdiagnosed and treated in early stages, and thus with good results, some patients cannot be cured. Completeknowledge of the pathogenesis of the disease will be helpful in identifying the patients with negative prognosticfactors, increased risk of recurrence and, perhaps, to find other therapeutic options. In the paper we are trying tosum up the up-to-date knowledge of the role of adhesive molecules in pathogenesis of endometrial cancer.

Heave and Flow: Understanding the role of resonance and shape evolution for heaving flexible panels

Science.gov (United States)

Hoover, Alexander; Cortez, Ricardo; Tytell, Eric; Fauci, Lisa

2017-11-01

Many animals that swim or fly use their body to accelerate the fluid around them, transferring momentum from their bodies to the surrounding fluid. The emergent kinematics from this transfer are a result of the coupling between the fluid and the material properties of the body. Here we present a computational study of a 3-dimensional flexible panel that is heaved at its leading edge in an incompressible, viscous fluid. These high-fidelity numerical simulations enable us to examine the role of resonance, fluid forces, and panel deformations have on swimming performance. Varying both the passive material properties and the heaving frequency of the panel, we find peaks in trailing edge amplitude and forward swimming speed are determined by a dimensionless quantity, the effective flexibility. Modal decompositions of panel deflections reveal that the strength of each mode is related to the effective flexibility and peaks in the swimming speed and trailing edge amplitude correspond to peaks in the contributions of different modes. Panels of different material properties but with similar effective flexibilities have modal contributions that evolve similarly over the phase of the heaving cycle and agreement in dominant vortex structures generated by the panel. NSF RTG 1043626.

Structural flexibility of the sulfur mustard molecule at finite temperature from Car-Parrinello molecular dynamics simulations.

Science.gov (United States)

Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel

2016-04-05

Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

Augmented-plane-wave calculations on small molecules

International Nuclear Information System (INIS)

Serena, P.A.; Baratoff, A.; Soler, J.M.

1993-01-01

We have performed ab initio calculations on a wide range of small molecules, demonstrating the accuracy and flexibility of an alternative method for calculating the electronic structure of molecules, solids, and surfaces. It is based on the local-density approximation (LDA) for exchange and correlation and the nonlinear augmented-plane-wave method. Very accurate atomic forces are obtained directly. This allows for implementation of Car-Parrinello-like techniques to determine simultaneously the self-consistent electron wave functions and the equilibrium atomic positions within an iterative scheme. We find excellent agreement with the best existing LDA-based calculations and remarkable agreement with experiment for the equilibrium geometries, vibrational frequencies, and dipole moments of a wide variety of molecules, including strongly bound homopolar and polar molecules, hydrogen-bound and electron-deficient molecules, and weakly bound alkali and noble-metal dimers, although binding energies are overestimated

Influence of semisynthetic modification of the scaffold of a contact domain of HbS on polymerization: role of flexible surface topology in polymerization inhibition.

Science.gov (United States)

Sonati, Srinivasulu; Bhutoria, Savita; Prabhakaran, Muthuchidambaran; Acharya, Seetharama A

2018-02-01

A new variant of HbS, HbS-Einstein with a deletion of segment α 23-26 in the B-helix, has been assembled by semisynthetic approach. B-helix of the α chain of cis αβ-dimer of HbS plays dominant role in the quinary interactions of deoxy HbS dimer. This B-helix is the primary scaffold that provides the orientation for the side chains of contact residues of this intermolecular contact domain. The design of HbS-Einstein has been undertaken to map the influence of perturbation of molecular surface topology and the flexibility of surface residues in the polymerization. The internal deletion exerts a strong inhibitory influence on Val-6 (β)-dependent polymerization, comparable to single contact site mutations and not for complete neutralization of Val-6(β)-dependent polymerization. The scaffold modification in cis-dimer is inhibitory, and is without any effect when present on the trans dimer. The flexibility changes in the surface topology in the region of scaffold modification apparently counteracts the intrinsic polymerization potential of the molecule. The inhibition is close to that of Le Lamentin mutation [His-20 (α) → Gln] wherein a mutation engineered without much change in flexibility of the contact domain. Interestingly, the chimeric HbS with swine-human chimeric α chain with multiple non-conservative mutations completely inhibits the Val-6(β)-dependent polymerization. The deformabilities of surface topology of chimeric HbS are comparable to HbS in spite of the multiple contact site mutations in the α-chain. We conclude that the design of antisickling Hbs for gene therapy of sickle cell disease should involve multiple mutations of intermolecular contact sites.

The Flexibility of Organization and the flexibility of product – premises of organizational success

OpenAIRE

Todorut, Amalia Venera

2008-01-01

Flexibility represents the ability of a manufactural system to adapt to some diversified tasks of production, thus to assure an economic efficiency – the rapport time/cost should be optimum, with insignificant structure changes within a long period of time. The central role of flexibility is to permit the survival and the success of the organizations in a turbulent circumstance, which is characteristic to the new world tendencies. The more flexible the organization becomes, the better it resp...

Business Models for Power System Flexibility

DEFF Research Database (Denmark)

Boscan, Luis; Poudineh, Rahmatallah

2016-01-01

As intermittent, renewable resources gain more share in the generation mix, the need for power system flexibility increases more than ever. Parallel to this, technological change and the emergence of new players bringing about innovative solutions are boosting the development of flexibility...... business models will play an important role in ensuring sufficiency and efficiency of flexibility services....

The Role of Molecule Clustering by Hydrogen Bond in Hydrous Ethanol on Laminar Burning Velocity

Directory of Open Access Journals (Sweden)

I Made Suarta

2016-01-01

Full Text Available The role of hydrogen bond molecule clustering in laminar burning velocities was observed. The water in hydrous ethanol can change the interaction between water-ethanol molecules. A certain amount of water can become oxygenated which increases the burning velocity. The hydrogen bond interaction pattern of ethanol and water molecules was modeled. Based on the molecular model, azeotropic behavior emerges from ethanol-water hydrogen bond, which is at a 95.1%v composition. The interaction with water molecule causes the ethanol molecule to be clustered with centered oxygenated compound. So, it supplies extra oxygen and provides intermolecular empty spaces that are easily infiltrated by the air. In the azeotropic composition, the molecular bond chain is the shortest, so hypothetically the burning velocity is anticipated to increase. The laminar burning velocity of ethanol fuel was tested in a cylindrical explosion bomb in lean, stoichiometric, and rich mixtures. The experimental result showed that the maximum burning velocity occurred at hydrous ethanol of 95.5%v composition. This discrepancy is the result of the addition of energy from 7.7% free ethanol molecules that are not clustered. At the rich mixture, the burning velocity of this composition is higher than that of anhydrous ethanol.

Role of signaling lymphocytic activation molecule in T helper cell responses

Directory of Open Access Journals (Sweden)

Jan E. de Vries

1998-01-01

Full Text Available Signaling lymphocytic activation molecule (SLAM; CDw150 is a 70 kDa glycoprotein. Signaling lymphocytic activation molecule is constitutively expressed on memory T cells, CD56+ T cells, a subset of T cell receptor γδ+ cells, immature thymocytes and, at low levels, on a proportion of peripheral blood B cells. Signaling lymphocytic activation molecule is rapidly upregulated on all T and B cells after activation. Engagement of SLAM by F(ab’2 fragments of an anti-SLAM monoclonal antibody (mAb A12 enhances antigen-specific T cell proliferation. In addition, mAb A12 was directly mitogenic for T cell clones and activated T cells. T cell proliferation induced by mAb A12 is independent of interleukin (IL-2, IL-4, IL-12 and IL-15, but is cyclosporin A sensitive. Ligation of SLAM during antigen-specific T cell proliferation resulted in upregulation of interferon (IFN-γ production, even by allergen-specific T helper cell (Th 2 clones, whereas the levels of IL-4 and IL-5 production were only marginally affected. The mAb A12 was unable to induce IL-4 and IL-5 production by Th1 clones. Co-stimulation of skin-derived Der P1-specific Th2 cells from patients with atopic dermatitis via SLAM resulted in the generation of a population of IFN-γ-producing cells, thereby reverting their phenotype to a Th0 pattern. Signaling lymphocytic activation molecule is a high-affinity self ligand mediating homophilic cell interaction. In addition, soluble SLAM enhances both T and B cell proliferation. Collectively, these data indicate that SLAM molecules act both as receptors and ligands that are not only involved in T cell expansion but also drive the expanding T cells during immune responses into the Th0/Th1 pathway. This suggests that signaling through SLAM plays a role in directing Th0/Th1 development.

Tuning the hybridization bandgap by meta-molecules with in-unit interaction

Energy Technology Data Exchange (ETDEWEB)

Chen, Yongqiang; Li, Yunhui, E-mail: liyunhui@tongji.edu.cn; Wu, Qian; Jiang, Haitao; Zhang, Yewen; Chen, Hong [Key Laboratory of Advanced Micro-Structured Materials, Ministry of Education, School of Physics Science and Engineering, Tongji University, Shanghai 200092 (China)

2015-09-07

In this paper, we demonstrate that the hybridization bandgap (HBG) can be tuned conveniently by deep subwavelength meta-molecules with in-unit interaction. Spontaneous-emission-cancellation-like (SEC-like) effect is realized in a meta-molecule by introducing the destructive interference of two detuned meta-atoms. The meta-atoms consisting of subwavelength zero-index-metamaterial-based resonators are side-coupled to a microstrip. Compared to conventional HBG configurations, the presence of in-unit interaction between meta-atoms provides more flexibility in tuning the bandgap properties, keeping the device volume almost unchanged. Both numerical simulations and microwave experiments confirm that the width, depth, and spectrum shape of HBG can be tuned by simply introducing SEC-like interaction into the meta-molecule. Due to these features, our design may be promising to be applied in microwave or optics communications systems with strict limitation of device volume and flexible bandgap properties.

Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

KAUST Repository

Zheng, B.; Wang, L. L.; Du, L.; Pan, Y.; Lai, Zhiping; Huang, Kuo-Wei; Du, H. L.

2016-01-01

Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

KAUST Repository

Zheng, B.

2016-05-11

Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

Single-molecule conductance of redox molecules in electrochemical scanning tunneling microscopy

DEFF Research Database (Denmark)

Haiss, W.; Albrecht, Tim; van Zalinge, H.

2007-01-01

of a maximum in the I-tunneling versus electrode potential relationship can be fitted by a "soft" gating concept. This arises from large configurational fluctuations of the molecular bridge linked to the gold contacts by flexible chains. This view is incorporated in a formalism that is well-suited for data...... analysis and reproduces in all important respects the 6V6 data for physically sound values of the appropriate parameters. This study demonstrates that fluctuations of isolated configurationally "soft" molecules can dominate charge transport patterns and that theoretical frameworks for compact monolayers...

Role of band 3 in the erythrocyte membrane structural changes under thermal fluctuations -multi scale modeling considerations.

Science.gov (United States)

Pajic-Lijakovic, Ivana

2015-12-01

An attempt was made to discuss and connect various modeling approaches on various time and space scales which have been proposed in the literature in order to shed further light on the erythrocyte membrane rearrangement caused by the cortex-lipid bilayer coupling under thermal fluctuations. Roles of the main membrane constituents: (1) the actin-spectrin cortex, (2) the lipid bilayer, and (3) the trans membrane protein band 3 and their course-consequence relations were considered in the context of the cortex non linear stiffening and corresponding anomalous nature of energy dissipation. The fluctuations induce alternating expansion and compression of the membrane parts in order to ensure surface and volume conservation. The membrane structural changes were considered within two time regimes. The results indicate that the cortex non linear stiffening and corresponding anomalous nature of energy dissipation are related to the spectrin flexibility distribution and the rate of its changes. The spectrin flexibility varies from purely flexible to semi flexible. It is influenced by: (1) the number of band 3 molecules attached to single spectrin filaments, and (2) phosphorylation of the actin-junctions. The rate of spectrin flexibility changes depends on the band 3 molecules rearrangement.

Basic roles of key molecules connected with NMDAR signaling pathway on regulating learning and memory and synaptic plasticity

Institute of Scientific and Technical Information of China (English)

Hui Wang; Rui-Yun Peng

2016-01-01

With key roles in essential brain functions ranging from the long-term potentiation (LTP) to synaptic plasticity,the N-methyl-D-aspartic acid receptor (NMDAR) can be considered as one of the fundamental glutamate receptors in the central nervous system.The role of NMDA R was first identified in synaptic plasticity and has been extensively studied.Some molecules,such as Ca2+,postsynaptic density 95 (PSD-95),calcium/calmodulin-dependent protein kinase Ⅱ (CaMK Ⅱ),protein kinase A (PKA),mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate (cAMP) responsive element binding protein (CREB),are of special importance in learning and memory.This review mainly focused on the new research of key molecules connected with learning and memory,which played important roles in the NMDAR signaling pathway.

Flexibility at Work: A Study of Further Education.

Science.gov (United States)

Edwards, Richard; Clarke, Julia; Harrison, Roger; Reeve, Fiona

2001-01-01

Interviews with 50 further education managers, lecturers, and students in Britain identified complex ways in which flexibility is experienced: (1) lecturers feel increasingly busy trying to provide flexibility; (2) role boundaries are becoming more and more fuzzy in the flexible workplace; and (3) there are notions of "good" and…

Toward Generalization of Iterative Small Molecule Synthesis.

Science.gov (United States)

Lehmann, Jonathan W; Blair, Daniel J; Burke, Martin D

2018-02-01

Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the "building block approach", i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach.

Toward Generalization of Iterative Small Molecule Synthesis

Science.gov (United States)

Lehmann, Jonathan W.; Blair, Daniel J.; Burke, Martin D.

2018-01-01

Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the “building block approach”, i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach. PMID:29696152

Interaction between vegetable oil based plasticizer molecules and polyvinyl chloride, and their plasticization effect

Science.gov (United States)

Haryono, Agus; Triwulandari, Evi; Jiang, Pingping

2017-01-01

Plasticizer molecules are low molecular weight compounds that are widely used in polymer industries especially in polyvinyl chloride (PVC) resin. As an additive in PVC resin, the important role of plasticizer molecules is to improve the flexibility and processability of PVC by lowering the glass transition temperature (Tg). However, the commercial plasticizer like di(2-ethylhexyl)phthalate (DEHP) is known to cause liver cancer, at least in laboratory rats. DEHP can leach out from PVC into blood, certain drug solutions and fatty foods, which has been detected in the bloodstream of patients undergoing transfusion. Vegetable oil based plasticizers have some attractive properties such as non-toxic, bio-degradable, good heat and light stability, renewable resources, and environmentally friendly. Here we discussed the main results and development of vegetable oil based plasticizer, and especially palm oil based plasticizer. The interaction between plasticizer and polymer was discussed from the properties of the plasticized polymeric material.

Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Giulia Menconi

2015-04-01

Full Text Available In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TAn repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TAn repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in

Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

Science.gov (United States)

Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

2015-04-01

In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a

Spins of adsorbed molecules investigated by the detection of Kondo resonance

Science.gov (United States)

Komeda, Tadahiro

2014-12-01

Surface magnetism has been one of the platforms to explore the magnetism in low dimensions. It is also a key component for the development of quantum information processes, which utilizes the spin degree of freedom. The Kondo resonance is a phenomenon that is caused by an interaction between an isolated spin and conduction electrons. First observed in the 1930s as an anomalous increase in the low-temperature resistance of metals embedded with magnetic atoms, the Kondo physics mainly studied the effects of bulk magnetic impurities in the resistivity. In the last 15 years it has undergone a revival by a scanning tunneling microscope (STM) which enables the measurement of the Kondo resonance at surfaces using an atomic scale point contact. The detection of the Kondo resonance can be a powerful tool to explore surface magnetism. In this article, I review recent studies of the surface spin of adsorbed molecules by the detection of the Kondo resonance. Researches on metal phthalocyanine (MPc) and porphyrin molecules will be examined. In addition, the Kondo resonance for double-decker lanthanoide Pc molecules will be discussed. Some of the double-decker Pc molecules show single-molecule magnet (SMM) behavior, which attracts attention as a material for electronic devices. For both classes, the ligand plays a crucial role in determining the parameters of the Kondo resonance, such as the Kondo temperature and the change of the shape from peak to Fano-dip. In addition, the spin in delocalized molecular orbital forms the Kondo resonance, which shows significant differences from the Kondo resonance formed by the metal spins. Since molecular orbital can be tuned in a flexible manner by the design of the molecule, the Kondo resonance formed by delocalized molecular orbital might expand the knowledge of this field.

The role of the ion-molecule and molecule-molecule interactions in the formation of the two-ion average force interaction potential

CERN Document Server

Ajrian, E A; Sidorenko, S N

2002-01-01

The effect of the ion-molecule and intermolecular interactions on the formation of inter-ion average force potentials is investigated within the framework of a classical ion-dipole model of electrolyte solutions. These potentials are shown to possess the Coulomb asymptotics at large distances while in the region of mean distances they reveal creation and disintegration of solvent-shared ion pairs. The calculation results provide a qualitatively authentic physical picture which is experimentally observed in strong electrolytes solutions. In particular, an increased interaction between an ion and a molecule enhances formation of ion pairs in which the ions are separated by one solvent molecule

Enzyme hydration, activity and flexibility : A neutron scattering approach

International Nuclear Information System (INIS)

Kurkal-Siebert, V.; Finney, J.L.; Daniel, R.M.; Smith, Jeremy C.

2006-01-01

Recent measurements have demonstrated enzyme activity at hydrations as low as 3%. The question of whether the hydration-induced enzyme flexibility is important for activity is addressed by performing picosecond dynamic neutron scattering experiments on pig liver esterase powders at various temperatures as well as solutions. At all temperatures and hydrations investigated here, significant quasielastic scattering intensity is found in the protein, indicating the presence of anharmonic, diffusive motion. As the hydration increases a temperature-dependent dynamical transition appears and strengthens involving additional diffusive motion. At low temperature, increasing hydration resulted in lower flexibility of the enzyme. At higher temperatures, systems containing sufficient number of water molecules interacting with the protein exhibit increased flexibility. The implication of these results is that, although the additional hydration-induced diffusive motion and flexibility at high temperatures in the enzyme detected here may be related to increased activity, they are not required for the enzyme to function

The Role of Functional Flexibility to Improve Energy Efficiency in Energy Consumption of the Case Borojerdiha house in Kashan

Directory of Open Access Journals (Sweden)

Mohammad Javad Mahdavinejad

2015-03-01

Full Text Available Man raises level of his needs by falsifying the nature and construction of the built spaces. By examining various aspects and complex dimensions of the human, variable and different needs can be clearly seen. Therefore, an architectural construction, especially housing, should be able to set the access conditions to meet the highest level of the needs and achieve to the highest level of responsiveness to the needs of users. Thus, conditions such as flexibility, adaptability, variability and all the principles that lead to generate opportunities and capacities proportional to user's needs in a building has been double necessary. With looking at the traditional architecture, we find that, despite the limitations in manufacturing technology, the architects used their own strategies for responding to existing problems. Strategies such as the use of multi-functional space, embedding spaces in the three scales of tiny, medium and large scales as well as ability to separate or merge spaces, are some of these items. By knowing, however, Iran's traditional home space is flexible, in this study, we sought to answer the question whether this flexibility in space has a role in the amount of energy consumption of the building? If there is, it has an increasing or decreasing role? In order to answer this question, several examples of traditional houses in the hot and dry climates is simulated that, due to brevity it is not expressed in this study. Among them, for example, is expressed Boroujerdi House and energy consumption of the existing state compared with when a space had not seasonal versatility. Finally, it is concluded that flexibility, reduce energy consumption in traditional buildings.

Ionic Liquid Mediated Dispersion and Support of Functional Molecules on Cellulose Fibers for Stimuli-Responsive Chromic Paper Devices.

Science.gov (United States)

Koga, Hirotaka; Nogi, Masaya; Isogai, Akira

2017-11-22

Functional molecules play a significant role in the development of high-performance composite materials. Functional molecules should be well dispersed (ideally dissolved) and supported within an easy-to-handle substrate to take full advantage of their functionality and ensure easy handling. However, simultaneously achieving the dissolution and support of functional molecules remains a challenge. Herein, we propose the combination of a nonvolatile ionic liquid and an easy-to-handle cellulose paper substrate for achieving this goal. First, the photochromic molecule, i.e., diarylethene, was dissolved in the ionic liquid 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([bmim]NTf 2 ). Then, diarylethene/[bmim]NTf 2 was supported on cellulose fibers within the paper, through hydrogen bonding between [bmim] cations of the ionic liquid and the abundant hydroxyl groups of cellulose. The as-prepared paper composites exhibited reversible, rapid, uniform, and vivid coloration and bleaching upon ultraviolet and visible light irradiation. The photochromic performance was superior to that of the paper prepared in the absence of [bmim]NTf 2 . This concept could be applied to other functional molecules. For example, lithium perchlorate/[bmim] tetrafluoroborate supported within cellulose paper acted as a flexible electrolyte to provide a paper-based electrochromic device. These findings are expected to further the development of composite materials with high functionality and practicality.

Simulating charge transport in flexible systems

Directory of Open Access Journals (Sweden)

Timothy Clark

2015-12-01

Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

I want to be creative: exploring the role of hedonic contingency theory in the positive mood-cognitive flexibility link.

Science.gov (United States)

Hirt, Edward R; Devers, Erin E; McCrea, Sean M

2008-02-01

Three studies explored the role of hedonic contingency theory as an explanation for the link between positive mood and cognitive flexibility. Study 1 examined the determinants of activity choice for participants in happy, sad, or neutral moods. Consistent with hedonic contingency theory, happy participants weighted potential for creativity as well as the pleasantness of the task more heavily in their preference ratings. In Study 2, participants were given either a neutral or mood-threatening item generation task to perform. Results illustrated that happy participants exhibited greater cognitive flexibility in all cases; when confronted with a potentially mood-threatening task, happy participants were able to creatively transform the task so as to maintain positive mood and interest. Finally, Study 3 manipulated participants' beliefs that moods could or could not be altered. Results replicated the standard positive mood-increased cognitive flexibility effect in the nonmood-freezing condition, but no effects of mood on creativity were found in the mood-freezing condition. These studies indicate that the hedonic contingency theory may be an important contributing mechanism behind the positive mood-cognitive flexibility link. (c) 2008 APA, all rights reserved

Contagious flexibility? A study on whether schedule flexibility facilitates work-life enrichment.

Science.gov (United States)

Pedersen, Vivi Bach; Jeppesen, Hans Jeppe

2012-08-01

Schedule flexibility defines an important generating resource for work-life enrichment; however, our knowledge about how such spillovers take place is limited. This multiple case study examines how workers from different working time contexts with varying levels of schedule flexibility experience work-life interplay. Given the adopted explorative design, it is important to interpret the findings in a tentative light. Nonetheless, the study offers important insight into work-life enrichment that may guide future research in this field. The findings indicate that schedule flexibility may act as a boundary-spanning resource owing to the agency potential it offers workers. Thus, it seemed that flexible schedule opportunities enabled workers to engage more fully in personal life activities, which in turn had a positive influence on their work involvement through positive affect. Such positive role engagements appeared, however, to be greatly determined by workers' boundary management and by time conditions of work and family. In conclusion, the major findings and limitation of the study are discussed against existing research and theory. © 2012 The Authors. Scandinavian Journal of Psychology © 2012 The Scandinavian Psychological Associations.

Exploring the Moderating Role of Perceived Flexibility Advantages in Mobile Learning Continuance Intention (MLCI

Directory of Open Access Journals (Sweden)

Rui-Ting Huang

2014-07-01

Full Text Available The primary purpose of this study was to explore the key factors that could affect mobile learning continuance intention (MLCI, and examine the moderating effect of perceived flexibility advantages (PFA on the relationship between key mobile learning elements and continuance intention. Five hundred undergraduate students who had previously adopted mobile devices to learn English took part in this study. Partial least squares (PLS analysis was utilized to test the hypotheses in this study. It has been found that the perceived usefulness of mobile technology, subjective norm, and self-management of learning could be closely linked to mobile learning continuance intention. With particular respect to the moderating role of perceived flexibility advantages, it has been demonstrated that PFA could moderate the relationship between perceived usefulness of mobile technology and mobile learning continuance intention, as well as the association between subjective norm and mobile learning continuance intention, whereas PFA did not moderate the link between self-management of learning and mobile learning continuance intention.This report has further added to the body of knowledge in the field of mobile learning through empirical examination.

Flexible Work Styles in the Corporate Research Center.

Science.gov (United States)

Baker, Katherine

2000-01-01

Explores the appropriateness for flexible work schedules for corporate librarians and provides insight into the benefits of flexible work arrangements in other industries. Highlights include technological changes that have changed roles and made resources available electronically; telecommuters; job sharing; and the effects of flexible…

The role of psychological flexibility in a self-help acceptance and commitment therapy intervention for psychological distress in a randomized controlled trial.

Science.gov (United States)

Fledderus, Martine; Bohlmeijer, Ernst T; Fox, Jean-Paul; Schreurs, Karlein M G; Spinhoven, Philip

2013-03-01

This study examined the role of psychological flexibility, as a risk factor and as a process of change, in a self-help Acceptance and Commitment Therapy (ACT) intervention for adults with mild to moderate depression and anxiety. Participants were randomized to the self-help programme with e-mail support (n=250), or to a waiting list control group (n=126). All participants completed measures before and after the intervention to assess depression, anxiety and psychological flexibility. Participants in the experimental condition also completed these measures during the intervention (after three and six weeks) and at a three-month follow-up. With multilevel modelling, it was shown that the effects of the intervention on psychological distress were stronger for participants with higher levels of psychological flexibility. Furthermore, our study showed that improved psychological flexibility mediated the effects of the ACT intervention. With a cross-lagged panel design, it was shown that especially improvements in psychological flexibility in the last three sessions of the intervention were important for further reductions in anxiety. To conclude, our study showed the importance of targeting psychological flexibility during an ACT intervention for a reduction in depressive and anxiety symptoms. Copyright © 2012 Elsevier Ltd. All rights reserved.

Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP.

Science.gov (United States)

Lassalle, Michael W; Kondou, Shinobu

2016-06-01

Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T 1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP

Directory of Open Access Journals (Sweden)

Michael W. Lassalle

2016-06-01

Full Text Available Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

Organizing and addressing magnetic molecules.

Science.gov (United States)

Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

2009-04-20

Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

Performance measurement of supply chain flexibility using witness

Directory of Open Access Journals (Sweden)

Rituraj Chandrakar

2012-10-01

Full Text Available In today’s global scenario of intense competition and environmental uncertainty flexibility in supply chain has an important role to play for the existence of any supply chain business. A need to be responsive to the constantly changing market scenario and cater to the customer needs, a certain degree of flexibility is required, which requires the coordination of many plants to produce and deliver goods to customers located in different places, and suppliers, which provide each plant with the required components. This paper intends to measure the degree of flexibility required for a two stage supply chain and assessing both the supplier flexibility and the assembler flexibility. In this paper, nine configurations of the SC are considered resulting from the combination of the three degrees of supplier and manufacturer flexibility, i.e. no flexibility, limited flexibility and total flexibility, respectively. Simulation model representing the different flexibility configurations are evaluated and the performance of each configuration analyzed to determine the flexibility configuration suitable to a supply chain. In particular the performance analysis of lead time, work-in-process, service level and cost are measured to determine the suitable flexibility.

Mechanical Response of Single Filamin A (ABP-280) Molecules and Its Role in the Actin/Filamin A Gel

Science.gov (United States)

Sano, Ryoko; Furuike, Shou; Ito, Tadanao; Ohashi, Kazuyo; Yamazaki, Masahito

2004-04-01

Actin/filamin A gel plays important roles in mechanical response of cells. We found a force (50 to 220 pN)-induced unfolding of single filamin A molecules using AFM, and have proposed a hypothesis on the role of single filamin A in the novel property of viscoelasticity of actin/filamin A gel. We also investigated structure and its dynamics of actin/filamin A gel formed in a giant liposome using fluorescence microscopy.

Electron-molecule collisions

International Nuclear Information System (INIS)

Shimamura, I.; Takayanagi, K.

1984-01-01

The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

RASPA: molecular simulation software for adsorption and diffusion in flexible nanoporous materials

NARCIS (Netherlands)

Dubbeldam, D.; Calero, S.; Ellis, D.E.; Snurr, R.Q.

2016-01-01

A new software package, RASPA, for simulating adsorption and diffusion of molecules in flexible nanoporous materials is presented. The code implements the latest state-of-the-art algorithms for molecular dynamics and Monte Carlo (MC) in various ensembles including symplectic/measure-preserving

Dual-Shell Fluorescent Nanoparticles for Self-Monitoring of pH-Responsive Molecule-Releasing in a Visualized Way.

Science.gov (United States)

Yang, Lingang; Cui, Chuanfeng; Wang, Lingzhi; Lei, Juying; Zhang, Jinlong

2016-07-27

The rational design and controlled synthesis of a smart device with flexibly tailored response ability is all along desirable for bioapplication but long remains a considerable challenge. Here, a pH-stimulated valve system with a visualized "on-off" mode is constructed through a dual-shell fluorescence resonance energy transfer (FRET) strategy. The dual shells refer to carbon dots and fluorescent molecules embedded polymethacrylic acid (F-PMAA) layers successively coating around a SiO2 core (ca. 120 nm), which play the roles as energy donor and acceptor, respectively. The total thickness of the dual-shell in the solid composite is ca. 10 nm. The priorities of this dual-shell FRET nanovalve stem from three facts: (1) the thin shell allows the formation of efficient FRET system without chemical bonding between energy donor and acceptor; (2) the maximum emission wavelength of CD layer is tunable in the range of 400-600 nm, thus providing a flexible energy donor for a wide variety of energy acceptors; (3) the outer F-PMAA shell with a pH-sensitive swelling-shrinking (on-off) behavior functions as a valve for regulating the FRET process. As such, a sensitive and stable pH ratiometric sensor with a working pH range of 3-6 has been built by simply encapsulating pH-responsive fluorescein isothiocyanate (FITC) into PMAA; a pH-dependent swelling-shrinking shuttle carrier with a finely controllable molecule-release behavior has been further fabricated using rhodamine B isothiocyanate (RBITC) as the energy donor and model guest molecule. Significantly, the controlled releasing process is visually self-monitorable.

New Therapeutic Drugs from Bioactive Natural Molecules: the Role of Gut Microbiota Metabolism in Neurodegenerative Diseases.

Science.gov (United States)

Di Meo, Francesco; Donato, Stella; Di Pardo, Alba; Maglione, Vittorio; Filosa, Stefania; Crispi, Stefania

2018-04-03

The gut-brain axis is considered a neuroendocrine system, which connects brain and gastrointestinal tract and plays an important role in stress response. The homeostasis of gut-brain axis is important for healthy conditions and its alterations are associated to neurological disorders and neurodegenerative diseases. Gut microbiota is a dynamic ecosystem that can be altered by external factors such as diet composition, antibiotics or xenobiotics. Recent advances in gut microbiota analyses indicate that the gut bacterial community plays a key role in maintaining normal brain functions. Recent metagenomic analyses have elucidated that the relationship between gut and brain, either in normal or in pathological conditions, reflects the existence of a "microbiota-gut-brain" axis. Gut microbiota composition can be influenced by dietary ingestion of probiotics or natural bioactive molecules such as prebiotics and polyphenols. Their derivatives coming from microbiota metabolism can affect both gut bacterial composition and brain biochemistry. Modifications of microbiota composition by natural bioactive molecules could be used to restore the altered brain functions, which characterize neurodegenerative diseases, leading to consider these compounds as novel therapeutic strategies for the treatment of neuropathologies. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Assembly of new polyoxometalate–templated metal–organic frameworks based on flexible ligands

Energy Technology Data Exchange (ETDEWEB)

Li, Na; Mu, Bao; Lv, Lei; Huang, Rudan, E-mail: huangrd@bit.edu.cn

2015-03-15

Four new polyoxometalate(POM)–templated metal–organic frameworks based on flexible ligands, namely, [Cu{sub 6}(bip){sub 12}(PMo{sup VI}{sub 12}O{sub 40}){sub 2}(PMo{sup V}Mo{sup VI}{sub 11}O{sub 40}O{sub 2})]·8H{sub 2}O(1), [Cu{sup I}{sub 3}Cu{sup II}{sub 3}(bip){sub 12}(PMo{sup VI}{sub 12}O{sub 40}){sub 2}(PMo{sup V}{sub 12}O{sub 34})]·8H{sub 2}O(2), [Ni{sub 6}(bip){sub 12}(PMo{sup VI}{sub 12}O{sub 40})(PMo{sup VI}{sub 11}Mo{sup V}O{sub 40}){sub 2}]Cl·6H{sub 2}O(3), [Co{sup II}{sub 3}Co{sup III}{sub 2}(H{sub 2}bib){sub 2}(Hbib){sub 2}(PW{sub 9}O{sub 34}){sub 2}(H{sub 2}O){sub 6}]·6H{sub 2}O(4) (bip=1,3-bis(imidazolyl)propane, bib=1,4-bis(imidazolyl)butane) have been obtained under hydrothermal condition and characterized by single-crystal X-ray diffraction analyses, elemental analyses, and thermogravimetric (TG) analyses. The studies of single crystal X-ray indicate that compounds 1–3 crystallize in the trigonal space group P-3, and compound 4 crystallizes in the triclinic space group P-1. Compounds 1 and 3 represent 3D frameworks, and POMs as the guest molecules are incorporated into the cages which are composed of the ligands and metals, while compounds 2 and 4 show 3D frameworks by hydrogen bonds. This compounds provide new examples of host–guest compounds based on flexible bis(imidazole) ligands. In addition, the electrochemical property and the catalytic property of compound 1 have also been investigated. - Graphical abstract: Four inorganic–organic hybrid compounds based polyoxometalates (POMs) and flexible ligands, namely, have been obtained under hydrothermal conditions and characterized by single-crystal X-ray diffraction analyses, elemental analyses, IR spectra, and thermogravimetric (TG) analyses. Compounds 1–3 are new examples of host–guest compounds based on flexible bis(imidazole) ligands and POMs as the guest molecules are incorporated into the cages which are composed of the ligands and metals. - Highlights: • Polyoxometalate�

Molecular Design of Branched and Binary Molecules at Ordered Interfaces

Energy Technology Data Exchange (ETDEWEB)

Genson, Kirsten Larson [Iowa State Univ., Ames, IA (United States)

2005-01-01

This study examined five different branched molecular architectures to discern the effect of design on the ability of molecules to form ordered structures at interfaces. Photochromic monodendrons formed kinked packing structures at the air-water interface due to the cross-sectional area mismatch created by varying number of alkyl tails and the hydrophilic polar head group. The lower generations formed orthorhombic unit cell with long range ordering despite the alkyl tails tilted to a large degree. Favorable interactions between liquid crystalline terminal groups and the underlying substrate were observed to compel a flexible carbosilane dendrimer core to form a compressed elliptical conformation which packed stagger within lamellae domains with limited short range ordering. A twelve arm binary star polymer was observed to form two dimensional micelles at the air-water interface attributed to the higher polystyrene block composition. Linear rod-coil molecules formed a multitude of packing structures at the air-water interface due to the varying composition. Tree-like rod-coil molecules demonstrated the ability to form one-dimensional structures at the air-water interface and at the air-solvent interface caused by the preferential ordering of the rigid rod cores. The role of molecular architecture and composition was examined and the influence chemically competing fragments was shown to exert on the packing structure. The amphiphilic balance of the different molecular series exhibited control on the ordering behavior at the air-water interface and within bulk structures. The shell nature and tail type was determined to dictate the preferential ordering structure and molecular reorganization at interfaces with the core nature effect secondary.

Role of Dispersive Fluorous Interaction in the Solvation Dynamics of the Perfluoro Group Containing Molecules.

Science.gov (United States)

Mondal, Saptarsi; Chaterjee, Soumit; Halder, Ritaban; Jana, Biman; Singh, Prashant Chandra

2017-08-17

Perfluoro group containing molecules possess an important self-aggregation property through the fluorous (F···F) interaction which makes them useful for diverse applications such as medicinal chemistry, separation techniques, polymer technology, and biology. In this article, we have investigated the solvation dynamics of coumarin-153 (C153) and coumarin-6H (C6H) in ethanol (ETH), 2-fluoroethanol (MFE), and 2,2,2-trifluoroethanol (TFE) using the femtosecond upconversion technique and molecular dynamics (MD) simulation to understand the role of fluorous interaction between the solute and solvent molecules in the solvation dynamics of perfluoro group containing molecules. The femtosecond upconversion data show that the time scales of solvation dynamics of C6H in ETH, MFE, and TFE are approximately the same whereas the solvation dynamics of C153 in TFE is slow as compared to that of ETH and MFE. It has also been observed that the time scale of solvation dynamics of C6H in ETH and MFE is higher than that of C153 in the same solvents. MD simulation results show a qualitative agreement with the experimental data in terms of the time scale of the slow components of the solvation for all the systems. The experimental and simulation studies combined lead to the conclusion that the solvation dynamics of C6H in all solvents as well as C153 in ETH and MFE is mostly governed by the charge distribution of ester moieties (C═O and O) of dye molecules whereas the solvation of C153 in TFE is predominantly due to the dispersive fluorous interaction (F···F) between the perfluoro groups of the C153 and solvent molecules.

Electron-molecule collisions

CERN Document Server

Takayanagi, Kazuo

1984-01-01

Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

Wearable Flexible Sensors: A Review

KAUST Repository

Nag, Anindya

2017-05-18

The paper provides a review on some of the significant research work done on wearable flexible sensors (WFS). Sensors fabricated with flexible materials have been attached to a person along with the embedded system to monitor a parameter and transfer the significant data to the monitoring unit for further analyses. The use of wearable sensors has played a quite important role to monitor physiological parameters of a person to minimize any malfunctioning happening in the body. The paper categorizes the work according to the materials used for designing the system, the network protocols and different types of activities that were being monitored. The challenges faced by the current sensing systems and future opportunities for the wearable flexible sensors regarding its market values are also briefly explained in the paper.

Wearable Flexible Sensors: A Review

KAUST Repository

Nag, Anindya; Mukhopadhyay, Subhas Chandra; Kosel, Jü rgen

2017-01-01

The paper provides a review on some of the significant research work done on wearable flexible sensors (WFS). Sensors fabricated with flexible materials have been attached to a person along with the embedded system to monitor a parameter and transfer the significant data to the monitoring unit for further analyses. The use of wearable sensors has played a quite important role to monitor physiological parameters of a person to minimize any malfunctioning happening in the body. The paper categorizes the work according to the materials used for designing the system, the network protocols and different types of activities that were being monitored. The challenges faced by the current sensing systems and future opportunities for the wearable flexible sensors regarding its market values are also briefly explained in the paper.

Intrinsic flexibility of porous materials; theory, modelling and the flexibility window of the EMT zeolite framework

International Nuclear Information System (INIS)

Fletcher, Rachel E.; Wells, Stephen A.; Leung, Ka Ming; Edwards, Peter P.; Sartbaeva, Asel

2015-01-01

Framework materials possess intrinsic flexibility which can be investigated using geometric simulation. We review framework flexibility properties in energy materials and present novel results on the flexibility window of the EMT zeolite framework containing 18-crown-6 ether as a structure directing agent (SDA). Framework materials have structures containing strongly bonded polyhedral groups of atoms connected through their vertices. Typically the energy cost for variations of the inter-polyhedral geometry is much less than the cost of distortions of the polyhedra themselves – as in the case of silicates, where the geometry of the SiO 4 tetrahedral group is much more strongly constrained than the Si—O—Si bridging angle. As a result, framework materials frequently display intrinsic flexibility, and their dynamic and static properties are strongly influenced by low-energy collective motions of the polyhedra. Insight into these motions can be obtained in reciprocal space through the ‘rigid unit mode’ (RUM) model, and in real-space through template-based geometric simulations. We briefly review the framework flexibility phenomena in energy-relevant materials, including ionic conductors, perovskites and zeolites. In particular we examine the ‘flexibility window’ phenomenon in zeolites and present novel results on the flexibility window of the EMT framework, which shed light on the role of structure-directing agents. Our key finding is that the crown ether, despite its steric bulk, does not limit the geometric flexibility of the framework

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

KAUST Repository

Serag, Maged F.

2014-10-06

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

KAUST Repository

Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

2014-01-01

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

Conserved water molecules in bacterial serine hydroxymethyltransferases.

Science.gov (United States)

Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

2015-10-01

Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The role of cognitive flexibility in cognitive restructuring skill acquisition among older adults.

Science.gov (United States)

Johnco, C; Wuthrich, V M; Rapee, R M

2013-08-01

Cognitive flexibility is one aspect of executive functioning that encompasses the ability to produce diverse ideas, consider response alternatives, and modify behaviors to manage changing circumstances. These processes are likely to be important for implementing cognitive restructuring. The present study investigated the impact of cognitive flexibility on older adults' ability to learn cognitive restructuring. Neuropsychological measures of cognitive flexibility were administered to 40 normal community-dwelling older adult volunteers and their ability to implement cognitive restructuring was coded and analyzed. Results indicated that the majority of participants showed good cognitive restructuring skill acquisition with brief training. The multiple regression analysis suggested that those with poorer cognitive flexibility on neuropsychological testing demonstrated poorer quality cognitive restructuring. In particular, perseverative thinking styles appear to negatively impact the ability to learn cognitive restructuring. Further research is needed to clarify whether older adults with poor cognitive flexibility can improve their cognitive restructuring skills with repetition over treatment or whether alternative skills should be considered. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Effect of hydration on the organo-noble gas molecule HKrCCH: role of krypton in the stabilization of hydrated HKrCCH complexes.

Science.gov (United States)

Biswas, Biswajit; Singh, Prashant Chandra

2015-11-11

The effect of hydration on the fluorine free organo-noble gas compound HKrCCH and the role of krypton in the stabilization of the hydrated HKrCCH complexes have been investigated using the quantum chemical calculations on the HKrCCH-(H2O)n=1-6 clusters. Structure and energetics calculations show that water stabilizes HKrCCH through the π hydrogen bond in which the OH group of water interacts with the C[triple bond, length as m-dash]C group of HKrCCH. A maximum of four water molecules can directly interact with the C[triple bond, length as m-dash]C of HKrCCH and after that only inter-hydrogen bonding takes place between the water molecules indicating that the primary hydration shell contains four water molecules. Atom in molecule analysis depicts that π hydrogen bonded complexes of the hydrated HKrCCH are cyclic structures in which the OKr interaction cooperates in the formation of strong O-HC[triple bond, length as m-dash]C interaction. Structure, energetics and charge analysis clearly established that krypton plays an important role in the stabilization as well as the formation of the primary hydration shell of hydrated HKrCCH complexes.

Unfolding Role of a Danger Molecule Adenosine Signaling in Modulation of Microbial Infection and Host Cell Response

Directory of Open Access Journals (Sweden)

Jaden S. Lee

2018-01-01

Full Text Available Ectonucleotidases CD39 and CD73, specific nucleotide metabolizing enzymes located on the surface of the host, can convert a pro-inflammatory environment driven by a danger molecule extracellular-ATP to an adenosine-mediated anti-inflammatory milieu. Accordingly, CD39/CD73 signaling has been strongly implicated in modulating the intensity, duration, and composition of purinergic danger signals delivered to host. Recent studies have eluted potential roles for CD39 and CD73 in selective triggering of a variety of host immune cells and molecules in the presence of pathogenic microorganisms or microbial virulence molecules. Growing evidence also suggests that CD39 and CD73 present complimentary, but likely differential, actions against pathogens to shape the course and severity of microbial infection as well as the associated immune response. Similarly, adenosine receptors A2A and A2B have been proposed to be major immunomodulators of adenosine signaling during chronic inflammatory conditions induced by opportunistic pathogens, such as oral colonizer Porphyromonas gingivalis. Therefore, we here review the recent studies that demonstrate how complex network of molecules in the extracellular adenosine signaling machinery and their interactions can reshape immune responses and may also be targeted by opportunistic pathogens to establish successful colonization in human mucosal tissues and modulate the host immune response.

Exploring the Framework Hydrophobicity and Flexibility of ZIF-8: From Biofuel Recovery to Hydrocarbon Separations

KAUST Repository

Zhang, Ke

2013-11-07

The framework hydrophobicity and flexibility of ZIF-8 are investigated by a detailed adsorption and diffusion study of a series of probe molecules including ethanol, 1-butanol, water, hexane isomers, xylene isomers, and 1,2,4-trimethylbenzene. The prospects for using ZIF-8 in biofuel recovery and hydrocarbon separations are discussed in terms of adsorption or kinetic selectivities. ZIF-8 shows extremely low water vapor uptakes and is especially suitable for vapor phase butanol-based biofuel recovery. The extraordinary framework flexibility of ZIF-8 is demonstrated by the adsorption of hydrocarbon molecules that are much larger than its nominal pore size, such as m-xylene, o-xylene and 1,2,4-trimethylbenzene. The calculation of corrected diffusion coefficients reveals an interesting spectrum of promising kinetic hydrocarbon separations by ZIF-8. These findings confirm that a molecular sieving effect tends to occur in the sorbate molecular size range of 4-6 Å rather than around the nominal ZIF-8 pore size of 3.4 Å, due to its surprising framework flexibility. © 2013 American Chemical Society.

Role of Intercellular Adhesion Molecule-1 in Radiation-Induced Brain Injury

International Nuclear Information System (INIS)

Wu, K.-L.; Tu Ba; Li Yuqing; Wong, C. Shun

2010-01-01

Purpose: To determine the role of intercellular adhesion molecule-1 (ICAM-1) in the pathogenesis of brain injury after irradiation (IR). Methods and Materials: We assessed the expression of ICAM-1 in mouse brain after cranial IR and determined the histopathologic and behavioral changes in mice that were either wildtype (+/+) or knockout (-/-) of the ICAM-1 gene after IR. Results: There was an early dose-dependent increase in ICAM-1 mRNA and protein expression after IR. Increased ICAM-1 immunoreactivity was observed in endothelia and glia of ICAM-1+/+ mice up to 8 months after IR. ICAM-1-/- mice showed no expression. ICAM-1+/+ and ICAM-1-/- mice showed similar vascular abnormalities at 2 months after 10-17 Gy, and there was evidence for demyelination and inhibition of hippocampal neurogenesis at 8 months after 10 Gy. After 10 Gy, irradiated ICAM-1+/+ and ICAM-1-/- mice showed similar behavioral changes at 2-6 months in open field, light-dark chamber, and T-maze compared with age-matched genotype controls. Conclusion: There is early and late upregulation of ICAM-1 in the vasculature and glia of mouse brain after IR. ICAM-1, however, does not have a causative role in the histopathologic injury and behavioral dysfunction after moderate single doses of cranial IR.

Can flexibility help you float?

Science.gov (United States)

Burton, L. J.; Bush, J. W. M.

2012-10-01

We consider the role of flexibility in the weight-bearing characteristics of bodies floating at an interface. Specifically, we develop a theoretical model for a two-dimensional thin floating plate that yields the maximum stable plate load and optimal stiffness for weight support. Plates small relative to the capillary length are primarily supported by surface tension, and their weight-bearing potential does not benefit from flexibility. Above a critical size comparable to the capillary length, flexibility assists interfacial flotation. For plates on the order of and larger than the capillary length, deflection from an initially flat shape increases the force resulting from hydrostatic pressure, allowing the plate to support a greater load. In this large plate limit, the shape that bears the most weight is a semicircle, which displaces the most fluid above the plate for a fixed plate length. Exact results for maximum weight-bearing plate shapes are compared to analytic approximations made in the limits of large and small plate sizes. The value of flexibility for floating to a number of biological organisms is discussed in light of our study.

Bacterial Vaginosis Bacterial and Epithelial Cell Adhesion Molecules

Directory of Open Access Journals (Sweden)

Şayeste Demirezen

2016-05-01

molecules. The most important adhesion molecules of epithelium are cadherins, fibronectins, Toll like receptors and carbohydrates. In bacteria, pilis, lypopolysaccaharide and biofilm have primary importance. In this review, the adhesion molecules are discussed in detail and their roles in formation of clue cell are clarified.

The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

Science.gov (United States)

Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

2013-04-25

The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

Insights into the role of protein molecule size and structure on interfacial properties using designed sequences

Science.gov (United States)

Dwyer, Mirjana Dimitrijev; He, Lizhong; James, Michael; Nelson, Andrew; Middelberg, Anton P. J.

2013-01-01

Mixtures of a large, structured protein with a smaller, unstructured component are inherently complex and hard to characterize at interfaces, leading to difficulties in understanding their interfacial behaviours and, therefore, formulation optimization. Here, we investigated interfacial properties of such a mixed system. Simplicity was achieved using designed sequences in which chemical differences had been eliminated to isolate the effect of molecular size and structure, namely a short unstructured peptide (DAMP1) and its longer structured protein concatamer (DAMP4). Interfacial tension measurements suggested that the size and bulk structuring of the larger molecule led to much slower adsorption kinetics. Neutron reflectometry at equilibrium revealed that both molecules adsorbed as a monolayer to the air–water interface (indicating unfolding of DAMP4 to give a chain of four connected DAMP1 molecules), with a concentration ratio equal to that in the bulk. This suggests the overall free energy of adsorption is equal despite differences in size and bulk structure. At small interfacial extensional strains, only molecule packing influenced the stress response. At larger strains, the effect of size became apparent, with DAMP4 registering a higher stress response and interfacial elasticity. When both components were present at the interface, most stress-dissipating movement was achieved by DAMP1. This work thus provides insights into the role of proteins' molecular size and structure on their interfacial properties, and the designed sequences introduced here can serve as effective tools for interfacial studies of proteins and polymers. PMID:23303222

No Relationship between Hamstring Flexibility and Hamstring Injuries in Male Amateur Soccer Players

NARCIS (Netherlands)

Van Doormaal, Mitchell C M; Van Der Horst, Nick; Backx, Frank J G; Smits, Dirk Wouter; Huisstede, Bionka M A

2017-01-01

BACKGROUND: In soccer, although hamstring flexibility is thought to play a major role in preventing hamstring injuries, the relationship between hamstring flexibility and hamstring injuries remains unclear. PURPOSE: To investigate the relationship between hamstring flexibility and hamstring injuries

Current rectification in a single molecule diode: the role of electrode coupling.

Science.gov (United States)

Sherif, Siya; Rubio-Bollinger, Gabino; Pinilla-Cienfuegos, Elena; Coronado, Eugenio; Cuevas, Juan Carlos; Agraït, Nicolás

2015-07-24

We demonstrate large rectification ratios (> 100) in single-molecule junctions based on a metal-oxide cluster (polyoxometalate), using a scanning tunneling microscope (STM) both at ambient conditions and at low temperature. These rectification ratios are the largest ever observed in a single-molecule junction, and in addition these junctions sustain current densities larger than 10(5) A cm(-2). By following the variation of the I-V characteristics with tip-molecule separation we demonstrate unambiguously that rectification is due to asymmetric coupling to the electrodes of a molecule with an asymmetric level structure. This mechanism can be implemented in other type of molecular junctions using both organic and inorganic molecules and provides a simple strategy for the rational design of molecular diodes.

Probing flexible conformations in molecular junctions by inelastic electron tunneling spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Deng, Mingsen [Department of Physics, Guizhou University, Guiyang, 550025 (China); Guizhou Provincial Key Laboratory of Computational Nano-Material Science, Institute of Applied Physics, Guizhou Normal College, Guiyang, 550018 (China); Ye, Gui; Jiang, Jun, E-mail: jiangj1@ustc.edu.cn [Department of Chemical Physics, School of Chemistry and Materials Science, University of Science and Technology of China, Hefei, 230026 (China); Cai, Shaohong, E-mail: caish@mail.gufe.edu.cn [Department of Physics, Guizhou University, Guiyang, 550025 (China); Guizhou Key Laboratory of Economic System Simulation, Guizhou University of Finance and Economics, Guiyang, 550004 (China); Sun, Guangyu [Guizhou Provincial Key Laboratory of Computational Nano-Material Science, Institute of Applied Physics, Guizhou Normal College, Guiyang, 550018 (China)

2015-01-15

The probe of flexible molecular conformation is crucial for the electric application of molecular systems. We have developed a theoretical procedure to analyze the couplings of molecular local vibrations with the electron transportation process, which enables us to evaluate the structural fingerprints of some vibrational modes in the inelastic electron tunneling spectroscopy (IETS). Based on a model molecule of Bis-(4-mercaptophenyl)-ether with a flexible center angle, we have revealed and validated a simple mathematical relationship between IETS signals and molecular angles. Our results might open a route to quantitatively measure key geometrical parameters of molecular junctions, which helps to achieve precise control of molecular devices.

Comparative Analysis of Immune Checkpoint Molecules and Their Potential Role in the Transmissible Tasmanian Devil Facial Tumor Disease

Directory of Open Access Journals (Sweden)

Andrew S. Flies

2017-05-01

Full Text Available Immune checkpoint molecules function as a system of checks and balances that enhance or inhibit immune responses to infectious agents, foreign tissues, and cancerous cells. Immunotherapies that target immune checkpoint molecules, particularly the inhibitory molecules programmed cell death 1 and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, have revolutionized human oncology in recent years, yet little is known about these key immune signaling molecules in species other than primates and rodents. The Tasmanian devil facial tumor disease is caused by transmissible cancers that have resulted in a massive decline in the wild Tasmanian devil population. We have recently demonstrated that the inhibitory checkpoint molecule PD-L1 is upregulated on Tasmanian devil (Sarcophilus harrisii facial tumor cells in response to the interferon-gamma cytokine. As this could play a role in immune evasion by tumor cells, we performed a thorough comparative analysis of checkpoint molecule protein sequences among Tasmanian devils and eight other species. We report that many of the key signaling motifs and ligand-binding sites in the checkpoint molecules are highly conserved across the estimated 162 million years of evolution since the last common ancestor of placental and non-placental mammals. Specifically, we discovered that the CTLA-4 (MYPPPY ligand-binding motif and the CTLA-4 (GVYVKM inhibitory domain are completely conserved across all nine species used in our comparative analysis, suggesting that the function of CTLA-4 is likely conserved in these species. We also found that cysteine residues for intra- and intermolecular disulfide bonds were also highly conserved. For instance, all 20 cysteine residues involved in disulfide bonds in the human 4-1BB molecule were also present in devil 4-1BB. Although many key sequences were conserved, we have also identified immunoreceptor tyrosine-based inhibitory motifs (ITIMs and immunoreceptor tyrosine-based switch

Flexible Electronics: Integration Processes for Organic and Inorganic Semiconductor-Based Thin-Film Transistors

Directory of Open Access Journals (Sweden)

Fábio F. Vidor

2015-07-01

Full Text Available Flexible and transparent electronics have been studied intensively during the last few decades. The technique establishes the possibility of fabricating innovative products, from flexible displays to radio-frequency identification tags. Typically, large-area polymeric substrates such as polypropylene (PP or polyethylene terephthalate (PET are used, which produces new requirements for the integration processes. A key element for flexible and transparent electronics is the thin-film transistor (TFT, as it is responsible for the driving current in memory cells, digital circuits or organic light-emitting devices (OLEDs. In this paper, we discuss some fundamental concepts of TFT technology. Additionally, we present a comparison between the use of the semiconducting organic small-molecule pentacene and inorganic nanoparticle semiconductors in order to integrate TFTs suitable for flexible electronics. Moreover, a technique for integration with a submicron resolution suitable for glass and foil substrates is presented.

Flexibility and Control : An empirical study relating production flexibility to the design of performance management systems

NARCIS (Netherlands)

Van Veen-Dirks, P.M.G.

2002-01-01

A critical challenge facing organizations is the design of management control systems, which play a key role in evaluating the achievement of organizational and individual objectives. This thesis addresses the design of management control (performance management) systems in the current flexible

The role of psychological flexibility in a self-help acceptance and commitment therapy intervention for psychological distress in a randomized controlled trial.

NARCIS (Netherlands)

Fledderus, M.; Bohlmeijer, Ernst Thomas; Fox, Gerardus J.A.; Schreurs, Karlein Maria Gertrudis; Spinhoven, Philip

2013-01-01

This study examined the role of psychological flexibility, as a risk factor and as a process of change, in a self-help Acceptance and Commitment Therapy (ACT) intervention for adults with mild to moderate depression and anxiety. Participants were randomized to the self-help programme with e-mail

Rosetta Ligand docking with flexible XML protocols.

Science.gov (United States)

Lemmon, Gordon; Meiler, Jens

2012-01-01

RosettaLigand is premiere software for predicting how a protein and a small molecule interact. Benchmark studies demonstrate that 70% of the top scoring RosettaLigand predicted interfaces are within 2Å RMSD from the crystal structure [1]. The latest release of Rosetta ligand software includes many new features, such as (1) docking of multiple ligands simultaneously, (2) representing ligands as fragments for greater flexibility, (3) redesign of the interface during docking, and (4) an XML script based interface that gives the user full control of the ligand docking protocol.

Roll-coating fabrication of flexible organic solar cells: comparison of fullerene and fullerene-free systems

DEFF Research Database (Denmark)

Liu, Kuan; Larsen-Olsen, Thue Trofod; Lin, Yuze

2016-01-01

Flexible organic solar cells (OSCs) based on a blend of low-bandgap polymer donor PTB7-TH and nonfullerene small molecule acceptor IEIC were fabricated via a roll-coating process under ambient atmosphere. Both an indium tin oxide (ITO)-free substrate and a flexible ITO substrate were employed...... in these inverted OSCs. OSCs with flexible ITO and ITO-free substrates exhibited power conversion efficiencies (PCEs) up to 2.26% and 1.79%, respectively, which were comparable to those of the reference devices based on fullerene acceptors under the same conditions. This is the first example for all roll......-coating fabrication procedures for flexible OSCs based on non-fullerene acceptors with the PCE exceeding 2%. The fullerene-free OSCs exhibited better dark storage stability than the fullerene-based control devices....

Method for analyzing structural changes of flexible metal-organic frameworks induced by adsorbates

NARCIS (Netherlands)

Dubbeldam, D.; Krishna, R.; Snurr, R.Q.

2009-01-01

Metal−organic frameworks (MOFs) have crystal structures that exhibit unusual flexibility. An extreme example is that of the "breathing MOF" MIL-53 that expands or shrinks to admit guest molecules like CO2 and water. We present a powerful simulation tool to quickly calculate unit cell shape and size

A flexible, transparent and high-performance gas sensor based on layer-materials for wearable technology

Science.gov (United States)

Zheng, Zhaoqiang; Yao, Jiandong; Wang, Bing; Yang, Guowei

2017-10-01

Gas sensors play a vital role among a wide range of practical applications. Recently, propelled by the development of layered materials, gas sensors have gained much progress. However, the high operation temperature has restricted their further application. Herein, via a facile pulsed laser deposition (PLD) method, we demonstrate a flexible, transparent and high-performance gas sensor made of highly-crystalline indium selenide (In2Se3) film. Under UV-vis-NIR light or even solar energy activation, the constructed gas sensors exhibit superior properties for detecting acetylene (C2H2) gas at room temperature. We attribute these properties to the photo-induced charger transfer mechanism upon C2H2 molecule adsorption. Moreover, no apparent degradation in the device properties is observed even after 100 bending cycles. In addition, we can also fabricate this device on rigid substrates, which is also capable to detect gas molecules at room temperature. These results unambiguously distinguish In2Se3 as a new candidate for future application in monitoring C2H2 gas at room temperature and open up new opportunities for developing next generation full-spectrum activated gas sensors.

Flexibility.

Science.gov (United States)

Humphrey, L. Dennis

1981-01-01

Flexibility is an important aspect of all sports and recreational activities. Flexibility can be developed and maintained by stretching exercises. Exercises designed to develop flexibility in ankle joints, knees, hips, and the lower back are presented. (JN)

FlavorDB: a database of flavor molecules

OpenAIRE

Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; NK, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet

2017-01-01

Abstract Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and ...

The Role of Learning Tasks on Attitude Change Using Cognitive Flexibility Hypertext Systems

Science.gov (United States)

Godshalk, Veronica M.; Harvey, Douglas M.; Moller, Leslie

2004-01-01

In this study, the authors examined the impact of task assignment on the effectiveness of a Web-based experiential exercise based on cognitive flexibility theory to enlighten learner attitudes toward the ill-structured topic of sexual harassment. In the research study, we sought to shed light on the use of a cognitive flexibility approach when…

Physisorption of three amine terminated molecules (TMBDA, BDA, TFBDA) on the Au(111) Surface: The Role of van der Waals Interaction

Science.gov (United States)

Aminpour, Maral; Le, Duy; Rahman, Talat S.

2012-02-01

Recently, the electronic properties and alignment of tetramethyl-1,4-benzenediamine (TMBDA), 1,4-benzenediamine (BDA) and tetrafluro-1,4-benzenediamine (TFBDA) molecules were studied experimentally. Discrepancies were found for both the binding energy and the molecule tilt angle with respect to the surface, when results were compared with density functional theory calculations [1]. We have included the effect of vdW interactions both between the molecules and the Au(111) surface and find binding energies which are in very good agreement with experiments. We also find that at low coverages each of these molecules would adsorb almost parallel to the surface. N-Au bond lengths and charge redistribution on adsorption of the molecules are also analyzed. Our calculations are based on DFT using vdW-DF exchange correlation functionals. For BDA (since we are aware of experimental data), we show that for higher coverage, inclusion of intermolecular van der Waals interaction leads to tilting of the molecules with respect to the surface and formation of line structures. Our results demonstrate the central role played by intermolecular interaction in pattern formation on this surface.[4pt] [1] M. Dell'Angela et al, Nano Lett. 2010, 10, 2470; M. Kamenetska et al, J. Phys. Chem. C, 2011, 115, 12625

Flexible working hours and well-being in Finland.

Science.gov (United States)

Kandolin, I; Härmä, M; Toivanen, M

2001-12-01

Flexibility of working hours became more prevalent in the 1990s in Finland. According to a representative survey on Finnish wage and salary earners (n = 1790) at the beginning of 2000, a great majority of male (76%) and female (65%) employees regularly worked overtime and/or had irregular working hours every month. These employees were flexible in meeting the needs of their companies/employers. Individual flexibility of working hours was far less common, only one third of male and female employees were able to regulate their working hours. A better balance between company-controlled and individual flexibility would, however, improve the well-being of employees. Employees working overtime without being allowed to regulate their working hours felt more symptoms of distress and had more conflicts in combining workplace and family roles than those who could individually determine their working hours flexibly. An investment in individually determined flexibility, for example by means of participatory planning, would improve the well-being of employees, and thus also improve the productivity of the organization.

Graphene-Tapered ZnO Nanorods Array as a Flexible Antireflection Layer

Directory of Open Access Journals (Sweden)

Taeseup Song

2015-01-01

Full Text Available Flexible solar cells have drawn a great deal of attention due to their various advantages including deformable and wearable characteristics. In the solar cells, the antireflection layer plays an important role in the improvement in the conversion efficiency by increasing the light transmission and suppressing the Fresnel refraction. For the successful implantation of the antireflection layer into the flexible solar cells, the flexible mechanical property of the antireflection layer is also necessary. However, the study on flexible antireflection layer for the flexible solar cells or optoelectronics is still lacking. In this study, we report the graphene-tapered ZnO nanorods array as a flexible antireflection layer for the application in flexible solar cells. Flexible two-dimensional graphene sheet and the tapered morphology of ZnO nanorods enable conformal coverage on the flexible substrate with curved surface and significant improvements in antireflection properties, respectively.

Lumbopelvic flexibility modulates neuromuscular responses during trunk flexion-extension.

Science.gov (United States)

Sánchez-Zuriaga, Daniel; Artacho-Pérez, Carla; Biviá-Roig, Gemma

2016-06-01

Various stimuli such as the flexibility of lumbopelvic structures influence the neuromuscular responses of the trunk musculature, leading to different load sharing strategies and reflex muscle responses from the afferents of lumbopelvic mechanoreceptors. This link between flexibility and neuromuscular response has been poorly studied. The aim of this study was to investigate the relationship between lumbopelvic flexibility and neuromuscular responses of the erector spinae, hamstring and abdominal muscles during trunk flexion-extension. Lumbopelvic movement patterns were measured in 29 healthy women, who were separated into two groups according to their flexibility during trunk flexion-extension. The electromyographic responses of erector spinae, rectus abdominis and biceps femoris were also recorded. Subjects with greater lumbar flexibility had significantly less pelvic flexibility and vice versa. Subjects with greater pelvic flexibility had a higher rate of relaxation and lower levels of hamstring activation during maximal trunk flexion. The neuromuscular response patterns of the hamstrings seem partially modulated by pelvic flexibility. Not so with the lumbar erector spinae and lumbar flexibility, despite the assertions of some previous studies. The results of this study improve our knowledge of the relationships between trunk joint flexibility and neuromuscular responses, a relationship which may play a role in low back pain. Copyright © 2016 Elsevier Ltd. All rights reserved.

The influence of flexible branches in flexible polymers

International Nuclear Information System (INIS)

Wescott, J.T.

1998-06-01

In this work the influence of branches in flexible polymer systems has been investigated by consideration of (1) the behaviour of isolated poly-α-olefin chains and (2) the p -T phase behaviour of poly(4-methylpentene-1)(P4MP1). Molecular dynamics simulations of isolated poly-α-olefins were performed in order to gauge directly the effect of molecular structure on chain dimensions, flexibility (via the persistence length) and shape. Under Θ-conditions the addition of short linear branches was shown to increase the flexibility of the backbone. In conditions of good solvent, however, the effect of longer and bulkier branches was to increase the persistence length and average size of the coil with the arrangement of side chain atoms making a small difference. The side branches themselves also affected the solvent conditions experienced by the backbone, behaving much like bound solvent. Consideration of ethylene-α-olefin copolymers, where the branch content was varied from 0-50%, showed that under good solvent conditions the branches increased the chain stiffness only when the gap between side branches was less than five backbone carbon atoms. The backbone torsions were also shown to play an important role in determining these trends. For comparison with the above simulations, persistence length values for polyethylene (= 7.3±0.2A) and P4MP1 (=7.6±0.3A) were measured experimentally by neutron scattering in dilute solution. A value of 6.7±0.5 for the characteristic ratio of PE was also calculated. To investigate the role of a bulky side group in crystalline phases, wide angle X-ray diffraction experiments using a Hikosaka pressure cell were performed on P4MP1. Computer modelling, utilising the experimental data obtained, determined the structure of a disordered phase produced at room temperature and a new high pressure/high temperature phase. The disordered phase was found to be due to a collapse of the backbone combined with some disordering of the side chains

A hydrogel capsule as gate dielectric in flexible organic field-effect transistors

Energy Technology Data Exchange (ETDEWEB)

Dumitru, L. M.; Manoli, K.; Magliulo, M.; Torsi, L., E-mail: luisa.torsi@uniba.it [Department of Chemistry, University of Bari “Aldo Moro”, Via Orabona 4, Bari I-70126 (Italy); Ligonzo, T. [Department of Physics, University of Bari “Aldo Moro”, Via Orabona 4, Bari I-70126 (Italy); Palazzo, G. [Department of Chemistry, University of Bari “Aldo Moro”, Via Orabona 4, Bari I-70126 (Italy); Center of Colloid and Surface Science—CSGI—Bari Unit, Via Orabona 4, Bari I-70126 (Italy)

2015-01-01

A jellified alginate based capsule serves as biocompatible and biodegradable electrolyte system to gate an organic field-effect transistor fabricated on a flexible substrate. Such a system allows operating thiophene based polymer transistors below 0.5 V through an electrical double layer formed across an ion-permeable polymeric electrolyte. Moreover, biological macro-molecules such as glucose-oxidase and streptavidin can enter into the gating capsules that serve also as delivery system. An enzymatic bio-reaction is shown to take place in the capsule and preliminary results on the measurement of the electronic responses promise for low-cost, low-power, flexible electronic bio-sensing applications using capsule-gated organic field-effect transistors.

Conformational flexibility of aspartame.

Science.gov (United States)

Toniolo, Claudio; Temussi, Pierandrea

2016-05-01

L-Aspartyl-L-phenylalanine methyl ester, better known as aspartame, is not only one of the most used artificial sweeteners, but also a very interesting molecule with respect to the correlation between molecular structure and taste. The extreme conformational flexibility of this dipeptide posed a huge difficulty when researchers tried to use it as a lead compound to design new sweeteners. In particular, it was difficult to take advantage of its molecular model as a mold to infer the shape of the, then unknown, active site of the sweet taste receptor. Here, we follow the story of the 3D structural aspects of aspartame from early conformational studies to recent docking into homology models of the receptor. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 376-384, 2016. © 2016 Wiley Periodicals, Inc.

Coupling chemical and biological catalysis: a flexible paradigm for producing biobased chemicals.

Science.gov (United States)

Schwartz, Thomas J; Shanks, Brent H; Dumesic, James A

2016-04-01

Advances in metabolic engineering have allowed for the development of new biological catalysts capable of selectively de-functionalizing biomass to yield platform molecules that can be upgraded to biobased chemicals using high efficiency continuous processing allowed by heterogeneous chemical catalysis. Coupling these disciplines overcomes the difficulties of selectively activating COH bonds by heterogeneous chemical catalysis and producing petroleum analogues by biological catalysis. We show that carboxylic acids, pyrones, and alcohols are highly flexible platforms that can be used to produce biobased chemicals by this approach. More generally, we suggest that molecules with three distinct functionalities may represent a practical upper limit on the extent of functionality present in the platform molecules that serve as the bridge between biological and chemical catalysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Role of the adhesion molecule F3/Contactin in synaptic plasticity and memory.

Science.gov (United States)

Gulisano, Walter; Bizzoca, Antonella; Gennarini, Gianfranco; Palmeri, Agostino; Puzzo, Daniela

2017-06-01

Cell adhesion molecules (CAMs) have a pivotal role in building and maintaining synaptic structures during brain development participating in axonal elongation and pathfinding, glial guidance of neuronal migration, as well as myelination. CAMs expression persists in the adult brain particularly in structures undergoing postnatal neurogenesis and involved in synaptic plasticity and memory as the hippocampus. Among the neural CAMs, we have recently focused on F3/Contactin, a glycosylphosphatidyl inositol-anchored glycoprotein belonging to the immunoglobulin superfamily, involved in neuronal development, synaptic maintenance and organization of neuronal networks. Here, we discuss our recent data suggesting that F3/Contactin exerts a role in hippocampal synaptic plasticity and memory in adult and aged mice. In particular, we have studied long-term potentiation (LTP), spatial and object recognition memory, and phosphorylation of the transcription factor cAMP-Responsive-Element Binding protein (CREB) in a transgenic mouse model of F3/Contactin overexpression. We also investigated whether F3/Contactin might influence neuronal apoptosis and the production of amyloid-beta peptide (Aβ), known to be one of the main pathogenetic hallmarks of Alzheimer's disease (AD). In conclusion, a further understanding of F3/Contactin role in synaptic plasticity and memory might have interesting clinical outcomes in cognitive disorders, such as aging and AD, offering innovative therapeutic opportunities. Copyright © 2016 Elsevier Inc. All rights reserved.

Emotional modulation of control dilemmas: the role of positive affect, reward, and dopamine in cognitive stability and flexibility.

Science.gov (United States)

Goschke, Thomas; Bolte, Annette

2014-09-01

Goal-directed action in changing environments requires a dynamic balance between complementary control modes, which serve antagonistic adaptive functions (e.g., to shield goals from competing responses and distracting information vs. to flexibly switch between goals and behavioral dispositions in response to significant changes). Too rigid goal shielding promotes stability but incurs a cost in terms of perseveration and reduced flexibility, whereas too weak goal shielding promotes flexibility but incurs a cost in terms of increased distractibility. While research on cognitive control has long been conducted relatively independently from the study of emotion and motivation, it is becoming increasingly clear that positive affect and reward play a central role in modulating cognitive control. In particular, evidence from the past decade suggests that positive affect not only influences the contents of cognitive processes, but also modulates the balance between complementary modes of cognitive control. In this article we review studies from the past decade that examined effects of induced positive affect on the balance between cognitive stability and flexibility with a focus on set switching and working memory maintenance and updating. Moreover, we review recent evidence indicating that task-irrelevant positive affect and performance-contingent rewards exert different and sometimes opposite effects on cognitive control modes, suggesting dissociations between emotional and motivational effects of positive affect. Finally, we critically review evidence for the popular hypothesis that effects of positive affect may be mediated by dopaminergic modulations of neural processing in prefrontal and striatal brain circuits, and we refine this "dopamine hypothesis of positive affect" by specifying distinct mechanisms by which dopamine may mediate effects of positive affect and reward on cognitive control. We conclude with a discussion of limitations of current research, point to

Trunk Flexibility Improvement in Response to Powered Assisted Exercise

Directory of Open Access Journals (Sweden)

B.S. Bains

2016-07-01

Full Text Available Background study: Flexibility in human spine has always plays an important role in dexterity and seamless ambulatory activities. When optimum range is not maintained by the trunk column, due to lack of flexibility, the posture gets affected resulting in reduce trunk rotation flexibility and mobility hence loss of complete trunk rotation. Objective: The purpose of this study is to determine the effect of Shapemaster Power Assisted Exercise Equipment (SPAEE on trunk flexibility. Methodology: Twenty healthy individual ages between 40 to 60 years were randomly divided into control and exercise groups. Shapemaster exercise program performed two times per week for 5 weeks and 45 minutes per session. Before and after 10 sessions of Shapemaster exercise protocol, Seated trunk rotation test was used to measure trunk flexibility. Results: Repeated measurement ANOVA were used to analysis data between groups. The results of this study illustrated that after 10th sessions trunk flexibility significantly improved (F (1.0, 18 = 11.732, p < 0.003. Conclusion: In conclusion results were determined that SPAEE is safe and it did effectively enhance flexibility among individual healthy adults. Keyword: Shapemaster Power Assisted Exercise Equipment (SPAEE, Trunk Flexibility, Healthy individual

Interface Molecules of Angiostrongylus cantonensis: Their Role in Parasite Survival and Modulation of Host Defenses

Directory of Open Access Journals (Sweden)

Alessandra L. Morassutti

2012-01-01

Full Text Available Angiostrongylus cantonensis is a nematode parasite that causes eosinophilic meningoencephalitis in humans. Disease presents following the ingestion of third-stage larvae residing in the intermediate mollusk host and disease manifests as an acute inflammation of the meninges characterized by eosinophil infiltrates which release a battery of proinflammatory and cytotoxic agents in response to the pathogen. As a mechanism of neutralizing these host defenses, A. cantonensis expresses different molecules with immunomodulatory properties that are excreted or secreted (ES. In this paper we discuss the role of ES proteins on disease exacerbation and their potential use as therapeutic targets.

Controllable synthesis and sintering of silver nanoparticles for inkjet-printed flexible electronics

International Nuclear Information System (INIS)

Zhang, Zhiliang; Zhu, Weiyue

2015-01-01

An effective and facile strategy was developed to successfully synthesize nearly uniform silver nanoparticles (AgNPs) with particle size of <10 nm, and demonstrated to achieve the sintering of AgNPs at room temperature for inkjet-printed flexible electronics. In such system, a series of different chain-length alkylamines were exploited as capped molecules to controllable synthesis of uniform AgNPs with the mean nanoparticle size in rang of 8.6 ± 0.9, 8.9 ± 1.2 and 9.2 ± 1.6 nm, and these ultra-small nanoparticles were very favorable to attain an excellent printing fluency. Based on the as-synthesized AgNPs, a sequence of flexible electrocircuits was successfully fabricated by ink-jet printing technique. After the dipped treatment, the printed AgNPs were achieved to spontaneous coalescence and aggregation at room temperature induced by preferential dissolution of capped molecules on AgNPs surfaces into methanol solution. These aggregated AgNPs demonstrated superior controllability, excellent stability and low resistivity in the range of 31.6–26.5 μΩ cm, and would have enormous potential in the application to be tailored for assembly of optoelectronics devices. - Highlights: • Silver nanoparticles with particle size of <10 nm was controllably synthesized. • The sintering of silver nanoparticles was conducted at room temperature. • The resistivity was reached as low as 26.5 μΩ cm for flexible electronics

Small molecules: the missing link in the central dogma.

Science.gov (United States)

Schreiber, Stuart L

2005-07-01

Small molecules have critical roles at all levels of biological complexity and yet remain orphans of the central dogma. Chemical biologists, working with small molecules, expand our understanding of these central elements of life.

Organizational Learning, Strategic Flexibility and Business Model Innovation: An Empirical Research Based on Logistics Enterprises

Science.gov (United States)

Bao, Yaodong; Cheng, Lin; Zhang, Jian

Using the data of 237 Jiangsu logistics firms, this paper empirically studies the relationship among organizational learning capability, business model innovation, strategic flexibility. The results show as follows; organizational learning capability has positive impacts on business model innovation performance; strategic flexibility plays mediating roles on the relationship between organizational learning capability and business model innovation; interaction among strategic flexibility, explorative learning and exploitative learning play significant roles in radical business model innovation and incremental business model innovation.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

Science.gov (United States)

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Global bending quantum number and the absence of monodromy in the HCN-CNH molecule

NARCIS (Netherlands)

Efstathiou, K; Joyeux, M; Sadovskií, D. A.

We introduce and analyze a model system based on a deformation of a spherical pendulum that can be used to reproduce large amplitude bending vibrations of flexible triatomic molecules with two stable linear equilibria. On the basis of our model and the recent vibrational potential [ J. Chem. Phys.

The role of verbal labels on flexible memory retrieval at 12-months of age.

Science.gov (United States)

Taylor, Gemma; Liu, Hao; Herbert, Jane S

2016-11-01

The provision of verbal labels enhances 12-month-old infants' memory flexibility across a form change in a puppet imitation task (Herbert, 2011), although the mechanisms for this effect remain unclear. Here we investigate whether verbal labels can scaffold flexible memory retrieval when task difficulty increases and consider the mechanism responsible for the effect of language cues on early memory flexibility. Twelve-month-old infants were provided with English, Chinese, or empty language cues during a difficult imitation task, a combined change in the puppet's colour and form at the test (Hayne et al., 1997). Imitation performance by infants in the English language condition only exceeded baseline performance after the 10-min delay. Thus, verbal labels facilitated flexible memory retrieval on this task. There were no correlations between infants' language comprehension and imitation performance. Thus, it is likely that verbal labels facilitate both attention and categorisation during encoding and retrieval. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Wind-Induced Reconfigurations in Flexible Branched Trees

Science.gov (United States)

Ojo, Oluwafemi; Shoele, Kourosh

2017-11-01

Wind induced stresses are the major mechanical cause of failure in trees. We know that the branching mechanism has an important effect on the stress distribution and stability of a tree in the wind. Eloy in PRL 2011, showed that Leonardo da Vinci's original observation which states the total cross section of branches is conserved across branching nodes is the best configuration for resisting wind-induced fracture in rigid trees. However, prediction of the fracture risk and pattern of a tree is also a function of their reconfiguration capabilities and how they mitigate large wind-induced stresses. In this studies through developing an efficient numerical simulation of flexible branched trees, we explore the role of the tree flexibility on the optimal branching. Our results show that the probability of a tree breaking at any point depends on both the cross-section changes in the branching nodes and the level of tree flexibility. It is found that the branching mechanism based on Leonardo da Vinci's original observation leads to a uniform stress distribution over a wide range of flexibilities but the pattern changes for more flexible systems.

Sustainable development of the wind power industry in a complex environment: a flexibility study

International Nuclear Information System (INIS)

Zhao, Zhen-Yu; Zhu, Jiang; Zuo, Jian

2014-01-01

As a new and developing green energy business in emerging economies such as China, the wind power industry chain faces some complex issues that are further compounded by turbulent internal and external environments. To deal with the complex environment, the wind power industry needs to improve its level of flexibility so that it can become more adaptable to the changing environment. Hence it is important to explore the dynamics of the wind power industry chain flexibility with respect to the ever changing environment. This study uses questionnaire surveys and expert interviews to identify the influential flexibility components of the wind power industry chain. Subsequently a fuzzy cognitive mapping (FCM) methodology was used to establish a flexibility operating mechanism model. The research found that special attention should be paid to competition flexibility, technology flexibility, and intellectual property and talent flexibility. Policies play a pivotal role in regulating the driving effects of these components of flexibility with the aim being long term sustainability of a healthy level of overall flexibility of the wind power industry chain. This should in turn facilitate the sustainable development of the industry. - Highlights: • Wind power industry shall improve flexibility to deal with complex environment. • Critical components of flexibility of wind power industry chain were identified. • An operating mechanism model for flexibility of wind power industry is proposed. • Fuzzy cognitive mapping method is employed to model the dynamics of flexibility. • Policies play a pivotal role in fostering an industry environment toward flexibility

'Women’s work penalty' in the access to flexible working arrangements across Europe

OpenAIRE

Chung, Heejung

2018-01-01

Do women and workers in female dominated workplaces have better access to flexible working arrangements? Given women’s roles in caregiving and due to the ‘flexibility stigma’ that may come with the use of flexible working arrangements, women and workers in female-dominated workplaces are expected to have greater access. However, flexible working arrangements are also used for performance enhancing purposes, hence, following the gendered rewards/organisation literature, men and workers in male...

Flexible Use of Predictive Cues beyond the Orbitofrontal Cortex: Role of the Submedius Thalamic Nucleus.

Science.gov (United States)

Alcaraz, Fabien; Marchand, Alain R; Vidal, Elisa; Guillou, Alexandre; Faugère, Angélique; Coutureau, Etienne; Wolff, Mathieu

2015-09-23

The orbitofrontal cortex (OFC) is known to play a crucial role in learning the consequences of specific events. However, the contribution of OFC thalamic inputs to these processes is largely unknown. Using a tract-tracing approach, we first demonstrated that the submedius nucleus (Sub) shares extensive reciprocal connections with the OFC. We then compared the effects of excitotoxic lesions of the Sub or the OFC on the ability of rats to use outcome identity to direct responding. We found that neither OFC nor Sub lesions interfered with the basic differential outcomes effect. However, more specific tests revealed that OFC rats, but not Sub rats, were disproportionally relying on the outcome, rather than on the discriminative stimulus, to guide behavior, which is consistent with the view that the OFC integrates information about predictive cues. In subsequent experiments using a Pavlovian contingency degradation procedure, we found that both OFC and Sub lesions produced a severe deficit in the ability to update Pavlovian associations. Altogether, the submedius therefore appears as a functionally relevant thalamic component in a circuit dedicated to the integration of predictive cues to guide behavior, previously conceived as essentially dependent on orbitofrontal functions. Significance statement: In the present study, we identify a largely unknown thalamic region, the submedius nucleus, as a new functionally relevant component in a circuit supporting the flexible use of predictive cues. Such abilities were previously conceived as largely dependent on the orbitofrontal cortex. Interestingly, this echoes recent findings in the field showing, in research involving an instrumental setup, an additional involvement of another thalamic nuclei, the parafascicular nucleus, when correct responding requires an element of flexibility (Bradfield et al., 2013a). Therefore, the present contribution supports the emerging view that limbic thalamic nuclei may contribute critically to

Theory of mind and context processing in schizophrenia: the role of cognitive flexibility.

Science.gov (United States)

Champagne-Lavau, Maud; Charest, Anick; Anselmo, Karyne; Rodriguez, Jean-Pierre; Blouin, Guy

2012-12-30

The present study sought to identify whether cognitive flexibility and context processing may impact theory of mind (ToM) ability in schizophrenia. Thirty two patients with schizophrenia and 29 matched healthy participants were tested individually on their ToM ability using a task involving attribution and comprehension of a speaker's ironic intent. This task made it possible to determine whether the degree of incongruity between contextual information and a target sentence has an impact on the attribution of ironic intent to the protagonists of a story. Participants were also assessed on their cognitive flexibility and working memory. The main results revealed that participants with schizophrenia correctly perceived contextual information cueing attribution of ironic intent to the protagonist of the stimulus, but they showed difficulty to correctly integrate this information, performing significantly worse than healthy participants when they attributed mental states. However, some participants with schizophrenia performed like healthy control participants on the ToM task while others did not. A lack of flexibility seems to differentiate the two schizophrenia subgroups thereby obtained, suggesting that cognitive flexibility has an impact on ToM performances in schizophrenia. These difficulties were not associated with clinical symptoms. Such results will have an impact on cognitive remediation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Towards Flexible Transparent Electrodes Based on Carbon and Metallic Materials

Directory of Open Access Journals (Sweden)

Minghui Luo

2017-01-01

Full Text Available Flexible transparent electrodes (FTEs with high stability and scalability are in high demand for the extremely widespread applications in flexible optoelectronic devices. Traditionally, thin films of indium thin oxide (ITO served the role of FTEs, but film brittleness and scarcity of materials limit its further application. This review provides a summary of recent advances in emerging transparent electrodes and related flexible devices (e.g., touch panels, organic light-emitting diodes, sensors, supercapacitors, and solar cells. Mainly focusing on the FTEs based on carbon nanomaterials (e.g., carbon nanotubes and graphene and metal materials (e.g., metal grid and metal nanowires, we discuss the fabrication techniques, the performance improvement, and the representative applications of these highly transparent and flexible electrodes. Finally, the challenges and prospects of flexible transparent electrodes will be summarized.

Cell Adhesion Molecules and Ubiquitination—Functions and Significance

Science.gov (United States)

Homrich, Mirka; Gotthard, Ingo; Wobst, Hilke; Diestel, Simone

2015-01-01

Cell adhesion molecules of the immunoglobulin (Ig) superfamily represent the biggest group of cell adhesion molecules. They have been analyzed since approximately 40 years ago and most of them have been shown to play a role in tumor progression and in the nervous system. All members of the Ig superfamily are intensively posttranslationally modified. However, many aspects of their cellular functions are not yet known. Since a few years ago it is known that some of the Ig superfamily members are modified by ubiquitin. Ubiquitination has classically been described as a proteasomal degradation signal but during the last years it became obvious that it can regulate many other processes including internalization of cell surface molecules and lysosomal sorting. The purpose of this review is to summarize the current knowledge about the ubiquitination of cell adhesion molecules of the Ig superfamily and to discuss its potential physiological roles in tumorigenesis and in the nervous system. PMID:26703751

Combining Single-Molecule Optical Trapping and Small-Angle X-Ray Scattering Measurements to Compute the Persistence Length of a Protein ER/K alpha-Helix

DEFF Research Database (Denmark)

Sivaramakrishnan, S.; Sung, J.; Ali, M.

2009-01-01

as a force transducer, rigid spacer, or flexible linker in proteins. In this study, we quantity this flexibility in terms of persistence length, namely the length scale over which it is rigid. We use single-molecule optical trapping and small-angle x-ray scattering, combined with Monte Carlo simulations...

Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

DEFF Research Database (Denmark)

Hjelt, T.; Vattulainen, Ilpo Tapio

2000-01-01

stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

Vibrationally coupled electron transport through single-molecule junctions

Energy Technology Data Exchange (ETDEWEB)

Haertle, Rainer

2012-04-26

Single-molecule junctions are among the smallest electric circuits. They consist of a molecule that is bound to a left and a right electrode. With such a molecular nanocontact, the flow of electrical currents through a single molecule can be studied and controlled. Experiments on single-molecule junctions show that a single molecule carries electrical currents that can even be in the microampere regime. Thereby, a number of transport phenomena have been observed, such as, for example, diode- or transistor-like behavior, negative differential resistance and conductance switching. An objective of this field, which is commonly referred to as molecular electronics, is to relate these transport phenomena to the properties of the molecule in the contact. To this end, theoretical model calculations are employed, which facilitate an understanding of the underlying transport processes and mechanisms. Thereby, one has to take into account that molecules are flexible structures, which respond to a change of their charge state by a profound reorganization of their geometrical structure or may even dissociate. It is thus important to understand the interrelation between the vibrational degrees of freedom of a singlemolecule junction and the electrical current flowing through the contact. In this thesis, we investigate vibrational effects in electron transport through singlemolecule junctions. For these studies, we calculate and analyze transport characteristics of both generic and first-principles based model systems of a molecular contact. To this end, we employ a master equation and a nonequilibrium Green's function approach. Both methods are suitable to describe this nonequilibrium transport problem and treat the interactions of the tunneling electrons on the molecular bridge non-perturbatively. This is particularly important with respect to the vibrational degrees of freedom, which may strongly interact with the tunneling electrons. We show in detail that the resulting

An overview of carbon materials for flexible electrochemical capacitors.

Science.gov (United States)

He, Yongmin; Chen, Wanjun; Gao, Caitian; Zhou, Jinyuan; Li, Xiaodong; Xie, Erqing

2013-10-07

Under the background of the quick development of lightweight, flexible, and wearable electronic devices in our society, a flexible and highly efficient energy management strategy is needed for their counterpart energy-storage systems. Among them, flexible electrochemical capacitors (ECs) have been considered as one of the most promising candidates because of their significant advantages in power and energy densities, and unique properties of being flexible, lightweight, low-cost, and environmentally friendly compared with current energy storage devices. In a common EC, carbon materials play an irreplaceable and principal role in its energy-storage performance. Up till now, most progress towards flexible ECs technologies has mostly benefited from the continuous development of carbon materials. As a result, in view of the dual remarkable highlights of ECs and carbon materials, a summary of recent research progress on carbon-based flexible EC electrode materials is presented in this review, including carbon fiber (CF, consisting of carbon microfiber-CMF and carbon nanofiber-CNF) networks, carbon nanotube (CNT) and graphene coatings, CNT and/or graphene papers (or films), and freestanding three-dimensional (3D) flexible carbon-based macroscopic architectures. Furthermore, some promising carbon materials for great potential applications in flexible ECs are introduced. Finally, the trends and challenges in the development of carbon-based electrode materials for flexible ECs and their smart applications are analyzed.

Calculations of critical micelle concentration by dissipative particle dynamics simulations: the role of chain rigidity.

Science.gov (United States)

Lee, Ming-Tsung; Vishnyakov, Aleksey; Neimark, Alexander V

2013-09-05

Micelle formation in surfactant solutions is a self-assembly process governed by complex interplay of solvent-mediated interactions between hydrophilic and hydrophobic groups, which are commonly called heads and tails. However, the head-tail repulsion is not the only factor affecting the micelle formation. For the first time, we present a systematic study of the effect of chain rigidity on critical micelle concentration and micelle size, which is performed with the dissipative particle dynamics simulation method. Rigidity of the coarse-grained surfactant molecule was controlled by the harmonic bonds set between the second-neighbor beads. Compared to flexible molecules with the nearest-neighbor bonds being the only type of bonded interactions, rigid molecules exhibited a lower critical micelle concentration and formed larger and better-defined micelles. By varying the strength of head-tail repulsion and the chain rigidity, we constructed two-dimensional diagrams presenting how the critical micelle concentration and aggregation number depend on these parameters. We found that the solutions of flexible and rigid molecules that exhibited approximately the same critical micelle concentration could differ substantially in the micelle size and shape depending on the chain rigidity. With the increase of surfactant concentration, primary micelles of more rigid molecules were found less keen to agglomeration and formation of nonspherical aggregates characteristic of flexible molecules.

Here, There and Everywhere: The Ubiquitous Distribution of the Immunosignaling Molecule Lysophosphatidylcholine and its Role on Chagas Disease

Directory of Open Access Journals (Sweden)

Mario Alberto Cardoso Silva-Neto

2016-02-01

Full Text Available Chagas disease is a severe illness, which can lead to death if the patients are not promptly treated. The disease is caused by the protozoan parasite Trypanosoma cruzi, which is mostly transmitted by a triatomine insect vector. There are 8-10 million people infected with T. cruzi in the world, but the vector-borne transmission occurs only in the Americas, especially Latin America. About 30 % of chronically infected people develop cardiac diseases and up to 10 % develop digestive, neurological or mixed disorders. Lysophosphatydilcholine (LPC is the major phospholipid component of oxidized low-density lipoproteins associated with atherosclerosis-related tissue damage. Insect-derived LPC is a powerful chemoattractant for inflammatory cells at the site of the insect bite, enhances parasite invasion, and inhibits the production of nitric oxide (NO by T. cruzi-stimulated macrophages. The recognition of the ubiquitous presence of LPC on the vector saliva, its production by the parasite itself and its presence both on patient plasma as well as its role on diverse host x parasite interaction systems lead us to compare its distribution in nature with the title of the famous Beatles song Here, There and Everywhere recorded exactly 50 years ago in 1966. Here, we review the major findings pointing out the role of such molecule as an immunosignaling modulator of Chagas disease transmission. Also, we believe that future investigation of the connection of this ubiquity and the immune role of such molecule may lead in the future to novel methods to control parasite transmission, infection and pathogenesis.

Here, There, and Everywhere: The Ubiquitous Distribution of the Immunosignaling Molecule Lysophosphatidylcholine and Its Role on Chagas Disease.

Science.gov (United States)

Silva-Neto, Mário Alberto C; Lopes, Angela H; Atella, Georgia C

2016-01-01

Chagas disease is a severe illness, which can lead to death if the patients are not promptly treated. The disease is caused by the protozoan parasite Trypanosoma cruzi, which is mostly transmitted by a triatomine insect vector. There are 8-10 million people infected with T. cruzi in the world, but the transmission of such disease by bugs occurs only in the Americas, especially Latin America. Chronically infected patients will develop cardiac diseases (30%) and up digestive, neurological, or mixed disorders (10%). Lysophosphatidylcholine (LPC) is the major phospholipid component of oxidized low-density lipoproteins associated with atherosclerosis-related tissue damage. Insect-derived LPC powerfully attracts inflammatory cells to the site of the insect bite, enhances parasite invasion, and inhibits the production of nitric oxide by T. cruzi-stimulated macrophages. The recognition of the ubiquitous presence of LPC on the vector saliva, its production by the parasite itself and its presence both on patient plasma and its role on diverse host × parasite interaction systems lead us to compare its distribution in nature with the title of the famous Beatles song "Here, There and Everywhere" recorded exactly 50 years ago in 1966. Here, we review the major findings pointing out the role of such molecule as an immunosignaling modulator of Chagas disease transmission. Also, we believe that future investigation of the connection of this ubiquity and the immune role of such molecule may lead in the future to novel methods to control parasite transmission, infection, and pathogenesis.

The Development of the Ventral Prefrontal Cortex and Social Flexibility

Science.gov (United States)

Nelson, Eric E.; Guyer, Amanda E.

2011-01-01

Over the last several years a number of studies in both humans and animals have suggested that the orbitofrontal and ventrolateral prefrontal cortices play an important role in generating flexible behavior. We suggest that input from these brain regions contribute to three functions involved in generating flexible behavior within social contexts: valuation, inhibition, and rule use. Recent studies have also demonstrated that the prefrontal cortex undergoes a prolonged course of maturation that extends well after puberty. Here, we review evidence that the prolonged development of these prefrontal regions parallels a slowly emerging ability for flexible social behavior. We also speculate on the possibility that sensitive periods for organizing social behavior may be embedded within this developmental time-fame. Finally, we discuss the role of prefrontal cortex in adolescent mood and anxiety disorders, particularly as orbitofrontal and ventrolateral prefrontal cortices are engaged in a social context. PMID:21804907

Molecular locks and keys: the role of small molecules in phytohormone research

Directory of Open Access Journals (Sweden)

Sandra eFonseca

2014-12-01

Full Text Available Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signalling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signalling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function.Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signalling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated responses. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds.

Conformational flexibility of BECN1: Essential to its key role in autophagy and beyond: BECN1 Structure and Mechanism

Energy Technology Data Exchange (ETDEWEB)

Mei, Yang [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Glover, Karen [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Su, Minfei [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Sinha, Sangita C. [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050

2016-08-13

BECN1 (Beclin 1), a highly conserved eukaryotic protein, is a key regulator of autophagy, a cellular homeostasis pathway, and also participates in vacuolar protein sorting, endocytic trafficking, and apoptosis. BECN1 is important for embryonic development, the innate immune response, tumor suppression, and protection against neurodegenerative disorders, diabetes, and heart disease. BECN1 mediates autophagy as a core component of the class III phosphatidylinositol 3-kinase complexes. However, the exact mechanism by which it regulates the activity of these complexes, or mediates its other diverse functions is unclear. BECN1 interacts with several diverse protein partners, perhaps serving as a scaffold or interaction hub for autophagy. Based on extensive structural, biophysical and bioinformatics analyses, BECN1 consists of an intrinsically disordered region (IDR), which includes a BH3 homology domain (BH3D); a flexible helical domain (FHD); a coiled-coil domain (CCD); and a β-α-repeated autophagy-specific domain (BARAD). Each of these BECN1 domains mediates multiple diverse interactions that involve concomitant conformational changes. Thus, BECN1 conformational flexibility likely plays a key role in facilitating diverse protein interactions. Further, BECN1 conformation and interactions are also modulated by numerous post-translational modifications. A better structure-based understanding of the interplay between different BECN1 conformational and binding states, and the impact of post-translational modifications will be essential to elucidating the mechanism of its multiple biological roles.

[Flexibility of cognitive activity depends on its context].

Science.gov (United States)

Kostandov, É A

2010-01-01

The main purpose of this survey is to explain the importance of set-shifting for a flexible cognitive activity. Working memory overload may result in set-shifting slowdown, i.e., in a more rigid set and in a less flexible cognitive activity. This effect displays itself in an increase of erroneous perceptions of external stimuli. Set rigidity level also depends on the cognitive activity context (i.e., on the type of external stimuli the person has to deal with). We analyzed EEG-coherence function and induced synchronization/desynchronization responses in theta (4-7 Hz) and low alpha (8-10 Hz) bands. Basing on these data, we discuss the role of tonic and phasic forms of cortico-hippocampal and fronto-thalamic systems' activation in cognitive activity flexibility.

Synthesis of molecules in interstellar clouds and star formation

International Nuclear Information System (INIS)

Ghosh, K.K.; Ghosh, S.N.

1981-01-01

Study of the formation and destruction processes of interstellar molecules may throw certain light on interstellar medium. Formation and destruction processes of some interstellar molecules are proposed on the basis of laboratory data. The abundances of these molecules are calculated under steady-state condition. The calculated values are then compared with the observed values, obtained by different investigators. It appears that gas phase ion-neutral reactions are capable of synthesizing most interstellar molecules. The role of ion-neutral reactions to star formation has also been discussed. (author)

Literacy processes cognitive flexibility in learning and teaching

CERN Document Server

Cartwright, Kelly B

2015-01-01

Reading and writing instruction require individuals--both students and teachers--to flexibly process many kinds of information, from a variety of sources. This is the first book to provide an in-depth examination of cognitive flexibility: how it develops across the lifespan; its role in specific literacy processes, such as phonemic awareness, word recognition, and comprehension; and implications for improving literacy instruction and teacher education. The contributors include leading researchers in literacy, psychology, and cognitive development, who summarize the current state of the science

Multiscale weighted colored graphs for protein flexibility and rigidity analysis

Science.gov (United States)

Bramer, David; Wei, Guo-Wei

2018-02-01

Protein structural fluctuation, measured by Debye-Waller factors or B-factors, is known to correlate to protein flexibility and function. A variety of methods has been developed for protein Debye-Waller factor prediction and related applications to domain separation, docking pose ranking, entropy calculation, hinge detection, stability analysis, etc. Nevertheless, none of the current methodologies are able to deliver an accuracy of 0.7 in terms of the Pearson correlation coefficients averaged over a large set of proteins. In this work, we introduce a paradigm-shifting geometric graph model, multiscale weighted colored graph (MWCG), to provide a new generation of computational algorithms to significantly change the current status of protein structural fluctuation analysis. Our MWCG model divides a protein graph into multiple subgraphs based on interaction types between graph nodes and represents the protein rigidity by generalized centralities of subgraphs. MWCGs not only predict the B-factors of protein residues but also accurately analyze the flexibility of all atoms in a protein. The MWCG model is validated over a number of protein test sets and compared with many standard methods. An extensive numerical study indicates that the proposed MWCG offers an accuracy of over 0.8 and thus provides perhaps the first reliable method for estimating protein flexibility and B-factors. It also simultaneously predicts all-atom flexibility in a molecule.

FlavorDB: a database of flavor molecules.

Science.gov (United States)

Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh

2018-01-04

Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Controlling single-molecule junction conductance by molecular interactions

Science.gov (United States)

Kitaguchi, Y.; Habuka, S.; Okuyama, H.; Hatta, S.; Aruga, T.; Frederiksen, T.; Paulsson, M.; Ueba, H.

2015-01-01

For the rational design of single-molecular electronic devices, it is essential to understand environmental effects on the electronic properties of a working molecule. Here we investigate the impact of molecular interactions on the single-molecule conductance by accurately positioning individual molecules on the electrode. To achieve reproducible and precise conductivity measurements, we utilize relatively weak π-bonding between a phenoxy molecule and a STM-tip to form and cleave one contact to the molecule. The anchoring to the other electrode is kept stable using a chalcogen atom with strong bonding to a Cu(110) substrate. These non-destructive measurements permit us to investigate the variation in single-molecule conductance under different but controlled environmental conditions. Combined with density functional theory calculations, we clarify the role of the electrostatic field in the environmental effect that influences the molecular level alignment. PMID:26135251

Molecular model for solubility of gases in flexible polymers

DEFF Research Database (Denmark)

Neergaard, Jesper; Hassager, Ole; Szabo, Peter

1999-01-01

We propose a model for a priori prediction of the solubility of gases in flexible polymers. The model is based on the concept of ideal solubility of gases in liquids. According to this concept, the mole fraction of gases in liquids is given by Raoult's law with the total pressure and the vapor...... pressure of the gas, where the latter may have to be extrapolated. However, instead of considering each polymer molecule as a rigid structure, we estimate the effective number of degrees of freedom from an equivalent freely jointed bead-rod model for the flexible polymer. In this model, we associate...... the length of the rods with the molecular weight corresponding to a Kuhn step. The model provides a tool for crude estimation of the gas solubility on the basis of only the monomer unit of the polymer and properties of the gas. A comparison with the solubility data for several gases in poly...

Flexible metal-organic framework compounds: In situ studies for selective CO{sub 2} capture

Energy Technology Data Exchange (ETDEWEB)

Allen, A.J., E-mail: andrew.allen@nist.gov [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Espinal, L.; Wong-Ng, W. [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Queen, W.L. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); The Molecular Foundry, Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA 94720 (United States); Brown, C.M. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE 19716 (United States); Kline, S.R. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Kauffman, K.L. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); Culp, J.T. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); URS Corporation, South Park, PA 15219 (United States); Matranga, C. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States)

2015-10-25

Results are presented that explore the dynamic structural changes occurring in two highly flexible nanocrystalline metal-organic framework (MOF) compounds during the adsorption and desorption of pure gases and binary mixtures. The Ni(1,2-bis(4-pyridyl)ethylene)[Ni(CN){sub 4}] and catena-bis(dibenzoylmethanato)-(4,4′-bipyridyl)nickel(II) chosen for this study are 3-D and 1-D porous coordination polymers (PCP) with a similar gate opening pressure response for CO{sub 2} isotherms at 303 K, but with differing degrees of flexibility for structural change to accommodate guest molecules. As such, they serve as a potential model system for evaluating the complex kinetics associated with dynamic structure changes occurring in response to gas adsorption in flexible MOF systems. Insights into the crystallographic changes occurring as the MOF pore structure expands and contracts in response to interactions with CO{sub 2}, N{sub 2}, and CO{sub 2}/N{sub 2} mixtures have been obtained from in situ small-angle neutron scattering and neutron diffraction, combined with ex situ X-ray diffraction structure measurements. The role of structure in carbon capture functionality is discussed with reference to the ongoing characterization challenges and a possible materials-by-design approach. - Graphical abstract: We present in situ small-angle neutron scattering results for two flexible metal-organic frameworks (MOFs). The figure shows that for one (NiBpene, high CO{sub 2} adsorption) the intensity of the Bragg peak for the expandable d-spacing most associated with CO{sub 2} adsorption varies approximately with the isotherm, while for the other (NiDBM-Bpy, high CO{sub 2} selectivity) the d-spacing, itself, varies with the isotherm. The cartoons show the proposed modes of structural change. - Highlights: • Dynamic structures of two flexible MOF CO{sub 2} sorbent compounds are compared in situ. • These porous solid sorbents serve as models for pure & dual gas adsorption. • Different

A new approach for evaluating flexible working hours.

Science.gov (United States)

Giebel, Ole; Janssen, Daniela; Schomann, Carsten; Nachreiner, Friedhelm

2004-01-01

Recent studies on flexible working hours show at least some of these working time arrangements seem to be associated with impairing effects of health and well-being. According to available evidence, variability of working hours seems to play an important role. The question, however, is how this variability can be assessed and used to explain or predict impairments. Based on earlier methods used to assess shift-work effects, a time series analysis approach was applied to the matter of flexible working hours. Data on the working hours of 4 week's length of 137 respondents derived from a survey on flexible work hours involving 15 companies of different production and service sectors in Germany were converted to time series and analyzed by spectral analysis. A cluster analysis of the resulting power spectra yielded 5 clusters of flexible work hours. Analyzing these clusters for differences in reported impairments showed that workers who showed suppression of circadian and weekly rhythms experienced severest impairments, especially in circadian controlled functions like sleep and digestion. The results thus indicate that analyzing the periodicity of flexible working hours seems to be a promising approach for predicting impairments which should be investigated further in the future.

On flexibility

OpenAIRE

Weiss, Christoph R.; Briglauer, Wolfgang

2000-01-01

By building on theoretical work by Mills and Schumann (1985) and Ungern-Sternberg (1990) this paper provides evidence on the determinants of two dimensions of flexibility, the flexibility in adjusting aggregate output over time (tactical flexibility) as well as the ability to switch quickly between products (operational flexibility). Econometric analysis of a sample of 40.000 farms in Upper-Austria for the period 1980 to 1990 suggests that larger full-time farms operated by younger, better ed...

Role of nitric oxide and related molecules in schizophrenia pathogenesis: biochemical, genetic and clinical aspects

Directory of Open Access Journals (Sweden)

Regina F. Nasyrova

2015-05-01

Full Text Available Currently, schizophrenia is considered a multifactorial disease. Over the past 50 years, many investigators have considered the role of toxic free radicals in the etiology of schizophrenia. This is an area of active research which is still evolving. Here, we review the recent data and current concepts on the roles of nitric oxide (NO and related molecules in the pathogenesis of schizophrenia. NO is involved in storage, uptake and release of mediators and neurotransmitters, including glutamate, acetylcholine, noradrenaline, GABA, taurine and glycine. In addition, NO diffuses across cell membranes and activates its own extrasynaptic receptors. Further, NO is involved in peroxidation and reactive oxidative stress. Investigations reveal significant disturbances in NO levels in the brain structures (cerebellum, hypothalamus, hippocampus, striatum and fluids of subjects with schizophrenia. Given the roles of NO in central nervous system development, these changes may result in neurodevelopmental changes associated with schizophrenia. We describe here the recent literature on NOS gene polymorphisms on schizophrenia, which all point to consistent results. We also discuss how NO may be a new target for the therapy of mental disorders. Currently there have been 2 randomized double-blind placebo-controlled trials of L-lysine as an NOS inhibitor in the CNS.

Reactive oxygen species, essential molecules, during plant-pathogen interactions.

Science.gov (United States)

Camejo, Daymi; Guzmán-Cedeño, Ángel; Moreno, Alexander

2016-06-01

Reactive oxygen species (ROS) are continually generated as a consequence of the normal metabolism in aerobic organisms. Accumulation and release of ROS into cell take place in response to a wide variety of adverse environmental conditions including salt, temperature, cold stresses and pathogen attack, among others. In plants, peroxidases class III, NADPH oxidase (NOX) locates in cell wall and plasma membrane, respectively, may be mainly enzymatic systems involving ROS generation. It is well documented that ROS play a dual role into cells, acting as important signal transduction molecules and as toxic molecules with strong oxidant power, however some aspects related to its function during plant-pathogen interactions remain unclear. This review focuses on the principal enzymatic systems involving ROS generation addressing the role of ROS as signal molecules during plant-pathogen interactions. We described how the chloroplasts, mitochondria and peroxisomes perceive the external stimuli as pathogen invasion, and trigger resistance response using ROS as signal molecule. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

Directory of Open Access Journals (Sweden)

Hymavati

2012-01-01

Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

Balance and flexibility.

Science.gov (United States)

2003-12-01

The 'work-life balance' and flexible working are currently key buzz terms in the NHS. Those looking for more information on these topics should visit Flexibility at www.flexibility.co.uk for a host of resources designed to support new ways of working, including information on flexible workers and flexible rostering, the legal balancing act for work-life balance and home working.

The novel 2Fe–2S outer mitochondrial protein mitoNEET displays conformational flexibility in its N-terminal cytoplasmic tethering domain

International Nuclear Information System (INIS)

Conlan, Andrea R.; Paddock, Mark L.; Axelrod, Herbert L.; Cohen, Aina E.; Abresch, Edward C.; Wiley, Sandra; Roy, Melinda; Nechushtai, Rachel; Jennings, Patricia A.

2009-01-01

The crystal structure of the anti-diabetic drug target mitoNEET obtained from a GFP fusion construct (1.4 Å resolution, R factor = 20.2%) shows that the CDGSH 2Fe–2S binding domains are superimposable with previously determined non-fused constructs. However, there is considerable flexibility in the position of the outer mitochondrial tethering arms resulting in two different conformations in the crystal structure. A primary role for mitochondrial dysfunction is indicated in the pathogenesis of insulin resistance. A widely used drug for the treatment of type 2 diabetes is pioglitazone, a member of the thiazolidinedione class of molecules. MitoNEET, a 2Fe–2S outer mitochondrial membrane protein, binds pioglitazone [Colca et al. (2004 ▶), Am. J. Physiol. Endocrinol. Metab.286, E252–E260]. The soluble domain of the human mitoNEET protein has been expressed C-terminal to the superfolder green fluorescent protein and the mitoNEET protein has been isolated. Comparison of the crystal structure of mitoNEET isolated from cleavage of the fusion protein (1.4 Å resolution, R factor = 20.2%) with other solved structures shows that the CDGSH domains are superimposable, indicating proper assembly of mitoNEET. Furthermore, there is considerable flexibility in the position of the cytoplasmic tethering arms, resulting in two different conformations in the crystal structure. This flexibility affords multiple orientations on the outer mitochondrial membrane

Low-energy electron scattering from molecules, biomolecules and surfaces

CERN Document Server

Carsky, Petr

2011-01-01

Since the turn of the 21st century, the field of electron molecule collisions has undergone a renaissance. The importance of such collisions in applications from radiation chemistry to astrochemistry has flowered, and their role in industrial processes such as plasma technology and lighting are vital to the advancement of next generation devices. Furthermore, the development of the scanning tunneling microscope highlights the role of such collisions in the condensed phase, in surface processing, and in the development of nanotechnology.Low-Energy Electron Scattering from Molecules, Biomolecule

MHCcluster, a method for functional clustering of MHC molecules

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Lundegaard, Claus; Buus, Søren

2013-01-01

The identification of peptides binding to major histocompatibility complexes (MHC) is a critical step in the understanding of T cell immune responses. The human MHC genomic region (HLA) is extremely polymorphic comprising several thousand alleles, many encoding a distinct molecule. The potentially...... binding specificity. The method has a flexible web interface that allows the user to include any MHC of interest in the analysis. The output consists of a static heat map and graphical tree-based visualizations of the functional relationship between MHC variants and a dynamic TreeViewer interface where...

The compatibility of flexible instruments under the Kyoto Protocol

International Nuclear Information System (INIS)

Jepma, C.J.; Van der Gaast, W.P.; Woerdman, E.

1998-01-01

The compatibility of the Kyoto Protocol flexible instruments and the lessons that can be learned form the AIJ-phase (AIJ stands for Activities Implemented Jointly) are discussed. The key point to be made is that there may be various applications of flexible instruments which can create situations where the various instruments would crowd out each other. On the other hand, applying flexible instruments may create a leverage for Parties in terms of achieving domestic environmental objectives. In addition, several issues related to the implementation of Joint Implementation (JI) , Clean Development Mechanism (CDM) and international emissions trading are discussed. The issues concern mainly those that have been included in the working programme on flexible instruments for CoP4 and CoP5 (CoP stands for Convention of Parties). As such the report discusses the consequences of possible negotiations outcomes at CoP for the effectiveness of flexible instruments, Parties' capabilities to achieve their Kyoto Protocol commitments cost-effectively, and the role of the private sector on the national and international credits markets(s). 106 refs

Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

Directory of Open Access Journals (Sweden)

Soledad R. Ordonez

2017-10-01

Full Text Available Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that form the first barrier of defense against fungal infections. These include host defense peptides, like LL-37 and defensins that can neutralize fungi by direct killing of the pathogen, and collectins, such as surfactant protein A and D, that can aggregate fungi and stimulate phagocytosis. In addition, these molecules have immunomodulatory activities which can aid in fungal clearance from the lung. However, existing observations are based on in vitro studies which do not reflect the complexity of the lung and its airway surface liquid. Ionic strength, pH, and the presence of mucus can have strong detrimental effects on antifungal activity, while the potential synergistic interplay between soluble effector molecules is largely unknown. In this review, we describe the current knowledge on soluble effector molecules that contribute to antifungal activity, the importance of environmental factors and discuss the future directions required to understand the innate antifungal defense in the lung.

Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

Science.gov (United States)

Ordonez, Soledad R.; Veldhuizen, Edwin J. A.; van Eijk, Martin; Haagsman, Henk P.

2017-01-01

Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that form the first barrier of defense against fungal infections. These include host defense peptides, like LL-37 and defensins that can neutralize fungi by direct killing of the pathogen, and collectins, such as surfactant protein A and D, that can aggregate fungi and stimulate phagocytosis. In addition, these molecules have immunomodulatory activities which can aid in fungal clearance from the lung. However, existing observations are based on in vitro studies which do not reflect the complexity of the lung and its airway surface liquid. Ionic strength, pH, and the presence of mucus can have strong detrimental effects on antifungal activity, while the potential synergistic interplay between soluble effector molecules is largely unknown. In this review, we describe the current knowledge on soluble effector molecules that contribute to antifungal activity, the importance of environmental factors and discuss the future directions required to understand the innate antifungal defense in the lung. PMID:29163395

Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

International Nuclear Information System (INIS)

Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A.

2015-01-01

Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m 2 g −1 ) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10 −3 S cm −1 at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g −1 , ∼39 Wh kg −1 and ∼19 kW kg −1 , respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10 4 charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better performance over LiTFSI-based gel. �

Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

Energy Technology Data Exchange (ETDEWEB)

Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A., E-mail: sahashmi@physics.du.ac.in

2015-08-01

Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m{sup 2} g{sup −1}) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10{sup −3} S cm{sup −1} at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g{sup −1}, ∼39 Wh kg{sup −1} and ∼19 kW kg{sup −1}, respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10{sup 4} charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better

Probing Protein Multidimensional Conformational Fluctuations by Single-Molecule Multiparameter Photon Stamping Spectroscopy

Science.gov (United States)

2015-01-01

Conformational motions of proteins are highly dynamic and intrinsically complex. To capture the temporal and spatial complexity of conformational motions and further to understand their roles in protein functions, an attempt is made to probe multidimensional conformational dynamics of proteins besides the typical one-dimensional FRET coordinate or the projected conformational motions on the one-dimensional FRET coordinate. T4 lysozyme hinge-bending motions between two domains along α-helix have been probed by single-molecule FRET. Nevertheless, the domain motions of T4 lysozyme are rather complex involving multiple coupled nuclear coordinates and most likely contain motions besides hinge-bending. It is highly likely that the multiple dimensional protein conformational motions beyond the typical enzymatic hinged-bending motions have profound impact on overall enzymatic functions. In this report, we have developed a single-molecule multiparameter photon stamping spectroscopy integrating fluorescence anisotropy, FRET, and fluorescence lifetime. This spectroscopic approach enables simultaneous observations of both FRET-related site-to-site conformational dynamics and molecular rotational (or orientational) motions of individual Cy3-Cy5 labeled T4 lysozyme molecules. We have further observed wide-distributed rotational flexibility along orientation coordinates by recording fluorescence anisotropy and simultaneously identified multiple intermediate conformational states along FRET coordinate by monitoring time-dependent donor lifetime, presenting a whole picture of multidimensional conformational dynamics in the process of T4 lysozyme open-close hinge-bending enzymatic turnover motions under enzymatic reaction conditions. By analyzing the autocorrelation functions of both lifetime and anisotropy trajectories, we have also observed the dynamic and static inhomogeneity of T4 lysozyme multidimensional conformational fluctuation dynamics, providing a fundamental

Ongoing behavioral state information signaled in the lateral habenula guides choice flexibility in freely moving rats

Directory of Open Access Journals (Sweden)

Phillip Michael Baker

2015-11-01

Full Text Available The lateral habenula (LHb plays a role in a wide variety of behaviors ranging from maternal care, to sleep, to various forms of cognition. One prominent theory with ample supporting evidence is that the LHb serves to relay basal ganglia and limbic signals about negative outcomes to midbrain monoaminergic systems. This makes it likely that the LHb is critically involved in behavioral flexibility as all of these systems have been shown to contribute when flexible behavior is required. Behavioral flexibility is commonly examined across species and is impaired in various neuropsychiatric conditions including autism, depression, addiction, and schizophrenia; conditions in which the LHb is thought to play a role. Therefore, a thorough examination of the role of the LHb in behavioral flexibility serves multiple functions including understanding possible connections with neuropsychiatric illnesses and additional insight into its role in cognition in general. Here we assess the LHb’s role in behavioral flexibility through comparisons of the roles its afferent and efferent pathways are known to play. Additionally, we provide new evidence supporting the LHb contributions to behavioral flexibility through organization of specific goal directed actions under cognitively demanding conditions. Specifically, in the first experiment, a majority of neurons recorded from the LHb were found to correlate with velocity on a spatial navigation task and did not change significantly when reward outcomes were manipulated. Additionally, measurements of local field potential in the theta band revealed significant changes in power relative to velocity and reward location. In a second set of experiments, inactivation of the LHb with the GABA agonists baclofen and muscimol led to an impairment in a spatial/response based repeated probabilistic reversal learning task. Control experiments revealed that this impairment was likely due to the demands of repeated switching

Protection of a PWR nuclear power stations against corrosion using hydrogen molecules to capture oxygen molecules

International Nuclear Information System (INIS)

Nahili, M.

2004-01-01

A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)

Enzymatic production of single-molecule FISH and RNA capture probes.

Science.gov (United States)

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Structural characterization of chiral molecules using vibrational circular dichroism spectroscopy

DEFF Research Database (Denmark)

Lassen, Peter Rygaard

2006-01-01

comparison of experimental and calculated spectra. Theoretical structures of the sample molecules were constructed and optimized using molecular mechanical force fields followed by the quantum mechanical method density functional theory (DFT). Calculations of IR absorption and VCD spectra were then carried...... out using the same DFT methods. Here, VCD has the advantage over CD that time-independent DFT calculations are sufficient. During the course of this project, the above methodology has been applied to a range of molecules. Some of them (nyasol, curcuphenol dimers and ginkgolide) are purely organic...... or as flexible as the curcuphenol dimer with 11 variable dihedral angles. This illustrates the capabilities of the method, which are primarily limited by the duration of DFT calculations. In the case of metal complexes, they have only recently become within reach of DFT, which opens new possibilities...

Population distribution of flexible molecules from maximum entropy analysis using different priors as background information: application to the Φ, Ψ-conformational space of the α-(1-->2)-linked mannose disaccharide present in N- and O-linked glycoproteins.

Science.gov (United States)

Säwén, Elin; Massad, Tariq; Landersjö, Clas; Damberg, Peter; Widmalm, Göran

2010-08-21

The conformational space available to the flexible molecule α-D-Manp-(1-->2)-α-D-Manp-OMe, a model for the α-(1-->2)-linked mannose disaccharide in N- or O-linked glycoproteins, is determined using experimental data and molecular simulation combined with a maximum entropy approach that leads to a converged population distribution utilizing different input information. A database survey of the Protein Data Bank where structures having the constituent disaccharide were retrieved resulted in an ensemble with >200 structures. Subsequent filtering removed erroneous structures and gave the database (DB) ensemble having three classes of mannose-containing compounds, viz., N- and O-linked structures, and ligands to proteins. A molecular dynamics (MD) simulation of the disaccharide revealed a two-state equilibrium with a major and a minor conformational state, i.e., the MD ensemble. These two different conformation ensembles of the disaccharide were compared to measured experimental spectroscopic data for the molecule in water solution. However, neither of the two populations were compatible with experimental data from optical rotation, NMR (1)H,(1)H cross-relaxation rates as well as homo- and heteronuclear (3)J couplings. The conformational distributions were subsequently used as background information to generate priors that were used in a maximum entropy analysis. The resulting posteriors, i.e., the population distributions after the application of the maximum entropy analysis, still showed notable deviations that were not anticipated based on the prior information. Therefore, reparameterization of homo- and heteronuclear Karplus relationships for the glycosidic torsion angles Φ and Ψ were carried out in which the importance of electronegative substituents on the coupling pathway was deemed essential resulting in four derived equations, two (3)J(COCC) and two (3)J(COCH) being different for the Φ and Ψ torsions, respectively. These Karplus relationships are denoted

Role of the DIP Molecules in DCC Signaling

Science.gov (United States)

1999-09-01

to policies of applicable Federal Law 45 CFR 46. N/A In conducting research utilizing recombinant DNA technology , the investigator(s) adhered to...for 1 h, then with 0.1 mg/ml of proteinase K, 0.1% SDS at 50’C Ihle, 1995; Fraser and Evan, 1996). These molecules overnight. Samples were extracted ...incubated with 20 yg/ml of anti-DCC antibody diluted in PBS-0.1% saponin for 1 h, washed with PBS, blocked Western blotting with 5% normal donkey serum for 1

Towards automated visual flexible endoscope navigation.

Science.gov (United States)

van der Stap, Nanda; van der Heijden, Ferdinand; Broeders, Ivo A M J

2013-10-01

The design of flexible endoscopes has not changed significantly in the past 50 years. A trend is observed towards a wider application of flexible endoscopes with an increasing role in complex intraluminal therapeutic procedures. The nonintuitive and nonergonomical steering mechanism now forms a barrier in the extension of flexible endoscope applications. Automating the navigation of endoscopes could be a solution for this problem. This paper summarizes the current state of the art in image-based navigation algorithms. The objectives are to find the most promising navigation system(s) to date and to indicate fields for further research. A systematic literature search was performed using three general search terms in two medical-technological literature databases. Papers were included according to the inclusion criteria. A total of 135 papers were analyzed. Ultimately, 26 were included. Navigation often is based on visual information, which means steering the endoscope using the images that the endoscope produces. Two main techniques are described: lumen centralization and visual odometry. Although the research results are promising, no successful, commercially available automated flexible endoscopy system exists to date. Automated systems that employ conventional flexible endoscopes show the most promising prospects in terms of cost and applicability. To produce such a system, the research focus should lie on finding low-cost mechatronics and technologically robust steering algorithms. Additional functionality and increased efficiency can be obtained through software development. The first priority is to find real-time, robust steering algorithms. These algorithms need to handle bubbles, motion blur, and other image artifacts without disrupting the steering process.

Indexing molecules with chemical graph identifiers.

Science.gov (United States)

Gregori-Puigjané, Elisabet; Garriga-Sust, Rut; Mestres, Jordi

2011-09-01

Fast and robust algorithms for indexing molecules have been historically considered strategic tools for the management and storage of large chemical libraries. This work introduces a modified and further extended version of the molecular equivalence number naming adaptation of the Morgan algorithm (J Chem Inf Comput Sci 2001, 41, 181-185) for the generation of a chemical graph identifier (CGI). This new version corrects for the collisions recognized in the original adaptation and includes the ability to deal with graph canonicalization, ensembles (salts), and isomerism (tautomerism, regioisomerism, optical isomerism, and geometrical isomerism) in a flexible manner. Validation of the current CGI implementation was performed on the open NCI database and the drug-like subset of the ZINC database containing 260,071 and 5,348,089 structures, respectively. The results were compared with those obtained with some of the most widely used indexing codes, such as the CACTVS hash code and the new InChIKey. The analyses emphasize the fact that compound management activities, like duplicate analysis of chemical libraries, are sensitive to the exact definition of compound uniqueness and thus still depend, to a minor extent, on the type and flexibility of the molecular index being used. Copyright © 2011 Wiley Periodicals, Inc.

Behavioral Flexibility Is Increased by Optogenetic Inhibition of Neurons in the Nucleus Accumbens Shell during Specific Time Segments

Science.gov (United States)

Aquili, Luca; Liu, Andrew W.; Shindou, Mayumi; Shindou, Tomomi; Wickens, Jeffery R.

2014-01-01

Behavioral flexibility is vital for survival in an environment of changing contingencies. The nucleus accumbens may play an important role in behavioral flexibility, representing learned stimulus-reward associations in neural activity during response selection and learning from results. To investigate the role of nucleus accumbens neural activity…

Toward a general mixed quantum/classical method for the calculation of the vibronic ECD of a flexible dye molecule with different stable conformers: Revisiting the case of 2,2,2-trifluoro-anthrylethanol.

Science.gov (United States)

Cerezo, Javier; Aranda, Daniel; Avila Ferrer, Francisco J; Prampolini, Giacomo; Mazzeo, Giuseppe; Longhi, Giovanna; Abbate, Sergio; Santoro, Fabrizio

2018-06-01

We extend a recently proposed mixed quantum/classical method for computing the vibronic electronic circular dichroism (ECD) spectrum of molecules with different conformers, to cases where more than one hindered rotation is present. The method generalizes the standard procedure, based on the simple Boltzmann average of the vibronic spectra of the stable conformers, and includes the contribution of structures that sample all the accessible conformational space. It is applied to the simulation of the ECD spectrum of (S)-2,2,2-trifluoroanthrylethanol, a molecule with easily interconvertible conformers, whose spectrum exhibits a pattern of alternating positive and negative vibronic peaks. Results are in very good agreement with experiment and show that spectra averaged over all the sampled conformational space can deviate significantly from the simple average of the contributions of the stable conformers. The present mixed quantum/classical method is able to capture the effect of the nonlinear dependence of the rotatory strength on the molecular structure and of the anharmonic couplings among the modes responsible for molecular flexibility. Despite its computational cost, the procedure is still affordable and promises to be useful in all cases where the ECD shape arises from a subtle balance between vibronic effects and conformational variety. © 2018 Wiley Periodicals, Inc.

Field-effect enhanced triboelectric colloidal quantum dot flexible sensor

Science.gov (United States)

Meng, Lingju; Xu, Qiwei; Fan, Shicheng; Dick, Carson R.; Wang, Xihua

2017-10-01

Flexible electronics, which is of great importance as fundamental sensor and communication technologies for many internet-of-things applications, has established a huge market encroaching into the trillion-dollar market of solid state electronics. For the capability of being processed by printing or spraying, colloidal quantum dots (CQDs) play an increasingly important role in flexible electronics. Although the electrical properties of CQD thin-films are expected to be stable on flexible substrates, their electrical performance could be tuned for applications in flexible touch sensors. Here, we report CQD touch sensors employing polydimethylsiloxane (PDMS) triboelectric films. The electrical response of touching activity is enhanced by incorporating CQD field-effect transistors into the device architecture. Thanks to the use of the CQD thin film as a current amplifier, the field-effect CQD touch sensor shows a fast response to various touching materials, even being bent to a large curvature. It also shows a much higher output current density compared to a PDMS triboelectric touch sensor.

Single-Molecule Nanomagnets

Science.gov (United States)

Friedman, Jonathan R.; Sarachik, Myriam P.

2010-04-01

Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

Molecule Matters van der Waals Molecules

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

Office flexible cystoscopy.

Science.gov (United States)

Kavoussi, L R; Clayman, R V

1988-11-01

Since the development of the first purpose-built flexible cystoscope in 1984, flexible cystoscopy has become an accepted diagnostic and therapeutic modality. Indeed, it is estimated that more than 10 per cent of practicing urologists are already familiar with this technology. The flexible cystoscope has markedly extended the urologist's ability to examine the bladder, and it has become a valuable adjunct to the rigid cystoscope. Although the operation of this instrument is vastly different from that of its rigid counterpart, with practice, the technique can be learned. After experience is obtained with diagnostic flexible cystoscopy, the urologist will likely prefer this new instrument for bladder inspection, as it provides for a more thorough yet less morbid and less expensive examination. In the future, the development of improved and smaller instrumentation will further extend the therapeutic indications for flexible cystoscopy. Indeed, advances in laser technology are already providing the urologist with 300- to 600-micron (0.9 to 1.8F) flexible probes capable of incision (KTP laser), fulguration (Nd:YAG laser), and stone disintegration (tunable dye laser). Lastly, the skills obtained in using the flexible cystoscope are all readily applicable to the development of dexterity with the already available flexible nephroscope and the more recently developed flexible ureteroscope.

High-efficiency and flexible generation of vector vortex optical fields by a reflective phase-only spatial light modulator.

Science.gov (United States)

Cai, Meng-Qiang; Wang, Zhou-Xiang; Liang, Juan; Wang, Yan-Kun; Gao, Xu-Zhen; Li, Yongnan; Tu, Chenghou; Wang, Hui-Tian

2017-08-01

The scheme for generating vector optical fields should have not only high efficiency but also flexibility for satisfying the requirements of various applications. However, in general, high efficiency and flexibility are not compatible. Here we present and experimentally demonstrate a solution to directly, flexibly, and efficiently generate vector vortex optical fields (VVOFs) with a reflective phase-only liquid crystal spatial light modulator (LC-SLM) based on optical birefringence of liquid crystal molecules. To generate the VVOFs, this approach needs in principle only a half-wave plate, an LC-SLM, and a quarter-wave plate. This approach has some advantages, including a simple experimental setup, good flexibility, and high efficiency, making the approach very promising in some applications when higher power is need. This approach has a generation efficiency of 44.0%, which is much higher than the 1.1% of the common path interferometric approach.

Computational and Experimental Insight Into Single-Molecule Piezoelectric Materials

Science.gov (United States)

Marvin, Christopher Wayne

Piezoelectric materials allow for the harvesting of ambient waste energy from the environment. Producing lightweight, highly responsive materials is a challenge for this type of material, requiring polymer, foam, or bio-inspired materials. In this dissertation, I explore the origin of the piezoelectric effect in single molecules through density functional theory (DFT), analyze the piezoresponse of bio-inspired peptidic materials through the use of atomic and piezoresponse force microscopy (AFM and PFM), and develop a novel class of materials combining flexible polyurethane foams and non-piezoelectric, polar dopants. For the DFT calculations, functional group, regiochemical, and heteroatom derivatives of [6]helicene were examined for their influence on the piezoelectric response. An aza[6]helicene derivative was found to have a piezoelectric response (108 pm/V) comparable to ceramics such as lead zirconium titanate (200+ pm/V). These computed materials have the possibility to compete with current field-leading piezomaterials such as lead zirconium titanate (PZT), zinc oxide (ZnO), and polyvinylidene difluoride (PVDF) and its derivatives. The use of AFM/PFM allows for the demonstration of the piezoelectric effect of the selfassembled monolayer (SAM) peptidic systems. Through PFM, the influence that the helicity and sequence of the peptide has on the overall response of the molecule can be analyzed. Finally, development of a novel class of piezoelectrics, the foam-based materials, expands the current understanding of the qualities required for a piezoelectric material from ceramic and rigid materials to more flexible, organic materials. Through the exploration of these novel types of piezoelectric materials, new design rules and figures of merit have been developed.

Specificity Characterization of SLA Class I Molecules Binding to Swine-Origin Viral Cytotoxic T Lymphocyte Epitope Peptides in Vitro

Directory of Open Access Journals (Sweden)

Caixia Gao

2017-12-01

Full Text Available Swine leukocyte antigen (SLA class I molecules play a crucial role in generating specific cellular immune responses against viruses and other intracellular pathogens. They mainly bind and present antigens of intracellular origin to circulating MHC I-restricted cytotoxic T lymphocytes (CTLs. Binding of an appropriate epitope to an SLA class I molecule is the single most selective event in antigen presentation and the first step in the killing of infected cells by CD8+ CTLs. Moreover, the antigen epitopes are strictly restricted to specific SLA molecules. In this study, we constructed SLA class I complexes in vitro comprising viral epitope peptides, the extracellular region of the SLA-1 molecules, and β2-microglobulin (β2m using splicing overlap extension polymerase chain reaction (SOE-PCR. The protein complexes were induced and expressed in an Escherichia coli prokaryotic expression system and subsequently purified and refolded. Specific binding of seven SLA-1 proteins to one classical swine fever virus (CSFV and four porcine reproductive and respiratory syndrome virus (PRRSV epitope peptides was detected by enzyme-linked immunosorbent assay (ELISA-based method. The SLA-1∗13:01, SLA-1∗11:10, and SLA-1∗11:01:02 proteins were able to bind specifically to different CTL epitopes of CSFV and PRRSV and the MHC restrictions of the five epitopes were identified. The fixed combination of Asn151Val152 residues was identified as the potentially key amino acid residues influencing the binding of viral several CTL epitope peptides to SLA-1∗13:01 and SLA-1∗04:01:01 proteins. The more flexible pocket E in the SLA-1∗13:01 protein might have fewer steric limitations and therefore be able to accommodate more residues of viral CTL epitope peptides, and may thus play a critical biochemical role in determining the peptide-binding motif of SLA-1∗13:01. Characterization of the binding specificity of peptides to SLA class I molecules provides an

Vibrations of a molecule in an external force field.

Science.gov (United States)

Okabayashi, Norio; Peronio, Angelo; Paulsson, Magnus; Arai, Toyoko; Giessibl, Franz J

2018-05-01

The oscillation frequencies of a molecule on a surface are determined by the mass distribution in the molecule and the restoring forces that occur when the molecule bends. The restoring force originates from the atomic-scale interaction within the molecule and with the surface, which plays an essential role in the dynamics and reactivity of the molecule. In 1998, a combination of scanning tunneling microscopy with inelastic tunneling spectroscopy revealed the vibrational frequencies of single molecules adsorbed on a surface. However, the probe tip itself exerts forces on the molecule, changing its oscillation frequencies. Here, we combine atomic force microscopy with inelastic tunneling spectroscopy and measure the influence of the forces exerted by the tip on the lateral vibrational modes of a carbon monoxide molecule on a copper surface. Comparing the experimental data to a mechanical model of the vibrating molecule shows that the bonds within the molecule and with the surface are weakened by the proximity of the tip. This combination of techniques can be applied to analyze complex molecular vibrations and the mechanics of forming and loosening chemical bonds, as well as to study the mechanics of bond breaking in chemical reactions and atomic manipulation.

Studying neuroprotective effect of Atorvastatin as a small molecule drug on high glucose-induced neurotoxicity in undifferentiated PC12 cells: role of NADPH oxidase.

Science.gov (United States)

Rayegan, Samira; Dehpour, Ahmad Reza; Sharifi, Ali Mohammad

2017-02-01

Overproduction of reactive oxygen species (ROS) by NADPH oxidase (NOX) activation has been considered the essential mechanism induced by hyperglycemia in various tissues. However, there is no comprehensive study on the role of NOXs in high glucose (HG)-induced toxic effect in neural tissues. Recently, a therapeutic strategy in oxidative related pathologies has been introduced by blocking the undesirable actions of NOX enzymes by small molecules. The protective roles of Statins in ameliorating oxidative stress by NOX inhibition have been shown in some tissues except neural. We hypothesized then, that different NOXs may have role in HG-induced neural cell injury. Furthermore, we postulate that Atorvastatin as a small molecule may modulate this NOXs activity to protect neural cells. Undifferentiated PC12 cells were treated with HG (140 mM/24 h) in the presence and absence of Atorvastatin (1 μM/96 h). The cell viability was measured by MTT assay and the gene and protein expressions profile of NOX (1-4) were determined by RT-PCR and western blotting, respectively. Levels of ROS and malondialdehyde (MDA) were also evaluated. Gene and protein expression levels of NOX (1-4) and consequently ROS and MDA levels were elevated in HG-treated PC12 cells. Atorvastatin could significantly decrease HG-induced NOXs, ROS and MDA elevation and improve impaired cell viability. It can be concluded that HG could elevate NOXs activity, ROS and MDA levels in neural tissues and Atorvastatin as a small molecule NOX inhibitor drug may prevent and delay diabetic complications, particularly neuropathy.

Bitter and sweet tasting molecules: It's complicated.

Science.gov (United States)

Di Pizio, Antonella; Ben Shoshan-Galeczki, Yaron; Hayes, John E; Niv, Masha Y

2018-04-19

"Bitter" and "sweet" are frequently framed in opposition, both functionally and metaphorically, in regard to affective responses, emotion, and nutrition. This oppositional relationship is complicated by the fact that some molecules are simultaneously bitter and sweet. In some cases, a small chemical modification, or a chirality switch, flips the taste from sweet to bitter. Molecules humans describe as bitter are recognized by a 25-member subfamily of class A G-protein coupled receptors (GPCRs) known as TAS2Rs. Molecules humans describe as sweet are recognized by a TAS1R2/TAS1R3 heterodimer of class C GPCRs. Here we characterize the chemical space of bitter and sweet molecules: the majority of bitter compounds show higher hydrophobicity compared to sweet compounds, while sweet molecules have a wider range of sizes. Importantly, recent evidence indicates that TAS1Rs and TAS2Rs are not limited to the oral cavity; moreover, some bitterants are pharmacologically promiscuous, with the hERG potassium channel, cytochrome P450 enzymes, and carbonic anhydrases as common off-targets. Further focus on polypharmacology may unravel new physiological roles for tastant molecules. Copyright © 2018 Elsevier B.V. All rights reserved.

Solution processable organic polymers and small molecules for bulk-heterojunction solar cells: A review

International Nuclear Information System (INIS)

Sharma, G. D.

2011-01-01

Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm 2 has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.

Conformation of flexibly linked triterpene dimers by using RDC-enhanced NMR spectroscopy

Science.gov (United States)

Lakshmi, Jerripothula K.; Pattnaik, Banita; Kavitha, Rachineni; Mallavadhani, Uppuluri V.; Jagadeesh, Bharatam

2018-06-01

Dimers of flexibly linked pentacyclic triterpene ursolic acid (UA) and its related frameworks such as asiatic acid (AA) and oleanolic acid (OA) have recently attracted significant attention due to their enhanced anti-cancer and anti-HCV activity compared to their respective monomers. Determination of conformation/inter-monomer orientation of these molecules is very important to understand their structure-activity relationship and to develop new scaffolds, which, however, is difficult through conventional NOE based solution-state NMR spectroscopy, due to lack of long-range NOEs. In the present work, we report a precise determination of conformation of two 1,2,3-triazole-linked triterpene dimer molecules, UA-AA and UA-OA, by employing one-bond Csbnd H residual dipolar couplings (RDCs) as additional long-range orientational restraints, measured in anisotropic PDMS/CDCl3 solvent medium.

The role of medicaments, exosomes and miRNA molecules in modulation of macrophage immune activity

Directory of Open Access Journals (Sweden)

Katarzyna Nazimek

2015-01-01

Full Text Available Macrophages play an important role in innate immunity, in induction and orchestration of acquired immune response as well as in the maintenance of tissue homeostasis. Macrophages as antigen presenting cells induce or inhibit the development of immune response and as effector cells play an important role in innate immunity to infectious agents and in delayed--type hypersensitivity as well. Thus, either up- or down-regulation of their activity leads to the impairment of different biological processes. This often results in the development of immunological diseases or inflammatory response associated with metabolic, cardiovascular or neuroendocrine disorders. Therefore, the possibility of modulation of macrophage function should allow for elaboration of new effective therapeutic strategies. Noteworthy, interaction of medicaments with macrophages may directly mediate their therapeutic activity or is an additional beneficial effect increasing efficacy of treatment. Further, macrophage differentiation is regulated by miRNA-223, while expression of miRNA-146 and miRNA-155 may modulate and/or be a result of the current cell phenotype. Present review is focused on the current knowledge about the action of medicaments, microRNA molecules, exosomes and related vesicles on macrophages leading to modulation of their biological activity.

Flexible structured high-frequency film bulk acoustic resonator for flexible wireless electronics

International Nuclear Information System (INIS)

Zhou, Changjian; Shu, Yi; Yang, Yi; Ren, Tian-Ling; Jin, Hao; Dong, Shu-Rong; Chan, Mansun

2015-01-01

Flexible electronics have inspired many novel and very important applications in recent years and various flexible electronic devices such as diodes, transistors, circuits, sensors, and radiofrequency (RF) passive devices including antennas and inductors have been reported. However, the lack of a high-performance RF resonator is one of the key bottlenecks to implement flexible wireless electronics. In this study, for the first time, a novel ultra-flexible structured film bulk acoustic resonator (FBAR) is proposed. The flexible FBAR is fabricated on a flexible polyimide substrate using piezoelectric thin film aluminum nitride (AlN) for acoustic wave excitation. Both the shear wave and longitudinal wave can be excited under the surface interdigital electrodes configuration we proposed. In the case of the thickness extension mode, a flexible resonator with a working frequency as high as of 5.2325 GHz has been realized. The resonators stay fully functional under bending status and after repeated bending and re-flattening operations. This flexible high-frequency resonator will serve as a key building block for the future flexible wireless electronics, greatly expanding the application scope of flexible electronics. (paper)

The nature and necessity of operational flexibility in the emergency department.

Science.gov (United States)

Ward, Michael J; Ferrand, Yann B; Laker, Lauren F; Froehle, Craig M; Vogus, Timothy J; Dittus, Robert S; Kripalani, Sunil; Pines, Jesse M

2015-02-01

Hospital-based emergency departments (EDs), given their high cost and major role in allocating care resources, are at the center of the debate about how to maximize value in delivering health care in the United States. To operate effectively and create value, EDs must be flexible, having the ability to rapidly adapt to the highly variable needs of patients. The concept of flexibility has not been well described in the ED literature. We introduce the concept, outline its potential benefits, and provide some illustrative examples to facilitate incorporating flexibility into ED management. We draw on operations research and organizational theory to identify and describe 5 forms of flexibility: physical, human resource, volume, behavioral, and conceptual. Each form of flexibility may be useful individually or in combination with other forms in improving ED performance and enhancing value. We also offer suggestions for measuring operational flexibility in the ED. A better understanding of operational flexibility and its application to the ED may help us move away from reactive approaches of managing variable demand to a more systematic approach. We also address the tension between cost and flexibility and outline how "partial flexibility" may help resolve some challenges. Applying concepts of flexibility from other disciplines may help clinicians and administrators think differently about their workflow and provide new insights into managing issues of cost, flow, and quality in the ED. Copyright © 2014 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

Impact of Building Design Parameters on Thermal Energy Flexibility in a Low-Energy Building

OpenAIRE

Sarran, Lucile; Foteinaki, Kyriaki; Gianniou, Panagiota; Rode, Carsten

2017-01-01

This work focuses on demand-side management potential for the heating grid in residential buildings. The possibility to increase the flexibility provided to the heat network through specific building design is investigated. The role of different parts of the building structure on thermal flexibility is assessed through a parameter variation on a building model. Different building designs are subjected to heat cut-offs, and flexibility is evaluated with respect to comfort preservation and heat...

Molecule Matters van der Waals Molecules

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

Flexible Molybdenum Electrodes towards Designing Affinity Based Protein Biosensors.

Science.gov (United States)

Kamakoti, Vikramshankar; Panneer Selvam, Anjan; Radha Shanmugam, Nandhinee; Muthukumar, Sriram; Prasad, Shalini

2016-07-18

Molybdenum electrode based flexible biosensor on porous polyamide substrates has been fabricated and tested for its functionality as a protein affinity based biosensor. The biosensor performance was evaluated using a key cardiac biomarker; cardiac Troponin-I (cTnI). Molybdenum is a transition metal and demonstrates electrochemical behavior upon interaction with an electrolyte. We have leveraged this property of molybdenum for designing an affinity based biosensor using electrochemical impedance spectroscopy. We have evaluated the feasibility of detection of cTnI in phosphate-buffered saline (PBS) and human serum (HS) by measuring impedance changes over a frequency window from 100 mHz to 1 MHz. Increasing changes to the measured impedance was correlated to the increased dose of cTnI molecules binding to the cTnI antibody functionalized molybdenum surface. We achieved cTnI detection limit of 10 pg/mL in PBS and 1 ng/mL in HS medium. The use of flexible substrates for designing the biosensor demonstrates promise for integration with a large-scale batch manufacturing process.

Neural correlates of reappraisal considering working memory capacity and cognitive flexibility.

Science.gov (United States)

Zaehringer, Jenny; Falquez, Rosalux; Schubert, Anna-Lena; Nees, Frauke; Barnow, Sven

2018-01-09

Cognitive reappraisal of emotion is strongly related to long-term mental health. Therefore, the exploration of underlying cognitive and neural mechanisms has become an essential focus of research. Considering that reappraisal and executive functions rely on a similar brain network, the question arises whether behavioral differences in executive functions modulate neural activity during reappraisal. Using functional neuroimaging, the present study aimed to analyze the role of working memory capacity (WMC) and cognitive flexibility in brain activity during down-regulation of negative emotions by reappraisal in N = 20 healthy participants. Results suggests that WMC and cognitive flexibility were negatively correlated with prefrontal activity during reappraisal condition. Here, results also revealed a negative correlation between cognitive flexibility and amygdala activation. These findings provide first hints that (1) individuals with lower WMC and lower cognitive flexibility might need more higher-order cognitive neural resources in order to down-regulate negative emotions and (2) cognitive flexibility relates to emotional reactivity during reappraisal.

Printable inorganic nanomaterials for flexible transparent electrodes: from synthesis to application

Science.gov (United States)

Wang, Dingrun; Mei, Yongfeng; Huang, Gaoshan

2018-01-01

Printed and flexible electronics are definitely promising cutting-edge electronic technologies of the future. They offer a wide-variety of applications such as flexible circuits, flexible displays, flexible solar cells, skin-like pressure sensors, and radio frequency identification tags in our daily life. As the most-fundamental component of electronics, electrodes are made of conductive materials that play a key role in flexible and printed electronic devices. In this review, various inorganic conductive materials and strategies for obtaining highly conductive and uniform electrodes are demonstrated. Applications of printed electrodes fabricated via these strategies are also described. Nevertheless, there are a number of challenges yet to overcome to optimize the processing and performance of printed electrodes. Project supported by the National Natural Science Foundation of China (Nos. 51475093, U1632115), the Science and Technology Commission of Shanghai Municipality (No. 14JC1400200), the National Key Technologies R&D Program of China (No. 2015ZX02102-003), and the Changjiang Young Scholars Programme of China.

Translocation of "rod-coil" polymers: probing the structure of single molecules within nanopores.

Science.gov (United States)

de Haan, Hendrick W; Slater, Gary W

2013-01-25

Using simulation and analytical techniques, we demonstrate that it is possible to extract structural information about biological molecules by monitoring the dynamics as they translocate through nanopores. From Langevin dynamics simulations of polymers exhibiting discrete changes in flexibility (rod-coil polymers), distinct plateaus are observed in the progression towards complete translocation. Characterizing these dynamics via an incremental mean first passage approach, the large steps are shown to correspond to local barriers preventing the passage of the coils while the rods translocate relatively easily. Analytical replication of the results provides insight into the corrugated nature of the free energy landscape as well as the dependence of the effective barrier heights on the length of the coil sections. Narrowing the width of the pore or decreasing the charge on either the rod or the coil segments are both shown to enhance the resolution of structural details. The special case of a single rod confined within a nanopore is also studied. Here, sufficiently long flexible sections attached to either end are demonstrated to act as entropic anchors which can effectively trap the rod within the pore for an extended period of time. Both sets of results suggest new experimental approaches for the control and study of biological molecules within nanopores.

Doing Identity Work: Fuzzy Boundaries and Flexibility in Further Education.

Science.gov (United States)

Harrison, Roger; Clarke, Julia; Reeve, Fiona; Edwards, Richard

2003-01-01

Case studies of three further education teachers illustrate different identity positions and discourses. What emerges is a complex image of teachers exploiting blurred role boundaries in the flexible workplace. (Contains 27 references.) (SK)

Flexibility@Work 2013: yearly report on flexible labor and employment

NARCIS (Netherlands)

Berkhout, E.; Heyma, A.; Prins, J.

2013-01-01

There is no clear evidence that the strong growth in the share of flexible labor relations between 2002 and 2007 points at a worldwide trend towards a larger share of flexible labor at the expense of traditional open-ended labor contracts. The growth in flexible labor varies too much between

High performance photovoltaic applications using solution-processed small molecules.

Science.gov (United States)

Chen, Yongsheng; Wan, Xiangjian; Long, Guankui

2013-11-19

Energy remains a critical issue for the survival and prosperity of humancivilization. Many experts believe that the eventual solution for sustainable energy is the use of direct solar energy as the main energy source. Among the options for renewable energy, photovoltaic technologies that harness solar energy offer a way to harness an unlimited resource and minimum environment impact in contrast with other alternatives such as water, nuclear, and wind energy. Currently, almost all commercial photovoltaic technologies use Si-based technology, which has a number of disadvantages including high cost, lack of flexibility, and the serious environmental impact of the Si industry. Other technologies, such as organic photovoltaic (OPV) cells, can overcome some of these issues. Today, polymer-based OPV (P-OPV) devices have achieved power conversion efficiencies (PCEs) that exceed 9%. Compared with P-OPV, small molecules based OPV (SM-OPV) offers further advantages, including a defined structure for more reproducible performance, higher mobility and open circuit voltage, and easier synthetic control that leads to more diversified structures. Therefore, while largely undeveloped, SM-OPV is an important emerging technology with performance comparable to P-OPV. In this Account, we summarize our recent results on solution-processed SM-OPV. We believe that solution processing is essential for taking full advantage of OPV technologies. Our work started with the synthesis of oligothiophene derivatives with an acceptor-donor-acceptor (A-D-A) structure. Both the backbone conjugation length and electron withdrawing terminal groups play an important role in the light absorption, energy levels and performance of the devices. Among those molecules, devices using a 7-thiophene-unit backbone and a 3-ethylrhodanine (RD) terminal unit produced a 6.1% PCE. With the optimized conjugation length and terminal unit, we borrowed from the results with P-OPV devices to optimize the backbone. Thus we

Structural characterization of new defective molecules in poly(amidoamide) dendrimers by combining mass spectrometry and nuclear magnetic resonance

Energy Technology Data Exchange (ETDEWEB)

Tintaru, Aura; Ungaro, Rémi [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France); Liu, Xiaoxiuan; Chen, Chao [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Giordano, Laurent [Aix-Marseille Université – CNRS, UMR 7313, Institut des Sciences Moléculaires de Marseille ISM2 and Ecole Centrale de Marseille, Marseille (France); Peng, Ling [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Charles, Laurence, E-mail: laurence.charles@univ-amu.fr [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France)

2015-01-01

Highlights: • ESI-MS/MS and NMR were combined to elucidate a new side-reaction during divergent synthesis of PAMAM dendrimers. • These new impurities exhibit a net gain of a single carbon atom as compared to expected molecules. • The side-reaction is due to formaldehyde, contained as trace level impurity in methanol used as the synthesis medium. - Abstract: A new side-reaction occurring during divergent synthesis of PAMAM dendrimers (generations G{sub 0}–G{sub 2}) was revealed by mass spectrometric detection of defective molecules with a net gain of a single carbon atom as compared to expected compounds. Combining MS/MS experiments performed on different electrosprayed precursor ions (protonated molecules and lithiated adducts) with NMR analyses allowed the origin of these by-products to be elucidated. Modification of one ethylenediamine end-group of perfect dendrimers into a cyclic imidazolidine moiety was induced by formaldehyde present at trace level in the methanol solvent used as the synthesis medium. Dendrimers studied here were purposely constructed from a triethanolamine core to make them more flexible, as compared to NH{sub 3}- or ethylenediamine-core PAMAM, and hence improve their interaction with DNA. Occurrence of this side-reaction would be favored by the particular flexibility of the dendrimer branches.

Most promising flexible generators for the wind dominated market

International Nuclear Information System (INIS)

Vorushylo, I.; Keatley, P.; Hewitt, NJ

2016-01-01

The intermittent nature of wind power and other forms of variable renewable energy requires complementary dispatchable flexible generators in order to guarantee the efficient, reliable and secure operation of electricity systems. The most popular solution to date has been peaking plant, usually in the form of open-cycle-gas- turbines (OCGT). Energy storage technologies have so far been considered too expensive, however technology development, as well as challenging renewable targets could potentially make storage economically viable. Although new advanced flexible combined-cycle gas turbines (CCGT) have been developed by some manufacturers, they have not yet been investigated in electricity market models. This paper describes a techno-economic assessment of the most suitable flexible technologies for the wind-dominated all Ireland electricity market (the Single Electricity Market (SEM)). The analysis is conducted by considering the impact of a series of policy scenarios which are compared in an electricity market model. The comparison is quantified using three primary metrics: technical benefits to the system, economic advantages to the consumer and investment viability. Modelling results suggest that advanced CCGT and energy storage solutions are the most advantageous, however they need strong governmental support to attract potential investors and guarantee deployment in the market. - Highlights: •Future efficiency and stability of the wind dominated require flexible generators. •Energy storage systems are the most technically advantageous flexible generators. •The advanced flexible CCGT is the most efficient solution from an economic point of view. •Traditional peaking plants (OCGT) is the least advantageous flexible generator. •The governments will play a key role in integration of the flexible technologies.

Image averaging of flexible fibrous macromolecules: the clathrin triskelion has an elastic proximal segment.

Science.gov (United States)

Kocsis, E; Trus, B L; Steer, C J; Bisher, M E; Steven, A C

1991-08-01

We have developed computational techniques that allow image averaging to be applied to electron micrographs of filamentous molecules that exhibit tight and variable curvature. These techniques, which involve straightening by cubic-spline interpolation, image classification, and statistical analysis of the molecules' curvature properties, have been applied to purified brain clathrin. This trimeric filamentous protein polymerizes, both in vivo and in vitro, into a wide range of polyhedral structures. Contrasted by low-angle rotary shadowing, dissociated clathrin molecules appear as distinctive three-legged structures, called "triskelions" (E. Ungewickell and D. Branton (1981) Nature 289, 420). We find triskelion legs to vary from 35 to 62 nm in total length, according to an approximately bell-shaped distribution (mu = 51.6 nm). Peaks in averaged curvature profiles mark hinges or sites of enhanced flexibility. Such profiles, calculated for each length class, show that triskelion legs are flexible over their entire lengths. However, three curvature peaks are observed in every case: their locations define a proximal segment of systematically increasing length (14.0-19.0 nm), a mid-segment of fixed length (approximately 12 nm), and a rather variable end-segment (11.6-19.5 nm), terminating in a hinge just before the globular terminal domain (approximately 7.3 nm diameter). Thus, two major factors contribute to the overall variability in leg length: (1) stretching of the proximal segment and (2) stretching of the end-segment and/or scrolling of the terminal domain. The observed elasticity of the proximal segment may reflect phosphorylation of the clathrin light chains.

Dissociation of Vertical Semiconductor Diatomic Artificial Molecules

International Nuclear Information System (INIS)

Pi, M.; Emperador, A.; Barranco, M.; Garcias, F.; Muraki, K.; Tarucha, S.; Austing, D. G.

2001-01-01

We investigate the dissociation of few-electron circular vertical semiconductor double quantum dot artificial molecules at 0T as a function of interdot distance. A slight mismatch introduced in the fabrication of the artificial molecules from nominally identical constituent quantum wells induces localization by offsetting the energy levels in the quantum dots by up to 2meV, and this plays a crucial role in the appearance of the addition energy spectra as a function of coupling strength particularly in the weak coupling limit

Fabrication of air-stable n-type carbon nanotube thin-film transistors on flexible substrates using bilayer dielectrics.

Science.gov (United States)

Li, Guanhong; Li, Qunqing; Jin, Yuanhao; Zhao, Yudan; Xiao, Xiaoyang; Jiang, Kaili; Wang, Jiaping; Fan, Shoushan

2015-11-14

Single-walled carbon nanotube (SWNT) thin-film transistors hold great potential for flexible electronics. However, fabrication of air-stable n-type devices by methods compatible with standard photolithography on flexible substrates is challenging. Here, we demonstrated that by using a bilayer dielectric structure of MgO and atomic layer deposited (ALD) Al2O3 or HfO2, air-stable n-type devices can be obtained. The mechanism for conduction type conversion was elucidated and attributed to the hole depletion in SWNT, the decrease of the trap state density by MgO assimilating adsorbed water molecules in the vicinity of SWNT, and the energy band bending because of the positive fixed charges in the ALD layer. The key advantage of the method is the relatively low temperature (120 or 90 °C) required here for the ALD process because we need not employ this step to totally remove the absorbates on the SWNTs. This advantage facilitates the integration of both p-type and n-type transistors through a simple lift off process and compact CMOS inverters were demonstrated. We also demonstrated that the doping of SWNTs in the channel plays a more important role than the Schottky barriers at the metal contacts in carbon nanotube thin-film transistors, unlike the situation in individual SWNT-based transistors.

A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

DEFF Research Database (Denmark)

Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

2014-01-01

. The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

Movable MEMS Devices on Flexible Silicon

KAUST Repository

Ahmed, Sally

2013-05-05

Flexible electronics have gained great attention recently. Applications such as flexible displays, artificial skin and health monitoring devices are a few examples of this technology. Looking closely at the components of these devices, although MEMS actuators and sensors can play critical role to extend the application areas of flexible electronics, fabricating movable MEMS devices on flexible substrates is highly challenging. Therefore, this thesis reports a process for fabricating free standing and movable MEMS devices on flexible silicon substrates; MEMS flexure thermal actuators have been fabricated to illustrate the viability of the process. Flexure thermal actuators consist of two arms: a thin hot arm and a wide cold arm separated by a small air gap; the arms are anchored to the substrate from one end and connected to each other from the other end. The actuator design has been modified by adding etch holes in the anchors to suit the process of releasing a thin layer of silicon from the bulk silicon substrate. Selecting materials that are compatible with the release process was challenging. Moreover, difficulties were faced in the fabrication process development; for example, the structural layer of the devices was partially etched during silicon release although it was protected by aluminum oxide which is not attacked by the releasing gas . Furthermore, the thin arm of the thermal actuator was thinned during the fabrication process but optimizing the patterning and etching steps of the structural layer successfully solved this problem. Simulation was carried out to compare the performance of the original and the modified designs for the thermal actuators and to study stress and temperature distribution across a device. A fabricated thermal actuator with a 250 μm long hot arm and a 225 μm long cold arm separated by a 3 μm gap produced a deflection of 3 μm before silicon release, however, the fabrication process must be optimized to obtain fully functioning

Flexibility and Sharing of Childcare Duties in Black Families.

Science.gov (United States)

Wilson, Melvin N.; And Others

1990-01-01

The findings of a survey of 64 Black families do not support the hypothesis of role flexibility and sharing in Black households. The mothers in the sample, 78 percent of whom were employed, were primarily responsible for household maintenance and child rearing. (DM)

Conformational Flexibility of Proteins Involved in Ribosome Biogenesis: Investigations via Small Angle X-ray Scattering (SAXS

Directory of Open Access Journals (Sweden)

Dritan Siliqi

2018-02-01

Full Text Available The dynamism of proteins is central to their function, and several proteins have been described as flexible, as consisting of multiple domains joined by flexible linkers, and even as intrinsically disordered. Several techniques exist to study protein structures, but small angle X-ray scattering (SAXS has proven to be particularly powerful for the quantitative analysis of such flexible systems. In the present report, we have used SAXS in combination with X-ray crystallography to highlight their usefulness at characterizing flexible proteins, using as examples two proteins involved in different steps of ribosome biogenesis. The yeast BRCA2 and CDKN1A-interactig protein, Bcp1, is a chaperone for Rpl23 of unknown structure. We showed that it consists of a rigid, slightly elongated protein, with a secondary structure comprising a mixture of alpha helices and beta sheets. As an example of a flexible molecule, we studied the SBDS (Shwachman-Bodian-Diamond Syndrome protein that is involved in the cytoplasmic maturation of the 60S subunit and constitutes the mutated target in the Shwachman-Diamond Syndrome. In solution, this protein coexists in an ensemble of three main conformations, with the N- and C-terminal ends adopting different orientations with respect to the central domain. The structure observed in the protein crystal corresponds to an average of those predicted by the SAXS flexibility analysis.

The role of stoichiometric flexibility in modelling forest ecosystem responses to nitrogen fertilization.

Science.gov (United States)

Meyerholt, Johannes; Zaehle, Sönke

2015-12-01

The response of the forest carbon (C) balance to changes in nitrogen (N) deposition is uncertain, partly owing to diverging representations of N cycle processes in dynamic global vegetation models (DGVMs). Here, we examined how different assumptions about the degree of flexibility of the ecosystem's C : N ratios contribute to this uncertainty, and which of these assumptions best correspond to the available data. We applied these assumptions within the framework of a DGVM and compared the results to responses in net primary productivity (NPP), leaf N concentration, and ecosystem N partitioning, observed at 22 forest N fertilization experiments. Employing flexible ecosystem pool C : N ratios generally resulted in the most convincing model-data agreement with respect to production and foliar N responses. An intermediate degree of stoichiometric flexibility in vegetation, where wood C : N ratio changes were decoupled from leaf and root C : N ratio changes, led to consistent simulation of production and N cycle responses to N addition. Assuming fixed C : N ratios or scaling leaf N concentration changes to other tissues, commonly assumed by DGVMs, was not supported by reported data. Between the tested assumptions, the simulated changes in ecosystem C storage relative to changes in C assimilation varied by up to 20%. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Small molecule probes for cellular death machines.

Science.gov (United States)

Li, Ying; Qian, Lihui; Yuan, Junying

2017-08-01

The past decade has witnessed a significant expansion of our understanding about the regulated cell death mechanisms beyond apoptosis. The application of chemical biological approaches had played a major role in driving these exciting discoveries. The discovery and use of small molecule probes in cell death research has not only revealed significant insights into the regulatory mechanism of cell death but also provided new drug targets and lead drug candidates for developing therapeutics of human diseases with huge unmet need. Here, we provide an overview of small molecule modulators for necroptosis and ferroptosis, two non-apoptotic cell death mechanisms, and discuss the molecular pathways and relevant pathophysiological mechanisms revealed by the judicial applications of such small molecule probes. We suggest that the development and applications of small molecule probes for non-apoptotic cell death mechanisms provide an outstanding example showcasing the power of chemical biology in exploring novel biological mechanisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

3D single-molecule super-resolution microscopy with a tilted light sheet.

Science.gov (United States)

Gustavsson, Anna-Karin; Petrov, Petar N; Lee, Maurice Y; Shechtman, Yoav; Moerner, W E

2018-01-09

Tilted light sheet microscopy with 3D point spread functions (TILT3D) combines a novel, tilted light sheet illumination strategy with long axial range point spread functions (PSFs) for low-background, 3D super-localization of single molecules as well as 3D super-resolution imaging in thick cells. Because the axial positions of the single emitters are encoded in the shape of each single-molecule image rather than in the position or thickness of the light sheet, the light sheet need not be extremely thin. TILT3D is built upon a standard inverted microscope and has minimal custom parts. The result is simple and flexible 3D super-resolution imaging with tens of nm localization precision throughout thick mammalian cells. We validate TILT3D for 3D super-resolution imaging in mammalian cells by imaging mitochondria and the full nuclear lamina using the double-helix PSF for single-molecule detection and the recently developed tetrapod PSFs for fiducial bead tracking and live axial drift correction.

Recombination and detachment in oxygen discharges: the role of metastable oxygen molecules

International Nuclear Information System (INIS)

Gudmundsson, J T

2004-01-01

A global (volume averaged) model of oxygen discharges is used to study the transition from a recombination dominated discharge to a detachment dominated discharge. The model includes the metastable oxygen molecules O 2 (a 1 Δ g ) and O 2 (b 1 Σ g + ) and the three Herzberg states O 2 (A 3 Σ u + , A' 3 Δ u , c 1 Σ u - ). Dissociative attachment of the oxygen molecule in the ground state O 2 ( 3 Σ g - ) and the metastable oxygen molecule O 2 (a 1 Δ g ) are the dominating channels for creation of the negative oxygen ion O - . At high pressures, dissociative attachment of the Herzberg states contributes significantly to the creation of the negative oxygen ion, O - . The detachment by a collision of the metastable oxygen molecule O 2 (b 1 Σ g + ) with the oxygen ion, O - , is a significant loss process for the O - at pressures above 10 mTorr. Its contribution to the loss is more significant at a lower applied power, but at the higher pressures it is always significant. Detachment by collision with O( 3 P) is also an important loss mechanism for O - . We find that ion-ion recombination is the dominating loss process for negative ions in oxygen discharges at low pressures and calculate the critical pressure where the contributions of recombination reactions and detachment reactions are equal. This critical pressure depends on the applied power, increases with applied power and is in the range 5-14 mTorr in the pressure and power range investigated

Economic and Technical Aspects of Flexible Storage Photovoltaic Systems in Europe

Directory of Open Access Journals (Sweden)

Henrik Zsiborács

2018-06-01

Full Text Available Solar energy has an increasing role in the global energy mix. The need for flexible storage photovoltaic systems and energy storage in electricity networks is becoming increasingly important as more generating capacity uses solar and wind energy. This paper is a study on the economic questions related to flexible storage photovoltaic systems of household size in 2018. The aim is to clarify whether it is possible in the European Union to achieve a payback of the costs of flexible storage photovoltaic system investments for residential customers considering the technology-specific storage aspects prevalent in 2018. We studied seven different flexible storage photovoltaic investments with different battery technologies in Germany, France, Italy, and Spain because, in Europe, these countries have a prominent role with regard to the spread of photovoltaic technology. These investment alternatives are studied with the help of economic indicators for the different cases of the selected countries. At the end of our paper we come to the conclusion that an investment of a flexible storage photovoltaic (PV system with Olivine-type-LiFePO4, Lithium-Ion, Vented lead-acid battery (OPzS, Sealed lead-acid battery (OPzV, and Aqueous Hybrid Ion (AHI batteries can have a positive net present value due to the high electricity prices in Germany and in Spain. The most cost-effective technology was the Olivine-type-LiFePO4 and the Lithium-Ion at the time of the study. We suggest the provision of governmental support and uniform European modifications to the regulatory framework, especially concerning grid fees and tariffs, which would be necessary in the beginning to help to introduce these flexible storage PV systems to the market.

The effects of workplace flexibility on health behaviors: a cross-sectional and longitudinal analysis.

Science.gov (United States)

Grzywacz, Joseph G; Casey, Patrick R; Jones, Fiona A

2007-12-01

To examine the cross-sectional and longitudinal associations between workplace flexibility and health behaviors, and estimate the potential importance of flexibility for effective worksite health promotion programs. Cross-sectional and longitudinal health risk appraisal data were obtained from US based employees of a multinational pharmaceutical company (n = 3193). Examined health behaviors were hours of sleep, physical activity frequency, health education seminar attendance, frequency of practicing personal resilience techniques, and self-appraised lifestyle. Self-reported flexibility in the workplace was the primary independent variable. Each health behavior, except regular attendance in health education seminars, was positively related to perceived flexibility in cross-sectional analyses. Sleep and self-appraised lifestyle were significantly related to changes in perceived flexibility over time. Workplace flexibility may contribute to positive lifestyle behaviors, and may play an important role in effective worksite health promotion programs.

Real-time optical modelling and investigation of inorganic nano-layer growth onto flexible polymeric substrates

International Nuclear Information System (INIS)

Laskarakis, A.; Georgiou, D.; Logothetidis, S.

2010-01-01

A major factor for the achievement of the desirable performance, efficiency and lifetime of flexible organic electronic devices is the optimization of the encapsulation layers that protect the device active layers by atmospheric gas molecule permeation. The active layers consisted of small molecule and/or polymer organic semiconductors as well as the organic conductors need to be encapsulated into a transparent medium that will provide the necessary protection and maintain their charge generation and transport characteristics. The encapsulation layers are generally consisted of inorganic thin films (silicon oxide-SiO x and aluminium oxide-AlO x ) deposited onto the polymeric substrates, such as PolyEthylene Terephthalate (PET). In this work, in situ and real-time Spectroscopic Ellipsometry in the ultraviolet spectral region has been implemented in order to investigate the growth of inorganic SiO x and AlO x nano-layers onto PET flexible polymeric substrates as well as the PET/inorganic interface effects during the early stages of growth. The analysis of the pseudodielectric function that was measured in real-time in very short time scales (in the order of hundreds of ms) has provided detailed information on the time evolution of the thickness and deposition rate of the inorganic nano-layers during their growth process as well as on their optical and electronic properties. This work proposes a methodology for using real-time optical monitoring technique with the aim to tailor and control the functionality of these materials for application in flexible electronic devices.

Flexible employment and nurses' intention to leave the profession: The role of support at work.

Science.gov (United States)

Zeytinoglu, Isik U; Denton, Margaret; Plenderleith, Jennifer Millen

2011-02-01

The objectives of this paper are to examine (1) the association between flexible employment and nurses' intention to leave the profession, and (2) whether or not support at work mediates the association between flexible employment and nurses' intention to leave the profession. Flexible employment is analyzed objectively using non-permanent contract, part-time employment status, casual employment status, involuntary hours and on-call work, and subjectively using job insecurity. Support at work refers to organizational, supervisor and peer support. Data come from our survey of 1396 nurses employed in three teaching hospitals in Southern Ontario. Descriptive statistics are provided. Bivariate correlations, hierarchical regression analysis and mediation tests are conducted. Compared to those in full-time employment, nurses in part-time employment do not intend to leave the profession. None of the other objective flexible employment factors are associated with intention to leave the profession. Perceived job insecurity is associated with intention to leave the profession. Low support at work contributes to intention to leave the profession and mediates the association between job insecurity and intention to leave the profession. The study provides evidence to health sector managers and policy makers that part-time employment, perceived job security and support at work are important factors to consider in efforts to retain nurses in the profession. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

Energy Technology Data Exchange (ETDEWEB)

Serer, María I.; Bonomi, Hernán R. [IIBBA–CONICET, Avenida Patricias Argentinas 435, C1405BWE Buenos Aires (Argentina); Guimarães, Beatriz G. [Synchrotron SOLEIL, L’Orme des Merisiers, Saint-Aubin BP 48, 91192 Gif-sur-Yvette CEDEX (France); Rossi, Rolando C. [Universidad de Buenos Aires, Junín 956, C1113AAD Buenos Aires (Argentina); Goldbaum, Fernando A.; Klinke, Sebastián, E-mail: sklinke@leloir.org.ar [IIBBA–CONICET, Avenida Patricias Argentinas 435, C1405BWE Buenos Aires (Argentina)

2014-05-01

This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one molecule of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C{sub 3} symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity.

Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

International Nuclear Information System (INIS)

Serer, María I.; Bonomi, Hernán R.; Guimarães, Beatriz G.; Rossi, Rolando C.; Goldbaum, Fernando A.; Klinke, Sebastián

2014-01-01

This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one molecule of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C 3 symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity

Flexible working and the contribution of nurses in mid-life to the workforce: a qualitative study.

Science.gov (United States)

Harris, Ruth; Bennett, Janette; Davey, Barbara; Ross, Fiona

2010-04-01

With the changing demographic profile of the nursing workforce, retaining the skill and experience of nurses in mid-life is very important. Work-life balance is a concept that is gaining increasing prominence in today's society. However, little is known about older nurses' experience of family friendly policies and flexible working. This study explored the organisational, professional and personal factors that influence perceptions of commitment and participation in the workforce for nurses working in mid-life (aged 45 and over). A qualitative study using a range of methods including biographical methods, semi-structured face-to-face interviews, focus groups and telephone interviews. Data were analysed using constant comparative method. A large inner city acute teaching hospital and an inner city mental health and social care trust providing both community and inpatient health and social care. 34 nurses and 3 health care assistants participated in individual interviews, 10 nurses participated in two focus groups and 17 managers participated in individual telephone interviews. Four themes emerged: the nature of nursing poses a challenge to the implementation of flexible working, differences in perceptions of the availability of flexible working, ward managers have a crucial role in the implementation of flexible working policies and the implementation of flexible working may be creating an inflexible workforce. The findings suggest that there are limits to the implementation of flexible working for nurses. In some areas there is evidence that the implementation of flexible working may be producing an inflexible workforce as older nurses are required to compensate for the flexible working patterns of their colleagues. Ward managers have a key role in the implementation of family friendly policies and require support to fulfil this role. There is a need for creative solutions to address implementation of flexible working for all nurses to ensure that workforce policy

Radiotherapy- and chemotherapy-induced normal tissue damage. The role of cytokines and adhesion molecules

International Nuclear Information System (INIS)

Plevova, P.

2002-01-01

Background. Ionising radiation and cytostatic agents used in cancer therapy exert damaging effects on normal tissues and induce a complex response at the cellular and molecular levels. Cytokines and adhesion molecules are involved in this response. Methods. Published data on the given topic have been reviewed. Results and conclusions. Various cytokines and adhesion molecules, including tumor necrosis factor α, interleukins- 1,-2,-4, and -6, interferon γ, granulocyte macrophage- and macrophage- colony stimulating factors, transforming growth factor β, platelet-derived growth factor, insulin-like growth factor I, fibroblast and epidermal growth factors, platelet-activating factor, intercellular adhesion molecule-1, vascular cell adhesion molecule-1, E- and P-selectins are involved in the response of normal tissues to ionizing radiation- and chemotherapy- induced normal tissues damage and are co-responsible for some side effects of these treatment modalities, including fever, anorexia and fatigue, suppression of hematopoiesis, both acute and late local tissue response. (author)

High-Performance Flexible Magnetic Tunnel Junctions for Smart Miniaturized Instruments

KAUST Repository

Amara, Selma.; Sevilla, Gallo. A. Torres; Hawsawi, Mayyada.; Mashraei, Yousof.; Mohammed, Hanan .; Cruz, Melvin E.; Ivanov, Yurii. P.; Jaiswal, Samridh.; Jakob, Gerhard.; Klä ui, Mathias.; Hussain, Muhammad.; Kosel, Jurgen.

2018-01-01

, where size and weight are critical parameters. Given their prevalence on the sensors market, flexible magnetic sensors play a major role in this progress. For many high-performance applications, magnetic tunnel junctions (MTJs) have become the first

Is Power Production Flexibility a Substitute for Storability? Evidence from Electricity Futures Prices

Energy Technology Data Exchange (ETDEWEB)

Kilic, M.; Huisman, R. [Erasmus School of Economics, Erasmus University Rotterdam, Rotterdam (Netherlands)

2010-07-15

Electricity is not storable. As a consequence, electricity demand and supply need to be in balance at any moment in time as a shortage in production volume cannot be compensated with supply from inventories. However, if the installed power supply capacity is very flexible, variation in demand can be counterbalanced with flexible adjustment of production volumes. Therefore, supply flexibility can replace the role of inventory. In this paper, we question whether power production flexibility is a substitute for storability. To do so, we examine power futures prices from countries that differ in their power supply and test whether power futures prices contain information about expected future spot prices and risk premiums and examine whether futures prices from a market in which power supply is more flexible would lead to futures prices that are more in line with the theory of storage. We find the opposite; futures prices from markets with flexible power supply behave according to the expectations theory. The implicit view from futures prices is that flexibility is not a substitute for storability.

Mental flexibility impairment in drivers with early Alzheimer's disease: A simulator-based study

Directory of Open Access Journals (Sweden)

Virginie Etienne

2013-07-01

Full Text Available After memory impairment, one of the most common troubles of early Alzheimer's disease (AD is the impairment of executive functioning. However, it can have major consequences on daily life, notably on the driving activity. The present study focused on one important executive function involved in driving: mental flexibility; and considered how this impairment can affect driving. Ten patients with early AD were matched with 29 healthy older drivers. All participants were given an evaluation of mental flexibility through neuropsychological tests and an experimental test developed on a static driving simulator. The experiment was divided in two conditions; one without mental flexibility and another condition with a mental flexibility demand. AD patients showed impairments in the neuropsychological tests evaluating mental flexibility. These deficits are linked to the deficits they showed in the driving simulator flexibility tests. This study contributes to the understanding of mental flexibility mechanisms and on their role in driving activity. It also confirms that the driving simulator is a suitable tool to explore cognitive disorders and driving ability.

Is Power Production Flexibility a Substitute for Storability? Evidence from Electricity Futures Prices

International Nuclear Information System (INIS)

Kilic, M.; Huisman, R.

2010-07-01

Electricity is not storable. As a consequence, electricity demand and supply need to be in balance at any moment in time as a shortage in production volume cannot be compensated with supply from inventories. However, if the installed power supply capacity is very flexible, variation in demand can be counterbalanced with flexible adjustment of production volumes. Therefore, supply flexibility can replace the role of inventory. In this paper, we question whether power production flexibility is a substitute for storability. To do so, we examine power futures prices from countries that differ in their power supply and test whether power futures prices contain information about expected future spot prices and risk premiums and examine whether futures prices from a market in which power supply is more flexible would lead to futures prices that are more in line with the theory of storage. We find the opposite; futures prices from markets with flexible power supply behave according to the expectations theory. The implicit view from futures prices is that flexibility is not a substitute for storability.

Magnetic field modification of ultracold molecule-molecule collisions

International Nuclear Information System (INIS)

Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

2009-01-01

We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

Dynamic Model of a Rotating Flexible Arm-Flexible Root Mechanism Driven by a Shaft Flexible in Torsion

Directory of Open Access Journals (Sweden)

S.Z. Ismail

2006-01-01

Full Text Available This paper presents a dynamic model of a rotating flexible beam carrying a payload at its tip. The model accounts for the driving shaft and the arm root flexibilities. The finite element method and the Lagrangian dynamics are used in deriving the equations of motion with the small deformation theory assumptions and the Euler-Bernoulli beam theory. The obtained model is a nonlinear-coupled system of differential equations. The model is simulated for different combinations of shaft and root flexibilities and arm properties. The simulation results showed that the root flexibility is an important factor that should be considered in association with the arm and shaft flexibilities, as its dynamics influence the motor motion. Moreover, the effect of system non-linearity on the dynamic behavior is investigated by simulating the equivalent linearized system and it was found to be an important factor that should be considered, particularly when designing a control strategy for practical implementation.

Specificity and affinity quantification of flexible recognition from underlying energy landscape topography.

Directory of Open Access Journals (Sweden)

Xiakun Chu

2014-08-01

Full Text Available Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less flexibility leads to weaker (stronger coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.

Electric moments in molecule interferometry

International Nuclear Information System (INIS)

Eibenberger, Sandra; Gerlich, Stefan; Arndt, Markus; Tuexen, Jens; Mayor, Marcel

2011-01-01

We investigate the influence of different electric moments on the shift and dephasing of molecules in a matter wave interferometer. Firstly, we provide a quantitative comparison of two molecules that are non-polar yet polarizable in their thermal ground state and that differ in their stiffness and response to thermal excitations. While C 25 H 20 is rather rigid, its larger derivative C 49 H 16 F 52 is additionally equipped with floppy side chains and vibrationally activated dipole moment variations. Secondly, we elucidate the role of a permanent electric dipole momentby contrasting the quantum interference pattern of a (nearly) non-polar and a polar porphyrin derivative. We find that a high molecular polarizability and even sizeable dipole moment fluctuations are still well compatible with high-contrast quantum interference fringes. The presence of permanent electric dipole moments, however, can lead to a dephasing and rapid degradation of the quantum fringe pattern already at moderate electric fields. This finding is of high relevance for coherence experiments with large organic molecules, which are generally equipped with strong electric moments.

Apoptosis following interleukin-2 withdrawal from T cells: evidence for a regulatory role of CD18 (beta 2-integrin) molecules

DEFF Research Database (Denmark)

Röpke, C; Gladstone, P; Nielsen, M

1996-01-01

, these findings suggest that CD18 molecules (beta 2-integrins) play a regulatory role in the apoptotic response following cytokine withdrawal, and that the regulation is mediated, at least partly, through T-T cell interactions. Thus, apoptotic death following IL-2 deprivation appears to be under "social" control...... activated T cells. Thus, removal of IL-2 from proliferating T cells not only induces growth arrest, but triggers a massive cell death due to apoptosis. While the apoptotic response involves a series of well-described events, it remains less clear how apoptosis is regulated following IL-2 withdrawal. Here...... molecules (CD28, CD29, CD49d, CD80, CD86) did not. Secondly, IL-2 withdrawal resulted in a retarded apoptotic response in LFA-1 (CD11a/CD18) negative T cells obtained from a leukocyte adhesion deficiency (LAD) patient, as compared to LFA-1 positive T cell lines. Thirdly, co-culture of LFA-1 positive...

Are building users prepared for energy flexible buildings?—A large-scale survey in the Netherlands

NARCIS (Netherlands)

Li, Rongling; Dane, G.Z.; Finck, C.J.; Zeiler, W.

2017-01-01

Building energy flexibility might play a crucial role in demand side management for integrating intermittent renewables into smart grids. The potential of building energy flexibility depends not only on the physical characteristics of a building but also on occupant behaviour in the building.

Inkjet-Printed Small-Molecule Organic Light-Emitting Diodes: Halogen-Free Inks, Printing Optimization, and Large-Area Patterning.

Science.gov (United States)

Zhou, Lu; Yang, Lei; Yu, Mengjie; Jiang, Yi; Liu, Cheng-Fang; Lai, Wen-Yong; Huang, Wei

2017-11-22

Manufacturing small-molecule organic light-emitting diodes (OLEDs) via inkjet printing is rather attractive for realizing high-efficiency and long-life-span devices, yet it is challenging. In this paper, we present our efforts on systematical investigation and optimization of the ink properties and the printing process to enable facile inkjet printing of conjugated light-emitting small molecules. Various factors on influencing the inkjet-printed film quality during the droplet generation, the ink spreading on the substrates, and its solidification processes have been systematically investigated and optimized. Consequently, halogen-free inks have been developed and large-area patterning inkjet printing on flexible substrates with efficient blue emission has been successfully demonstrated. Moreover, OLEDs manufactured by inkjet printing the light-emitting small molecules manifested superior performance as compared with their corresponding spin-cast counterparts.

Global Sourcing Flexibility

DEFF Research Database (Denmark)

Ørberg Jensen, Peter D.; Petersen, Bent

2013-01-01

the higher costs (but decreased risk for value chain disruption) embedded in a more flexible global sourcing model that allows the firm to replicate and/or relocate activities across multiple locations. We develop a model and propositions on facilitating and constraining conditions of global sourcing...... sourcing flexibility. Here we draw on prior research in the fields of organizational flexibility, international business and global sourcing as well as case examples and secondary studies. In the second part of the paper, we discuss the implications of global sourcing flexibility for firm strategy...... and operations against the backdrop of the theory-based definition of the construct. We discuss in particular the importance of global sourcing flexibility for operational performance stability, and the trade-off between specialization benefits, emerging from location and service provider specialization, versus...

Flexible anodized aluminum oxide membranes with customizable back contact materials.

Science.gov (United States)

Nadimpally, B; Jarro, C A; Mangu, R; Rajaputra, S; Singh, V P

2016-12-16

Anodized aluminum oxide (AAO) membranes were fabricated using flexible substrate/carrier material. This method facilitates the use of AAO templates with many different materials as substrates that are otherwise incompatible with most anodization techniques. Thin titanium (Ti) and tungsten (W) layers were employed as interlayer materials. Titanium enhances adhesion. Tungsten not only helps eliminate the barrier layer but also plays a critical role in enabling the use of flexible substrates. The resulting flexible templates provide new, exciting opportunities in photovoltaic and other device applications. CuInSe 2 nanowires were electrochemically deposited into porous AAO templates with molybdenum (Mo) as the back contact material. The feasibility of using any material to form a contact with semiconductor nanowires has been demonstrated for the first time enabling new avenues in photovoltaic applications.

Flexible anodized aluminum oxide membranes with customizable back contact materials

Science.gov (United States)

Nadimpally, B.; Jarro, C. A.; Mangu, R.; Rajaputra, S.; Singh, V. P.

2016-12-01

Anodized aluminum oxide (AAO) membranes were fabricated using flexible substrate/carrier material. This method facilitates the use of AAO templates with many different materials as substrates that are otherwise incompatible with most anodization techniques. Thin titanium (Ti) and tungsten (W) layers were employed as interlayer materials. Titanium enhances adhesion. Tungsten not only helps eliminate the barrier layer but also plays a critical role in enabling the use of flexible substrates. The resulting flexible templates provide new, exciting opportunities in photovoltaic and other device applications. CuInSe2 nanowires were electrochemically deposited into porous AAO templates with molybdenum (Mo) as the back contact material. The feasibility of using any material to form a contact with semiconductor nanowires has been demonstrated for the first time enabling new avenues in photovoltaic applications.

Small molecules make big differences: molecular doping effects on electronic and optical properties of phosphorene

International Nuclear Information System (INIS)

Jing, Yu; Tang, Qing; He, Peng; Zhou, Zhen; Shen, Panwen

2015-01-01

Systematical computations on the density functional theory were performed to investigate the adsorption of three typical organic molecules, tetracyanoquinodimethane (TCNQ), tetracyanoethylene (TCNE) and tetrathiafulvalene (TTF), on the surface of phosphorene monolayers and thicker layers. There exist considerable charge transfer and strong non-covalent interaction between these molecules and phosphorene. In particular, the band gap of phosphorene decreases dramatically due to the molecular modification and can be further tuned by applying an external electric field. Meanwhile, surface molecular modification has proven to be an effective way to enhance the light harvesting of phosphorene in different directions. Our results predict a flexible method toward modulating the electronic and optical properties of phosphorene and shed light on its experimental applications. (paper)

An integrated approach of network-based systems biology, molecular docking, and molecular dynamics approach to unravel the role of existing antiviral molecules against AIDS-associated cancer.

Science.gov (United States)

Omer, Ankur; Singh, Poonam

2017-05-01

A serious challenge in cancer treatment is to reposition the activity of various already known drug candidates against cancer. There is a need to rewrite and systematically analyze the detailed mechanistic aspect of cellular networks to gain insight into the novel role played by various molecules. Most Human Immunodeficiency Virus infection-associated cancers are caused by oncogenic viruses like Human Papilloma Viruses and Epstein-Bar Virus. As the onset of AIDS-associated cancers marks the severity of AIDS, there might be possible interconnections between the targets and mechanism of both the diseases. We have explored the possibility of certain antiviral compounds to act against major AIDS-associated cancers: Kaposi's Sarcoma, Non-Hodgkin Lymphoma, and Cervical Cancer with the help of systems pharmacology approach that includes screening for targets and molecules through the construction of a series of drug-target and drug-target-diseases network. Two molecules (Calanolide A and Chaetochromin B) and the target "HRAS" were finally screened with the help of molecular docking and molecular dynamics simulation. The results provide novel antiviral molecules against HRAS target to treat AIDS defining cancers and an insight for understanding the pharmacological, therapeutic aspects of similar unexplored molecules against various cancers.

New Roles Assigned to the α1–β1 (and α2–β2 Interface of the Human Hemoglobin Molecule from Physiological to Cellular

Directory of Open Access Journals (Sweden)

Yoshiaki Sugawara

2011-11-01

Full Text Available Cellular life is reliant upon rapid and efficient responses to internal and external conditions. The basic molecular events associated with these processes are the structural transitions of the proteins (structural protein allostery involved. From this view, the human hemoglobin (Hb molecule (α2β2 holds a special position in this field. Hb has two types of αβ interface (i.e., α1β1 [and α2β2] and α1β2 [and α2β1]. The latter α1–β2 (and α2–β1 interface is known to be associated with cooperative O2 binding, and exhibits principal roles if the molecule goes from its deoxy to oxy quaternary structure. However, the role of the former α1–β1 (and α2–β2 interface has been unclear for a long time. In this regard, important and intriguing observations have been accumulating. A new role was attributed first as stabilizing the HbO2 tetramer against acidic autoxidation. That is, the α1–β1 (and α2–β2 interface produces a conformational constraint in the β chain whereby the distal (E7 histidine (His residue is tilted slightly away from the bound O2 so as to prevent proton-catalyzed displacement of O2– by a solvent water molecule. The β chains thus acquire pH-dependent delayed autoxidation in the HbO2 tetramer. The next role was suggested by our studies searching for similar phenomena in normal human erythrocytes under mild heating. Tilting of the distal (E7 His in turn triggered degradation of the Hb molecule to hemichrome, and subsequent clustering of Heinz bodies within the erythrocyte. As Heinz body-containing red cells become trapped in the spleen, it was demonstrated that the α1–β1 (and α2–β2 interface may exert delicate control of the fate (removal of its own erythrocyte. Herein we review and summarize the related results and current interpretation of the oxidative behavior of human Hb, emphasizing the correlation between hemichrome emergence and Heinz-body formation, and specifically discuss the new roles

Dynamic simulations of single-molecule enzyme networks

NARCIS (Netherlands)

Armbruster, H.D.; Nagy, J.D.; Rijt, van de E.A.F.; Rooda, J.E.

2009-01-01

Along with the growth of technologies allowing accurate visualization of biochemical reactions to the scale of individual molecules has arisen an appreciation of the role of statistical fluctuations in intracellular biochemistry. The stochastic nature of metabolism can no longer be ignored. It can

Aggregation of flexible polyelectrolytes: Phase diagram and dynamics.

Science.gov (United States)

Tom, Anvy Moly; Rajesh, R; Vemparala, Satyavani

2017-10-14

Similarly charged polymers in solution, known as polyelectrolytes, are known to form aggregated structures in the presence of oppositely charged counterions. Understanding the dependence of the equilibrium phases and the dynamics of the process of aggregation on parameters such as backbone flexibility and charge density of such polymers is crucial for insights into various biological processes which involve biological polyelectrolytes such as protein, DNA, etc. Here, we use large-scale coarse-grained molecular dynamics simulations to obtain the phase diagram of the aggregated structures of flexible charged polymers and characterize the morphology of the aggregates as well as the aggregation dynamics, in the presence of trivalent counterions. Three different phases are observed depending on the charge density: no aggregation, a finite bundle phase where multiple small aggregates coexist with a large aggregate and a fully phase separated phase. We show that the flexibility of the polymer backbone causes strong entanglement between charged polymers leading to additional time scales in the aggregation process. Such slowing down of the aggregation dynamics results in the exponent, characterizing the power law decay of the number of aggregates with time, to be dependent on the charge density of the polymers. These results are contrary to those obtained for rigid polyelectrolytes, emphasizing the role of backbone flexibility.

Detecting high-density ultracold molecules using atom–molecule collision

International Nuclear Information System (INIS)

Chen, Jun-Ren; Kao, Cheng-Yang; Chen, Hung-Bin; Liu, Yi-Wei

2013-01-01

Utilizing single-photon photoassociation, we have achieved ultracold rubidium molecules with a high number density that provides a new efficient approach toward molecular quantum degeneracy. A new detection mechanism for ultracold molecules utilizing inelastic atom–molecule collision is demonstrated. The resonant coupling effect on the formation of the X 1 Σ + g ground state 85 Rb 2 allows for a sufficient number of more deeply bound ultracold molecules, which induced an additional trap loss and heating of the co-existing atoms owing to the inelastic atom–molecule collision. Therefore, after the photoassociation process, the ultracold molecules can be investigated using the absorption image of the ultracold rubidium atoms mixed with the molecules in a crossed optical dipole trap. The existence of the ultracold molecules was then verified, and the amount of accumulated molecules was measured. This method detects the final produced ultracold molecules, and hence is distinct from the conventional trap loss experiment, which is used to study the association resonance. It is composed of measurements of the time evolution of an atomic cloud and a decay model, by which the number density of the ultracold 85 Rb 2 molecules in the optical trap was estimated to be >5.2 × 10 11 cm −3 . (paper)

Engineered jadomycin analogues with altered sugar moieties revealing JadS as a substrate flexible O-glycosyltransferase.

Science.gov (United States)

Li, Liyuan; Pan, Guohui; Zhu, Xifen; Fan, Keqiang; Gao, Wubin; Ai, Guomin; Ren, Jinwei; Shi, Mingxin; Olano, Carlos; Salas, José A; Yang, Keqian

2017-07-01

Glycosyltransferases (GTs)-mediated glycodiversification studies have drawn significant attention recently, with the goal of generating bioactive compounds with improved pharmacological properties by diversifying the appended sugars. The key to achieving glycodiversification is to identify natural and/or engineered flexible GTs capable of acting upon a broad range of substrates. Here, we report the use of a combinatorial biosynthetic approach to probe the substrate flexibility of JadS, the GT in jadomycin biosynthesis, towards different non-native NDP-sugar substrates, enabling us to identify six jadomycin B analogues with different sugar moieties. Further structural engineering by precursor-directed biosynthesis allowed us to obtain 11 new jadomycin analogues. Our results for the first time show that JadS is a flexible O-GT that can utilize both L- and D- sugars as donor substrates, and tolerate structural changes at the C2, C4 and C6 positions of the sugar moiety. JadS may be further exploited to generate novel glycosylated jadomycin molecules in future glycodiversification studies.

Conflicting flexibility

NARCIS (Netherlands)

De Jong, P.; Schaap, A.

2011-01-01

New buildings are designed for first users. For a sustainable approach there are many advantages in designing in flexibility and adjustability in order to enable and facilitate the other sequential users. For the first investor this flexibility is translated into improved exit values due to

The Role of Cognitive Flexibility in the Spatial Representation of Children's Drawings

Science.gov (United States)

Ebersbach, Mirjam; Hagedorn, Helena

2011-01-01

Representing the spatial appearance of objects and scenes in drawings is a difficult task for young children in particular. In the present study, the relationship between spatial drawing and cognitive flexibility was investigated. Seven- to 11-year-olds (N = 60) were asked to copy a three-dimensional model in a drawing. The use of depth cues as an…

Single-molecule magnets on a polymeric thin film as magnetic quantum bits

Science.gov (United States)

Ruiz-Molina, Daniel; Gomez, Jordi; Mas-Torrent, Marta; Balana, Ana Isabel; Domingo, Nues; Tejada, Javier; Martinez, Maria Teresa; Rovira, Concepcio; Veciana, Jaume

2003-04-01

Single-molecule magnets (SMM) have a large-spin ground state with appreciable magnetic anisotropy, resulting in a barrier for the spin reversal As a consequence, interesting magnetic properties such as out-of-phase ac magnetic susceptibility signals and stepwise magnetization hysteresis loops are observed. In addition to resonant magnetization tunnelling, during the last few years several other interesting phenomena have also been reported. The origin of the slow magnetization relaxation rates as well as of other phenomena are due to individual molecules rather than to long-range ordering; as confirmed by magnetization relaxation and heat capacity studies. Therefore, SMM represent nanoscale magnetic particles of a sharply defined size that offer the potential access to the ultimate high-density information storage devices as well as for quantum computing applications. However, if a truly molecular computational device based on SMM is to be achieved, new systematic studies that allow us to find a proper way to address properly oriented individual molecules or molecular aggregates onto the surface of a thin film, where each molecule or molecular aggregate can be used as a bit of information, are highly required. Here we report a new soft, reliable and simple methodology to address individual Mn12 molecules onto a film surface, as revealed by Atomic Force Microscopy (AFM) and Magnetic Force Microscopy (MFM) images. Moreover, the advantageous properties of polymeric matrices, such as flexibility, transparency and low density, make this type of materials very interesting for potential applications.

Inter-vertebral flexibility of the ostrich neck: implications for estimating sauropod neck flexibility.

Science.gov (United States)

Cobley, Matthew J; Rayfield, Emily J; Barrett, Paul M

2013-01-01

The flexibility and posture of the neck in sauropod dinosaurs has long been contentious. Improved constraints on sauropod neck function will have major implications for what we know of their foraging strategies, ecology and overall biology. Several hypotheses have been proposed, based primarily on osteological data, suggesting different degrees of neck flexibility. This study attempts to assess the effects of reconstructed soft tissues on sauropod neck flexibility through systematic removal of muscle groups and measures of flexibility of the neck in a living analogue, the ostrich (Struthio camelus). The possible effect of cartilage on flexibility is also examined, as this was previously overlooked in osteological estimates of sauropod neck function. These comparisons show that soft tissues are likely to have limited the flexibility of the neck beyond the limits suggested by osteology alone. In addition, the inferred presence of cartilage, and varying the inter-vertebral spacing within the synovial capsule, also affect neck flexibility. One hypothesis proposed that flexibility is constrained by requiring a minimum overlap between successive zygapophyses equivalent to 50% of zygapophyseal articular surface length (ONP50). This assumption is tested by comparing the maximum flexibility of the articulated cervical column in ONP50 and the flexibility of the complete neck with all tissues intact. It is found that this model does not adequately convey the pattern of flexibility in the ostrich neck, suggesting that the ONP50 model may not be useful in determining neck function if considered in isolation from myological and other soft tissue data.

Inter-vertebral flexibility of the ostrich neck: implications for estimating sauropod neck flexibility.

Directory of Open Access Journals (Sweden)

Matthew J Cobley

Full Text Available The flexibility and posture of the neck in sauropod dinosaurs has long been contentious. Improved constraints on sauropod neck function will have major implications for what we know of their foraging strategies, ecology and overall biology. Several hypotheses have been proposed, based primarily on osteological data, suggesting different degrees of neck flexibility. This study attempts to assess the effects of reconstructed soft tissues on sauropod neck flexibility through systematic removal of muscle groups and measures of flexibility of the neck in a living analogue, the ostrich (Struthio camelus. The possible effect of cartilage on flexibility is also examined, as this was previously overlooked in osteological estimates of sauropod neck function. These comparisons show that soft tissues are likely to have limited the flexibility of the neck beyond the limits suggested by osteology alone. In addition, the inferred presence of cartilage, and varying the inter-vertebral spacing within the synovial capsule, also affect neck flexibility. One hypothesis proposed that flexibility is constrained by requiring a minimum overlap between successive zygapophyses equivalent to 50% of zygapophyseal articular surface length (ONP50. This assumption is tested by comparing the maximum flexibility of the articulated cervical column in ONP50 and the flexibility of the complete neck with all tissues intact. It is found that this model does not adequately convey the pattern of flexibility in the ostrich neck, suggesting that the ONP50 model may not be useful in determining neck function if considered in isolation from myological and other soft tissue data.

Flexibility in radiation protection legislation

International Nuclear Information System (INIS)

Beaver, P.F.; Gill, J.R.

1980-01-01

The UK approach to radiation protection legislation is described in detail. The advantages are outlined of a flexible approach whereby the objectives of the legislation are clearly identified but the means of achieving these are left open or qualified by terms such as 'where reasonably practicable'. The roles and viewpoints of management and unions in such an approach are discussed especially with respect to legislation such as the Health and Safety at Work Act. Specific topics include requirements for notification of use, criteria for controlled areas and the tasks of the radiation protection adviser. (UK)

Kidney injury molecule-1 in renal disease

NARCIS (Netherlands)

Waanders, Femke; van Timmeren, Mirjan M.; Stegeman, Coen A.; Bakker, Stephan J. L.; van Goor, Harry

Kidney injury molecule-1 (KIM-1) is a marker for renal proximal tubular damage, the hallmark of virtually all proteinuric, toxic and ischaemic kidney diseases. KIM-1 has gained increasing interest because of its possible pathophysiological role in modulating tubular damage and repair. In this

Flexible work arrangements, job satisfaction, and turnover intentions: the mediating role of work-to-family enrichment.

Science.gov (United States)

McNall, Laurel A; Masuda, Aline D; Nicklin, Jessica M

2010-01-01

The authors examined the relation between the availability of 2 popular types of flexible work arrangements (i.e., flextime and compressed workweek) and work-to-family enrichment and, in turn, the relation between work-to-family enrichment and (a) job satisfaction and (b) turnover intentions. In a sample of 220 employed working adults, hierarchical regression analyses showed that work-to-family enrichment mediated the relation between flexible work arrangements and both job satisfaction and turnover intentions, even after controlling for gender, age, marital status, education, number of children, and hours worked. Thus, the availability of flexible work arrangements such as flextime and compressed workweek seems to help employees experience greater enrichment from work to home, which, in turn, is associated with higher job satisfaction and lower turnover intentions. The authors discuss the implications for research and practice.

The formation of carbon chain molecules in IRC + 10216

International Nuclear Information System (INIS)

Howe, D.A.; Millar, T.J.

1990-01-01

This paper considers the formation of carbon-chain molecules, including C 2n H, C n S, HC 2n+1 N (n = 1-3) and SiC n (n = 1-4), in the outflowing envelope of the late-type carbon star IRC + 10216. The results suggest that the organo-sulphur species C 2 S and C 3 S can be formed in ion-molecule reactions involving acetylene ions and parent CS and SiS molecules. In addition to ion-molecule processes, neutral-neutral reactions can play a significant role in the formation of hydrocarbons and cyanopolyynes with up to six heavy atoms and in the formation of SiC 4 , and suggest that SiC 3 might be observable. However, the short time-scales available in the outflow are such that the observed abundances of the cyanopolyynes larger than HC 5 N cannot be reproduced using the parent molecules and abundances adopted here. (author)

The effect of chordwise flexibility on flapping foil propulsion in quiescent fluid

Science.gov (United States)

Shinde, Sachin; Arakeri, Jaywant

2010-11-01

Motivated to understand the role of wing flexibility of flying creatures during hovering, we experimentally study the effect of chordwise flexibility on the flow generated in quiescent fluid by a sinusoidally pitching rigid symmetrical foil with a flexible flap attached at the trailing edge. This foil produces a narrow, coherent jet containing reverse Karman vortex street, and a corresponding thrust. The thrust and flow is similar to that produced by a hovering bird or insect, however the mechanism seems to be different from known hovering mechanisms. Novelty of the present hovering mechanism is that the thrust generation is due to the coordinated pushing action of rigid foil and flexible flap. We identify the flow and vortex generation mechanism. This foil produces jet flows over a range of flapping frequencies and amplitudes. In contrast, the foil without flap i.e. with rigid trailing edge produces a weak, divergent jet that meanders randomly. Appending a flexible flap to the foil suppresses jet-meandering and strengthens the jet. Flexibility of flap is crucial in determining the flow structure. This study is useful in designing MAVs and thrusters.

Ultraviolet photodetection of flexible ZnO nanowire sheets in polydimethylsiloxane polymer.

Science.gov (United States)

Liu, Jinzhang; Motta, Nunzio; Lee, Soonil

2012-01-01

ZnO nanowires are normally exposed to an oxygen atmosphere to achieve high performance in UV photodetection. In this work we present results on a UV photodetector fabricated using a flexible ZnO nanowire sheet embedded in polydimethylsiloxane (PDMS), a gas-permeable polymer, showing reproducible UV photoresponse and enhanced photoconduction. PDMS coating results in a reduced response speed compared to that of a ZnO nanowire film in air. The rising speed is slightly reduced, while the decay time is prolonged by about a factor of four. We conclude that oxygen molecules diffusing in PDMS are responsible for the UV photoresponse.

Stochastic Dynamics Underlying Cognitive Stability and Flexibility.

Directory of Open Access Journals (Sweden)

Kai Ueltzhöffer

2015-06-01

Full Text Available Cognitive stability and flexibility are core functions in the successful pursuit of behavioral goals. While there is evidence for a common frontoparietal network underlying both functions and for a key role of dopamine in the modulation of flexible versus stable behavior, the exact neurocomputational mechanisms underlying those executive functions and their adaptation to environmental demands are still unclear. In this work we study the neurocomputational mechanisms underlying cue based task switching (flexibility and distractor inhibition (stability in a paradigm specifically designed to probe both functions. We develop a physiologically plausible, explicit model of neural networks that maintain the currently active task rule in working memory and implement the decision process. We simplify the four-choice decision network to a nonlinear drift-diffusion process that we canonically derive from a generic winner-take-all network model. By fitting our model to the behavioral data of individual subjects, we can reproduce their full behavior in terms of decisions and reaction time distributions in baseline as well as distractor inhibition and switch conditions. Furthermore, we predict the individual hemodynamic response timecourse of the rule-representing network and localize it to a frontoparietal network including the inferior frontal junction area and the intraparietal sulcus, using functional magnetic resonance imaging. This refines the understanding of task-switch-related frontoparietal brain activity as reflecting attractor-like working memory representations of task rules. Finally, we estimate the subject-specific stability of the rule-representing attractor states in terms of the minimal action associated with a transition between different rule states in the phase-space of the fitted models. This stability measure correlates with switching-specific thalamocorticostriatal activation, i.e., with a system associated with flexible working memory

Flexible Carbon Aerogels

Directory of Open Access Journals (Sweden)

Marina Schwan

2016-09-01

Full Text Available Carbon aerogels are highly porous materials with a large inner surface area. Due to their high electrical conductivity they are excellent electrode materials in supercapacitors. Their brittleness, however, imposes certain limitations in terms of applicability. In that context, novel carbon aerogels with varying degree of flexibility have been developed. These highly porous, light aerogels are characterized by a high surface area and possess pore structures in the micrometer range, allowing for a reversible deformation of the aerogel network. A high ratio of pore size to particle size was found to be crucial for high flexibility. For dynamic microstructural analysis, compression tests were performed in-situ within a scanning electron microscope allowing us to directly visualize the microstructural flexibility of an aerogel. The flexible carbon aerogels were found to withstand between 15% and 30% of uniaxial compression in a reversible fashion. These findings might stimulate further research and new application fields directed towards flexible supercapacitors and batteries.

Versatile single-molecule multi-color excitation and detection fluorescence setup for studying biomolecular dynamics

KAUST Repository

Sobhy, M. A.

2011-11-07

Single-molecule fluorescence imaging is at the forefront of tools applied to study biomolecular dynamics both in vitro and in vivo. The ability of the single-molecule fluorescence microscope to conduct simultaneous multi-color excitation and detection is a key experimental feature that is under continuous development. In this paper, we describe in detail the design and the construction of a sophisticated and versatile multi-color excitation and emission fluorescence instrument for studying biomolecular dynamics at the single-molecule level. The setup is novel, economical and compact, where two inverted microscopes share a laser combiner module with six individual laser sources that extend from 400 to 640 nm. Nonetheless, each microscope can independently and in a flexible manner select the combinations, sequences, and intensities of the excitation wavelengths. This high flexibility is achieved by the replacement of conventional mechanical shutters with acousto-optic tunable filter (AOTF). The use of AOTF provides major advancement by controlling the intensities, duration, and selection of up to eight different wavelengths with microsecond alternation time in a transparent and easy manner for the end user. To our knowledge this is the first time AOTF is applied to wide-field total internal reflection fluorescence (TIRF) microscopy even though it has been commonly used in multi-wavelength confocal microscopy. The laser outputs from the combiner module are coupled to the microscopes by two sets of four single-mode optic fibers in order to allow for the optimization of the TIRF angle for each wavelength independently. The emission is split into two or four spectral channels to allow for the simultaneous detection of up to four different fluorophores of wide selection and using many possible excitation and photoactivation schemes. We demonstrate the performance of this new setup by conducting two-color alternating excitation single-molecule fluorescence resonance energy

Role of ICAM-1 polymorphisms (G241R, K469E) in mediating its single-molecule binding ability: Atomic force microscopy measurements on living cells

Energy Technology Data Exchange (ETDEWEB)

Bai, Rui [Chinese (301) General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China); Yi, Shaoqiong [Beijing Institute of Biotechnology, 20 Dongdajie, Fengtai, Beijing 100071 (China); Zhang, Xuejie [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China); Liu, Huiliang, E-mail: lhl518@vip.sina.com [Department of Cardiology, The General Hospital of Chinese People’s Armed Police Forces, Beijing 100039 (China); Fang, Xiaohong, E-mail: xfang@iccas.ac.cn [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China)

2014-06-13

Highlights: • We evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations. • AFM was used to measure single-molecule binding ability on living cells. • The SNP of ICAM-1 may induce changes in expressions rather than single-molecule binding ability. - Abstract: Atherosclerosis (As) is characterized by chronic inflammation and is a major cause of human mortality. ICAM-1-mediated adhesion of leukocytes in vessel walls plays an important role in the pathogenesis of atherosclerosis. Two single nucleotide polymorphisms (SNPs) of human intercellular adhesion molecule-1 (ICAM-1), G241R and K469E, are associated with a number of inflammatory diseases. SNP induced changes in ICAM-1 function rely not only on the expression level but also on the single-molecule binding ability which may be affected by single molecule conformation variations such as protein splicing and folding. Previous studies have shown associations between G241R/K469E polymorphisms and ICAM-1 gene expression. Nevertheless, few studies have been done that focus on the single-molecule forces of the above SNPs and their ligands. In the current study, we evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations – GK (G241/K469), GE (G241/E469), RK (R241/K469) and RE (R241/E469). No difference in adhesion ability was observed via cell adhesion assay or atomic force microscopy (AFM) measurement when comparing the GK, GE, RK, or RE genotypes of ICAM-1 to each other. On the other hand, flow cytometry suggested that there was significantly higher expression of GE genotype of ICAM-1 on transfected CHO cells. Thus, we concluded that genetic susceptibility to diseases related to ICAM-1 polymorphisms, G241R or K469E, might be due to the different expressions of ICAM-1 variants rather than to the single-molecule binding ability of ICAM-1.

Reversibly Bistable Flexible Electronics

KAUST Repository

Alfaraj, Nasir

2015-05-01

Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

Constructive episodic simulation, flexible recombination, and memory errors.

Science.gov (United States)

Schacter, Daniel L; Carpenter, Alexis C; Devitt, Aleea; Roberts, Reece P; Addis, Donna Rose

2018-01-01

According to Mahr & Csibra (M&C), the view that the constructive nature of episodic memory is related to its role in simulating future events has difficulty explaining why memory is often accurate. We hold this view, but disagree with their conclusion. Here we consider ideas and evidence regarding flexible recombination processes in episodic retrieval that accommodate both accuracy and distortion.

Neural Correlates of Attentional Flexibility during Approach and Avoidance Motivation

Science.gov (United States)

Calcott, Rebecca D.; Berkman, Elliot T.

2015-01-01

Dynamic, momentary approach or avoidance motivational states have downstream effects on eventual goal success and overall well being, but there is still uncertainty about how those states affect the proximal neurocognitive processes (e.g., attention) that mediate the longer-term effects. Attentional flexibility, or the ability to switch between different attentional foci, is one such neurocognitive process that influences outcomes in the long run. The present study examined how approach and avoidance motivational states affect the neural processes involved in attentional flexibility using fMRI with the aim of determining whether flexibility operates via different neural mechanisms under these different states. Attentional flexibility was operationalized as subjects’ ability to switch between global and local stimulus features. In addition to subjects’ motivational state, the task context was manipulated by varying the ratio of global to local trials in a block in light of recent findings about the moderating role of context on motivation-related differences in attentional flexibility. The neural processes involved in attentional flexibility differ under approach versus avoidance states. First, differences in the preparatory activity in key brain regions suggested that subjects’ preparedness to switch was influenced by motivational state (anterior insula) and the interaction between motivation and context (superior temporal gyrus, inferior parietal lobule). Additionally, we observed motivation-related differences the anterior cingulate cortex during switching. These results provide initial evidence that motivation-induced behavioral changes may arise via different mechanisms in approach versus avoidance motivational states. PMID:26000735

Growing interstellar molecules with ion-molecule reactions

International Nuclear Information System (INIS)

Bohme, D.K.

1989-01-01

Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

Flexible MEMS: A novel technology to fabricate flexible sensors and electronics

Science.gov (United States)

Tu, Hongen

This dissertation presents the design and fabrication techniques used to fabricate flexible MEMS (Micro Electro Mechanical Systems) devices. MEMS devices and CMOS(Complementary Metal-Oxide-Semiconductor) circuits are traditionally fabricated on rigid substrates with inorganic semiconductor materials such as Silicon. However, it is highly desirable that functional elements like sensors, actuators or micro fluidic components to be fabricated on flexible substrates for a wide variety of applications. Due to the fact that flexible substrate is temperature sensitive, typically only low temperature materials, such as polymers, metals, and organic semiconductor materials, can be directly fabricated on flexible substrates. A novel technology based on XeF2(xenon difluoride) isotropic silicon etching and parylene conformal coating, which is able to monolithically incorporate high temperature materials and fluidic channels, was developed at Wayne State University. The technology was first implemented in the development of out-of-plane parylene microneedle arrays that can be individually addressed by integrated flexible micro-channels. These devices enable the delivery of chemicals with controlled temporal and spatial patterns and allow us to study neurotransmitter-based retinal prosthesis. The technology was further explored by adopting the conventional SOI-CMOS processes. High performance and high density CMOS circuits can be first fabricated on SOI wafers, and then be integrated into flexible substrates. Flexible p-channel MOSFETs (Metal-Oxide-Semiconductor Field-Effect-Transistors) were successfully integrated and tested. Integration of pressure sensors and flow sensors based on single crystal silicon has also been demonstrated. A novel smart yarn technology that enables the invisible integration of sensors and electronics into fabrics has been developed. The most significant advantage of this technology is its post-MEMS and post-CMOS compatibility. Various high

Can goal-free problems facilitating students' flexible thinking?

Science.gov (United States)

Maulidya, Sity Rahmy; Hasanah, Rusi Ulfa; Retnowati, Endah

2017-08-01

Problem solving is the key of doing and also learning mathematics. It takes also the fundamental role of developing mathematical knowledge. Responding to the current reform movement in mathematics, students are expected to learn to be a flexible thinker. The ability to think flexible is challenged by the globalisation, hence influence mathematics education. A flexible thinking includes ability to apply knowledge in different contexts rather than simply use it in similar context when it is studied. Arguably problem solving activities can contribute to the development of the ability to apply skills to unfamiliar situations. Accordingly, an appropriate classroom instructional strategy must be developed. A cognitive load theory suggests that by reducing extraneous cognitive load during learning could enhance transfer learning. A goal-free problem strategy that is developed based in cognitive load theory have been showed to be effective for transfer learning. This strategy enables students to learn a large numbers of problem solving moves from a mathematics problem. The instruction in a goal-free problem directs students to `calculate as many solution as you can' rather than to calculate a single given goal. Many experiment research evident goal-free problem enhance learning. This literature review will discuss evidence goal-free problem facilitate students to solve problems flexibly and thus enhance their problem solving skills, including how its implication in the classroom.

Emmprin (basigin/CD147): matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression.

Science.gov (United States)

Nabeshima, Kazuki; Iwasaki, Hiroshi; Koga, Kaori; Hojo, Hironobu; Suzumiya, Junji; Kikuchi, Masahiro

2006-07-01

Emmprin (basigin, CD147) is a cell surface glycoprotein that belongs to the immunoglobulin superfamily. It is highly expressed on the surface of tumor cells and stimulates adjacent fibroblasts or tumor cells to produce matrix metalloproteinases. Moreover, it has recently been shown that emmprin also stimulates expression of vascular endothelial growth factor and hyaluronan, which leads to angiogenesis and anchorage-independent growth/multidrug resistance, respectively. These findings have made emmprin an important molecule in tumor progression and, thus, more attractive as a target for antitumor treatment. However, other functions of emmprin, including as an activator of T cells, a chaperone for monocarboxylate transporters, a receptor for cyclophilin A and a neural recognition molecule, are also being identified in physiological and pathological conditions. Therefore, it is essential to develop specific means to control particular functions of emmprin, for which elucidation of each mechanism is crucial. This review will discuss the role of emmprin in tumor progression and recent advances in the molecular mechanisms of diverse phenomena regulated by emmprin.

Optimized circuit design for flexible 8-bit RFID transponders with active layer of ink-jet printed small molecule semiconductors

NARCIS (Netherlands)

Kjellander, B.K.C.; Smaal, W.T.T.; Myny, K.; Genoe, J.; Dehaene, W.; Heremans, P.; Gelinck, G.H.

2013-01-01

We ink-jet print a blend of 6,13-bis(triisopropyl-silylethynyl)pentacene and polystyrene as the active layer for flexible circuits. The discrete ink-jet printed transistors exhibit a saturation mobility of 0.5 cm2 V -1 s-1. The relative spread in transistor characteristics can be very large. This

Flexible Carpooling: Exploratory Study

OpenAIRE

Dorinson, Diana; Gay, Deanna; Minett, Paul; Shaheen, Susan

2009-01-01

Energy consumption could be reduced if more people shared rides rather than driving alone yet carpooling represents a small proportion of all potential carpoolers. Prior research has found that many who might carpool were concerned about reduced flexibility with carpooling. If flexibility is one of the barriers how could carpooling be organized to be more flexible? In Northern Virginia a flexible system has evolved where there are 3,500 single-use carpools per day. In another example there ...

Glycine Perturbs Local and Global Conformational Flexibility of a Transmembrane Helix

DEFF Research Database (Denmark)

Högel, Philipp; Götz, Alexander; Kuhne, Felix

2018-01-01

Flexible transmembrane helices frequently support the conformational transitions between different functional states of membrane proteins. While proline is well known to distort and destabilize transmembrane helices, the role of glycine is still debated. Here, we systematically investigated the e...

Medium-scale carbon nanotube thin-film integrated circuits on flexible plastic substrates.

Science.gov (United States)

Cao, Qing; Kim, Hoon-sik; Pimparkar, Ninad; Kulkarni, Jaydeep P; Wang, Congjun; Shim, Moonsub; Roy, Kaushik; Alam, Muhammad A; Rogers, John A

2008-07-24

The ability to form integrated circuits on flexible sheets of plastic enables attributes (for example conformal and flexible formats and lightweight and shock resistant construction) in electronic devices that are difficult or impossible to achieve with technologies that use semiconductor wafers or glass plates as substrates. Organic small-molecule and polymer-based materials represent the most widely explored types of semiconductors for such flexible circuitry. Although these materials and those that use films or nanostructures of inorganics have promise for certain applications, existing demonstrations of them in circuits on plastic indicate modest performance characteristics that might restrict the application possibilities. Here we report implementations of a comparatively high-performance carbon-based semiconductor consisting of sub-monolayer, random networks of single-walled carbon nanotubes to yield small- to medium-scale integrated digital circuits, composed of up to nearly 100 transistors on plastic substrates. Transistors in these integrated circuits have excellent properties: mobilities as high as 80 cm(2) V(-1) s(-1), subthreshold slopes as low as 140 m V dec(-1), operating voltages less than 5 V together with deterministic control over the threshold voltages, on/off ratios as high as 10(5), switching speeds in the kilohertz range even for coarse (approximately 100-microm) device geometries, and good mechanical flexibility-all with levels of uniformity and reproducibility that enable high-yield fabrication of integrated circuits. Theoretical calculations, in contexts ranging from heterogeneous percolative transport through the networks to compact models for the transistors to circuit level simulations, provide quantitative and predictive understanding of these systems. Taken together, these results suggest that sub-monolayer films of single-walled carbon nanotubes are attractive materials for flexible integrated circuits, with many potential areas of

DNA-Based Single-Molecule Electronics: From Concept to Function

Science.gov (United States)

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

DNA-Based Single-Molecule Electronics: From Concept to Function.

Science.gov (United States)

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

Chemical Principles and Interference in the Electrical Conductance of Single Molecules

DEFF Research Database (Denmark)

Borges, Anders Christian

, the conductance of molecules can vary orders of magnitude and the concept of interference is believed to play a major role in this. This thesis investigates the links between single molecule conductance, chemistry and interference effects in short organic molecules. It is investigated to which extent...... the conductance can be understood in terms of separate contributions and when the effects of interference are important. Links between chemical principles and constructive- and destructive interference effects are demonstrated using a combination of simple models, atomistic calculations and Scanning......-Tunneling Microscope Break-Junction experiments (STM-BJ). It is demonstrated that these links can be used to design molecules exhibiting surprising interference effects and to interpret and predict the trends in the characteristic conductance of single molecules without resorting to numerical computational methods...

Local Flexibility Market Design for Aggregators Providing Multiple Flexibility Services at Distribution Network Level

Directory of Open Access Journals (Sweden)

Pol Olivella-Rosell

2018-04-01

Full Text Available This paper presents a general description of local flexibility markets as a market-based management mechanism for aggregators. The high penetration of distributed energy resources introduces new flexibility services like prosumer or community self-balancing, congestion management and time-of-use optimization. This work is focused on the flexibility framework to enable multiple participants to compete for selling or buying flexibility. In this framework, the aggregator acts as a local market operator and supervises flexibility transactions of the local energy community. Local market participation is voluntary. Potential flexibility stakeholders are the distribution system operator, the balance responsible party and end-users themselves. Flexibility is sold by means of loads, generators, storage units and electric vehicles. Finally, this paper presents needed interactions between all local market stakeholders, the corresponding inputs and outputs of local market operation algorithms from participants and a case study to highlight the application of the local flexibility market in three scenarios. The local market framework could postpone grid upgrades, reduce energy costs and increase distribution grids’ hosting capacity.

[Inspecting the cochlear scala tympanic with flexible and semi-flexible micro-endoscope].

Science.gov (United States)

Zhang, Daoxcing; Zhang, Yankun

2006-02-01

Flexible and semi-flexible micro-endoscopes were used in cochlear scala tympani inspection , to explore their application in inner ear examination. Fifteen profound hearing loss patients preparing for cochlear implant were included in this study. During the operation, micro-endoscopy was performed after opening the cochlear scala tympani. And 1 mm diameter semi-flexible micro-endoscope could go as deep as 9 mm into the cochlear scala tympani, while 0. 5 mm diameter flexible micro-endoscope could go as deep as 25 mm. The inspecting results were compared with video recording. Using 0.5 mm flexible micro-endoscope, we canould check cochlear scala tympani with depth range of 15-25 mm, but the video imaging was not clear enough to examine the microstructure in the cochlear. With 1 mm diameter semi-flexible micro-endoscope, we could reach 9 mm deep into the cochlear. During the examination, we found 3 cases with calcification deposit in osseous spiral lamina, l case with granulation tissue in the lateral wall of scala tympani, no abnormal findings in the other 11 cases. Inspecting the cochlear scala tympani with 0.5 mm flexible micro-endoscope, even though we can reach the second circuit of the cochlear, it is difficult to find the pathology in the cochlear because of the poor video imaging. With 1 mm semi-flexible micro-endoscope, we can identify the microstructure of the cochlear clearly and find the pathologic changes, but the inserting depth was limited to 9 mm with limitation to examine the whole cochlear.

Flexible cultural repertoires

DEFF Research Database (Denmark)

Lindegaard, Marie Rosenkrantz; Zimmermann, Francisca

2017-01-01

Despite extensive studies of street culture and the risks of offending and victimization in urban marginalized areas, little is known about the role of cultural repertoires for variation in victimization risks among young men not involved in crime. Based on two ethnographic studies, conducted...... independently of the authors in neighbouring township areas of Cape Town, we offer insights into patterns of victimization among young men not involved in crime who live and attend school in the townships. Young men WHO perform decent cultural repertoires are highly exposed to victimization due to their moral...... rejection of crime-involved youth. Young men who perform flexible cultural repertoires, by incorporating and shifting between gang and decent repertoires, experience low victimization due to their adaptation to crime-involved youth. Findings emphasize the importance of detailed investigations of the way...

Development of Flexible Pneumatic Cylinder with Built-in Flexible Linear Encoder and Flexible Bending Sensor

Science.gov (United States)

Akagi, Tetsuya; Dohta, Shujiro; Matsushita, Hisashi; Fukuhara, Akimasa

The purpose of this study is to develop a lightweight and intelligent soft actuator which can be safely attached to the human body. A novel flexible pneumatic cylinder that can be used even if it is deformed by external force had been proposed. The cylinder can realize both pushing and pulling motions even if the cylinder bends. In this paper, a flexible pneumatic cylinder with a built-in flexible linear encoder is proposed and tested. The encoder can detect the cylinder displacement even if the cylinder bends. In the next step, to realize an intelligent flexible cylinder, it is essential to recognize the angle of deflection of the cylinder to estimate the direction of the external force. Therefore, a flexible bending sensor that can measure the directional angle by attaching it to the end of the cylinder is also proposed and tested. The tested bending sensor also consists of four inexpensive photo-reflectors set on the circumferential surface to the cylinder tube every 90 degrees from the center of the tube. By measuring the distance between the photo reflector and the surface of the tube at each point, the bending directional angle of the cylinder can be obtained. A low cost measuring system using a micro-computer incorporating a programmed Up/Down counter to measure the displacement of the cylinder is also developed. As a result, it was confirmed that the measuring accuracy of the bending directional angle was good, less than 0.7 degrees as a standard deviation.

Cycloxygenase-2(cox-2) - a potential target for screening of small molecules as radiation countermeasure agents: an in silico study

International Nuclear Information System (INIS)

Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I.; Barik, Tapan Kumar

2012-01-01

COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)

Cycloxygenase-2(cox-2) - a potential target for screening of small molecules as radiation countermeasure agents: an in silico study

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I., E-mail: prem_indra@yahoo.co.in [Radiation Biosciences Division, Institute of Nuclear Medicine and Allied Sciences, Delhi (India); Barik, Tapan Kumar [P.G. Department of Zoology, Berhampur University, Berhampur (India)

2012-07-01

COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)

Quantifying the topography of the intrinsic energy landscape of flexible biomolecular recognition

Science.gov (United States)

Chu, Xiakun; Gan, Linfeng; Wang, Erkang; Wang, Jin

2013-01-01

Biomolecular functions are determined by their interactions with other molecules. Biomolecular recognition is often flexible and associated with large conformational changes involving both binding and folding. However, the global and physical understanding for the process is still challenging. Here, we quantified the intrinsic energy landscapes of flexible biomolecular recognition in terms of binding–folding dynamics for 15 homodimers by exploring the underlying density of states, using a structure-based model both with and without considering energetic roughness. By quantifying three individual effective intrinsic energy landscapes (one for interfacial binding, two for monomeric folding), the association mechanisms for flexible recognition of 15 homodimers can be classified into two-state cooperative “coupled binding–folding” and three-state noncooperative “folding prior to binding” scenarios. We found that the association mechanism of flexible biomolecular recognition relies on the interplay between the underlying effective intrinsic binding and folding energy landscapes. By quantifying the whole global intrinsic binding–folding energy landscapes, we found strong correlations between the landscape topography measure Λ (dimensionless ratio of energy gap versus roughness modulated by the configurational entropy) and the ratio of the thermodynamic stable temperature versus trapping temperature, as well as between Λ and binding kinetics. Therefore, the global energy landscape topography determines the binding–folding thermodynamics and kinetics, crucial for the feasibility and efficiency of realizing biomolecular function. We also found “U-shape” temperature-dependent kinetic behavior and a dynamical cross-over temperature for dividing exponential and nonexponential kinetics for two-state homodimers. Our study provides a unique way to bridge the gap between theory and experiments. PMID:23754431

Towards interoperability of energy management systems using flexibility through conceptual modeling

NARCIS (Netherlands)

Rumph, F.J.; Huitema, G.B.; Verhoosel, J.

2013-01-01

Smart Grid technologies are being developed to better operate the power system and integrate larger amounts of renewable intermittent power sources and new energy efficient electrical equipment. Coordinating flexibilities in power supply and demand plays a crucial role in this development.

Electric-Field Control of Interfering Transport Pathways in a Single-Molecule Anthraquinone Transistor

NARCIS (Netherlands)

Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; van der Zant, Herre S. J.

It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the

Retail electricity price savings from compliance flexibility in GHG standards for stationary sources

International Nuclear Information System (INIS)

Burtraw, Dallas; Woerman, Matt; Paul, Anthony

2012-01-01

The EPA will issue rules regulating greenhouse gas (GHG) emissions from existing steam boilers and refineries in 2012. A crucial issue affecting the scope and cost of emissions reductions will be the potential introduction of flexibility in compliance, including averaging across groups of facilities. This research investigates the role of compliance flexibility for the most important of these source categories—existing coal-fired power plants—that currently account for one-third of national emissions of carbon dioxide, the most important greenhouse gas. We find a flexible standard, calibrated to achieve the same emissions reductions as a traditional(inflexible) approach, reduces the increase in electricity price by 60 percent and overall costs by two-thirds in 2020. The flexible standard also leads to substantially more investment to improve the operating efficiency of existing facilities, whereas the traditional standard leads to substantially greater retirement of existing facilities. - Highlights: ► The U.S. EPA will regulate GHG emissions from power plants under the Clean Air Act. ► We compare a flexible standard with fleet-wide averaging to a traditional standard. ► Flexible standard reduces the increase in electricity price by 60percent in 2020. ► Flexible standard reduces the increase in overall costs by two-thirds in 2020. ► Flexible standard leads to more efficiency investment and less capacity retirement.

Molecule nanoweaver

Science.gov (United States)

Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

2009-03-10

A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

Gas market distorting effects of imbalanced gas balancing rules: Inefficient regulation of pipeline flexibility

International Nuclear Information System (INIS)

Keyaerts, Nico; Hallack, Michelle; Glachant, Jean-Michel; D'haeseleer, William

2011-01-01

This paper analyzes the value and cost of line-pack flexibility in liberalized gas markets through examination of the techno-economic characteristics of gas transport pipelines and the trade-offs between different ways to use the infrastructure: transport and flexibility. Line-pack flexibility is becoming increasingly important as a tool to balance gas supply and demand over different periods. In the European liberalized market context, a monopolist unbundled network operator offers regulated transport services and flexibility (balancing) services according to the network code and balancing rules. Therefore, gas policy makers should understand the role and consequences of line-pack regulation. The analysis shows that the line-pack flexibility service has an important economic value for the shippers and the TSO. Furthermore, the analysis identifies distorting effects in the gas market due to inadequate regulation of line-pack flexibility: by disregarding the sunk costs of flexibility in the balancing rules, the overall efficiency of the gas system is decreased. Finally, the analysis demonstrates that the actual costs of line-pack flexibility are related to the peak cumulative imbalance throughout the balancing period. Any price for pipeline flexibility should, therefore, be based on the related trade-off between the right to use the line-pack flexibility and the provision of transport services. - Research Highlights: →Line-pack flexibility is a main gas balancing instrument. →Capacity related costs of line-pack flexibility depend on peak cumulative imbalances. →Line-pack pricing rules determine choice between ex ante and ex post balancing. →Inefficient line-pack regulation causes gas market distortions.

Psychological Flexibility as a Buffer against Caregiver Distress in Families with Psychosis

DEFF Research Database (Denmark)

Jansen, Jens E; Haahr, Ulrik H; Lyse, Hanne-Grethe

2017-01-01

involved. Recent advances in cognitive behavioral therapy seem to converge on the importance of acceptance- and mindfulness based processes. Aim: To examine the impact of psychological flexibility on caregiver distress in the early phases of psychosis, while controlling for known predictors of caregiver...... user symptoms, drug use and global functioning, psychological flexibility was a significant predictor of caregiver distress. Conclusion: Greater level of psychological flexibility in caregivers, seems to be related to lower levels of caregiver distress. This finding corresponds to studies within......Background: Research has shown that caregivers of persons with psychosis play an invaluable role in recovery, but unfortunately, often report high levels of distress. While cognitive models of caregiver distress have been well-supported, there is still limited knowledge of the psychological factors...

Flexible Word Classes

DEFF Research Database (Denmark)

• First major publication on the phenomenon • Offers cross-linguistic, descriptive, and diverse theoretical approaches • Includes analysis of data from different language families and from lesser studied languages This book is the first major cross-linguistic study of 'flexible words', i.e. words...... that cannot be classified in terms of the traditional lexical categories Verb, Noun, Adjective or Adverb. Flexible words can - without special morphosyntactic marking - serve in functions for which other languages must employ members of two or more of the four traditional, 'specialised' word classes. Thus......, flexible words are underspecified for communicative functions like 'predicating' (verbal function), 'referring' (nominal function) or 'modifying' (a function typically associated with adjectives and e.g. manner adverbs). Even though linguists have been aware of flexible world classes for more than...

The Power of Electric Vehicles - Exploring the Value of Flexible Electricity Demand in a Multi-actor Context

NARCIS (Netherlands)

Verzijlbergh, R.A.

2013-01-01

Electric vehicles (EVs) have the potential to play a crucial role in clean and intelligent power systems. The key to this potential lies in the flexibility that EVs provide by the ability to shift their electricity demand in time. This flexibility can be used to facilitate the integration of

Theoretical investigation of interaction of sorbitol molecules with alcohol dehydrogenase in aqueous solution using molecular dynamics simulation.

Science.gov (United States)

Bahrami, Homayoon; Zahedi, Mansour; Moosavi-Movahedi, Ali Akbar; Azizian, Homa; Amanlou, Massoud

2011-03-01

The nature of protein-sorbitol-water interaction in solution at the molecular level, has been investigated using molecular dynamics simulations. In order to do this task, two molecular dynamics simulations of the protein ADH in solution at room temperature have been carried out, one in the presence (about 0.9 M) and another in the absence of sorbitol. The results show that the sorbitol molecules cluster and move toward the protein, and form hydrogen bonds with protein. Also, coating by sorbitol reduces the conformational fluctuations of the protein compared to the sorbitol-free system. Thus, it is concluded that at moderate concentration of sorbitol solution, sorbitol molecules interact with ADH via many H-bonds that prevent the protein folding. In fact, at more concentrated sorbitol solution, water and sorbitol molecules accumulate around the protein surface and form a continuous space-filling network to reduce the protein flexibility. Namely, in such solution, sorbitol molecules can stabilize a misfolded state of ADH, and prevent the protein from folding to its native structure.

Flexible Graphene-Based Wearable Gas and Chemical Sensors.

Science.gov (United States)

Singh, Eric; Meyyappan, M; Nalwa, Hari Singh

2017-10-11

Wearable electronics is expected to be one of the most active research areas in the next decade; therefore, nanomaterials possessing high carrier mobility, optical transparency, mechanical robustness and flexibility, lightweight, and environmental stability will be in immense demand. Graphene is one of the nanomaterials that fulfill all these requirements, along with other inherently unique properties and convenience to fabricate into different morphological nanostructures, from atomically thin single layers to nanoribbons. Graphene-based materials have also been investigated in sensor technologies, from chemical sensing to detection of cancer biomarkers. The progress of graphene-based flexible gas and chemical sensors in terms of material preparation, sensor fabrication, and their performance are reviewed here. The article provides a brief introduction to graphene-based materials and their potential applications in flexible and stretchable wearable electronic devices. The role of graphene in fabricating flexible gas sensors for the detection of various hazardous gases, including nitrogen dioxide (NO 2 ), ammonia (NH 3 ), hydrogen (H 2 ), hydrogen sulfide (H 2 S), carbon dioxide (CO 2 ), sulfur dioxide (SO 2 ), and humidity in wearable technology, is discussed. In addition, applications of graphene-based materials are also summarized in detecting toxic heavy metal ions (Cd, Hg, Pb, Cr, Fe, Ni, Co, Cu, Ag), and volatile organic compounds (VOCs) including nitrobenzene, toluene, acetone, formaldehyde, amines, phenols, bisphenol A (BPA), explosives, chemical warfare agents, and environmental pollutants. The sensitivity, selectivity and strategies for excluding interferents are also discussed for graphene-based gas and chemical sensors. The challenges for developing future generation of flexible and stretchable sensors for wearable technology that would be usable for the Internet of Things (IoT) are also highlighted.

Charge migration induced by attosecond pulses in bio-relevant molecules

International Nuclear Information System (INIS)

Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero

2016-01-01

After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

International Nuclear Information System (INIS)

Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

2011-01-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

Energy Technology Data Exchange (ETDEWEB)

Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

2011-03-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Subtle balance of tropoelastin molecular shape and flexibility regulates dynamics and hierarchical assembly.

Science.gov (United States)

Yeo, Giselle C; Tarakanova, Anna; Baldock, Clair; Wise, Steven G; Buehler, Markus J; Weiss, Anthony S

2016-02-01

The assembly of the tropoelastin monomer into elastin is vital for conferring elasticity on blood vessels, skin, and lungs. Tropoelastin has dual needs for flexibility and structure in self-assembly. We explore the structure-dynamics-function interplay, consider the duality of molecular order and disorder, and identify equally significant functional contributions by local and global structures. To study these organizational stratifications, we perturb a key hinge region by expressing an exon that is universally spliced out in human tropoelastins. We find a herniated nanostructure with a displaced C terminus and explain by molecular modeling that flexible helices are replaced with substantial β sheets. We see atypical higher-order cross-linking and inefficient assembly into discontinuous, thick elastic fibers. We explain this dysfunction by correlating local and global structural effects with changes in the molecule's assembly dynamics. This work has general implications for our understanding of elastomeric proteins, which balance disordered regions with defined structural modules at multiple scales for functional assembly.

Flexible Bistable Smectic-A Liquid Crystal Device Using Photolithography and Photoinduced Phase Separation

Directory of Open Access Journals (Sweden)

Yang Lu

2012-01-01

Full Text Available A flexible bistable smectic-A liquid crystal (SmA LC device using pixel-isolated mode was demonstrated, in which SmA LC molecules were isolated in pixels by vertical polymer wall and horizontal polymer layer. The above microstructure was achieved by using ultraviolet (UV photolithography and photoinduced phase separation. The polymer wall was fabricated by photolithography, and then the SmA LC was encapsulated in pixels between polymer wall through UV-induced phase separation, in which the polymer wall acts as supporting structure from mechanical pressure and maintains the cell gap from bending, and the polymer layer acts as adhesive for tight attachment of two substrates. The results demonstrated that all the intrinsic bistable properties of the SmA LC are preserved, and good electrooptical characteristics such as high contrast ratio and excellent stability of the bistable states were characterized. This kind of SmA bistable flexible display has high potential to be used as electronic paper, smart switchable reflective windows, and so forth.

Hydrogen transfer reactions of interstellar Complex Organic Molecules

Science.gov (United States)

Álvarez-Barcia, S.; Russ, P.; Kästner, J.; Lamberts, T.

2018-06-01

Radical recombination has been proposed to lead to the formation of complex organic molecules (COMs) in CO-rich ices in the early stages of star formation. These COMs can then undergo hydrogen addition and abstraction reactions leading to a higher or lower degree of saturation. Here, we have studied 14 hydrogen transfer reactions for the molecules glyoxal, glycoaldehyde, ethylene glycol, and methylformate and an additional three reactions where CHnO fragments are involved. Over-the-barrier reactions are possible only if tunneling is invoked in the description at low temperature. Therefore the rate constants for the studied reactions are calculated using instanton theory that takes quantum effects into account inherently. The reactions were characterized in the gas phase, but this is expected to yield meaningful results for CO-rich ices due to the minimal alteration of reaction landscapes by the CO molecules. We found that rate constants should not be extrapolated based on the height of the barrier alone, since the shape of the barrier plays an increasingly larger role at decreasing temperature. It is neither possible to predict rate constants based only on considering the type of reaction, the specific reactants and functional groups play a crucial role. Within a single molecule, though, hydrogen abstraction from an aldehyde group seems to be always faster than hydrogen addition to the same carbon atom. Reactions that involve heavy-atom tunneling, e.g., breaking or forming a C-C or C-O bond, have rate constants that are much lower than those where H transfer is involved.

Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

International Nuclear Information System (INIS)

Xie, Yang; Wang, Jianhua; Liu, Chundong

2016-01-01

With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer’s disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F_i and the nonspecific force F_0 between a single Aβ–Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F_i between a single Aβ–Aβ pair in the presence of Cu"2"+, Zn"2"+, Ca"2"+ and Al"3"+ increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

Science.gov (United States)

Xie, Yang; Wang, Jianhua; Liu, Chundong

2016-09-01

With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer's disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F i and the nonspecific force F 0 between a single Aβ-Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F i between a single Aβ-Aβ pair in the presence of Cu2+, Zn2+, Ca2+ and Al3+ increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

Energy Technology Data Exchange (ETDEWEB)

Xie, Yang; Wang, Jianhua, E-mail: wjh@cqu.edu.cn; Liu, Chundong [Chongqing University, Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering (China)

2016-09-15

With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer’s disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F{sub i} and the nonspecific force F{sub 0} between a single Aβ–Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F{sub i} between a single Aβ–Aβ pair in the presence of Cu{sup 2+}, Zn{sup 2+}, Ca{sup 2+} and Al{sup 3+} increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

Flexible magnetoimpedance sensor

KAUST Repository

Li, Bodong; Kavaldzhiev, Mincho; Kosel, Jü rgen

2015-01-01

Flexible magnetoimpedance (MI) sensors fabricated using a NiFe/Cu/NiFe tri-layer on Kapton substrate have been studied. A customized flexible microstrip transmission line was employed to investigate the MI sensors's magnetic field and frequency

Quorum sensing molecules production by nosocomial and soil isolates Acinetobacter baumannii.

Science.gov (United States)

Erdönmez, Demet; Rad, Abbas Yousefi; Aksöz, Nilüfer

2017-12-01

Acinetobacter species remain alive in hospitals on various surfaces, both dry and moist, forming an important source of hospital infections. These bacteria are naturally resistant to many antibiotic classes. Although the role of the quorum sensing system in regulating the virulence factors of Acinetobacter species has not been fully elucidated, it has been reported that they play a role in bacterial biofilm formation. The biofilm formation helps them to survive under unfavorable growth conditions and antimicrobial treatments. It is based on the accumulation of bacterial communication signal molecules in the area. In this study, we compared the bacterial signal molecules of 50 nosocomial Acinetobacter baumannii strain and 20 A. baumannii strain isolated from soil. The signal molecules were detected by the biosensor bacteria (Chromobacterium violaceum 026, Agrobacterium tumefaciens A136, and Agrobacterium tumefaciens NTL1) and their separation was determined by thin-layer chromatography. As a result, it has been found that soil-borne isolates can produce 3-oxo-C8-AHL and C8-AHL, whereas nosocomial-derived isolates can produce long-chain signals such as C10-AHL, C12-AHL, C14-AHL and C16-AHL. According to these results, it is possible to understand that these signal molecules are found in the infection caused by A. baumannii. The inhibition of this signaling molecules in a communication could use to prevent multiple antibiotic resistance of these bacteria.

Torque Measurement at the Single Molecule Level

Science.gov (United States)

Forth, Scott; Sheinin, Maxim Y.; Inman, James; Wang, Michelle D.

2017-01-01

Methods for exerting and measuring forces on single molecules have revolutionized the study of the physics of biology. However, it is often the case that biological processes involve rotation or torque generation, and these parameters have been more difficult to access experimentally. Recent advances in the single molecule field have led to the development of techniques which add the capability of torque measurement. By combining force, displacement, torque, and rotational data, a more comprehensive description of the mechanics of a biomolecule can be achieved. In this review, we highlight a number of biological processes for which torque plays a key mechanical role. We describe the various techniques that have been developed to directly probe the torque experienced by a single molecule, and detail a variety of measurements made to date using these new technologies. We conclude by discussing a number of open questions and propose systems of study which would be well suited for analysis with torsional measurement techniques. PMID:23541162

Ultraviolet photodetection of flexible ZnO nanowire sheets in polydimethylsiloxane polymer

Directory of Open Access Journals (Sweden)

Jinzhang Liu

2012-05-01

Full Text Available ZnO nanowires are normally exposed to an oxygen atmosphere to achieve high performance in UV photodetection. In this work we present results on a UV photodetector fabricated using a flexible ZnO nanowire sheet embedded in polydimethylsiloxane (PDMS, a gas-permeable polymer, showing reproducible UV photoresponse and enhanced photoconduction. PDMS coating results in a reduced response speed compared to that of a ZnO nanowire film in air. The rising speed is slightly reduced, while the decay time is prolonged by about a factor of four. We conclude that oxygen molecules diffusing in PDMS are responsible for the UV photoresponse.

Flexible magnetoimpedance sensor

International Nuclear Information System (INIS)

Li, Bodong; Kavaldzhiev, Mincho N.; Kosel, Jürgen

2015-01-01

Flexible magnetoimpedance (MI) sensors fabricated using a NiFe/Cu/NiFe tri-layer on Kapton substrate have been studied. A customized flexible microstrip transmission line was employed to investigate the MI sensors's magnetic field and frequency responses and their dependence on the sensors's deflection. For the first time, the impedance characteristic is obtained through reflection coefficient analysis over a wide range of frequencies from 0.1 MHz to 3 GHz and for deflections ranging from zero curvature to a radius of 7.2 cm. The sensor element maintains a high MI ratio of up to 90% and magnetic sensitivity of up to 9.2%/Oe over different bending curvatures. The relationship between the curvature and material composition is discussed based on the magnetostriction effect and stress simulations. The sensor's large frequency range, simple fabrication process and high sensitivity provide a great potential for flexible electronics and wireless applications. - Highlights: • A flexible magnetoimpedance (MI) sensor is developed. • Studies are carried out using a flexible microstrip transmission line. • An MI ratio of up to 90% is obtained. • The effect of magnetostriction is studied

Flexible transparent electrode

Science.gov (United States)

Demiryont, Hulya; Shannon, Kenneth C., III; Moorehead, David; Bratcher, Matthew

2011-06-01

This paper presents the properties of the EclipseTECTM transparent conductor. EclipseTECTM is a room temperature deposited nanostructured thin film coating system comprised of metal-oxide semiconductor elements. The system possesses metal-like conductivity and glass-like transparency in the visible region. These highly conductive TEC films exhibit high shielding efficiency (35dB at 1 to 100GHz). EclipseTECTM can be deposited on rigid or flexible substrates. For example, EclipseTECTM deposited on polyethylene terephthalate (PET) is extremely flexible that can be rolled around a 9mm diameter cylinder with little or no reduction in electrical conductivity and that can assume pre-extension states after an applied stress is relieved. The TEC is colorless and has been tailored to have high visible transmittance which matches the eye sensitivity curve and allows the viewing of true background colors through the coating. EclipseTECTM is flexible, durable and can be tailored at the interface for applications such as electron- or hole-injecting OLED electrodes as well as electrodes in flexible displays. Tunable work function and optical design flexibility also make EclipseTECTM well-suited as a candidate for grid electrode replacement in next-generation photovoltaic cells.

Flexible Foam Model.

Energy Technology Data Exchange (ETDEWEB)

Neilsen, Michael K.; Lu, Wei-Yang; Werner, Brian T.; Scherzinger, William M.; Lo, Chi S.

2018-03-01

Experiments were performed to characterize the mechanical response of a 15 pcf flexible polyurethane foam to large deformation at different strain rates and temperatures. Results from these experiments indicated that at room temperature, flexible polyurethane foams exhibit significant nonlinear elastic deformation and nearly return to their original undeformed shape when unloaded. However, when these foams are cooled to temperatures below their glass transition temperature of approximately -35 o C, they behave like rigid polyurethane foams and exhibit significant permanent deformation when compressed. Thus, a new model which captures this dramatic change in behavior with temperature was developed and implemented into SIERRA with the name Flex_Foam to describe the mechanical response of both flexible and rigid foams to large deformation at a variety of temperatures and strain rates. This report includes a description of recent experiments. Next, development of the Flex Foam model for flexible polyurethane and other flexible foams is described. Selection of material parameters are discussed and finite element simulations with the new Flex Foam model are compared with experimental results to show behavior that can be captured with this new model.

Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

NARCIS (Netherlands)

Ordonez, Soledad R; Veldhuizen, Edwin J A; van Eijk, Martin; Haagsman, Henk P

2017-01-01

Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that

Effect of dipole polarizability on positron binding by strongly polar molecules

International Nuclear Information System (INIS)

Gribakin, G F; Swann, A R

2015-01-01

A model for positron binding to polar molecules is considered by combining the dipole potential outside the molecule with a strongly repulsive core of a given radius. Using existing experimental data on binding energies leads to unphysically small core radii for all of the molecules studied. This suggests that electron–positron correlations neglected in the simple model play a large role in determining the binding energy. We account for these by including the polarization potential via perturbation theory and non-perturbatively. The perturbative model makes reliable predictions of binding energies for a range of polar organic molecules and hydrogen cyanide. The model also agrees with the linear dependence of the binding energies on the polarizability inferred from the experimental data (Danielson et al 2009 J. Phys. B: At. Mol. Opt. Phys. 42 235203). The effective core radii, however, remain unphysically small for most molecules. Treating molecular polarization non-perturbatively leads to physically meaningful core radii for all of the molecules studied and enables even more accurate predictions of binding energies to be made for nearly all of the molecules considered. (paper)

Sub-100 nm gold nanohole-enhanced Raman scattering on flexible PDMS sheets

Science.gov (United States)

Lee, Seunghyun; Ongko, Andry; Kim, Ho Young; Yim, Sang-Gu; Jeon, Geumhye; Jeong, Hee Jin; Lee, Seungwoo; Kwak, Minseok; Yang, Seung Yun

2016-08-01

Surface-enhanced Raman spectroscopy (SERS) is a highly sensitive vibrational spectroscopy technique enabling detection of multiple analytes at the molecular level in a nondestructive and rapid manner. In this work, we introduce a new approach to fabricate deep subwavelength-scaled (sub-100 nm) metallic nanohole arrays (quasi-3D metallic nanoholes) on flexible and highly efficient SERS substrates. Target structures have been fabricated using a two-step process consisting of (i) direct pattern transfer of spin-coated polymer films onto polydimethylsiloxane (PDMS) substrates by plasma etching with transferred anodic aluminum oxide masks, and (ii) producing SERS-active substrates by functionalization of the etched polymeric films followed by Au deposition. Such an all-dry, top-down lithographic approach enables on-demand patterning of SERS-active metallic nanoholes with high structural fidelity even onto flexible and stretchable substrates, thus making possible multiple sensing modes in a versatile fashion. For example, metallic nanoholes on flexible PDMS substrates are highly amenable to their integration with curved glass sticks, which can be used in optical fiber-integrated SERS systems. Au surfaces immobilized by probe DNA molecules show a selective enhancement of Raman scattering with Cy5-labeled complementary DNA (as compared to flat Au surfaces), demonstrating the potential of using the quasi-3D Au nanohole arrays for bio-sensing applications.

Constraint Network Analysis (CNA): a Python software package for efficiently linking biomacromolecular structure, flexibility, (thermo-)stability, and function.

Science.gov (United States)

Pfleger, Christopher; Rathi, Prakash Chandra; Klein, Doris L; Radestock, Sebastian; Gohlke, Holger

2013-04-22

For deriving maximal advantage from information on biomacromolecular flexibility and rigidity, results from rigidity analyses must be linked to biologically relevant characteristics of a structure. Here, we describe the Python-based software package Constraint Network Analysis (CNA) developed for this task. CNA functions as a front- and backend to the graph-based rigidity analysis software FIRST. CNA goes beyond the mere identification of flexible and rigid regions in a biomacromolecule in that it (I) provides a refined modeling of thermal unfolding simulations that also considers the temperature-dependence of hydrophobic tethers, (II) allows performing rigidity analyses on ensembles of network topologies, either generated from structural ensembles or by using the concept of fuzzy noncovalent constraints, and (III) computes a set of global and local indices for quantifying biomacromolecular stability. This leads to more robust results from rigidity analyses and extends the application domain of rigidity analyses in that phase transition points ("melting points") and unfolding nuclei ("structural weak spots") are determined automatically. Furthermore, CNA robustly handles small-molecule ligands in general. Such advancements are important for applying rigidity analysis to data-driven protein engineering and for estimating the influence of ligand molecules on biomacromolecular stability. CNA maintains the efficiency of FIRST such that the analysis of a single protein structure takes a few seconds for systems of several hundred residues on a single core. These features make CNA an interesting tool for linking biomacromolecular structure, flexibility, (thermo-)stability, and function. CNA is available from http://cpclab.uni-duesseldorf.de/software for nonprofit organizations.

The U.S. Strategic Flexibility Policy: Prospects for the U.S.-ROK Alliance

National Research Council Canada - National Science Library

Oh, Soonkun

2006-01-01

.... With the United States and South Korea's recent agreement on the strategic flexibility of USFK, it became obvious that the primary role of the USFK will be changed from North Korean deterrence...

Intersystem crossing in complex molecules

International Nuclear Information System (INIS)

Pappalardo, R.G.

1980-01-01

The general question of singlet-triplet intersystem crossing is addressed in the context of large organic molecules, i.e., ''complex'' molecules capable of self-relaxation in the absence of collisions. Examples of spectral properties of such molecules in the vapor phase are discussed, relying on extensive Russian literature in this area. Formal expressions for the relaxation rate in the electronic excited states are derived on the basis of the formalism of collision theory, and are applied to the specific case of intersystem crossing. The derivation of the ''energy-gap'' law for triplet-singlet conversion in aromatic hydrocarbons is briefly outlined. The steep rise of internal conversion rates as a function of excess excitation energy, and its competition with the intersystem crossing process, are reviewed for the case of naphthalene vapor. A general expression for the spin-orbit interaction Hamiltonian in molecular systems is outlined. Experimental observations on singlet-triplet conversion rates and the factors that can drastically affect such rates are discussed, with emphasis on the ''in- ternal'' and ''external'' heavy-atom effects. Basic relations of ESR spectroscopy and magnetophotoselection are reviewed. Technological implications of the singlet-triplet crossing in complex molecules are discussed in the context of chelate lasers, dye lasers and luminescent displays. Effects related to singlet-triplet crossing, and generally to excited-state energy-transfer in biological systems, are exemplified by the role of aromatic amino-acids in the phosphorescence of proteins, by some recent studies of energy-transfer in models of biomembranes, and by the clustering of triplet-energy donor-acceptor pairs in micelles

Multiphoton dissociation of polyatomic molecules

International Nuclear Information System (INIS)

Schulz, P.A.

1979-10-01

The dynamics of infrared multiphoton excitation and dissociation of SF 6 was investigated under collision free conditions by a crossed laser-molecular beam method. In order to understand the excitation mechanism and to elucidate the requirements of laser intensity and energy fluence, a series of experiments were carried out to measure the dissociation yield dependences on energy fluence, vibrational temperature of SF 6 , the pulse duration of the CO 2 laser and the frequency in both one and two laser experiments. Translational energy distributions of the SF 5 dissociation product measured by time of flight and angular distributions and the dissociation lifetime of excited SF 6 as inferred from the observation of secondary dissociation of SF 5 into SF 4 and F during the laser pulse suggest that the dynamics of dissociation of excited molecules is dominated by complete energy randomization and rapid intramolecular energy transfer on a nanosecond timescale, and can be adequately described by RRKM theory. An improved phenomenological model including the initial intensity dependent excitation, a rate equation describing the absorption and stimulated emission of single photons, and the unimolecular dissociation of excited molecules is constructed based on available experimental results. The model shows that the energy fluence of the laser determines the excitation of molecules in the quasi-continuum and the excess energy with which molecules dissociate after the laser pulse. The role played by the laser intensity in multiphoton dissociation is more significant than just that of overcoming the intensity dependent absorption in the lowest levels. 63 references

Hierarchical virtual screening approaches in small molecule drug discovery.

Science.gov (United States)

Kumar, Ashutosh; Zhang, Kam Y J

2015-01-01

Virtual screening has played a significant role in the discovery of small molecule inhibitors of therapeutic targets in last two decades. Various ligand and structure-based virtual screening approaches are employed to identify small molecule ligands for proteins of interest. These approaches are often combined in either hierarchical or parallel manner to take advantage of the strength and avoid the limitations associated with individual methods. Hierarchical combination of ligand and structure-based virtual screening approaches has received noteworthy success in numerous drug discovery campaigns. In hierarchical virtual screening, several filters using ligand and structure-based approaches are sequentially applied to reduce a large screening library to a number small enough for experimental testing. In this review, we focus on different hierarchical virtual screening strategies and their application in the discovery of small molecule modulators of important drug targets. Several virtual screening studies are discussed to demonstrate the successful application of hierarchical virtual screening in small molecule drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Lessons learned from mice deficient in lectin complement pathway molecules

DEFF Research Database (Denmark)

Genster, Ninette; Takahashi, Minoru; Sekine, Hideharu

2014-01-01

in turn activate downstream complement components, ultimately leading to elimination of the pathogen. Mice deficient in the key molecules of lectin pathway of complement have been generated in order to build knowledge of the molecular mechanisms of the lectin pathway in health and disease. Despite......The lectin pathway of the complement system is initiated when the pattern-recognition molecules, mannose-binding lectin (MBL), ficolins or collectin-11, bind to invading pathogens or damaged host cells. This leads to activation of MBL/ficolin/collectin-11 associated serine proteases (MASPs), which...... differences in the genetic arrangements of murine and human orthologues of lectin pathway molecules, the knockout mice have proven to be valuable models to explore the effect of deficiency states in humans. In addition, new insight and unexpected findings on the diverse roles of lectin pathway molecules...

ReFlexIn: a flexible receptor protein-ligand docking scheme evaluated on HIV-1 protease.

Directory of Open Access Journals (Sweden)

Simon Leis

Full Text Available For many targets of pharmaceutical importance conformational changes of the receptor protein are relevant during the ligand binding process. A new docking approach, ReFlexIn (Receptor Flexibility by Interpolation, that combines receptor flexibility with the computationally efficient potential grid representation of receptor molecules has been evaluated on the retroviral HIV-1 (Human Immunodeficiency Virus 1 protease system. An approximate inclusion of receptor flexibility is achieved by using interpolation between grid representations of individual receptor conformations. For the retroviral protease the method was tested on an ensemble of protease structures crystallized in the presence of different ligands and on a set of structures obtained from morphing between the unbound and a ligand-bound protease structure. Docking was performed on ligands known to bind to the protease and several non-binders. For the binders the ReFlexIn method yielded in almost all cases ligand placements in similar or closer agreement with experiment than docking to any of the ensemble members without degrading the discrimination with respect to non-binders. The improved docking performance compared to docking to rigid receptors allows for systematic virtual screening applications at very small additional computational cost.

Flexibility in competency-based workplace transition programs: an exploratory study of community child and family health nursing.

Science.gov (United States)

Cusack, Lynette; Gilbert, Sandra; Fereday, Jennifer

2013-03-01

Successful transition to practice programs that use competency-based assessment require the involvement of all staff, especially those undertaking the preceptor role. Qualitative data were collected using interview methods. Participants were 14 newly employed nurses and 7 preceptors in the child and family community health service in South Australia. Participant narratives were recorded electronically, transcribed, and thematically analyzed using the paradigm of critical social science. Five themes were identified that describe enablers as well as barriers to applying a flexible transition to practice program using competency-based assessment. These included flexibility in the program design, flexibility on the part of preceptors, flexibility to enable recognition of previous learning, flexibility in the assessment of competencies, and flexibility in workload. To ensure successful application of a transition to practice program using competency-based assessment, preceptors must understand the flexible arrangements built into the program design and have the confidence and competence to apply them. Copyright 2013, SLACK Incorporated.

Incentivizing Flexibility in System Operations

Energy Technology Data Exchange (ETDEWEB)

Milligan, Michael [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Bloom, Aaron P [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Townsend, Aaron [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Ela, Erik [Electric Power Research Institute; Botterud, Audun [Argonne National Laboratory; Levin, Todd [Argonne National Laboratory

2018-02-15

Defining flexibility has been a challenge that a number of industry members and researchers have attempted to address in recent years. With increased variability and uncertainty of variable generation (VG), the resources on the system will have to be more flexible to adjust output, so that power output ranges, power ramp rates, and energy duration sustainability are sufficient to meet the needs of balancing supply with demand at various operational timescales. This chapter discusses whether existing market designs provide adequate incentives for resources to offer their flexibility into the market to meet the increased levels of variability and uncertainty introduced by VG in the short-term operational time frame. It presents a definition of flexibility and discusses how increased levels of VG require increased needs for flexibility on power systems. Following this introductory material, the chapter examines how existing market designs ensure that resources have the right incentives to provide increased flexibility, and then discusses a number of emerging market design elements that impact flexibility incentives.

From flexibility human resource management to employee engagement and perceived job performance across the lifespan: A multisample study

NARCIS (Netherlands)

Bal, P.M.; Lange, A.H. de

2015-01-01

This study investigated the effects of flexibility human resource management (HRM) on employee outcomes over time, as well as the role of age in these relations. Based on work adjustment theory and AMO theory, it was predicted that availability and use of flexibility HRM would be positively related

Studies on the role of unsaturation in the fatty acid surfactant molecule on the thermal conductivity of magnetite nanofluids.

Science.gov (United States)

Lenin, Ramanujam; Joy, Pattayil Alias

2017-11-15

To study the role of unsaturation in the surfactant molecule on the thermal conductivity of magnetite nanofluids, four different fatty acid (stearic, oleic, linoleic, and linolenic acids with different degree of unsaturation) coated magnetite nanoparticles of comparable size are prepared and dispersed in toluene. It is found that the nanofluid with the saturated fatty acid coated nanoparticles show larger viscosity than the fluid with the unsaturated fatty acid coated particles at all concentrations. Thermal conductivity studies show enhancement only above a critical concentration for all fluids. The critical concentration for thermal conductivity enhancement varies with the surfactant, possibly due to the difference in the degree of aggregation of the nanoparticles in the fluid, because of the difference in the conformation of the surfactant molecules on the nanoparticle's surface. The experimental thermal conductivity follows the Maxwell model at higher concentrations. From the overall studies, it is observed that the thermal conductivity of the fluids with aggregated or assembled nanoparticles shows slightly larger enhancement than that of the fluids with isolated particles. However, in the presence of a magnetic field, the fluids with isolated nanoparticles showed relatively larger enhancement, possibly due to the easy response of the isolated magnetite nanoparticles to the applied field. Copyright © 2017 Elsevier Inc. All rights reserved.

A-VCI: A flexible method to efficiently compute vibrational spectra

Science.gov (United States)

Odunlami, Marc; Le Bris, Vincent; Bégué, Didier; Baraille, Isabelle; Coulaud, Olivier

2017-06-01

The adaptive vibrational configuration interaction algorithm has been introduced as a new method to efficiently reduce the dimension of the set of basis functions used in a vibrational configuration interaction process. It is based on the construction of nested bases for the discretization of the Hamiltonian operator according to a theoretical criterion that ensures the convergence of the method. In the present work, the Hamiltonian is written as a sum of products of operators. The purpose of this paper is to study the properties and outline the performance details of the main steps of the algorithm. New parameters have been incorporated to increase flexibility, and their influence has been thoroughly investigated. The robustness and reliability of the method are demonstrated for the computation of the vibrational spectrum up to 3000 cm-1 of a widely studied 6-atom molecule (acetonitrile). Our results are compared to the most accurate up to date computation; we also give a new reference calculation for future work on this system. The algorithm has also been applied to a more challenging 7-atom molecule (ethylene oxide). The computed spectrum up to 3200 cm-1 is the most accurate computation that exists today on such systems.

Single-molecule mechanics of protein-labelled DNA handles

Directory of Open Access Journals (Sweden)

Vivek S. Jadhav

2016-01-01

Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

Identification and quantitation of signal molecule-dependent protein phosphorylation

KAUST Repository

Groen, Arnoud J.; Thomas, Ludivine; Lilley, Kathryn S.; Marondedze, Claudius

2013-01-01

in combination with phosphopeptide enrichment by titanium dioxide (TiO2) and their identification by MS is described. This workflow can be used to gain insights into the role of signalling molecules such as cyclic nucleotides on regulatory networks through

Pharmacology of cell adhesion molecules of the nervous system

DEFF Research Database (Denmark)

Kiryushko, Darya; Bock, Elisabeth; Berezin, Vladimir

2007-01-01

Cell adhesion molecules (CAMs) play a pivotal role in the development and maintenance of the nervous system under normal conditions. They also are involved in numerous pathological processes such as inflammation, degenerative disorders, and cancer, making them attractive targets for drug...

Graphene-based materials for flexible supercapacitors.

Science.gov (United States)

Shao, Yuanlong; El-Kady, Maher F; Wang, Lisa J; Zhang, Qinghong; Li, Yaogang; Wang, Hongzhi; Mousavi, Mir F; Kaner, Richard B

2015-06-07

The demand for flexible/wearable electronic devices that have aesthetic appeal and multi-functionality has stimulated the rapid development of flexible supercapacitors with enhanced electrochemical performance and mechanical flexibility. After a brief introduction to flexible supercapacitors, we summarize current progress made with graphene-based electrodes. Two recently proposed prototypes for flexible supercapacitors, known as micro-supercapacitors and fiber-type supercapacitors, are then discussed. We also present our perspective on the development of graphene-based electrodes for flexible supercapacitors.

RNA versatility, flexibility, and thermostability for practice in RNA nanotechnology and biomedical applications.

Science.gov (United States)

Haque, Farzin; Pi, Fengmei; Zhao, Zhengyi; Gu, Shanqing; Hu, Haibo; Yu, Hang; Guo, Peixuan

2018-01-01

In recent years, RNA has attracted widespread attention as a unique biomaterial with distinct biophysical properties for designing sophisticated architectures in the nanometer scale. RNA is much more versatile in structure and function with higher thermodynamic stability compared to its nucleic acid counterpart DNA. Larger RNA molecules can be viewed as a modular structure built from a combination of many 'Lego' building blocks connected via different linker sequences. By exploiting the diversity of RNA motifs and flexibility of structure, varieties of RNA architectures can be fabricated with precise control of shape, size, and stoichiometry. Many structural motifs have been discovered and characterized over the years and the crystal structures of many of these motifs are available for nanoparticle construction. For example, using the flexibility and versatility of RNA structure, RNA triangles, squares, pentagons, and hexagons can be constructed from phi29 pRNA three-way-junction (3WJ) building block. This review will focus on 2D RNA triangles, squares, and hexamers; 3D and 4D structures built from basic RNA building blocks; and their prospective applications in vivo as imaging or therapeutic agents via specific delivery and targeting. Methods for intracellular cloning and expression of RNA molecules and the in vivo assembly of RNA nanoparticles will also be reviewed. WIREs RNA 2018, 9:e1452. doi: 10.1002/wrna.1452 This article is categorized under: RNA Methods > RNA Nanotechnology RNA Structure and Dynamics > RNA Structure, Dynamics and Chemistry RNA in Disease and Development > RNA in Disease Regulatory RNAs/RNAi/Riboswitches > Regulatory RNAs. © 2017 Wiley Periodicals, Inc.

Flexible Metal Oxide/Graphene Oxide Hybrid Neuromorphic Devices on Flexible Conducting Graphene Substrates

OpenAIRE

Wan, Chang Jin; Wang, Wei; Zhu, Li Qiang; Liu, Yang Hui; Feng, Ping; Liu, Zhao Ping; Shi, Yi; Wan, Qing

2016-01-01

Flexible metal oxide/graphene oxide hybrid multi-gate neuron transistors were fabricated on flexible graphene substrates. Dendritic integrations in both spatial and temporal modes were successfully emulated, and spatiotemporal correlated logics were obtained. A proof-of-principle visual system model for emulating lobula giant motion detector neuron was investigated. Our results are of great interest for flexible neuromorphic cognitive systems.

Mechanochemical Association Reaction of Interfacial Molecules Driven by Shear.

Science.gov (United States)

Khajeh, Arash; He, Xin; Yeon, Jejoon; Kim, Seong H; Martini, Ashlie

2018-05-29

Shear-driven chemical reaction mechanisms are poorly understood because the relevant reactions are often hidden between two solid surfaces moving in relative motion. Here, this phenomenon is explored by characterizing shear-induced polymerization reactions that occur during vapor phase lubrication of α-pinene between sliding hydroxylated and dehydroxylated silica surfaces, complemented by reactive molecular dynamics simulations. The results suggest that oxidative chemisorption of the α-pinene molecules at reactive surface sites, which transfers oxygen atoms from the surface to the adsorbate molecule, is the critical activation step. Such activation takes place more readily on the dehydroxylated surface. During this activation, the most strained part of the α-pinene molecules undergoes a partial distortion from its equilibrium geometry, which appears to be related to the critical activation volume for mechanical activation. Once α-pinene molecules are activated, association reactions occur between the newly attached oxygen and one of the carbon atoms in another molecule, forming ether bonds. These findings have general implications for mechanochemistry because they reveal that shear-driven reactions may occur through reaction pathways very different from their thermally induced counterparts and specifically the critical role of molecular distortion in such reactions.

Flexible Electronics Research Facility

Data.gov (United States)

Federal Laboratory Consortium — The Flexible Electronics Research Facility designs, synthesizes, tests, and fabricates materials and devices compatible with flexible substrates for Army information...

Third-order polynomial model for analyzing stickup state laminated structure in flexible electronics

Science.gov (United States)

Meng, Xianhong; Wang, Zihao; Liu, Boya; Wang, Shuodao

2018-02-01

Laminated hard-soft integrated structures play a significant role in the fabrication and development of flexible electronics devices. Flexible electronics have advantageous characteristics such as soft and light-weight, can be folded, twisted, flipped inside-out, or be pasted onto other surfaces of arbitrary shapes. In this paper, an analytical model is presented to study the mechanics of laminated hard-soft structures in flexible electronics under a stickup state. Third-order polynomials are used to describe the displacement field, and the principle of virtual work is adopted to derive the governing equations and boundary conditions. The normal strain and the shear stress along the thickness direction in the bi-material region are obtained analytically, which agree well with the results from finite element analysis. The analytical model can be used to analyze stickup state laminated structures, and can serve as a valuable reference for the failure prediction and optimal design of flexible electronics in the future.

Electric-Field Control of Interfering Transport Pathways in a Single-Molecule Anthraquinone Transistor

Science.gov (United States)

Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; Zant, Herre S. J. van der

2015-08-01

It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the molecule is reduced resulting into a ten-fold increase in the off-resonant differential conductance. Theoretical calculations link the change in differential conductance to a reduction-induced change in conjugation, thereby lifting destructive interference of transport pathways.

Superhydrophobic and Slippery Lubricant-Infused Flexible Transparent Nanocellulose Films by Photoinduced Thiol-Ene Functionalization.

Science.gov (United States)

Guo, Jiaqi; Fang, Wenwen; Welle, Alexander; Feng, Wenqian; Filpponen, Ilari; Rojas, Orlando J; Levkin, Pavel A

2016-12-14

Films comprising nanofibrillated cellulose (NFC) are suitable substrates for flexible devices in analytical, sensor, diagnostic, and display technologies. However, some major challenges in such developments include their high moisture sensitivity and the complexity of current methods available for functionalization and patterning. In this work, we present a facile process for tailoring the surface wettability and functionality of NFC films by a fast and versatile approach. First, the NFC films were coated with a layer of reactive nanoporous silicone nanofilament by polycondensation of trichlorovinylsilane (TCVS). The TCVS afforded reactive vinyl groups, thereby enabling simple UV-induced functionalization of NFC films with various thiol-containing molecules via the photo "click" thiol-ene reaction. Modification with perfluoroalkyl thiols resulted in robust superhydrophobic surfaces, which could then be further transformed into transparent slippery lubricant-infused NFC films that displayed repellency against both aqueous and organic liquids with surface tensions as low as 18 mN·m -1 . Finally, transparent and flexible NFC films incorporated hydrophilic micropatterns by modification with OH, NH 2 , or COOH surface groups, enabling space-resolved superhydrophobic-hydrophilic domains. Flexibility, transparency, patternability, and perfect superhydrophobicity of the produced nanocellulose substrates warrants their application in biosensing, display protection, and biomedical and diagnostics devices.

Theoretical investigation of structure and stability of molecules of borohydrides B2H6, AlBH6 and ScBH6

International Nuclear Information System (INIS)

Musaev, D.G.; Zyubin, A.S.; Charkin, O.P.; Bonakkorsi, R.; Tomazi, Ya.

1988-01-01

Geometry of alternative structures of M 3+ BH 6 molecules are optimized on the two-exponent bases; their energies are refined with a fuller basis DEHD taking into account electron correlation within the frames of the MP3 method. The tendencies in the change of relative energies of the structures and their stability to decomposition are analyzed. It is noted that AlBH 6 and ScBH 6 molecules are not rigid to migration of M 3+ H 2 + ''cation'' round BH 4 - anion, as well ScBH 6 molecules are flexible to rotation of H 2 Sc group round the Sc-B axis. The data are compared with the results of previous similar calculations of borohydrides of elements in the first two groups (Li-Cu and Be-Zn)

Hierarchical Self-Organization of AB _n Dendron-like Molecules into a Supramolecular Lattice Sequence

Energy Technology Data Exchange (ETDEWEB)

Feng, Xueyan [Department; Zhang, Ruimeng [Department; Li, Yiwen [College; Hong, You-lee [RIKEN CLST-JEOL; JEOL RESONANCE; Guo, Dong [Department; Lang, Kening [Department; Wu, Kuan-Yi [Department; Huang, Mingjun [Department; Mao, Jialin [Department; Wesdemiotis, Chrys [Department; Nishiyama, Yusuke [RIKEN CLST-JEOL; JEOL RESONANCE; Zhang, Wei [Department; Zhang, Wei [South; Miyoshi, Toshikazu [Department; Li, Tao [X-ray; Cheng, Stephen Z. D. [Department

2017-08-07

To understand the hierarchical self-organization behaviors of soft materials as well as their dependence on molecular geometry, a series of ABn dendron-type giant molecules based on polyhedral oligomeric silsesquioxane (POSS) nanoparticles were designed and synthesized. The apex of these molecules is a hydrophilic POSS cage with fourteen hydroxyl groups (denoted DPOSS). At its periphery, there are different numbers (n = 1–8) of hydrophobic POSS cages with seven isobutyl groups (denoted BPOSS), connected to the apical DPOSS via flexible dendron type linker(s). With varying the BPOSS number from one to seven, a supramolecular lattice formation sequence ranging from lamella (DPOSS-BPOSS), double gyroid (space group of Ia3d, DPOSS-BPOSS2), hexagonal cylinder (space group of P6mm, DPOSS-BPOSS3), Frank-Kasper A15 (space group of Pm3n, DPOSS-BPOSS4, DPOSS-BPOSS5, and DPOSS-BPOSS6), to Frank-Kasper sigma (space group of P42/mnm, DPOSS-BPOSS7) phases can be observed. The nanostructure formations in this series of ABn dendron-type giant molecules are mainly directed by the macromolecular geometric shapes. Furthermore, within each spherical motif, the soft spherical core is consisted of hydrophilic DPOSS cages with flexible linkages, while the hydrophobic BPOSS cages form the relative rigid shell and contact with neighbors to provide decreased interfaces among the spherical motifs for constructing final polyhedral motifs in these Frank-Kasper lattices. This study provides the design principle of macromolecules with specific geometric shapes and functional groups to achieve anticipated structures and macroscopic properties.

WAGE FLEXIBILITY IN THE CONTEMPORARY SOCIETY

Directory of Open Access Journals (Sweden)

TECULESCU Silviu Alexandru

2010-12-01

Full Text Available The paper follows to offer the most efficient solutions for the attainment by Romania of the economic development level associated to the Western European countries. It proposes the division of the flexibility of labour market in three components, namely: internal flexibility, external flexibility and wage flexibility. The analysis performed within the present study will emphasize the wage flexibility. Wage flexibility can be classified in four components: a plans of individual and group incentives; b plans of assigning wages out of productivity; c plans of distribution of profits and, respectively, d plans of suggestions. The labour market flexibility, in general, and especially the wage flexibility contributes to the increase of employee motivation at the workplace, aspect which leeds to the growth of labour productivity, through this one being put the bases of the medium- and long-term economic development.

Low carbon technologies as providers of operational flexibility in future power systems

International Nuclear Information System (INIS)

Pavić, Ivan; Capuder, Tomislav; Kuzle, Igor

2016-01-01

Highlights: • Mixed integer linear programming model for provision of multiple services from EV. • EV energy and reserve services provision effects on power system operation. • Impacts of conventional unit’s decommission on system’s operation and flexibility. • Assessment of power system’s flexibility under different wind generation polices. - Abstract: The paper presents a unit commitment model, based on mixed integer linear programming, capable of assessing the impact of electric vehicles (EV) on provision of ancillary services in power systems with high share of renewable energy sources (RES). The analyses show how role of different conventional units changes with integration of variable and uncertain RES and how introducing a flexible sources on the demand side, in this case EV, impact the traditional provision of spinning/contingency reserve services. In addition, technical constraints of conventional units, such as nuclear, gas or coal, limit the inherit flexibility of the system which results in curtailing clean renewable sources and inefficient operation. Following on that, sensitivity analyses of operational cost and wind curtailment shows which techno-economic constraints impact the flexibility of the high RES systems the most and how integration of more flexible units or decommission of conventional nuclear, coal and gas driven power plants would impact the system’s operation. Finally, two different wind generation polices (wind penalization and wind turbines as reserve providers) have been analysed in terms of operational flexibility through different stages of conventional unit’s decommission and compared with the same analyses when EV were used as reserve providers.

Energy Flexibility in the Power System

DEFF Research Database (Denmark)

Billanes, Joy Dalmacio; Ma, Zheng; Jørgensen, Bo Nørregaard

2017-01-01

Energy flexibility can address the challenges of large scale integration of renewable energy resources and thereby increasing imbalance in the power system. Flexible power system can provide reliable supply, low electricity cost and sustainability. Various situations and factors influence...... the adoption of the flexibility solutions, such as flexible electricity generation, demand-response, and electricity storage. This paper tries to analyze the current energy flexibility solutions and the factors that can influence the energy flexibility adoption. This paper takes Philippines as case study...... to provide an overview of the current condition of the Philippines’ power system and discuss the energy flexibility in the Philippines’ power system. A further discussion and recommendation is conducted in the end of the paper....

The association between soluble intercellular adhesion molecule-1 levels in drained dialysate and peritoneal injury in peritoneal dialysis.

Science.gov (United States)

Igarashi, Yusuke; Morishita, Yoshiyuki; Yoshizawa, Hiromichi; Imai, Reika; Imai, Toshimi; Hirahara, Ichiro; Akimoto, Tetsu; Ookawara, Susumu; Ishibashi, Kenichi; Muto, Shigeaki; Nagata, Daisuke

2017-11-01

Chronic inflammation of the peritoneum causes peritoneal injury in patients on peritoneal dialysis. Intercellular adhesion molecule-1 and its circulating form, soluble intercellular adhesion molecule-1, play pivotal roles in inflammation. However, their role in peritoneal injury is unclear. We measured changes in intercellular adhesion molecule-1 expression in the peritoneum of a peritoneal injury model in rats. The associations between soluble intercellular adhesion molecule-1 levels in drained dialysate and the solute transport rate (D/P-Cr and D/D0-glucose) determined by the peritoneal equilibration test, and matrix metalloproteinase-2 levels in drained dialysate were investigated in 94 peritoneal drained dialysate samples. Intercellular adhesion molecule-1 expression was increased in the peritoneum of rats with peritoneal injury. Soluble intercellular adhesion molecule-1 levels in drained dialysate were significantly positively correlated with D/P-Cr (r = .51, p molecule-1expression is increased in the peritoneum of a peritoneal injury model in the rat, and soluble intercellular adhesion molecule-1 levels in drained dialysate are associated with peritoneal injury in patients on peritoneal dialysis. These results suggest that soluble intercellular adhesion molecule-1 could be a novel biomarker of peritoneal injury in patients on peritoneal dialysis.

The cell adhesion molecule Fasciclin2 regulates brush border length and organization in Drosophila renal tubules

DEFF Research Database (Denmark)

Halberg, Kenneth Agerlin; Rainey, Stephanie M.; Veland, Iben Rønn

2016-01-01

Multicellular organisms rely on cell adhesion molecules to coordinate cell-cell interactions, and to provide navigational cues during tissue formation. In Drosophila, Fasciclin 2 (Fas2) has been intensively studied due to its role in nervous system development and maintenance; yet, Fas2 is most...... role for this well-known cell adhesion molecule, and propose that Fas2-mediated intermicrovillar homophilic adhesion complexes help stabilize the brush border....

Organizational flexibility estimation

OpenAIRE

Komarynets, Sofia

2013-01-01

By the help of parametric estimation the evaluation scale of organizational flexibility and its parameters was formed. Definite degrees of organizational flexibility and its parameters for the Lviv region enterprises were determined. Grouping of the enterprises under the existing scale was carried out. Special recommendations to correct the enterprises behaviour were given.

Inter-Vertebral Flexibility of the Ostrich Neck: Implications for Estimating Sauropod Neck Flexibility

OpenAIRE

Cobley, Matthew J.; Rayfield, Emily J.; Barrett, Paul M.

2013-01-01

The flexibility and posture of the neck in sauropod dinosaurs has long been contentious. Improved constraints on sauropod neck function will have major implications for what we know of their foraging strategies, ecology and overall biology. Several hypotheses have been proposed, based primarily on osteological data, suggesting different degrees of neck flexibility. This study attempts to assess the effects of reconstructed soft tissues on sauropod neck flexibility through systematic removal o...

Flexible automated manufacturing for SMEs

DEFF Research Database (Denmark)

Grube Hansen, David; Bilberg, Arne; Madsen, Erik Skov

2017-01-01

SMEs are in general highly flexible and agile in order to accommodate the customer demands in the paradigm of High Mix-Low Volume manufacturing. The flexibility and agility have mainly been enabled by manual labor, but as we are entering the technology and data driven fourth industrial revolution......, where augmented operators and machines work in cooperation in a highly flexible and productive manufacturing system both an opportunity and a need has raised for developing highly flexible and efficient automation....

On flexible and rigid nouns

DEFF Research Database (Denmark)

Rijkhoff, Jan

2010-01-01

classes. Finally this article wants to claim that the distinction between rigid and flexible noun categories (a) adds a new dimension to current classifications of parts of speech systems, (b) correlates with certain grammatical phenomena (e.g. so-called number discord), and (c) helps to explain the parts......This article argues that in addition to the major flexible lexical categories in Hengeveld’s classification of parts of speech systems (Contentive, Non-Verb, Modifier), there are also flexible word classes within the rigid lexical category Noun (Set Noun, Sort Noun, General Noun). Members...... by the flexible item in the external world. I will then argue that flexible word classes constitute a proper category (i.e. they are not the result of a merger of some rigid word classes) in that members of flexible word categories display the same properties regarding category membership as members of rigid word...

On flexible and rigid nouns

DEFF Research Database (Denmark)

Rijkhoff, Jan

2008-01-01

Studies in Language 32-3 (2008), 727-752. Special issue: Parts of Speech: Descriptive tools, theoretical constructs Jan Rijkhoff - On flexible and rigid nouns This article argues that in addition to the flexible lexical categories in Hengeveld’s classification of parts-of-speech systems (Contentive......, Non-Verb, Modifier), there are also flexible word classes within the rigid lexical category Noun (Set Noun, Sort Noun, General Noun). Members of flexible word classes are characterized by their vague semantics, which in the case of nouns means that values for the semantic features Shape...... and Homogeneity are either left undetermined or they are specified in such a way that they do not quite match the properties of the kind of entity denoted by the flexible item in the external world. I will then argue that flexible word classes constitute a proper category (i.e. they are not the result of a merger...

Distributed flow sensing for closed-loop speed control of a flexible fish robot.

Science.gov (United States)

Zhang, Feitian; Lagor, Francis D; Yeo, Derrick; Washington, Patrick; Paley, Derek A

2015-10-23

Flexibility plays an important role in fish behavior by enabling high maneuverability for predator avoidance and swimming in turbulent flow. This paper presents a novel flexible fish robot equipped with distributed pressure sensors for flow sensing. The body of the robot is molded from soft, hyperelastic material, which provides flexibility. Its Joukowski-foil shape is conducive to modeling the fluid analytically. A quasi-steady potential-flow model is adopted for real-time flow estimation, whereas a discrete-time vortex-shedding flow model is used for higher-fidelity simulation. The dynamics for the flexible fish robot yield a reduced model for one-dimensional swimming. A recursive Bayesian filter assimilates pressure measurements to estimate flow speed, angle of attack, and foil camber. The closed-loop speed-control strategy combines an inverse-mapping feedforward controller based on an average model derived for periodic actuation of angle-of-attack and a proportional-integral feedback controller utilizing the estimated flow information. Simulation and experimental results are presented to show the effectiveness of the estimation and control strategy. The paper provides a systematic approach to distributed flow sensing for closed-loop speed control of a flexible fish robot by regulating the flapping amplitude.

CNS role evolution.

Science.gov (United States)

Payne, J L; Baumgartner, R G

1996-01-01

THE CNS ROLE has been actualized in a variety of ways. Flexibility-inherent in the role-and the revolution in health care consciousness tend to place the CNS at risk for criticism regarding value to the organization. At Vanderbilt University Medical Center, a CNS task force evaluated the current reality of CNS practice and recommended role changes to include the financial analysis of patient care. After incorporating a financial perspective into our present practice, we have embarked on an interesting journey of post-Master's degree study, that of the tertiary care nurse practitioner. This practice option could elevated the clinical and financial aspects of providing cost-effective health care to a more autonomous role form; however, the transition has been challenging. Since 1990, the American Nurses Association has recommended that nursing school curricula change to meet the needs of the health care environment and provide increased career flexibility through creating one advanced degree incorporating both CNS and NP functions. Swiftly moving past differences and toward similarities will bridge the gap for advanced practice nurses in the future.

Above-threshold ionization in multicenter molecules: The role of the initial state

Science.gov (United States)

Suárez, Noslen; Chacón, Alexis; Pisanty, Emilio; Ortmann, Lisa; Landsman, Alexandra S.; Picón, Antonio; Biegert, Jens; Lewenstein, Maciej; Ciappina, Marcelo F.

2018-03-01

A possible route to extract electronic and nuclear dynamics from molecular targets with attosecond temporal and nanometer spatial resolution is to employ recolliding electrons as "probes." The recollision process in molecules is, however, very challenging to treat using ab initio approaches. Even for the simplest diatomic systems, such as H2, today's computational capabilities are not enough to give a complete description of the electron and nuclear dynamics initiated by a strong laser field. As a consequence, approximate qualitative descriptions are called to play an important role. In this paper we extend the work presented in Suárez et al. [N. Suárez, A. Chacón, J. A. Pérez-Hernández, J. Biegert, M. Lewenstein, and M. F. Ciappina, High-order-harmonic generation in atomic and molecular systems, Phys. Rev. A 95, 033415 (2017), 10.1103/PhysRevA.95.033415] to three-center molecular targets. Additionally, we incorporate a more accurate description of the molecular ground state, employing information extracted from quantum chemistry software packages. This step forward allows us to include, in a detailed way, both the molecular symmetries and nodes present in the high-occupied molecular orbital. We are able, on the one hand, to keep our formulation as analytical as in the case of diatomics and, on the other hand, to still give a complete description of the underlying physics behind the above-threshold ionization process. The application of our approach to complex multicenter—with more than three centers—targets appears to be straightforward.

The flexible loop L1 of the H3K4 demethylase JARID1B ARID domain has a crucial role in DNA-binding activity

International Nuclear Information System (INIS)

Yao, Wenming; Peng, Yu; Lin, Donghai

2010-01-01

JARID1B, a member of the JmjC demethylase family, has a crucial role in H3K4me3 demethylation. The ARID domain is a potential DNA-binding domain of JARID1B. Previous studies indicate that a GC-rich DNA motif is the specific target of the ARID domain. However, the details of the interaction between the ARID domain and duplex DNA require further study. Here, we utilized NMR spectroscopy to assign the backbone amino acids and mapped the DNA-binding sites of the human JARID1B ARID domain. Perturbations to 1 H- 15 N correlation spectra revealed that the flexible loop L1 of ARID was the main DNA-binding interface. EMSA and intrinsic fluorescence experiments demonstrated that mutations on loop L1 strongly reduced the DNA-binding activity of JARID1B ARID. Furthermore, transfection of mutant forms resulted in a distinct loss of intrinsic H3K4 demethylase activity, implying that the flexible loop L1 made a major contribution to sustaining the DNA-binding ability of JARID1B ARID domain.

Flexible supercapacitor electrodes based on real metal-like cellulose papers.

Science.gov (United States)

Ko, Yongmin; Kwon, Minseong; Bae, Wan Ki; Lee, Byeongyong; Lee, Seung Woo; Cho, Jinhan

2017-09-14

The effective implantation of conductive and charge storage materials into flexible frames has been strongly demanded for the development of flexible supercapacitors. Here, we introduce metallic cellulose paper-based supercapacitor electrodes with excellent energy storage performance by minimizing the contact resistance between neighboring metal and/or metal oxide nanoparticles using an assembly approach, called ligand-mediated layer-by-layer assembly. This approach can convert the insulating paper to the highly porous metallic paper with large surface areas that can function as current collectors and nanoparticle reservoirs for supercapacitor electrodes. Moreover, we demonstrate that the alternating structure design of the metal and pseudocapacitive nanoparticles on the metallic papers can remarkably increase the areal capacitance and rate capability with a notable decrease in the internal resistance. The maximum power and energy density of the metallic paper-based supercapacitors are estimated to be 15.1 mW cm -2 and 267.3 μWh cm -2 , respectively, substantially outperforming the performance of conventional paper or textile-type supercapacitors.With ligand-mediated layer-by-layer assembly between metal nanoparticles and small organic molecules, the authors prepare metallic paper electrodes for supercapacitors with high power and energy densities. This approach could be extended to various electrodes for portable/wearable electronics.

Atkins' molecules

CERN Document Server

Atkins, Peters

2003-01-01

Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

Glycomics: revealing the dynamic ecology and evolution of sugar molecules.

Science.gov (United States)

Springer, Stevan A; Gagneux, Pascal

2016-03-01

Sugars are the most functionally and structurally diverse molecules in the biological world. Glycan structures range from tiny single monosaccharide units to giant chains thousands of units long. Some glycans are branched, their monosaccharides linked together in many different combinations and orientations. Some exist as solitary molecules; others are conjugated to proteins and lipids and alter their collective functional properties. In addition to structural and storage roles, glycan molecules participate in and actively regulate physiological and developmental processes. Glycans also mediate cellular interactions within and between individuals. Their roles in ecology and evolution are pivotal, but not well studied because glycan biochemistry requires different methods than standard molecular biology practice. The properties of glycans are in some ways convenient, and in others challenging. Glycans vary on organismal timescales, and in direct response to physiological and ecological conditions. Their mature structures are physical records of both genetic and environmental influences during maturation. We describe the scope of natural glycan variation and discuss how studying glycans will allow researchers to further integrate the fields of ecology and evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

Flexible magnetoimpidence sensor

KAUST Repository

Kavaldzhiev, Mincho

2015-05-01

Recently, flexible electronic devices have attracted increasing interest, due to the opportunities they promise for new applications such as wearable devices, where the components are required to flex during normal use[1]. In this light, different magnetic sensors, like microcoil, spin valve, giant magnetoresistance (GMR), magnetoimpedance (MI), have been studied previously on flexible substrates.

Global Analysis of Flexible Risers

DEFF Research Database (Denmark)

Banke, Lars

1996-01-01

Flexible pipes are often a technically attractive alternative to the traditional steel pipe. Often commercial utilisation of oil/gas fields depends on the use of flexible pipes. An example is when floating production vessels are used, where the flexible pipe follows the wave induced motions...

Dynamics of harmonic generation in atoms and molecules

International Nuclear Information System (INIS)

Boutu, W.

2007-09-01

Harmonics are generated when an ultra-short laser impulse with an energy of 10 14 W/cm 2 is focused on a gas jet. A radiation in the UV X range is then emitted in the direction of the incident laser beam. This radiation has a periodical spectral structure composed of odd harmonics of the fundamental frequency. The first part of this work is dedicated to the optimization of the harmonic radiation. We have studied an alternative and cheaper solution to the flexible mirror, we have used a set of concentric phase plates in order to control the spatial phase of the beam and create an enlarged square profile near the focusing spot. We show how different parameters like phase shift or luminous-flux density or jet position have an impact on the harmonic signal. This second part of this work deals with the generation of high order harmonics in N 2 and CO 2 molecules. The experimental setting is based on the RABITT method (reconstruction of the atto-second burst by interference of 2-photon transitions). We have observed the presence of a spectral minimum linked to a phenomena of quantum interferences between the molecule and the electron wave packet. Moreover, a shift in the spectral phase appears at the place of the interference. (A.C.)

Thermal ion-molecule reactions in oxygen-containing molecules

International Nuclear Information System (INIS)

Kumakura, Minoru

1981-02-01

The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)

Flexibility in insulin prescription

Directory of Open Access Journals (Sweden)

Sanjay Kalra

2016-01-01

Full Text Available This communication explores the concept of flexibility, a propos insulin preparations and insulin regimes used in the management of type 2 diabetes. The flexibility of an insulin regime or preparation is defined as their ability to be injected at variable times, with variable injection-meal time gaps, in a dose frequency and quantum determined by shared decision making, with a minimal requirement of glucose monitoring and health professional consultation, with no compromise on safety, efficiency and tolerability. The relative flexibility of various basal, prandial and dual action insulins, as well as intensive regimes, is compared. The biopsychosocial model of health is used to assess the utility of different insulins while encouraging a philosophy of flexible insulin usage.

Cold Rydberg molecules

Science.gov (United States)

Raithel, Georg; Zhao, Jianming

2017-04-01

Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

Adsorption of different amphiphilic molecules onto polystyrene latices.

Science.gov (United States)

Jódar-Reyes, A B; Ortega-Vinuesa, J L; Martín-Rodríguez, A

2005-02-15

In order to know the influence of the surface characteristics and the chain properties on the adsorption of amphiphilic molecules onto polystyrene latex, a set of experiments to study the adsorption of ionic surfactants, nonionic surfactants and an amphiphilic synthetic peptide on different latex dispersions was performed. The adsorbed amount versus the equilibrium surfactant concentration was determined. The main adsorption mechanism was the hydrophobic attraction between the nonpolar tail of the molecule and the hydrophobic regions of the latex surface. This attraction overcame the electrostatic repulsion between chains and latex surface with identical charge sign. However, the electrostatic interactions chain-surface and chain-chain also played a role. General patterns for the adsorption of ionic chains on charged latex surfaces could be established. Regarding the shape, the isotherms presented different plateaus corresponding to electrostatic effects and conformational changes. The surfactant size also affects the adsorption results: the higher the hydrophilic moiety in the surfactant molecule the lower the adsorbed amount.

Insertion of liquid crystal molecules into hydrocarbon monolayers

Energy Technology Data Exchange (ETDEWEB)

Popov, Piotr, E-mail: ppopov@kent.edu; Mann, Elizabeth K. [Department of Physics, Kent State University, Kent, Ohio 44242 (United States); Lacks, Daniel J. [Department of Chemical Engineering, Case Western Reserve University, Cleveland, Ohio 44106 (United States); Jákli, Antal [Liquid Crystal Institute, Kent State University, Kent, Ohio 44242-0001 (United States)

2014-08-07

Atomistic molecular dynamics simulations were carried out to investigate the molecular mechanisms of vertical surface alignment of liquid crystals. We study the insertion of nCB (4-Cyano-4{sup ′}-n-biphenyl) molecules with n = 0,…,6 into a bent-core liquid crystal monolayer that was recently found to provide good vertical alignment for liquid crystals. The results suggest a complex-free energy landscape for the liquid crystal within the layer. The preferred insertion direction of the nCB molecules (core or tail first) varies with n, which can be explained by entropic considerations. The role of the dipole moments was found to be negligible. As vertical alignment is the leading form of present day liquid crystal displays (LCD), these results will help guide improvement of the LCD technology, as well as lend insight into the more general problem of insertion of biological and other molecules into lipid and surfactant layers.

Flexible Microsphere-Embedded Film for Microsphere-Enhanced Raman Spectroscopy.

Science.gov (United States)

Xing, Cheng; Yan, Yinzhou; Feng, Chao; Xu, Jiayu; Dong, Peng; Guan, Wei; Zeng, Yong; Zhao, Yan; Jiang, Yijian

2017-09-27

Dielectric microspheres with extraordinary microscale optical properties, such as photonic nanojets, optical whispering-gallery modes (WGMs), and directional antennas, have drawn interest in many research fields. Microsphere-enhanced Raman spectroscopy (MERS) is an alternative approach for enhanced Raman detection by dielectric microstructures. Unfortunately, fabrication of microsphere monolayer arrays is the major challenge of MERS for practical applications on various specimen surfaces. Here we report a microsphere-embedded film (MF) by immersing a highly refractive microsphere monolayer array in the poly(dimethylsiloxane) (PDMS) film as a flexible MERS sensing platform for one- to three-dimensional (1D to 3D) specimen surfaces. The directional antennas and wave-guided whispering-gallery modes (WG-WGMs) contribute to the majority of Raman enhancement by the MFs. Moreover, the MF can be coupled with surface-enhanced Raman spectroscopy (SERS) to provide an extra >10-fold enhancement. The limit of detection is therefore improved for sensing of crystal violet (CV) and Sudan I molecules in aqueous solutions at concentrations down to 10 -7 M. A hybrid dual-layer microsphere enhancer, constructed by depositing a MF onto a microsphere monolayer array, is also demonstrated, wherein the WG-WGMs become dominant and boost the enhancement ratio >50-fold. The present work opens up new opportunities for design of cost-effective and flexible MERS sensing platforms as individual or associated techniques toward practical applications in ultrasensitive Raman detection.

EDITORIAL: Focus on Cold and Ultracold Molecules FOCUS ON COLD AND ULTRACOLD MOLECULES

Science.gov (United States)

Carr, Lincoln D.; Ye, Jun

2009-05-01

and H Pu Collisions of bosonic ultracold polar molecules in microwave traps Alexander V Avdeenkov Cold TiO(X3Δ)-He collisions Mei-Ju Lu and Jonathan D Weinstein Investigation of dephasing rates in an interacting Rydberg gas U Raitzsch, R Heidemann, H Weimer, B Butscher, P Kollmann, R Löw, H P Büchler and T Pfau Impact of electric fields on highly excited rovibrational states of polar dimers Rosario González-Férez and Peter Schmelcher Phase transition from straight into twisted vortex lines in dipolar Bose-Einstein condensates M Klawunn and L Santos Stimulating the production of deeply bound RbCs molecules with laser pulses: the role of spin-orbit coupling in forming ultracold molecules Subhas Ghosal, Richard J Doyle, Christiane P Koch and Jeremy M Hutson Sensitive measurement of mp/me variance using vibrational transition frequencies of cold molecules Masatoshi Kajita

Education for Flexible Personality

Directory of Open Access Journals (Sweden)

Bogomir Novak

1998-12-01

Full Text Available Flexible personality transforms both cultural environment and itself. Post-modern personality is both contemplative and active. On one hand, it is subject to inner imagination of a creative act, and on the other hand, to creation of a tangible product What is more, flexible personality is also autonomous, mature, healthy and well balanced, as well as stable and responsive to the demand for change. Due to ever quicker changes, flexible personality is a must. And it is a task. The impact of professional work of adults on the education of children, however, is being conditioned by the exrigid family and rigid enterprises or institutions in which adults are employed. Nevertheless, flexible educational style is not repressive, as it used to be, nor permissive and totally concentrated on the child. It is a choice between the two qualities. The educators' style is dependent on their attitude towards life (play and self-education and not only towards work. Nowadays, flexibility is a way towards quality management of social and personal changes.

Study of molecule-metal interfaces by means of the normal incidence X-ray standing wave technique

International Nuclear Information System (INIS)

Mercurio, Giuseppe

2012-01-01

Functional surfaces based on monolayers of organic molecules are currently subject of an intense research effort due to their applications in molecular electronics, sensing and catalysis. Because of the strong dependence of organic based devices on the local properties of the molecule-metal interface, a direct investigation of the interface chemistry is of paramount importance. In this context, the bonding distance, measured by means of the normal incidence X-ray standing wave technique (NIXSW), provides a direct access to the molecule-metal interactions. At the same time, NIXSW adsorption heights are used to benchmark different density functional theory (DFT) schemes and determine the ones with predictive power for similar systems. This work investigates the geometric and chemical properties of different molecule/metal interfaces, relevant to molecular electronics and functional surfaces applications, primarily by means of the NIXSW technique. All NIXSW data are analyzed with the newly developed open source program Torricelli, which is thoroughly documented in the thesis. In order to elucidate the role played by the substrate within molecule/metal interfaces, the prototype organic molecule 3,4,9,10-perylene-tetracarboxylic-dianhydride (PTCDA) is explored on the Ag(110) surface. The molecule results more distorted and at smaller bonding distances on the more reactive Ag(110) surface, in comparison with the Ag(100), the Ag(111) and Au(111) substrates. This conclusion follows from the detailed molecular adsorption geometry obtained from the differential analysis of nonequivalent carbon and oxygen species (including a careful error analysis). Subsequently, the chemisorptive PTCDA/Ag(110) interaction is tuned by the co-deposition of an external alkali metal, namely K. As a consequence, the functional groups of PTCDA unbind from the surface, which, in turn, undergoes major reconstruction. In fact, the resulting nanopatterned surface consists of alternated up and down

Method of osmotic energy harvesting using responsive compounds and molecules

KAUST Repository

Hu, Xiao

2017-07-27

The present invention discloses and claims a more efficient and economical method and system for osmotic energy production and capture using responsive compounds and molecules. The present invention is an energy harvest system enabled by stimuli responsive draw solutions that are competent in terms of energy production, geographic location flexibility, and the affordable, efficient and economical production and delivery of osmotic power. Specifically, the present invention is a novel osmotic power system that uses stimuli responsive draw solutions, economically feasible larger permeable membranes, and low grade heat sources to deliver osmotic power more efficiently and economically with less negative environmental impact, greater power output, and located in more geographically diverse areas of the world than previously thought possible for supporting such a power source.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

Science.gov (United States)

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Along the Central Dogma-Controlling Gene Expression with Small Molecules.

Science.gov (United States)

Schneider-Poetsch, Tilman; Yoshida, Minoru

2018-05-04

The central dogma of molecular biology, that DNA is transcribed into RNA and RNA translated into protein, was coined in the early days of modern biology. Back in the 1950s and 1960s, bacterial genetics first opened the way toward understanding life as the genetically encoded interaction of macromolecules. As molecular biology progressed and our knowledge of gene control deepened, it became increasingly clear that expression relied on many more levels of regulation. In the process of dissecting mechanisms of gene expression, specific small-molecule inhibitors played an important role and became valuable tools of investigation. Small molecules offer significant advantages over genetic tools, as they allow inhibiting a process at any desired time point, whereas mutating or altering the gene of an important regulator would likely result in a dead organism. With the advent of modern sequencing technology, it has become possible to monitor global cellular effects of small-molecule treatment and thereby overcome the limitations of classical biochemistry, which usually looks at a biological system in isolation. This review focuses on several molecules, especially natural products, that have played an important role in dissecting gene expression and have opened up new fields of investigation as well as clinical venues for disease treatment. Expected final online publication date for the Annual Review of Biochemistry Volume 87 is June 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

Van Der Waals Heterostructures between Small Organic Molecules and Layered Substrates

Directory of Open Access Journals (Sweden)

Han Huang

2016-09-01

Full Text Available Two dimensional atomic crystals, like grapheme (G and molybdenum disulfide (MoS2, exhibit great interest in electronic and optoelectronic applications. The excellent physical properties, such as transparency, semiconductivity, and flexibility, make them compatible with current organic electronics. Here, we review recent progress in the understanding of the interfaces of van der Waals (vdW heterostructures between small organic molecules (pentacene, copper phthalocyanine (CuPc, perylene-3,4,9,10-tetracarboxylic dianhydride (PTCDA, and dioctylbenzothienobenzothiophene (C8-BTBT and layered substrates (G, MoS2 and hexagonal boron nitride (h-BN. The influences of the underlying layered substrates on the molecular arrangement, electronic and vibrational properties will be addressed.

In silico single-molecule manipulation of DNA with rigid body dynamics.

Directory of Open Access Journals (Sweden)

Pascal Carrivain

2014-02-01

Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

Innovation and behavioral flexibility in wild redfronted lemurs (Eulemur rufifrons).

Science.gov (United States)

Huebner, Franziska; Fichtel, Claudia

2015-05-01

Innovations and problem-solving abilities can provide animals with important ecological advantages as they allow individuals to deal with novel social and ecological challenges. Innovation is a solution to a novel problem or a novel solution to an old problem, with the latter being especially difficult. Finding a new solution to an old problem requires individuals to inhibit previously applied solutions to invent new strategies and to behave flexibly. We examined the role of experience on cognitive flexibility to innovate and to find new problem-solving solutions with an artificial feeding task in wild redfronted lemurs (Eulemur rufifrons). Four groups of lemurs were tested with feeding boxes, each offering three different techniques to extract food, with only one technique being available at a time. After the subjects learned a technique, this solution was no longer successful and subjects had to invent a new technique. For the first transition between task 1 and 2, subjects had to rely on their experience of the previous technique to solve task 2. For the second transition, subjects had to inhibit the previously learned technique to learn the new task 3. Tasks 1 and 2 were solved by most subjects, whereas task 3 was solved by only a few subjects. In this task, besides behavioral flexibility, especially persistence, i.e., constant trying, was important for individual success during innovation. Thus, wild strepsirrhine primates are able to innovate flexibly, suggesting a general ecological relevance of behavioral flexibility and persistence during innovation and problem solving across all primates.

Electron-excited molecule interactions

International Nuclear Information System (INIS)

Christophorou, L.G.; Tennessee Univ., Knoxville, TN

1991-01-01

In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

Role of impurity molecules in radiation-initiated processes in solid carbohydrates

International Nuclear Information System (INIS)

Kavetskii, V.G.; Yudin, I.V.

1992-01-01

Extension of the use of ionizing radiation for sterilization of medicinal preparations is stimulating the study of radiation-initiated processes in solid polyhydroxyl matrixes containing impurities of various organic substances. Such investigations make it possible to establish common characteristics of the effect of impurity molecules on the radiolysis of organic crystals. The materials of the investigation were lactose and rhamnose, precipitated by slow evaporation of the solvent from saturated aqueous solutions with different dihydroxyacetone contents. 4 refs., 1 fig

DAT/SERT Selectivity of Flexible GBR 12909 Analogs Modeled Using 3D-QSAR Methods

Science.gov (United States)

Gilbert, Kathleen M.; Boos, Terrence L.; Dersch, Christina M.; Greiner, Elisabeth; Jacobson, Arthur E.; Lewis, David; Matecka, Dorota; Prisinzano, Thomas E.; Zhang, Ying; Rothman, Richard B.; Rice, Kenner C.; Venanzi, Carol A.

2007-01-01

The dopamine reuptake inhibitor GBR 12909 (1-{2-[bis(4-fluorophenyl)methoxy]ethyl}-4-(3-phenylpropyl)piperazine, 1) and its analogs have been developed as tools to test the hypothesis that selective dopamine transporter (DAT) inhibitors will be useful therapeutics for cocaine addiction. This 3D-QSAR study focuses on the effect of substitutions in the phenylpropyl region of 1. CoMFA and CoMSIA techniques were used to determine a predictive and stable model for the DAT/serotonin transporter (SERT) selectivity (represented by pKi (DAT/SERT)) of a set of flexible analogs of 1, most of which have eight rotatable bonds. In the absence of a rigid analog to use as a 3D-QSAR template, six conformational families of analogs were constructed from six pairs of piperazine and piperidine template conformers identified by hierarchical clustering as representative molecular conformations. Three models stable to y-value scrambling were identified after a comprehensive CoMFA and CoMSIA survey with Region Focusing. Test set correlation validation led to an acceptable model, with q2 = 0.508, standard error of prediction = 0.601, two components, r2 = 0.685, standard error of estimate = 0.481, F value = 39, percent steric contribution = 65, and percent electrostatic contribution = 35. A CoMFA contour map identified areas of the molecule that affect pKi (DAT/SERT). This work outlines a protocol for deriving a stable and predictive model of the biological activity of a set of very flexible molecules. PMID:17127069

Graphene-cellulose paper flexible supercapacitors

Energy Technology Data Exchange (ETDEWEB)

Weng, Zhe; Su, Yang; Li, Feng; Du, Jinhong; Cheng, Hui-Ming [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Wang, Da-Wei [ARC Centre of Excellence for Functional Nanomaterials, Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, St Lucia, Brisbane, Qld 4072 (Australia)

2011-10-15

A simple and scalable method to fabricate graphene-cellulose paper (GCP) membranes is reported; these membranes exhibit great advantages as freestanding and binder-free electrodes for flexible supercapacitors. The GCP electrode consists of a unique three-dimensional interwoven structure of graphene nanosheets and cellulose fibers and has excellent mechanical flexibility, good specific capacitance and power performance, and excellent cyclic stability. The electrical conductivity of the GCP membrane shows high stability with a decrease of only 6% after being bent 1000 times. This flexible GCP electrode has a high capacitance per geometric area of 81 mF cm{sup -2}, which is equivalent to a gravimetric capacitance of 120 F g{sup -1} of graphene, and retains >99% capacitance over 5000 cycles. Several types of flexible GCP-based polymer supercapacitors with various architectures are assembled to meet the power-energy requirements of typical flexible or printable electronics. Under highly flexible conditions, the supercapacitors show a high capacitance per geometric area of 46 mF cm{sup -2} for the complete devices. All the results demonstrate that polymer supercapacitors made using GCP membranes are versatile and may be used for flexible and portable micropower devices. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

The role of p53 molecule in radiation and hyperthermic therapies

International Nuclear Information System (INIS)

Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

2003-01-01

In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

Specialization and Flexibility in Port Cargo Handling

Directory of Open Access Journals (Sweden)

Hakkı KİŞİ

2016-11-01

Full Text Available Cargo handling appears to be the fundamental function of ports. In this context, the question of type of equipment and capacity rate need to be tackled with respect to cargo handling principles. The purpose of this study is to discuss the types of equipment to be used in ports, relating the matter to costs and capacity. The question is studied with a basic economic theoretical approach. Various conditions like port location, size, resources, cargo traffic, ships, etc. are given parameters to dictate the type and specification of the cargo handling equipment. Besides, a simple approach in the context of cost capacity relation can be useful in deciding whether to use specialized or flexible equipment. Port equipment is sometimes expected to be flexible to handle various types of cargo as many as possible and sometimes to be specialized to handle one specific type of cargo. The cases that might be suitable for those alternatives are discussed from an economic point of view in this article. Consequently, effectiveness and efficiency criteria play important roles in determining the handling equipment in ports.

Mycosporine-like amino acids are multifunctional molecules in sea hares and their marine community

Science.gov (United States)

Kicklighter, Cynthia E.; Kamio, Michiya; Nguyen, Linh; Germann, Markus W.; Derby, Charles D.

2011-01-01

Molecules of keystone significance are relatively rare, yet mediate a variety of interactions between organisms. They influence the distribution and abundance of species, the transfer of energy across multiple trophic levels, and thus they play significant roles in structuring ecosystems. Despite their potential importance in facilitating our understanding of ecological systems, only three molecules thus far have been proposed as molecules of keystone significance: saxitoxin and dimethyl sulfide in marine communities and tetrodotoxin in riparian communities. In the course of studying the neuroecology of chemical defenses, we identified three mycosporine-like amino acids (MAAs)—N-ethanol palythine (= asterina-330), N-isopropanol palythine (= aplysiapalythine A), and N-ethyl palythine (= aplysiapalythine B)—as intraspecific alarm cues for sea hares (Aplysia californica). These alarm cues are released in the ink secretion of sea hares and cause avoidance behaviors in neighboring conspecifics. Further, we show that these three bioactive MAAs, two [aplysiapalythine A (APA) and -B (APB)] being previously unknown molecules, are present in the algal diet of sea hares and are concentrated in their defensive secretion as well as in their skin. MAAs are known to be produced by algae, fungi, and cyanobacteria and are acquired by many aquatic animals through trophic interactions. MAAs are widely used as sunscreens, among other uses, but sea hares modify their function to serve a previously undocumented role, as intraspecific chemical cues. Our findings highlight the multifunctionality of MAAs and their role in ecological connectivity, suggesting that they may function as molecules of keystone significance in marine ecosystems. PMID:21709250

Single-Molecule Interfacial Electron Transfer

Energy Technology Data Exchange (ETDEWEB)

Ho, Wilson [Univ. of California, Irvine, CA (United States)

2018-02-03

Interfacial electron transfer (ET) plays an important role in many chemical and biological processes. Specifically, interfacial ET in TiO₂-based systems is important to solar energy technology, catalysis, and environmental remediation technology. However, the microscopic mechanism of interfacial ET is not well understood with regard to atomic surface structure, molecular structure, bonding, orientation, and motion. In this project, we used two complementary methodologies; single-molecule fluorescence spectroscopy, and scanning-tunneling microscopy and spectroscopy (STM and STS) to address this scientific need. The goal of this project was to integrate these techniques and measure the molecular dependence of ET between adsorbed molecules and TiO₂ semiconductor surfaces and the ET induced reactions such as the splitting of water. The scanning probe techniques, STM and STS, are capable of providing the highest spatial resolution but not easily time-resolved data. Single-molecule fluorescence spectroscopy is capable of good time resolution but requires further development to match the spatial resolution of the STM. The integrated approach involving Peter Lu at Bowling Green State University (BGSU) and Wilson Ho at the University of California, Irvine (UC Irvine) produced methods for time and spatially resolved chemical imaging of interfacial electron transfer dynamics and photocatalytic reactions. An integral aspect of the joint research was a significant exchange of graduate students to work at the two institutions. This project bridged complementary approaches to investigate a set of common problems by working with the same molecules on a variety of solid surfaces, but using appropriate techniques to probe under ambient (BGSU) and ultrahigh vacuum (UCI) conditions. The molecular level understanding of the fundamental interfacial electron transfer processes obtained in this joint project will be important for developing efficient light harvesting

Three-dimensional formulation of rigid-flexible multibody systems with flexible beam elements

International Nuclear Information System (INIS)

Garcia-Vallejo, D.; Mayo, J.; Escalona, J. L.; Dominguez, J.

2008-01-01

Multibody systems generally contain solids with appreciable deformations and which decisively influence the dynamics of the system. These solids have to be modeled by means of special formulations for flexible solids. At the same time, other solids are of such a high stiffness that they may be considered rigid, which simplifies their modeling. For these reasons, for a rigid-flexible multibody system, two types of formulations coexist in the equations of the system. Among the different possibilities provided in the literature on the material, the formulation in natural coordinates and the formulation in absolute nodal coordinates are utilized in this paper to model the rigid and flexible solids, respectively. This paper contains a mixed formulation based on the possibility of sharing coordinates between a rigid solid and a flexible solid. The global mass matrix of the system is shown to be constant and, in addition, many of the constraint equations obtained upon utilizing these formulations are linear and can be eliminated

Applications of cross sections for electron-molecule collision processes

International Nuclear Information System (INIS)

Cartwright, D.C.

1985-01-01

The role of electron-molecule collision cross sections is discussed for the study of the ionospheric and auroral processes in planetary atmospheres and of discharge-pumped lasers. These two areas emphasize the importance of further theoretical and experimental studies concerning electron-impact processes. 13 refs., 3 figs., 2 tabs

Ultrafast single-molecule photonics: Excited state dynamics in coherently coupled complexes

International Nuclear Information System (INIS)

Hernando, Jordi; Hoogenboom, Jacob; Dijk, Erik van; Garcia-Parajo, Maria; Hulst, Niek F. van

2008-01-01

We present a single-molecule study on femtosecond dynamics in multichromophoric systems, combining fs pump-probe, emission-spectra and fluorescence-lifetime analysis. The ultrafast fs approach gives direct information on the initial exciton dynamics after excitation. The lifetime data show superradiance, a direct measure for the extent of the coherent coupling and static disorder. The spectra finally reveal the role of exciton-phonon coupling. At the single-molecule level a wide range of exciton delocalization lengths and energy redistribution times is revealed

Ultrafast single-molecule photonics: Excited state dynamics in coherently coupled complexes

Energy Technology Data Exchange (ETDEWEB)

Hernando, Jordi [Dept. de Quimica, Universitat Autonoma Barcelona, 08193 Cerdanyola del Valles (Spain); Hoogenboom, Jacob [ICFO-Institut de Ciencies Fotoniques, Mediterranean Technology Park, 08860 Castelldefels, Barcelona (Spain); Dijk, Erik van [Applied Optics Group, MESA Institute for Nanotechnology, University of Twente, 7500AE Enschede (Netherlands); Garcia-Parajo, Maria [IBEC-Institute of BioEngineering of Catalunya, 08028 Barcelona (Spain); ICREA-Institucio Catalana de Recerca i Estudis Avancats, 08015 Barcelona (Spain); Hulst, Niek F. van [ICFO-Institut de Ciencies Fotoniques, Mediterranean Technology Park, 08860 Castelldefels, Barcelona (Spain) and ICREA-Institucio Catalana de Recerca i Estudis Avancats, 08015 Barcelona (Spain)], E-mail: Niek.vanHulst@ICFO.es

2008-05-15

We present a single-molecule study on femtosecond dynamics in multichromophoric systems, combining fs pump-probe, emission-spectra and fluorescence-lifetime analysis. The ultrafast fs approach gives direct information on the initial exciton dynamics after excitation. The lifetime data show superradiance, a direct measure for the extent of the coherent coupling and static disorder. The spectra finally reveal the role of exciton-phonon coupling. At the single-molecule level a wide range of exciton delocalization lengths and energy redistribution times is revealed.

Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: A peculiar role of geometry

Energy Technology Data Exchange (ETDEWEB)

Aryanpour, Karan [Department of Physics, University of Arizona, Tucson, Arizona 85721 (United States); Shukla, Alok [Department of Physics, Indian Institute of Technology, Powai, Mumbai 400076 (India); Mazumdar, Sumit [Department of Physics, University of Arizona, Tucson, Arizona 85721 (United States); College of Optical Sciences, University of Arizona, Tucson, Arizona 85721 (United States)

2014-03-14

We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D{sub 6h} point group symmetry versus ovalene with D{sub 2h} symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D{sub 6h} group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D{sub 2h} ovalene but not in those with D{sub 6h} symmetry.

Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: A peculiar role of geometry

International Nuclear Information System (INIS)

Aryanpour, Karan; Shukla, Alok; Mazumdar, Sumit

2014-01-01

We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D 6h point group symmetry versus ovalene with D 2h symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D 6h group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D 2h ovalene but not in those with D 6h symmetry

Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: a peculiar role of geometry.

Science.gov (United States)

Aryanpour, Karan; Shukla, Alok; Mazumdar, Sumit

2014-03-14

We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D(6h) point group symmetry versus ovalene with D(2h) symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D(6h) group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D(2h) ovalene but not in those with D(6h) symmetry.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Development of the Coping Flexibility Scale: Evidence for the Coping Flexibility Hypothesis

Science.gov (United States)

Kato, Tsukasa

2012-01-01

"Coping flexibility" was defined as the ability to discontinue an ineffective coping strategy (i.e., evaluation coping) and produce and implement an alternative coping strategy (i.e., adaptive coping). The Coping Flexibility Scale (CFS) was developed on the basis of this definition. Five studies involving approximately 4,400 Japanese…

Timing-based business models for flexibility creation in the electric power sector

International Nuclear Information System (INIS)

Helms, Thorsten; Loock, Moritz; Bohnsack, René

2016-01-01

Energy policies in many countries push for an increase in the generation of wind and solar power. Along these developments, the balance between supply and demand becomes more challenging as the generation of wind and solar power is volatile, and flexibility of supply and demand becomes valuable. As a consequence, companies in the electric power sector develop new business models that create flexibility through activities of timing supply and demand. Based on an extensive qualitative analysis of interviews and industry research in the energy industry, the paper at hand explores the role of timing-based business models in the power sector and sheds light on the mechanisms of flexibility creation through timing. In particular we distill four ideal-type business models of flexibility creation with timing and reveal how they can be classified along two dimensions, namely costs of multiplicity and intervention costs. We put forward that these business models offer ‘coupled services’, combining resource-centered and service-centered perspectives. This complementary character has important implications for energy policy. - Highlights: •Explores timing-based business models providing flexibility in the energy industry. •Timing-based business models can be classified on two dimensions. •Timing-based business models offer ‘coupled services’. • ‘Coupled services’ couple timing as a service with supply- or demand side valuables. •Policy and managerial implications for energy market design.

Positron-Electron Annihilation Process in (2,2)-Difluoropropane Molecule

Science.gov (United States)

Liu, Yang; Ma, Xiao-Guang; Zhu, Ying-Hao

2016-04-01

The positron-electron annihilation process in (2,2)-difluoropropane molecule and the corresponding gamma-ray spectra are studied by quantum chemistry method. The positrophilic electrons in (2,2)-difluoropropane molecule are found for the first time. The theoretical predictions show that the outermost 2s electrons of fluoride atoms play an important role in positron-electron annihilation process of (2,2)-difiuoropropane. In the present scheme, the correlation coefficient between the theoretical gamma-ray spectra and the experiments can be 99%. The present study gives an alternative annihilation model for positron-electron pair in larger molecules. Supported by the National Natural Science Foundation of China under Grant No. 11347011 and the Natural Science Foundation Project of Shandong Province under Grant No. ZR2011AM010 and 2014 Technology Innovation Fund of Ludong University under Grant Nos. 1d151007 and ld15l016

Abstract flexibility description for virtual power plant scheduling

OpenAIRE

Fröhling, Judith

2017-01-01

In the ongoing paradigm shift of the energy market from big power plants to more and more small and decentralized power plants, virtual power plants (VPPs) play an important role. VPPs bundle the capacities of the small and decentralized resources (DER). Planing of VPP operation, that is also called scheduling, relies on the flexibilities of controllable DER in the VPP, e.g., combined heat and power plants (CHPs), heat pumps and batteries. The aim of this thesis is the development of an abstr...

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

OpenAIRE

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...

Labour Market Flexibility between Risk and Opportunity for Gender Equality Analyses of Self-employment, Part-time Work, and Job Autonomy

OpenAIRE

König, Stefanie

2016-01-01

The dissertation “Labour Market Flexibility between Risk and Opportunity for Gender Equality – Analyses of Self-employment, Part-time Work, and Job Autonomy” addresses the main research question: Is flexibility the key to a less gendered labour market, or does it rather foster more traditional roles and gender inequality? In four empirical studies, different aspects in life were investigated in order to gain a holistic understanding of gender inequalities related to flexibility at work: the d...

Ultra-cold molecule production

International Nuclear Information System (INIS)

Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

2005-01-01

The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

Unsolved problems of crystallization and melting of flexible macromolecules

International Nuclear Information System (INIS)

Wunderlich, B.

1992-01-01

The thermodynamics, kinetics, and computer simulations of crystallization and melting is discussed. The thermodynamics is shown to be well understood, although for many specific crystals not enough details for full description are available. Experiments on the crystallization kinetics of poly(ethylene) and poly(oxyethylene) in the presence of crystal nuclei as a function of molecular mass revealed that with increasing mass, the crystallization behavior deviates increasingly from that of small, rigid molecules. Instead of showing a continuously changing, linear crystallization rate with temperature through the equilibrium melting temperature, T m 0 , these flexible macromolecules show a region of practically zero crystallization rate between T m 0 and about (T m 0 - 15) K, creating a temperature region of metastability in the melt that cannot be broken by nucleation with pregrown crystals. Molecular Nucleation was proposed as a cooperative process to be of overriding importance for the description of polymer crystallization, and to be at the center of segregation of molecules of lower molecular mass by growing crystal fronts. Initial efforts to model sufficiently large crystals using Monte Carlo and molecular dynamics methods are presented. Some of the short-time intermediates in the melting, crystallization, and annealing processes seem to have little similarity to commonly assumed models of crystallization and melting and are presented as discussion topics

The Flexibility of Pusher Furnace Grate

Directory of Open Access Journals (Sweden)

Słowik J.A.

2016-12-01

Full Text Available The lifetime of guide grates in pusher furnaces for heat treatment could be increased by raising the flexibility of their structure through, for example, the replacement of straight ribs, parallel to the direction of grate movement, with more flexible segments. The deformability of grates with flexible segments arranged in two orientations, i.e. crosswise (perpendicular to the direction of compression and lengthwise (parallel to the direction of compression, was examined. The compression process was simulated using SolidWorks Simulation program. Relevant regression equations were also derived describing the dependence of force inducing the grate deformation by 0.25 mm ‒ modulus of grate elasticity ‒ on the number of flexible segments in established orientations. These calculations were made in Statistica and Scilab programs. It has been demonstrated that, with the same number of segments, the crosswise orientation of flexible segments increases the grate structure flexibility in a more efficient way than the lengthwise orientation. It has also been proved that a crucial effect on the grate flexibility has only the quantity and orientation of segments (crosswise / lengthwise, while the exact position of segments changes the grate flexibility by less than 1%.

Molecules in stars

International Nuclear Information System (INIS)

Tsuji, T.

1986-01-01

Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

High Performance Electronics on Flexible Silicon

KAUST Repository

Sevilla, Galo T.

2016-09-01

Over the last few years, flexible electronic systems have gained increased attention from researchers around the world because of their potential to create new applications such as flexible displays, flexible energy harvesters, artificial skin, and health monitoring systems that cannot be integrated with conventional wafer based complementary metal oxide semiconductor processes. Most of the current efforts to create flexible high performance devices are based on the use of organic semiconductors. However, inherent material\\'s limitations make them unsuitable for big data processing and high speed communications. The objective of my doctoral dissertation is to develop integration processes that allow the transformation of rigid high performance electronics into flexible ones while maintaining their performance and cost. In this work, two different techniques to transform inorganic complementary metal-oxide-semiconductor electronics into flexible ones have been developed using industry compatible processes. Furthermore, these techniques were used to realize flexible discrete devices and circuits which include metal-oxide-semiconductor field-effect-transistors, the first demonstration of flexible Fin-field-effect-transistors, and metal-oxide-semiconductors-based circuits. Finally, this thesis presents a new technique to package, integrate, and interconnect flexible high performance electronics using low cost additive manufacturing techniques such as 3D printing and inkjet printing. This thesis contains in depth studies on electrical, mechanical, and thermal properties of the fabricated devices.

Energy transfers between N_2(A"3Σ) nitrogen metastable molecules and oxygen atoms and molecules

International Nuclear Information System (INIS)

De Souza, Antonio Rogerio

1985-01-01

This research thesis aims at determining reaction coefficients for energy transfers between nitrogen in its metastable status and oxygen atoms and molecules, the variation of these coefficients with respect to temperature (mainly in the 200-400 K range), products formed and more particularly branching rates of O("1S) oxygen and of NO_2. Reaction coefficients are experimentally determined by using the technique of post-discharge in flow. The experimental set-up is described and the study of the best operating conditions is reported. In the next part, the author reports the study of the energy transfer between nitrogen in its metastable status N_2(A) and oxygen molecules. Reaction coefficients are determined for the first three vibrational levels. The author then reports the study of the transfer of N_2(A) molecules on oxygen atoms in their fundamental status. Reactions coefficients and their variations are determined for the three first vibrational levels. The author describes the dissociation method and the method of detection of atomic oxygen. A kinetic model is proposed for the analysis of formed products during a post-discharge in flow, and the branching rate for the formation of O("1S) oxygen between 190 and 365 K is determined. The author finally discusses publications on the role of these reactions in the interpretation of some atmospheric phenomena

Differential Role of CBT Skills, DBT Skills and Psychological Flexibility in Predicting Depressive versus Anxiety Symptom Improvement

Science.gov (United States)

Webb, Christian A.; Beard, Courtney; Kertz, Sarah J.; Hsu, Kean; Björgvinsson, Thröstur

2016-01-01

Objective Studies have reported associations between cognitive behavioral therapy (CBT) skill use and symptom improvement in depressed outpatient samples. However, little is known regarding the temporal relationship between different subsets of therapeutic skills and symptom change among relatively severely depressed patients receiving treatment in psychiatric hospital settings. Method Adult patients with major depression (N=173) receiving combined psychotherapeutic and pharmacological treatment at a psychiatric hospital completed repeated assessments of traditional CBT skills, DBT skills and psychological flexibility, as well as depressive and anxiety symptoms. Results Results indicated that only use of behavioral activation (BA) strategies significantly predicted depressive symptom improvement in this sample; whereas DBT skills and psychological flexibility predicted anxiety symptom change. In addition, a baseline symptom severity X BA strategies interaction emerged indicating that those patients with higher pretreatment depression severity exhibited the strongest association between use of BA strategies and depressive symptom improvement. Conclusions Findings suggest the importance of emphasizing the acquisition and regular use of BA strategies with severely depressed patients in short-term psychiatric settings. In contrast, an emphasis on the development of DBT skills and the cultivation of psychological flexibility may prove beneficial for the amelioration of anxiety symptoms. PMID:27057997

Transition metal chemistry of hydroxy(–OH)-rich molecules ...

Indian Academy of Sciences (India)

Administrator

Appropriately designed hydroxy(–OH) containing Schiff's base and Mannich base molecules have been recently found to be important for development of the coordination chemistry of a number of metal ions in the biomimetic chemistry of metalloenzymes. In this context, our group has studied the coordination role of these ...

Decision making under uncertainty and inertia constraints: sectoral implications of the when flexibility

International Nuclear Information System (INIS)

Lecocq, F.; Hourcade, J.-C.; Ha Duong, M.

1998-01-01

Current debates on climate mitigation emphasize the role of the inertia of the economic system. Our aim in this paper is to study in more depth how sectorally differentiated inertia impacts on optimal CO 2 -emission abatement policies. Using the STARTS model, we show that optimal abatement levels and costs differ sensibly among sectors. Differential inertia is the critical determinant of this trade-off, especially in the case of a 20-year delay in the action, or in an underestimation of the growth of the transportation sector. In particular, the burden of any additional abatement effort falls on the most flexible sector, i.e. the industry. Debates on mitigation emphasize the role of inertia of the economic system. This paper aims at studying more in depth how sectorally differentiated inertia should influence optimal CO 2 emission abatement policies. Using a two-sector version of STARTS, we show that under perfect expectations, optimal abatement profiles and associated costs differ sensibly between a flexible and a rigid sector (transportation). In a second step, we scrutinize the role of the uncertainty by testing the case of a 20-year delay of action and an underestimated growth of the transportation sector. We do this for three concentration ceilings and we point out the magnitude of the burden which falls on the flexible sector. We derive some policy implications for the ranking of public policies and for incentive instruments to be set up at international level. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

Deleted in Malignant Brain Tumors 1 is a versatile mucin-like molecule likely to play a differential role in digestive tract cancer

DEFF Research Database (Denmark)

Mollenhauer, J; Herbertz, S; Helmke, B

2001-01-01

Deleted in Malignant Brain Tumors 1 (DMBT1) has been proposed as a candidate tumor suppressor gene for brain, lung, and digestive tract cancer. In particular, alterations of the gene and/or a loss of expression have been observed in gastric, colorectal, and esophageal carcinomas. Initial evidence...... has accumulated that DMBT1 may represent a multifunctional protein. Because the consequences of a loss of DMBT1 function may be different depending on its original function in a particular tissue, we wondered if it is appropriate to assume a uniform role for DMBT1 in digestive tract carcinomas. We...... hypothesized that a systematic characterization of DMBT1 in the human alimentary tract would be useful to improve the understanding of this molecule and its role in digestive tract carcinomas. Our data indicate that the expression pattern and subcellular distribution of DMBT1 in the human alimentary tract...

Molecule Matters

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

In Search of Small Molecule Inhibitors Targeting the Flexible CK2 Subunit Interface

Directory of Open Access Journals (Sweden)

Benoît Bestgen

2017-02-01

Full Text Available Protein kinase CK2 is a tetrameric holoenzyme composed of two catalytic (α and/or α’ subunits and two regulatory (β subunits. Crystallographic data paired with fluorescence imaging techniques have suggested that the formation of the CK2 holoenzyme complex within cells is a dynamic process. Although the monomeric CK2α subunit is endowed with a constitutive catalytic activity, many of the plethora of CK2 substrates are exclusively phosphorylated by the CK2 holoenzyme. This means that the spatial and high affinity interaction between CK2α and CK2β subunits is critically important and that its disruption may provide a powerful and selective way to block the phosphorylation of substrates requiring the presence of CK2β. In search of compounds inhibiting this critical protein–protein interaction, we previously designed an active cyclic peptide (Pc derived from the CK2β carboxy-terminal domain that can efficiently antagonize the CK2 subunit interaction. To understand the functional significance of this interaction, we generated cell-permeable versions of Pc, exploring its molecular mechanisms of action and the perturbations of the signaling pathways that it induces in intact cells. The identification of small molecules inhibitors of this critical interaction may represent the first-choice approach to manipulate CK2 in an unconventional way.

Single molecule transcription factor dynamics in the syncytial Drosophila embryo

Science.gov (United States)

Darzacq, Xavier

During early development in the Drosophila embryo, cell fates are determined over the course of just 2 hours with exquisite spatio-temoral precision. One of the key regulators of this process is the transcription factor Bicoid which forms a concentration gradient across the long axis of the embryo. Although Bicoids' primary role is activation at the anterior, where concentrations are highest, it is also known to play a role in the posterior where there are only 100s of molecules per nucleus. Understanding how Bicoid can find its target at such low concentrations has remained intractable, largely due to the inability to perform single molecule imaging in the context of the developing embryo. Here we use lattice light sheet microscopy to overcome the technical barriers of sample thickness and auto-fluorescence to characterize the single molecule dynamics of Bicoid. We find that off-rates do not vary across the embryo and that instead the on-rates are modulated through the formation of clusters that enrich local concentration. This data is contrary to the current concentration dependent model of Bicoid function since local concentration within the nucleus is now a regulated parameter and suggests a previously unknown mechanism for regulation at extremely low concentrations.

Controlling Electrical Conductance through a π‐Conjugated Cruciform Molecule by Selective Anchoring to Gold Electrodes

DEFF Research Database (Denmark)

Huang, Cancan; Chen, Songjie; Ørnsø, Kristian Baruël

2015-01-01

Tuning charge transport at the single‐molecule level plays a crucial role in the construction of molecular electronic devices. Introduced herein is a promising and operationally simple approach to tune two distinct charge‐transport pathways through a cruciform molecule. Upon in situ cleavage of t...

Workplace flexibility: from research to action.

Science.gov (United States)

Galinsky, Ellen; Sakai, Kelly; Wigton, Tyler

2011-01-01

Ellen Galinsky, Kelly Sakai, and Tyler Wigton explore the "time famine" among American workers-the continuing sense among employees of not having enough time to manage the multiple responsibilities of work and personal and family life. Noting that large shares of U.S. employees report feeling the need for greater workplace flexibility to enable them to take better care of family responsibilities, the authors examine a large-scale community-engagement initiative to increase workplace flexibility voluntarily. Using the 2008 National Study of the Changing Workforce as a primary source of data, the authors begin with an overview of the prevalence of flexibility in today's American workplace. They track which categories of employees have access to various flexibility options, as well as the extent to which employees with access to various types of flexibility use those options. Findings from the study indicate that the majority of employees want flexibility but that access to it varies, with more advantaged employees--those who are well educated, have high salaries, and work full time, for example--being doubly advantaged in having greater access to flexibility. A number of employers, say the authors, tend to be skeptical of the value of workplace flexibility and to fear that employees will abuse it if it is offered. But the study data reveal that most employees use flexibility quite conservatively. When the authors use their nationally representative data set to investigate correlations between access to workplace flexibility and a range of workplace outcomes especially valued by employers--employee engagement, job satisfaction, retention, and health--they find that employers as well as employees can benefit from flexibility. Finally, the authors discuss When Work Works, a large, national community-based initiative under way since 2003 to increase voluntary adoption of workplace flexibility. The authors detail the conceptual basis of the project's design, noting its

Single Molecule Nanoelectrochemistry in Electrical Junctions.

Science.gov (United States)

Nichols, Richard J; Higgins, Simon J

2016-11-15

gating. This has been referred to as to a "single molecule transistor configuration" with the gate voltage being provided by the controllable potential achieved through the electrochemical double layer. It is shown how the electrolyte medium can control such gating, with ionic liquids providing more efficient gate coupling than aqueous electrolytes. Control of the conductance of viologen molecular wires can also be achieved by encapsulating the viologen redox moiety within a molecular cage, thereby controlling its immediate environment. Molecular conductance can also be gated through multiple redox states. This has been shown for the redox moiety pyrrolo-tetrathiafulvalene, which undergoes single molecule electrochemical transistor gating through three redox states in molecular junctions. Charge transport through this junction follows a two-step hopping mechanism, demonstrating the role of the redox center in electron transfer across the molecular bridge. Recent electrolyte gating studies of rigid, conjugated redox-active metal complexes with tailored terpyridine coordinating ligands and anchors are also presented. These aforementioned studies have all been performed with gold electrode contacts. The Account concludes with recent data showing that it is now possible to study single molecule electrochemical gating with nickel electrodes. This opens up new perspectives for studying interfacial charge transfer with a wide variety of other electrode materials including semiconductor electrodes and also points toward future opportunities for coupling molecular spintronics and nanoelectrochemistry.

Free-form Flexible Lithium-Ion Microbattery

KAUST Repository

Kutbee, Arwa T.; Ghoneim, Mohamed T.; Ahmed, Sally; Hussain, Muhammad Mustafa

2016-01-01

Wearable electronics need miniaturized, safe and flexible power sources. Lithium ion battery is a strong candidate as high performance flexible battery. The development of flexible materials for battery electrodes suffers from the limited material

Cognitive Flexibility in Obsessive Compulsive Disorder

DEFF Research Database (Denmark)

Jónsson, Hjalti; Salkovskis, Paul M.

BT for problems such as OCD requires a level of cognitive flexibility (that is the ability to take a different perspective on ones problems). It could be argued that problems in set shifting (by neuropsychological tests) might underpin problems in this area. Two assessments were used (1: perception...... of cognitive flexibility was assessed by questionnaire 2: neuropsychological evaluation of set shifting). This study will recruit three groups: OCD patients, anxious and healthy controls. Cognitive flexibility is measured using modified version of the Cognitive Flexibility Scale (Martin & Rubin, 1995......) and neuropsychological measures of cognitive flexibility (Wisconsin Cart Sorting Test, Trail Making Test A/B, The Brixton Test). IN addition to the group comparison, the relationship between perceived flexibility, set shifting and psychopathology will be investigated. The implications of the findings for treatment...

Agreement Between Face-to-Face and Free Software Video Analysis for Assessing Hamstring Flexibility in Adolescents.

Science.gov (United States)

Moral-Muñoz, José A; Esteban-Moreno, Bernabé; Arroyo-Morales, Manuel; Cobo, Manuel J; Herrera-Viedma, Enrique

2015-09-01

The objective of this study was to determine the level of agreement between face-to-face hamstring flexibility measurements and free software video analysis in adolescents. Reduced hamstring flexibility is common in adolescents (75% of boys and 35% of girls aged 10). The length of the hamstring muscle has an important role in both the effectiveness and the efficiency of basic human movements, and reduced hamstring flexibility is related to various musculoskeletal conditions. There are various approaches to measuring hamstring flexibility with high reliability; the most commonly used approaches in the scientific literature are the sit-and-reach test, hip joint angle (HJA), and active knee extension. The assessment of hamstring flexibility using video analysis could help with adolescent flexibility follow-up. Fifty-four adolescents from a local school participated in a descriptive study of repeated measures using a crossover design. Active knee extension and HJA were measured with an inclinometer and were simultaneously recorded with a video camera. Each video was downloaded to a computer and subsequently analyzed using Kinovea 0.8.15, a free software application for movement analysis. All outcome measures showed reliability estimates with α > 0.90. The lowest reliability was obtained for HJA (α = 0.91). The preliminary findings support the use of a free software tool for assessing hamstring flexibility, offering health professionals a useful tool for adolescent flexibility follow-up.

Flexible packaging for PV modules

Science.gov (United States)

Dhere, Neelkanth G.

2008-08-01

Economic, flexible packages that provide needed level of protection to organic and some other PV cells over >25-years have not yet been developed. However, flexible packaging is essential in niche large-scale applications. Typical configuration used in flexible photovoltaic (PV) module packaging is transparent frontsheet/encapsulant/PV cells/flexible substrate. Besides flexibility of various components, the solder bonds should also be flexible and resistant to fatigue due to cyclic loading. Flexible front sheets should provide optical transparency, mechanical protection, scratch resistance, dielectric isolation, water resistance, UV stability and adhesion to encapsulant. Examples are Tefzel, Tedlar and Silicone. Dirt can get embedded in soft layers such as silicone and obscure light. Water vapor transmittance rate (WVTR) of polymer films used in the food packaging industry as moisture barriers are ~0.05 g/(m2.day) under ambient conditions. In comparison, light emitting diodes employ packaging components that have WVTR of ~10-6 g/(m2.day). WVTR of polymer sheets can be improved by coating them with dense inorganic/organic multilayers. Ethylene vinyl acetate, an amorphous copolymer used predominantly by the PV industry has very high O2 and H2O diffusivity. Quaternary carbon chains (such as acetate) in a polymer lead to cleavage and loss of adhesional strength at relatively low exposures. Reactivity of PV module components increases in presence of O2 and H2O. Adhesional strength degrades due to the breakdown of structure of polymer by reactive, free radicals formed by high-energy radiation. Free radical formation in polymers is reduced when the aromatic rings are attached at regular intervals. This paper will review flexible packaging for PV modules.

Flexible devices: from materials, architectures to applications

Science.gov (United States)

Zou, Mingzhi; Ma, Yue; Yuan, Xin; Hu, Yi; Liu, Jie; Jin, Zhong

2018-01-01

Flexible devices, such as flexible electronic devices and flexible energy storage devices, have attracted a significant amount of attention in recent years for their potential applications in modern human lives. The development of flexible devices is moving forward rapidly, as the innovation of methods and manufacturing processes has greatly encouraged the research of flexible devices. This review focuses on advanced materials, architecture designs and abundant applications of flexible devices, and discusses the problems and challenges in current situations of flexible devices. We summarize the discovery of novel materials and the design of new architectures for improving the performance of flexible devices. Finally, we introduce the applications of flexible devices as key components in real life. Project supported by the National Key R&D Program of China (Nos. 2017YFA0208200, 2016YFB0700600, 2015CB659300), the National Natural Science Foundation of China (Nos. 21403105, 21573108), and the Fundamental Research Funds for the Central Universities (No. 020514380107).

Developmental constraints on behavioural flexibility.

Science.gov (United States)

Holekamp, Kay E; Swanson, Eli M; Van Meter, Page E

2013-05-19

We suggest that variation in mammalian behavioural flexibility not accounted for by current socioecological models may be explained in part by developmental constraints. From our own work, we provide examples of constraints affecting variation in behavioural flexibility, not only among individuals, but also among species and higher taxonomic units. We first implicate organizational maternal effects of androgens in shaping individual differences in aggressive behaviour emitted by female spotted hyaenas throughout the lifespan. We then compare carnivores and primates with respect to their locomotor and craniofacial adaptations. We inquire whether antagonistic selection pressures on the skull might impose differential functional constraints on evolvability of skulls and brains in these two orders, thus ultimately affecting behavioural flexibility in each group. We suggest that, even when carnivores and primates would theoretically benefit from the same adaptations with respect to behavioural flexibility, carnivores may nevertheless exhibit less behavioural flexibility than primates because of constraints imposed by past adaptations in the morphology of the limbs and skull. Phylogenetic analysis consistent with this idea suggests greater evolutionary lability in relative brain size within families of primates than carnivores. Thus, consideration of developmental constraints may help elucidate variation in mammalian behavioural flexibility.

Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

International Nuclear Information System (INIS)

Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

2007-01-01

We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

Formation of Ultracold Molecules

Energy Technology Data Exchange (ETDEWEB)

Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

2016-01-28

Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

Flexible Thermoelectric Generators on Silicon Fabric

KAUST Repository

Sevilla, Galo T.

2012-01-01

In this work, the development of a Thermoelectric Generator on Flexible Silicon Fabric is explored to extend silicon electronics for flexible platforms. Low cost, easily deployable plastic based flexible electronics are of great interest for smart

Mechanism of SOS PR-domain autoinhibition revealed by single-molecule assays on native protein from lysate.

Science.gov (United States)

Lee, Young Kwang; Low-Nam, Shalini T; Chung, Jean K; Hansen, Scott D; Lam, Hiu Yue Monatrice; Alvarez, Steven; Groves, Jay T

2017-04-28

The guanine nucleotide exchange factor (GEF) Son of Sevenless (SOS) plays a critical role in signal transduction by activating Ras. Here we introduce a single-molecule assay in which individual SOS molecules are captured from raw cell lysate using Ras-functionalized supported membrane microarrays. This enables characterization of the full-length SOS protein, which has not previously been studied in reconstitution due to difficulties in purification. Our measurements on the full-length protein reveal a distinct role of the C-terminal proline-rich (PR) domain to obstruct the engagement of allosteric Ras independently of the well-known N-terminal domain autoinhibition. This inhibitory role of the PR domain limits Grb2-independent recruitment of SOS to the membrane through binding of Ras·GTP in the SOS allosteric binding site. More generally, this assay strategy enables characterization of the functional behaviour of GEFs with single-molecule precision but without the need for purification.

The Role of Compensation Criteria to Minimize Face-Time Bias and Support Faculty Career Flexibility

Directory of Open Access Journals (Sweden)

Lydia Pleotis Howell MD

2016-02-01

Full Text Available Work-life balance is important to recruitment and retention of the younger generation of medical faculty, but medical school flexibility policies have not been fully effective. We have reported that our school’s policies are underutilized due to faculty concerns about looking uncommitted to career or team. Since policies include leaves and accommodations that reduce physical presence, faculty may fear “face-time bias,” which negatively affects evaluation of those not “seen” at work. Face-time bias is reported to negatively affect salary and career progress. We explored face-time bias on a leadership level and described development of compensation criteria intended to mitigate face-time bias, raise visibility, and reward commitment and contribution to team/group goals. Leaders from 6 partner departments participated in standardized interviews and group meetings. Ten compensation plans were analyzed, and published literature was reviewed. Leaders did not perceive face-time issues but saw team pressure and perception of availability as performance motivators. Compensation plans were multifactor productivity based with many quantifiable criteria; few addressed team contributions. Using these findings, novel compensation criteria were developed based on a published model to mitigate face-time bias associated with team perceptions. Criteria for organizational citizenship to raise visibility and reward group outcomes were included. We conclude that team pressure and perception of availability have the potential to lead to bias and may contribute to underuse of flexibility policies. Recognizing organizational citizenship and cooperative effort via specific criteria in a compensation plan may enhance a culture of flexibility. These novel criteria have been effective in one pilot department.

Plasma jet printing of electronic materials on flexible and nonconformal objects.

Science.gov (United States)

Gandhiraman, Ram P; Jayan, Vivek; Han, Jin-Woo; Chen, Bin; Koehne, Jessica E; Meyyappan, M

2014-12-10

We present a novel approach for the room-temperature fabrication of conductive traces and their subsequent site-selective dielectric encapsulation for use in flexible electronics. We have developed an aerosol-assisted atmospheric pressure plasma-based deposition process for efficiently depositing materials on flexible substrates. Silver nanowire conductive traces and silicon dioxide dielectric coatings for encapsulation were deposited using this approach as a demonstration. The paper substrate with silver nanowires exhibited a very low change in resistance upon 50 cycles of systematic deformation, exhibiting high mechanical flexibility. The applicability of this process to print conductive traces on nonconformal 3D objects was also demonstrated through deposition on a 3D-printed thermoplastic object, indicating the potential to combine plasma printing with 3D printing technology. The role of plasma here includes activation of the material present in the aerosol for deposition, increasing the deposition rate, and plasma polymerization in the case of inorganic coatings. The demonstration here establishes a low-cost, high-throughput, and facile process for printing electronic components on nonconventional platforms.

Levels Of Serum Intercellular And Vascular Adhesion Molecules In ...

African Journals Online (AJOL)

The study evaluated the possible significant role of soluble intercellular and vascular adhesion molecule-1 (sICAM-1 and sVCAM-1), sE-selectin and interluekin-1β in development nephropathy in patients with insulin dependent diabetes mellitus (IDDM). This study included 60 patients with type 1 diabetes mellitus (IDDM) ...

Adhesion molecules in breast carcinoma: a challenge to the pathologist

Directory of Open Access Journals (Sweden)

Claudia Rossetti

2015-02-01

Full Text Available The role of adhesion molecules is very important both in the activation of carcinogenesis and in the differentiation of subtypes of breast carcinoma, aiding in diagnosis, prognosis and therapeutic choice in these tumors. Therefore, understanding the functions and interrelationships among these molecules is crucial to the pathologist, who often uses these factors as a resource to differentiate tumors and further classify them according to a molecular point of view. Our goal is to describe the applicability and the difficulties encountered by the pathologist in the diagnosis of breast carcinoma, discussing the most commonly used markers of adhesion in routine analyses.

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

Science.gov (United States)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

Evidence supporting a role for astrocytes in the regulation of cognitive flexibility and neuronal oscillations through the Ca2+ binding protein S100β.

Science.gov (United States)

Brockett, Adam T; Kane, Gary A; Monari, Patrick K; Briones, Brandy A; Vigneron, Pierre-Antoine; Barber, Gabriela A; Bermudez, Andres; Dieffenbach, Uma; Kloth, Alexander D; Buschman, Timothy J; Gould, Elizabeth

2018-01-01

The medial prefrontal cortex (mPFC) is important for cognitive flexibility, the ability to switch between two task-relevant dimensions. Changes in neuronal oscillations and alterations in the coupling across frequency ranges have been correlated with attention and cognitive flexibility. Here we show that astrocytes in the mPFC of adult male Sprague Dawley rats, participate in cognitive flexibility through the astrocyte-specific Ca2+ binding protein S100β, which improves cognitive flexibility and increases phase amplitude coupling between theta and gamma oscillations. We further show that reduction of astrocyte number in the mPFC impairs cognitive flexibility and diminishes delta, alpha and gamma power. Conversely, chemogenetic activation of astrocytic intracellular Ca2+ signaling in the mPFC enhances cognitive flexibility, while inactivation of endogenous S100β among chemogenetically activated astrocytes in the mPFC prevents this improvement. Collectively, our work suggests that astrocytes make important contributions to cognitive flexibility and that they do so by releasing a Ca2+ binding protein which in turn enhances coordinated neuronal oscillations.

Evaluation of the Electronic Structure of Single-Molecule Junctions Based on Current-Voltage and Thermopower Measurements: Application to C60 Single-Molecule Junction.

Science.gov (United States)

Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

2017-02-16

The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

UNITY OF THE ORGANIZATIONAL FUNCTIONS FLEXIBILITY

OpenAIRE

George MOLDOVEANU; Cosmin DOBRIN

2012-01-01

The paper has the goal to analyse the correlation of the flexibility of all organizational functions. Based upon theoretical and practical studies, the decrease of flexibility into an "activity area" of organizations implies a diminution on a large scale of the flexibility of the processing system as a law expression of the decreasing outputs within economy. Therefore, at the level of each organizational function there are several major directions ensuring the flexibility of the "ensemble".

Anti-cancer Lead Molecule

KAUST Repository

Sagar, Sunil; Kaur, Mandeep; Esau, Luke E.

2014-01-01

Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

Anti-cancer Lead Molecule

KAUST Repository

Sagar, Sunil

2014-04-17

Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

Flexible barrier technology for enabling rollable AMOLED displays and upscaling flexible OLED lighting

NARCIS (Netherlands)

Li, F.M.; Unnikrishnan, S.; Weijer, P. van de; Assche, F. van; Shen, J.; Ellis, T.; Manders, W.; Akkerman, H.; Bouten, P.; Mol, A.M.B. van

2013-01-01

The availability of a high performance thin-film barrier is the most critical challenge in upscaling and commercializing flexible OLED products. We report a flexible thin-film-barrier technology that meets lifetime specifications for OLED lighting, and demonstrate it in rollable QVGA a-IGZO AMOLED

Functional network of glycan-related molecules: Glyco-Net in Glycoconjugate Data Bank

Directory of Open Access Journals (Sweden)

Miura Nobuaki

2010-06-01

Full Text Available Abstract Background Glycans are involved in a wide range of biological process, and they play an essential role in functions such as cell differentiation, cell adhesion, pathogen-host recognition, toxin-receptor interactions, signal transduction, cancer metastasis, and immune responses. Elucidating pathways related to post-translational modifications (PTMs such as glycosylation are of growing importance in post-genome science and technology. Graphical networks describing the relationships among glycan-related molecules, including genes, proteins, lipids and various biological events are considered extremely valuable and convenient tools for the systematic investigation of PTMs. However, there is no database which dynamically draws functional networks related to glycans. Description We have created a database called Glyco-Net http://www.glycoconjugate.jp/functions/, with many binary relationships among glycan-related molecules. Using search results, we can dynamically draw figures of the functional relationships among these components with nodes and arrows. A certain molecule or event corresponds to a node in the network figures, and the relationship between the molecule and the event are indicated by arrows. Since all components are treated equally, an arrow is also a node. Conclusions In this paper, we describe our new database, Glyco-Net, which is the first database to dynamically show networks of the functional profiles of glycan related molecules. The graphical networks will assist in the understanding of the role of the PTMs. In addition, since various kinds of bio-objects such as genes, proteins, and inhibitors are equally treated in Glyco-Net, we can obtain a large amount of information on the PTMs.

Intraepithelial lymphocytes express junctional molecules in murine small intestine

International Nuclear Information System (INIS)

Inagaki-Ohara, Kyoko; Sawaguchi, Akira; Suganuma, Tatsuo; Matsuzaki, Goro; Nawa, Yukifumi

2005-01-01

Intestinal intraepithelial lymphocytes (IEL) that reside at basolateral site regulate the proliferation and differentiation of epithelial cells (EC) for providing a first line of host defense in intestine. However, it remains unknown how IEL interact and communicate with EC. Here, we show that IEL express junctional molecules like EC. We identified mRNA expression of the junctional molecules in IEL such as zonula occludens (ZO)-1, occludin and junctional adhesion molecule (JAM) (tight junction), β-catenin and E-cadherin (adherens junction), and connexin26 (gap junction). IEL constitutively expressed occludin and E-cadherin at protein level, while other T cells in the thymus, spleen, liver, mesenteric lymph node, and Peyer's patches did not. γδ IEL showed higher level of these expressions than αβ IEL. The expression of occludin was augmented by anti-CD3 Ab stimulation. These results suggest the possibility of a novel role of IEL concerning epithelial barrier and communication between IEL and EC

"I just had to be flexible and show good patience": management of interactional approaches to enact mentoring roles by peer mentors with developmental disabilities.

Science.gov (United States)

Schwartz, Ariel E; Kramer, Jessica M

2017-06-08

Peer mentoring may be an effective approach for fostering skill development for mentors and mentees with developmental disabilities. However, little is known about how mentors with developmental disabilities perceive and enact their roles. (1) How do young adults with developmental disabilities describe their role as a peer mentor in the context of instrumental peer mentoring? (2) How do they enact their perceived roles? Thematic analysis of semi-structured reflections completed by six mentors with developmental disabilities (ages 17-35) with multiple mentoring experiences. Mentors perceived themselves as professionals with a primary role of teaching, and for some mentoring relationships, a secondary role of developing an interpersonal relationship. To enact these roles, mentors used a supportive interactional approach characterized by actions such as encouragement and sharing examples and dispositions, such as flexibility and patience. Mentors monitored mentee learning and engagement within the mentoring session and, as needed, adjusted their approach to optimize mentee learning and engagement. To successfully manage their interactional approach, mentors used supports such as peer mentoring scripts, tip sheets, and supervisors. While mentors reported several actions for teaching, they may benefit from training to learn approaches to facilitate more consistent development of interpersonal relationships. Implications for Rehabilitation Peer mentoring may be an effective approach for fostering skill development for young adult mentors and mentees with developmental disabilities. In this study, young adult peer mentors with developmental disabilities perceived themselves as professionals with a primary role of teaching and a secondary role of developing an interpersonal relationship. Peer mentors used actions and dispositions that matched their perceived roles and supported mentees with developmental disabilities to engage in instrumental mentoring. With supports and

A flexible fuzzy regression algorithm for forecasting oil consumption estimation

International Nuclear Information System (INIS)

Azadeh, A.; Khakestani, M.; Saberi, M.

2009-01-01

Oil consumption plays a vital role in socio-economic development of most countries. This study presents a flexible fuzzy regression algorithm for forecasting oil consumption based on standard economic indicators. The standard indicators are annual population, cost of crude oil import, gross domestic production (GDP) and annual oil production in the last period. The proposed algorithm uses analysis of variance (ANOVA) to select either fuzzy regression or conventional regression for future demand estimation. The significance of the proposed algorithm is three fold. First, it is flexible and identifies the best model based on the results of ANOVA and minimum absolute percentage error (MAPE), whereas previous studies consider the best fitted fuzzy regression model based on MAPE or other relative error results. Second, the proposed model may identify conventional regression as the best model for future oil consumption forecasting because of its dynamic structure, whereas previous studies assume that fuzzy regression always provide the best solutions and estimation. Third, it utilizes the most standard independent variables for the regression models. To show the applicability and superiority of the proposed flexible fuzzy regression algorithm the data for oil consumption in Canada, United States, Japan and Australia from 1990 to 2005 are used. The results show that the flexible algorithm provides accurate solution for oil consumption estimation problem. The algorithm may be used by policy makers to accurately foresee the behavior of oil consumption in various regions.

Exotic helium molecules; Molecules exotiques d'helium

Energy Technology Data Exchange (ETDEWEB)

Portier, M

2007-12-15

We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

Optimized flexible cover films for improved conversion efficiency in thin film flexible solar cells

Science.gov (United States)

Guterman, Sidney; Wen, Xin; Gudavalli, Ganesh; Rhajbhandari, Pravakar; Dhakal, Tara P.; Wilt, David; Klotzkin, David

2018-05-01

Thin film solar cell technologies are being developed for lower cost and flexible applications. For such technologies, it is desirable to have inexpensive, flexible cover strips. In this paper, we demonstrate that transparent silicone cover glass adhesive can be doped with TiO2 nanoparticles to achieve an optimal refractive index and maximize the performance of the cell. Cells covered with the film doped with nanoparticles at the optimal concentration demonstrated a ∼1% increase in photocurrent over the plain (undoped) film. In addition, fused silica beads can be incorporated into the flexible cover slip to realize a built-in pseudomorphic glass diffuser layer as well. This additional degree of freedom in engineering flexible solar cell covers allows maximal performance from a given cell for minimal increased cost.

Toward Additive-Free Small-Molecule Organic Solar Cells: Roles of the Donor Crystallization Pathway and Dynamics

KAUST Repository

Abdelsamie, Maged

2015-09-29

The ease with which small-molecule donors crystallize during solution processing is directly linked to the need for solvent additives. Donor molecules that get trapped in disordered (H1) or liquid crystalline (T1) mesophases require additive processing to promote crystallization, phase separation, and efficient light harvesting. A donor material (X2) that crystallizes directly from solution yields additive-free solar cells with an efficiency of 7.6%. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Free-form Flexible Lithium-Ion Microbattery

KAUST Repository

Kutbee, Arwa T.

2016-03-02

Wearable electronics need miniaturized, safe and flexible power sources. Lithium ion battery is a strong candidate as high performance flexible battery. The development of flexible materials for battery electrodes suffers from the limited material choices. In this work, we present integration strategy to rationally design materials and processes to report flexible inorganic lithium-ion microbattery with no restrictions on the materials used. The battery shows an enhanced normalized capacity of 147 μAh/cm2 when bent.

Flexible Programmes in Higher Professional Education: Expert Validation of a Flexible Educational Model

Science.gov (United States)

Schellekens, Ad; Paas, Fred; Verbraeck, Alexander; van Merrienboer, Jeroen J. G.

2010-01-01

In a preceding case study, a process-focused demand-driven approach for organising flexible educational programmes in higher professional education (HPE) was developed. Operations management and instructional design contributed to designing a flexible educational model by means of discrete-event simulation. Educational experts validated the model…

Modulation of dendritic cell and T cell cross-talk during aging: The potential role of checkpoint inhibitory molecules.

Science.gov (United States)

Gardner, Joanne K; Mamotte, Cyril D S; Jackaman, Connie; Nelson, Delia J

2017-09-01

Dendritic cells (DCs) undergo continuous changes throughout life, and there is evidence that elderly DCs have a reduced capacity to stimulate T cells, which may contribute to impaired anti-tumour immune responses in elderly people with cancer. Changes in checkpoint inhibitory molecules/pathways during aging may be one mechanism that impairs the ability of elderly DCs to activate T cells. However, little is currently known regarding the combined effects of aging and cancer on DC and T cell inhibitory molecules/pathways. In this review, we discuss our current understanding of the influence of aging and cancer on key DC and T cell inhibitory molecules/pathways, the potential underlying cellular and molecular mechanisms contributing to their modulation, and the possibility of therapeutically targeting inhibitory molecules in elderly cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.