WorldWideScience

Sample records for flexible molecules role

  1. The role of angular momentum in the superrotor theory for rovibrational motion of extremely flexible molecules

    Science.gov (United States)

    Schmiedt, Hanno; Jensen, Per; Schlemmer, Stephan

    2017-12-01

    Recently, we proposed a novel approach to the description of the rotation-vibration motion for extremely flexible molecules (Schmiedt et al., 2016, 2017). Such molecules have multiple very "soft" vibrational modes and so, they lack a well-defined equilibrium structure. We have applied the new superrotor model to the prototype example of an extremely flexible molecule, CH5+, for which we combine two, essentially free vibrational modes (describing internal rotation) with the over-all rotation of the molecule and consider the resulting motion as a free rotation in five-dimensional space, with a Hamiltonian whose symmetry is described by SO(5), the five-dimensional rotation group. In the present work we discuss the correlation between the superrotor energies and those obtained in the more usual situation of the internal and over-all rotations being separable, and we give an initial discussion of the selection rules for electric dipole transitions obtained in the superrotor approach. Such selection rules are required for a detailed comparison between the superrotor predictions and the available, experimentally derived energy spacings (Asvany et al., 2015; Brackertz, 2016).

  2. Flexible single molecule simulation of reaction-diffusion processes

    International Nuclear Information System (INIS)

    Hellander, Stefan; Loetstedt, Per

    2011-01-01

    An algorithm is developed for simulation of the motion and reactions of single molecules at a microscopic level. The molecules diffuse in a solvent and react with each other or a polymer and molecules can dissociate. Such simulations are of interest e.g. in molecular biology. The algorithm is similar to the Green's function reaction dynamics (GFRD) algorithm by van Zon and ten Wolde where longer time steps can be taken by computing the probability density functions (PDFs) and then sample from the distribution functions. Our computation of the PDFs is much less complicated than GFRD and more flexible. The solution of the partial differential equation for the PDF is split into two steps to simplify the calculations. The sampling is without splitting error in two of the coordinate directions for a pair of molecules and a molecule-polymer interaction and is approximate in the third direction. The PDF is obtained either from an analytical solution or a numerical discretization. The errors due to the operator splitting, the partitioning of the system, and the numerical approximations are analyzed. The method is applied to three different systems involving up to four reactions. Comparisons with other mesoscopic and macroscopic models show excellent agreement.

  3. Role of Flexibility in Sustainable Port Development

    NARCIS (Netherlands)

    Taneja, P.; Vellinga, T.; Ros, R.

    2012-01-01

    Sustainability has become a high profile objective in all aspects of our lives, including the development of our infrastructures. Flexibility can enhance sustainability endeavors, yet its contribution is not clear to most. In this paper we investigate the role of flexibility in sustainable port

  4. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  5. Quantum mechanical computations and spectroscopy: from small rigid molecules in the gas phase to large flexible molecules in solution.

    Science.gov (United States)

    Barone, Vincenzo; Improta, Roberto; Rega, Nadia

    2008-05-01

    Interpretation of structural properties and dynamic behavior of molecules in solution is of fundamental importance to understand their stability, chemical reactivity, and catalytic action. While information can be gained, in principle, by a variety of spectroscopic techniques, the interpretation of the rich indirect information that can be inferred from the analysis of experimental spectra is seldom straightforward because of the subtle interplay of several different effects, whose specific role is not easy to separate and evaluate. In such a complex scenario, theoretical studies can be very helpful at two different levels: (i) supporting and complementing experimental results to determine the structure of the target molecule starting from its spectral properties; (ii) dissecting and evaluating the role of different effects in determining the observed spectroscopic properties. This is the reason why computational spectroscopy is rapidly evolving from a highly specialized research field into a versatile and widespread tool for the assignment of experimental spectra and their interpretation in terms of chemical physical effects. In such a situation, it becomes important that both computationally and experimentally oriented chemists are aware that new methodological advances and integrated computational strategies are available, providing reliable estimates of fundamental spectral parameters not only for relatively small molecules in the gas phase but also for large and flexible molecules in condensed phases. In this Account, we review the most significant methodological contributions from our research group in this field, and by exploiting some recent results of their application to the computation of IR, UV-vis, NMR, and EPR spectral parameters, we discuss the microscopic mechanisms underlying solvent and vibrational effects on the spectral parameters. After reporting some recent achievements for the study of excited states by first principle quantum mechanical

  6. Flexibility and conformational change of IgG molecule

    International Nuclear Information System (INIS)

    Alpert, Y.; Ostanevich, Yu.M.

    1982-12-01

    The dynamic behaviour of pig anti-Dnp-immunoglobulin (IgG) investigated by the neutron spin echo technique gave evidence of internal motion of a biological macromolecule. It is suggested that this motion belongs to the wobbling of the Fab parts of the investigated IgG molecule around its so called hinge region. (author)

  7. New basis set for the prediction of the specific rotation in flexible biological molecules

    DEFF Research Database (Denmark)

    Baranowska-Łaczkowska, Angelika; Z. Łaczkowski, Krzysztof Z. Łaczkowski; Henriksen, Christian

    2016-01-01

    are compared to those obtained with the (d-)aug-cc-pVXZ (X = D, T and Q) basis sets of Dunning et al. The ORP values are in good overall agreement with the aug-cc-pVTZ results making the ORP a good basis set for routine TD-DFT optical rotation calculations of conformationally flexible molecules. The results...

  8. Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

    Science.gov (United States)

    Maiti, Prabal K.; Bagchi, Biman

    2009-12-01

    In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

  9. Crystal structure prediction of flexible molecules using parallel genetic algorithms with a standard force field.

    Science.gov (United States)

    Kim, Seonah; Orendt, Anita M; Ferraro, Marta B; Facelli, Julio C

    2009-10-01

    This article describes the application of our distributed computing framework for crystal structure prediction (CSP) the modified genetic algorithms for crystal and cluster prediction (MGAC), to predict the crystal structure of flexible molecules using the general Amber force field (GAFF) and the CHARMM program. The MGAC distributed computing framework includes a series of tightly integrated computer programs for generating the molecule's force field, sampling crystal structures using a distributed parallel genetic algorithm and local energy minimization of the structures followed by the classifying, sorting, and archiving of the most relevant structures. Our results indicate that the method can consistently find the experimentally known crystal structures of flexible molecules, but the number of missing structures and poor ranking observed in some crystals show the need for further improvement of the potential. Copyright 2009 Wiley Periodicals, Inc.

  10. RapidRMSD: Rapid determination of RMSDs corresponding to motions of flexible molecules.

    Science.gov (United States)

    Neveu, Emilie; Popov, Petr; Hoffmann, Alexandre; Migliosi, Angelo; Besseron, Xavier; Danoy, Grégoire; Bouvry, Pascal; Grudinin, Sergei

    2018-03-15

    The root mean square deviation (RMSD) is one of the most used similarity criteria in structural biology and bioinformatics. Standard computation of the RMSD has a linear complexity with respect to the number of atoms in a molecule, making RMSD calculations time-consuming for the large-scale modeling applications, such as assessment of molecular docking predictions or clustering of spatially proximate molecular conformations. Previously we introduced the RigidRMSD algorithm to compute the RMSD corresponding to the rigid-body motion of a molecule. In this study we go beyond the limits of the rigid-body approximation by taking into account conformational flexibility of the molecule. We model the flexibility with a reduced set of collective motions computed with e.g. normal modes or principal component analysis. The initialization of our algorithm is linear in the number of atoms and all the subsequent evaluations of RMSD values between flexible molecular conformations depend only on the number of collective motions that are selected to model the flexibility. Therefore, our algorithm is much faster compared to the standard RMSD computation for large-scale modeling applications. We demonstrate the efficiency of our method on several clustering examples, including clustering of flexible docking results and molecular dynamics (MD) trajectories. We also demonstrate how to use the presented formalism to generate pseudo-random constant-RMSD structural molecular ensembles and how to use these in cross-docking. We provide the algorithm written in C ++ as the open-source RapidRMSD library governed by the BSD-compatible license, which is available at http://team.inria.fr/nano-d/software/RapidRMSD/. The constant-RMSD structural ensemble application and clustering of MD trajectories is available at http://team.inria.fr/nano-d/software/nolb-normal-modes/. sergei.grudinin@inria.fr. Supplementary data are available at Bioinformatics.

  11. Symmetry numbers for rigid, flexible, and fluxional molecules: theory and applications.

    Science.gov (United States)

    Gilson, Michael K; Irikura, Karl K

    2010-12-16

    The use of molecular simulations and ab initio calculations to predict thermodynamic properties of molecules has become routine. Such methods rely upon an accurate representation of the molecular partition function or configurational integral, which in turn often includes a rotational symmetry number. However, the reason for including the symmetry number is unclear to many practitioners, and there is also a need for a general prescription for evaluating the symmetry numbers of flexible molecules, i.e., for molecules with thermally active internal degrees of freedom, such as internal rotors. Surprisingly, we have been unable to find any complete and convincing explanations of these important issues in textbooks or the journal literature. The present paper aims to explain why symmetry numbers are needed and how their values should be determined. Both classical and quantum approaches are provided.

  12. Role of Pectoral Fin Flexibility in Robotic Fish Performance

    Science.gov (United States)

    Bazaz Behbahani, Sanaz; Tan, Xiaobo

    2017-08-01

    Pectoral fins play a vital role in the maneuvering and locomotion of fish, and they have become an important actuation mechanism for robotic fish. In this paper, we explore the effect of flexibility of robotic fish pectoral fins on the robot locomotion performance and mechanical efficiency. A dynamic model for the robotic fish is presented, where the flexible fin is modeled as multiple rigid elements connected via torsional springs and dampers. Blade element theory is used to capture the hydrodynamic force on the fin. The model is validated with experimental results obtained on a robotic fish prototype, equipped with 3D-printed fins of different flexibility. The model is then used to analyze the impacts of fin flexibility and power/recovery stroke speed ratio on the robot swimming speed and mechanical efficiency. It is found that, in general, flexible fins demonstrate advantages over rigid fins in speed and efficiency at relatively low fin-beat frequencies, while rigid fins outperform flexible fins at higher frequencies. For a given fin flexibility, the optimal frequency for speed performance differs from the optimal frequency for mechanical efficiency. In addition, for any given fin, there is an optimal power/recovery stroke speed ratio, typically in the range of 2-3, that maximizes the speed performance. Overall, the presented model offers a promising tool for fin flexibility and gait design, to achieve speed and efficiency objectives for robotic fish actuated with pectoral fins.

  13. Multi-solution processes of small molecule for flexible white organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Yu-Sheng, E-mail: ystsai@nfu.edu.tw [Institute of Electro-optical and Materials Science, National Formosa University, Yunlin 63201, Taiwan, ROC (China); Chittawanij, Apisit; Hong, Lin-Ann; Guo, Siou-Wei [Institute of Electro-optical and Materials Science, National Formosa University, Yunlin 63201, Taiwan, ROC (China); Wang, Ching-Chiun [Department of Solid State Lighting Technology, Mechanical and Systems Research Laboratories, Industrial Technology Research Institute, Hsinchu 31040, Taiwan, ROC (China); Juang, Fuh-Shyang [Institute of Electro-optical and Materials Science, National Formosa University, Yunlin 63201, Taiwan, ROC (China); Lai, Shih-Hsiang [Department of Solid State Lighting Technology, Mechanical and Systems Research Laboratories, Industrial Technology Research Institute, Hsinchu 31040, Taiwan, ROC (China); Lin, Yang-Ching [Institute of Electro-optical and Materials Science, National Formosa University, Yunlin 63201, Taiwan, ROC (China)

    2016-04-01

    Most small molecule organic light emitting diode (SM-OLED) device structures are made in one layer using solution-based processing because the solution is usually a high dissolvent material that easily attacks the layer below it. We demonstrate a simple and reliable stamping technique for fabricating multi-solution process flexible white SM-OLEDs. The structure is anode/spin-hole injection layer/spin-emitting layer/stamping-electron transport layer/cathode. Poly(di-methyl silane) (PDMS) stamp is used for transferring electron transport layer. An intermediate ultraviolet-ozone surface treatment is introduced to temporarily modify the PDMS stamp surface. Then, the solution-based electron transport layer film can therefore be uniformly formed on top of the PDMS surface. After that the electron transport layer film on the PDMS stamp is transfer-printed onto the emitting layer with suitable heating and pressing. A solution-based processing is successfully established to efficiently fabricate flexible white SM-OLEDs. The SM-OLEDs were obtained at the current density of 20 mA/cm{sup 2}, luminance of 1062 cd/m{sup 2}, current efficiency of 5.57 cd/A, and Commission internationale de l'éclairage coordinate of (0.32, 0.35). - Highlights: • All solution-processed small molecule materials (emitting layer, electron transport layer). • Poly(di-methylsilane) (PDMS) stamp is subsequently used for stamping transfer. • The flexible white SM-OLEDs are based on solution-processes with a low-cost method.

  14. Multi-solution processes of small molecule for flexible white organic light-emitting diodes

    International Nuclear Information System (INIS)

    Tsai, Yu-Sheng; Chittawanij, Apisit; Hong, Lin-Ann; Guo, Siou-Wei; Wang, Ching-Chiun; Juang, Fuh-Shyang; Lai, Shih-Hsiang; Lin, Yang-Ching

    2016-01-01

    Most small molecule organic light emitting diode (SM-OLED) device structures are made in one layer using solution-based processing because the solution is usually a high dissolvent material that easily attacks the layer below it. We demonstrate a simple and reliable stamping technique for fabricating multi-solution process flexible white SM-OLEDs. The structure is anode/spin-hole injection layer/spin-emitting layer/stamping-electron transport layer/cathode. Poly(di-methyl silane) (PDMS) stamp is used for transferring electron transport layer. An intermediate ultraviolet-ozone surface treatment is introduced to temporarily modify the PDMS stamp surface. Then, the solution-based electron transport layer film can therefore be uniformly formed on top of the PDMS surface. After that the electron transport layer film on the PDMS stamp is transfer-printed onto the emitting layer with suitable heating and pressing. A solution-based processing is successfully established to efficiently fabricate flexible white SM-OLEDs. The SM-OLEDs were obtained at the current density of 20 mA/cm"2, luminance of 1062 cd/m"2, current efficiency of 5.57 cd/A, and Commission internationale de l'éclairage coordinate of (0.32, 0.35). - Highlights: • All solution-processed small molecule materials (emitting layer, electron transport layer). • Poly(di-methylsilane) (PDMS) stamp is subsequently used for stamping transfer. • The flexible white SM-OLEDs are based on solution-processes with a low-cost method.

  15. Neutral molecules in tokamak edge plasma - role of vibrationally excited hydrogen molecules

    International Nuclear Information System (INIS)

    Cadez, I.; Cercek, M.; Pelicon, P.; Razpet, A.

    2003-01-01

    The role of neutral molecules in edge plasma is discussed with special emphasis on the vibrationally excited hydrogen. Neutral molecules are formed mostly by surface processes on the walls and then released to the edge plasma where they take part in volumetric reactions with other particles. Typically these molecules are formed in excited states and data are needed for their reactions on the wall and in the volume. Processes in edge plasma determine particle and energy flux what is especially critical issue in tokamak divertor region. Various cross sections and reaction rates are needed for modelling edge plasma and its interaction with walls. (author)

  16. Docking ligands into flexible and solvated macromolecules. 7. Impact of protein flexibility and water molecules on docking-based virtual screening accuracy.

    Science.gov (United States)

    Therrien, Eric; Weill, Nathanael; Tomberg, Anna; Corbeil, Christopher R; Lee, Devin; Moitessier, Nicolas

    2014-11-24

    The use of predictive computational methods in the drug discovery process is in a state of continual growth. Over the last two decades, an increasingly large number of docking tools have been developed to identify hits or optimize lead molecules through in-silico screening of chemical libraries to proteins. In recent years, the focus has been on implementing protein flexibility and water molecules. Our efforts led to the development of Fitted first reported in 2007 and further developed since then. In this study, we wished to evaluate the impact of protein flexibility and occurrence of water molecules on the accuracy of the Fitted docking program to discriminate active compounds from inactive compounds in virtual screening (VS) campaigns. For this purpose, a total of 171 proteins cocrystallized with small molecules representing 40 unique enzymes and receptors as well as sets of known ligands and decoys were selected from the Protein Data Bank (PDB) and the Directory of Useful Decoys (DUD), respectively. This study revealed that implementing displaceable crystallographic or computationally placed particle water molecules and protein flexibility can improve the enrichment in active compounds. In addition, an informed decision based on library diversity or research objectives (hit discovery vs lead optimization) on which implementation to use may lead to significant improvements.

  17. Flexibility.

    Science.gov (United States)

    Humphrey, L. Dennis

    1981-01-01

    Flexibility is an important aspect of all sports and recreational activities. Flexibility can be developed and maintained by stretching exercises. Exercises designed to develop flexibility in ankle joints, knees, hips, and the lower back are presented. (JN)

  18. Ion-molecule reactions: their role in radiation chemistry

    International Nuclear Information System (INIS)

    Lias, S.G.; Ausloos, P.

    1975-01-01

    A comprehensive review of ion--molecule reactions is presented, including information from mass spectrometric, organic chemistry, and NMR studies, from theoretical calculations, and from gas and liquid phase radiation chemistry. Special emphasis is placed on interpreting the role of ion--molecule reactions in systems under high energy irradiation. The discussion is presented under the following chapter headings: ion--molecule reactions and their role in radiation chemistry; unimolecular processes: the nature and structure of ionic intermediates in radiolysis; ion lifetimes and the fate of unreactive ions; kinetics and mechanisms of ion--molecule reactions; proton transfer reactions; negative atom and two-atom transfer reactions; condensation reactions; and, association or clustering reactions

  19. Structure and phase behavior of a confined nanodroplet composed of the flexible chain molecules.

    Science.gov (United States)

    Kim, Soon-Chul; Kim, Eun-Young; Seong, Baek-Seok

    2011-04-28

    A polymer density functional theory has been employed for investigating the structure and phase behaviors of the chain polymer, which is modelled as the tangentially connected sphere chain with an attractive interaction, inside the nanosized pores. The excess free energy of the chain polymer has been approximated as the modified fundamental measure-theory for the hard spheres, the Wertheim's first-order perturbation for the chain connectivity, and the mean-field approximation for the van der Waals contribution. For the value of the chemical potential corresponding to a stable liquid phase in the bulk system and a metastable vapor phase, the flexible chain molecules undergo the liquid-vapor transition as the pore size is reduced; the vapor is the stable phase at small volume, whereas the liquid is the stable phase at large volume. The wide liquid-vapor coexistence curve, which explains the wide range of metastable liquid-vapor states, is observed at low temperature. The increase of temperature and decrease of pore size result in a narrowing of liquid-vapor coexistence curves. The increase of chain length leads to a shift of the liquid-vapor coexistence curve towards lower values of chemical potential. The coexistence curves for the confined phase diagram are contained within the corresponding bulk liquid-vapor coexistence curve. The equilibrium capillary phase transition occurs at a higher chemical potential than in the bulk phase.

  20. The role of adhesive molecules in endometrial cancer: part II

    Directory of Open Access Journals (Sweden)

    Andrzej Malinowski

    2010-12-01

    Full Text Available The carcinogenesis is a result of both functional and structural disorders in the tissue. It initiates as a mutationin a gene encoding protein that is essential for cellular function. The subsequent cascade of eventsleads to accumulation of mutations and loss of cellular function. The cell loses its tissue-specific morphology,disconnects from other cells and extracellular matrix and migrates – the invasion begins. It is now clear thatadhesive molecules are a key player in this cascade. These proteins of the cell membrane surface are responsiblefor attachment of the cells to each other and to the extracellular matrix. These interactions are crucial forboth structural and functional tissue organization. Lack of this homeostasis destroys the tissue architectureand impairs its function and results in invasion. Abnormal expression of adhesive molecules was reported in allexamined cancers, including endometrial cancer.Endometrial cancer is the most common gynaecological cancer in developed countries. Although in many casesdiagnosed and treated in early stages, and thus with good results, some patients cannot be cured. Completeknowledge of the pathogenesis of the disease will be helpful in identifying the patients with negative prognosticfactors, increased risk of recurrence and, perhaps, to find other therapeutic options. In the paper we are trying tosum up the up-to-date knowledge of the role of adhesive molecules in pathogenesis of endometrial cancer.

  1. The role of water molecules in computational drug design.

    Science.gov (United States)

    de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

    2010-01-01

    Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

  2. Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

    KAUST Repository

    Zheng, B.; Wang, L. L.; Du, L.; Pan, Y.; Lai, Zhiping; Huang, Kuo-Wei; Du, H. L.

    2016-01-01

    Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

  3. Diffusion as a function of guest molecule length and functionalization in flexible metal–organic frameworks

    KAUST Repository

    Zheng, B.

    2016-05-11

    Understanding guest diffusion in nanoporous host-guest systems is crucial in the efficient design of metal-organic frameworks (MOFs) for chemical separation and drug delivery applications. In this work, we investigated the effect of molecule length on the diffusion rate in the zeolitic imidazolate framework 8 (ZIF-8), trying to find a simple and straightforward variable to characterize the complicated guest diffusion. We found that, counter-intuitively, long guest molecules can diffuse as quickly as short molecules; the diffusion coefficient of ethyl acetate for example is of the same order of magnitude as ethane and ethanol, as excludes the existence of a simple relationship between molecule length and diffusion rate. This phenomenon is explained by a study of the contributions of intra- and inter-cage movement to overall transport. Steric confinement limits the degrees of freedom of long guest molecules, shortening their residence time and increasing the efficiency of radial diffusion. In contrast, shorter molecules meander within MOF cages, reducing transport. Furthermore, the energy barrier of inter-cage transport also does not exhibit a simple dependence on a guest molecule length, attributing to the effect of the type of functional group on diffusion. Guests over varying lengths were investigated by using theoretical methods, revealing that the guest diffusion in ZIF-8 depends on the number of contiguous carbon atoms in a molecule, rather than its overall length. Thus, we proposed simple criteria to predict arbitrary guest molecule diffusivity in ZIF-8 without time-consuming experimentation. © 2016 The Royal Society of Chemistry.

  4. Role of chrysin on expression of insulin signaling molecules

    Directory of Open Access Journals (Sweden)

    Kottireddy Satyanarayana

    2015-01-01

    Full Text Available Background: Currently available drugs are unsuccessful for the treatment of tye-2 diabetes due to their adverseside-effects. Hence, a search for novel drugs, especially ofplant origin, continues. Chrysin (5,7-dihydroxyflavone is a flavonoid, natural component of traditional medicinal herbs, present in honey, propolis and many plant extracts that hasbeen used in traditional medicine around the world to treat numerous ailments. Objective: The present study was aimed to identify the protective role of chrysin on the expression of insulin-signaling molecules in the skeletal muscle of high fat and sucrose-induced type-2 diabetic adult male rats. Materials and Methods: The oral effective dose of chrysin (100 mg/kg body weight was given once a day until the end of the study (30 days post-induction of diabetes to high fat diet-induced diabetic rats.At the end of the experimental period, fasting blood glucose, oral glucose tolerance, serum lipid profile, lipid peroxidation (LPO and free radical generation, as well as the levels of insulin signaling molecules and tissue glycogen in the gastrocnemius muscle were assessed. Results: Diabetic rats showed impaired glucose tolerance and impairment in insulin signaling molecules (IR, IRS-1, p-IRS-1Tyr 632 , p- Akt Thr308 , glucose transporter subtype 4 [GLUT4] proteins and glycogen concentration. Serum insulin, lipid profile, LPO and free radical generation were found to be increased in diabetic control rats.The treatment with chrysin normalized the altered levels of blood glucose, serum insulin, lipid profile, LPO and insulin signaling molecules as well as GLUT4 proteins. Conclusion: Our present findings indicate that chrysin improves glycemic control through activation of insulin signal transduction in the gastrocnemius muscle of high fat and sucrose-induced type-2 diabetic male rats.

  5. Roll-coating fabrication of flexible large area small molecule solar cells with power conversion efficiency exceeding 1%

    DEFF Research Database (Denmark)

    Liu, Wenqing; Liu, Shiyong; Zawacka, Natalia Klaudia

    2014-01-01

    All solution-processed flexible large area small molecule bulk heterojunction solar cells were fabricated via roll-coating technology. Our devices were produced from slot-die coating on a lab-scale mini roll-coater under ambient conditions without the use of spin-coating or vacuum evaporation.......01%, combined with an open circuit voltage of 0.73 V, a short-circuit current density of 3.13 mA cm (2) and a fill factor of 44% were obtained for the device with SM1, which was the first example reported for efficient roll-coating fabrication of flexible large area small molecule solar cells with PCE exceeding...... methods. Four diketopyrrolopyrrole based small molecules (SMs 1-4) were utilized as electron donors with (6,6)phenyl- C61-butyric acid methyl ester as an acceptor and their photovoltaic performances based on roll-coated devices were investigated. The best power conversion efficiency (PCE) of 1...

  6. Flexible molecular-scale electronic devices composed of diarylethene photoswitching molecules

    KAUST Repository

    Kim, Dongku; Jeong, Hyunhak; Lee, Hanki; Hwang, Wangtaek; Wolf, Jannic Sebastian; Scheer, Elke; Huhn, Thomas; Jeong, Heejun; Lee, Takhee

    2014-01-01

    The electrical properties of diarylethene photoswitching molecular devices on flexible substrates are studied. When exposed to UV or visible light, diarylethene molecular devices show two electrical states (a high and a low conductance state) with a discrepancy of an order of magnitude in the level of current between the two states. The diarylethene flexible molecular devices exhibit excellent long-time stability and reliable electrical characteristics in both conductance states when subjected to various mechanical stresses. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Flexible molecular-scale electronic devices composed of diarylethene photoswitching molecules

    KAUST Repository

    Kim, Dongku

    2014-03-31

    The electrical properties of diarylethene photoswitching molecular devices on flexible substrates are studied. When exposed to UV or visible light, diarylethene molecular devices show two electrical states (a high and a low conductance state) with a discrepancy of an order of magnitude in the level of current between the two states. The diarylethene flexible molecular devices exhibit excellent long-time stability and reliable electrical characteristics in both conductance states when subjected to various mechanical stresses. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Roll-coating fabrication of ITO-free flexible solar cells based on a non-fullerene small molecule acceptor

    DEFF Research Database (Denmark)

    Liu, Wenqing; Shi, Hangqi; Andersen, Thomas Rieks

    2015-01-01

    We report organic solar cells (OSCs) with non-fullerene small molecule acceptors (SMAs) prepared in large area via a roll coating process. We employ all solution-processed indium tin oxide (ITO)-free flexible substrates for inverted solar cells with a new SMA of F(DPP)(2)B-2. By utilizing poly(3......-hexylthiophene) as donor blended with F(DPP)(2)B-2 as acceptor, ITO-free large-area flexible SMA based OSCs were produced under ambient conditions with the use of slot-die coating and flexographic printing methods on a lab-scale compact roll-coater that is readily transferrable to roll-to-roll processing...

  9. Family Roles as Moderators of the Relationship between Schedule Flexibility and Stress

    Science.gov (United States)

    Jang, Soo Jung; Zippay, Allison; Park, Rhokeun

    2012-01-01

    Employer initiatives that address the spillover of work strain onto family life include flexible work schedules. This study explored the mediating role of negative work-family spillover in the relationship between schedule flexibility and employee stress and the moderating roles of gender, family workload, and single-parent status. Data were drawn…

  10. Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

    Science.gov (United States)

    Spyrakis, Francesca; Cavasotto, Claudio N

    2015-10-01

    Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Water molecule network and active site flexibility of apo protein tyrosine phosphatase 1B

    DEFF Research Database (Denmark)

    Pedersen, A.K.; Peters, Günther H.J.; Møller, K.B.

    2004-01-01

    Protein tyrosine phosphatase 1B (PTP1B) plays a key role as a negative regulator of insulin and leptin signalling and is therefore considered to be an important molecular target for the treatment of type 2 diabetes and obesity. Detailed structural information about the structure of PTP1B, including...

  12. In Search of Small Molecule Inhibitors Targeting the Flexible CK2 Subunit Interface

    Directory of Open Access Journals (Sweden)

    Benoît Bestgen

    2017-02-01

    Full Text Available Protein kinase CK2 is a tetrameric holoenzyme composed of two catalytic (α and/or α’ subunits and two regulatory (β subunits. Crystallographic data paired with fluorescence imaging techniques have suggested that the formation of the CK2 holoenzyme complex within cells is a dynamic process. Although the monomeric CK2α subunit is endowed with a constitutive catalytic activity, many of the plethora of CK2 substrates are exclusively phosphorylated by the CK2 holoenzyme. This means that the spatial and high affinity interaction between CK2α and CK2β subunits is critically important and that its disruption may provide a powerful and selective way to block the phosphorylation of substrates requiring the presence of CK2β. In search of compounds inhibiting this critical protein–protein interaction, we previously designed an active cyclic peptide (Pc derived from the CK2β carboxy-terminal domain that can efficiently antagonize the CK2 subunit interaction. To understand the functional significance of this interaction, we generated cell-permeable versions of Pc, exploring its molecular mechanisms of action and the perturbations of the signaling pathways that it induces in intact cells. The identification of small molecules inhibitors of this critical interaction may represent the first-choice approach to manipulate CK2 in an unconventional way.

  13. Managing the Work and Family Roles. Does Flexibility Reduce the Negative Interference? An Exploratory Study

    Directory of Open Access Journals (Sweden)

    Cătălina CICEI

    2015-12-01

    Full Text Available Balancing work and family demands has become a great challenge for employees. By providing flexible benefits, organizations actively engage in endeavours aimed at reducing the negative interference between the two life spheres. Even if some empirical studies have examined the effects of family supportive initiatives, focusing on flexibility, however, the findings tend to lack consistency. If flexible benefits are traditionally associated with reduced levels of work-family conflict, in some studies no significant results have been reported. Another line of research suggests that flexibility can actually increase the negative work-family interface. From this perspective, the current study examines the relationship between the flexibility benefits used and work-family conflict, focusing especially on the role flextime and telecommuting. Using flexible benefits is negatively associated with time and strain-based conflict, the effects of flextime and telecommuting varying accordingly to the type of conflict examined. Limitations of the current study andfuture research directions are examined.

  14. Structural flexibility of the sulfur mustard molecule at finite temperature from Car-Parrinello molecular dynamics simulations.

    Science.gov (United States)

    Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel

    2016-04-05

    Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. The role of the hippocampus in flexible cognition and social behavior

    Directory of Open Access Journals (Sweden)

    Rachael D Rubin

    2014-09-01

    Full Text Available Successful behavior requires actively acquiring and representing information about the environment and people, and manipulating and using those acquired representations flexibly to optimally act in and on the world. The frontal lobes have figured prominently in most accounts of flexible or goal-directed behavior, as evidenced by often-reported behavioral inflexibility in individuals with frontal lobe dysfunction. Here, we propose that the hippocampus also plays a critical role by forming and reconstructing relational memory representations that underlie flexible cognition and social behavior. There is mounting evidence that damage to the hippocampus can produce inflexible and maladaptive behavior when such behavior places high demands on the generation, recombination, and flexible use of information. This is seen in abilities as diverse as memory, navigation, exploration, imagination, creativity, decision-making, character judgments, establishing and maintaining social bonds, empathy, social discourse, and language use. Thus, the hippocampus, together with its extensive interconnections with other neural systems, supports the flexible use of information in general. Further, we suggest that this understanding has important clinical implications. Hippocampal abnormalities can produce profound deficits in real-world situations, which typically place high demands on the flexible use of information, but are not always obvious on diagnostic tools tuned to frontal lobe function. This review documents the role of the hippocampus in supporting flexible representations and aims to expand our understanding of the dynamic networks that operate as we move through and create meaning of our world.

  16. The role of the hippocampus in flexible cognition and social behavior.

    Science.gov (United States)

    Rubin, Rachael D; Watson, Patrick D; Duff, Melissa C; Cohen, Neal J

    2014-01-01

    Successful behavior requires actively acquiring and representing information about the environment and people, and manipulating and using those acquired representations flexibly to optimally act in and on the world. The frontal lobes have figured prominently in most accounts of flexible or goal-directed behavior, as evidenced by often-reported behavioral inflexibility in individuals with frontal lobe dysfunction. Here, we propose that the hippocampus also plays a critical role by forming and reconstructing relational memory representations that underlie flexible cognition and social behavior. There is mounting evidence that damage to the hippocampus can produce inflexible and maladaptive behavior when such behavior places high demands on the generation, recombination, and flexible use of information. This is seen in abilities as diverse as memory, navigation, exploration, imagination, creativity, decision-making, character judgments, establishing and maintaining social bonds, empathy, social discourse, and language use. Thus, the hippocampus, together with its extensive interconnections with other neural systems, supports the flexible use of information in general. Further, we suggest that this understanding has important clinical implications. Hippocampal abnormalities can produce profound deficits in real-world situations, which typically place high demands on the flexible use of information, but are not always obvious on diagnostic tools tuned to frontal lobe function. This review documents the role of the hippocampus in supporting flexible representations and aims to expand our understanding of the dynamic networks that operate as we move through and create meaning of our world.

  17. Temporal flexibility and careers: The role of large-scale organizations for physicians

    OpenAIRE

    Forrest Briscoe

    2006-01-01

    Temporal flexibility and careers: The role of large-scale organizations for physicians. Forrest Briscoe Briscoe This study investigates how employment in large-scale organizations affects the work lives of practicing physicians. Well-established theory associates larger organizations with bureaucratic constraint, loss of workplace control, and dissatisfaction, but this author finds that large scale is also associated with greater schedule and career flexibility. Ironically, the bureaucratic p...

  18. Role of the DIP Molecules in DCC Signaling

    Science.gov (United States)

    1999-09-01

    to policies of applicable Federal Law 45 CFR 46. N/A In conducting research utilizing recombinant DNA technology , the investigator(s) adhered to...for 1 h, then with 0.1 mg/ml of proteinase K, 0.1% SDS at 50’C Ihle, 1995; Fraser and Evan, 1996). These molecules overnight. Samples were extracted ...incubated with 20 yg/ml of anti-DCC antibody diluted in PBS-0.1% saponin for 1 h, washed with PBS, blocked Western blotting with 5% normal donkey serum for 1

  19. A role for adhesion molecules in contact-dependent T help for B cells

    DEFF Research Database (Denmark)

    Owens, T

    1991-01-01

    The role of cell contact in T-dependent B cell activation was examined. Small resting B cells from C57BL/6 mice were cultured with CBA-derived, non-alloreactive cloned T helper cells in anti-T cell receptor V beta 8-coated microwells. This induced polyclonal B cell activation to enter cell cycle...... that continued cell contact involving adhesion/accessory molecules induces B cells to proliferate and to respond to T cell lymphokines. A signaling role for cell interaction molecules on B cells is proposed, similar to the role of these and analogous molecules on T cells....

  20. Role for Adhesion Molecules in the Spermatogonial Stem Cell Niche

    NARCIS (Netherlands)

    de Rooij, Dirk G.; Repping, S.; van Pelt, Ans M. M.

    2008-01-01

    In this issue of Cell Stem Cell, Kanatsu-Shinohara et al. (2008) show that beta 1-integrin participates in normal spermatogenesis and is required for spermatogonial stem cell (SSC) homing to the basal membrane niche. The methodology used provides a powerful tool to study the role of other factors in

  1. The Role of Molecules in Low Temperature Plasmas for Lighting

    International Nuclear Information System (INIS)

    Lapatovich, Walter P.

    2007-01-01

    High intensity discharge (HID) lamps are low temperature (∼0.5eV), weakly ionized plasmas sustained in a refractory but light transmissive envelope for the purpose of converting electrical power into visible radiation. For commercial applications this conversion must occur with good efficiency and with sufficient spectral content throughout the visible (380-780nm) to permit the light so generated to render colors in a fashion comparable to natural sunlight. These goals are often achieved by adding multiple metals to a basic mercury discharge. Because the vapor pressure of most metals is very much lower than mercury itself, chemical compounds containing the desired metals, and having higher vapor pressures are used to introduce the material into the basic discharge. Complexing agents which further improve the vapor pressure are used to enhance the amount of metals in the discharge. The metal compound and complexes are usually polyatomic species which vaporize and subsequently dissociate as they diffuse into the bulk plasma. Under the approximation of local thermodynamic equilibrium (LTE) the particles are in equilibrium, but not with the radiation Held. Strong thermal (106K/m) and density gradients are sustained in the discharge. Atomic and molecular radiation produced in the high temperature core transits through colder gas regions before exiting the lamp. In these regions where the complex molecular species exists in an undissociated state, bound-free transitions can result in energy being effectively converted from light radiation into heat in the mantle. Bound-bound transitions In Identifiable molecules can result in modification of the spectral output in unpredictable and counter-intuitive ways. Examples of completing agents and their effect on the spectral output of typical rare-earth containing HID lamps will be given. The melt composition and the complexing agents themselves may change with time, as chemical reactions in the lamp occur, and their benefit

  2. The Role of Representations in Executive Function: Investigating a Developmental Link Between Flexibility and Abstraction

    Directory of Open Access Journals (Sweden)

    Maria eKharitonova

    2011-11-01

    Full Text Available Young children often perseverate, engaging in previously correct, but no longer appropriate behaviors. One account posits that such perseveration results from the use of stimulus-specific representations of a situation, which are distinct from abstract, generalizable representations that support flexible behavior. Previous findings supported this account, demonstrating that only children who flexibly switch between rules could generalize their behavior to novel stimuli. However, this link between flexibility and generalization might reflect general cognitive abilities, or depend upon similarities across the measures or their temporal order. The current work examined these issues by testing the specificity and generality of this link. In two experiments with three-year-old children, flexibility was measured in terms of switching between rules in a card-sorting task, while abstraction was measured in terms of selecting which stimulus did not belong in an odd-one-out task. The link between flexibility and abstraction was general across (1 abstraction dimensions similar to or different from those in the card-sorting task and (2 abstraction tasks that preceded or followed the switching task. Good performance on abstraction and flexibility measures did not extend to all cognitive tasks, including an IQ measure, and dissociated from children’s ability to gaze at the correct stimulus in the odd-one-out task, suggesting that the link between flexibility and abstraction is specific to such measures, rather than reflecting general abilities that affect all tasks. We interpret these results in terms of the role that developing prefrontal cortical regions play in processes such as working memory, which can support both flexibility and abstraction.

  3. Flexible Bronchoscopy.

    Science.gov (United States)

    Miller, Russell J; Casal, Roberto F; Lazarus, Donald R; Ost, David E; Eapen, George A

    2018-03-01

    Flexible bronchoscopy has changed the course of pulmonary medicine. As technology advances, the role of the flexible bronchoscope for both diagnostic and therapeutic indications is continually expanding. This article reviews the historical development of the flexible bronchoscopy, fundamental uses of the flexible bronchoscope as a tool to examine the central airways and obtain diagnostic tissue, and the indications, complications, and contraindications to flexible bronchoscopy. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. THE ROLE OF WORK AND LABOUR MARKET FLEXIBILITY IN WORKING LIFE PROLONGATION: CASE SLOVENIA

    Directory of Open Access Journals (Sweden)

    Klemen, SIROK

    2014-11-01

    Full Text Available Building upon the premise that the prolongation of working life presents an adequate approach to address the fast approaching challenges of population ageing, the paper presents labour market outcomes of older workers in Slovenia in order to explore the role of social system and labour market flexibility in retirement behaviour. By applying bivariate graphic analysis and series of logistic models, paper finds that decisions of older workers (aged 50 - 69 of whether to retire or to continue working up to legal retirement age is being predominately shaped by the pension system parameters. Economic activity beyond this age (or when retired on the other hand predominately correlates with flexible work arrangements and work motivation. Thus, the future policies in Slovenia aiming to prolong working careers within formal or informal sector should simultaneously do both; change pension system parameters and significantly expand the system flexibility stimulating willing and capable elderly to continue working within the formal sector.

  5. Linking meters and markets: Roles and incentives to support a flexible demand side

    DEFF Research Database (Denmark)

    Katz, Jonas

    2014-01-01

    wholesale market participants to the demand side is mostly infeasible, resulting in flexibility tasks being aggregated and delegated to balancing responsible wholesale traders. This analysis focuses on whether current incentives and roles are appropriate and where the design could be improved to establish......Present trends in the development of electricity systems are expected to generate a growing need for flexibility in decentralised resources, including demand response. In order to enable decentralised actors to create value, the organisation of markets and incentives should incorporate these new...... a flexible demand side with a particular focus on the Danish case. Design-related barriers are identified that affect expected value, associated risks, and the distribution of responsibilities. This serves as a basis to define policy options in the context of Nordic electricity markets. © 2014 Elsevier Ltd...

  6. Multiconformation, Density Functional Theory-Based pKa Prediction in Application to Large, Flexible Organic Molecules with Diverse Functional Groups.

    Science.gov (United States)

    Bochevarov, Art D; Watson, Mark A; Greenwood, Jeremy R; Philipp, Dean M

    2016-12-13

    We consider the conformational flexibility of molecules and its implications for micro- and macro-pK a . The corresponding formulas are derived and discussed against the background of a comprehensive scientific and algorithmic description of the latest version of our computer program Jaguar pK a , a density functional theory-based pK a predictor, which is now capable of acting on multiple conformations explicitly. Jaguar pK a is essentially a complex computational workflow incorporating research and technologies from the fields of cheminformatics, molecular mechanics, quantum mechanics, and implicit solvation models. The workflow also makes use of automatically applied empirical corrections which account for the systematic errors resulting from the neglect of explicit solvent interactions in the algorithm's implicit solvent model. Applications of our program to large, flexible organic molecules representing several classes of functional groups are shown, with a particular emphasis in illustrations laid on drug-like molecules. It is demonstrated that a combination of aggressive conformational search and an explicit consideration of multiple conformations nearly eliminates the dependence of results on the initially chosen conformation. In certain cases this leads to unprecedented accuracy, which is sufficient for distinguishing stereoisomers that have slightly different pK a values. An application of Jaguar pK a to proton sponges, the pK a of which are strongly influenced by steric effects, showcases the advantages that pK a predictors based on quantum mechanical calculations have over similar empirical programs.

  7. Optimized circuit design for flexible 8-bit RFID transponders with active layer of ink-jet printed small molecule semiconductors

    NARCIS (Netherlands)

    Kjellander, B.K.C.; Smaal, W.T.T.; Myny, K.; Genoe, J.; Dehaene, W.; Heremans, P.; Gelinck, G.H.

    2013-01-01

    We ink-jet print a blend of 6,13-bis(triisopropyl-silylethynyl)pentacene and polystyrene as the active layer for flexible circuits. The discrete ink-jet printed transistors exhibit a saturation mobility of 0.5 cm2 V -1 s-1. The relative spread in transistor characteristics can be very large. This

  8. Novel roles for immune molecules in neural development: Implications for neurodevelopmental disoders

    Directory of Open Access Journals (Sweden)

    Paula A Garay

    2010-09-01

    Full Text Available Although the brain has classically been considered "immune-privileged," current research suggests extensive communication between the nervous and the immune systems in both health and disease. Recent studies demonstrate that immune molecules are present at the right place and time to modulate the development and function of the healthy and diseased CNS. Indeed, immune molecules play integral roles in the CNS throughout neural development, including affecting neurogenesis, neuronal migration, axon guidance, synapse formation, activity-dependent refinement of circuits, and synaptic plasticity. Moreover, the roles of individual immune molecules in the nervous system may change over development. This review focuses on the effects of immune molecules on neuronal connections in the mammalian central nervous system—specifically the roles for MHCI and its receptors, complement, and cytokines on the function, refinement, and plasticity of cortical and hippocampal synapses and their relationship to neurodevelopmental disorders. These functions for immune molecules during neural development suggest that they could also mediate pathological responses to chronic elevations of cytokines in neurodevelopmental disorders, including autism spectrum disorders (ASD and schizophrenia.

  9. Reversible flexible structural changes in multidimensional MOFs by guest molecules (I{sub 2}, NH{sub 3}) and thermal stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yang; Li, Libo; Yang, Jiangfeng; Wang, Shuang; Li, Jinping, E-mail: Jpli211@hotmail.com

    2015-03-15

    Three metal–organic frameworks (MOFs), [Cu(INA){sub 2}], [Cu(INA){sub 2}I{sub 2}] and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}], were synthesized with 3D, 2D, and 0D structures, respectively. Reversible flexible structural changes of these MOFs were reported. Through high temperature (60–100 °C) stimulation of I{sub 2} or ambient temperature stimulation of NH{sub 3}, [Cu(INA){sub 2}] (3D) converted to [Cu(INA){sub 2}I{sub 2}] (2D) and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}] (0D); as the temperature increased to 150 °C, the MOFs changed back to their original form. In this way, this 3D MOF has potential application in the capture of I{sub 2} and NH{sub 3} from polluted water and air. XRD, TGA, SEM, NH{sub 3}-TPD, and the measurement of gas adsorption were used to describe the changes in processes regarding the structure, morphology, and properties. - Graphical abstract: Through I{sub 2}, NH{sub 3} molecules and thermal stimulation, the three MOFs can achieve reversible flexible structural changes. Different methods were used to prove the flexible reversible changes. - Highlights: • [Cu(INA){sub 2}] can flexible transform to [Cu(INA){sub 2}I{sub 2}] and [Cu(INA){sub 2}(H{sub 2}O){sub 2}(NH{sub 3}){sub 2}] by adsorbing I{sub 2} or NH{sub 3}. • The reversible flexible transformation related to material source, temperature and concentration. • Potential applications for the capture of I{sub 2} and NH{sub 3} from polluted water or air.

  10. Heave and Flow: Understanding the role of resonance and shape evolution for heaving flexible panels

    Science.gov (United States)

    Hoover, Alexander; Cortez, Ricardo; Tytell, Eric; Fauci, Lisa

    2017-11-01

    Many animals that swim or fly use their body to accelerate the fluid around them, transferring momentum from their bodies to the surrounding fluid. The emergent kinematics from this transfer are a result of the coupling between the fluid and the material properties of the body. Here we present a computational study of a 3-dimensional flexible panel that is heaved at its leading edge in an incompressible, viscous fluid. These high-fidelity numerical simulations enable us to examine the role of resonance, fluid forces, and panel deformations have on swimming performance. Varying both the passive material properties and the heaving frequency of the panel, we find peaks in trailing edge amplitude and forward swimming speed are determined by a dimensionless quantity, the effective flexibility. Modal decompositions of panel deflections reveal that the strength of each mode is related to the effective flexibility and peaks in the swimming speed and trailing edge amplitude correspond to peaks in the contributions of different modes. Panels of different material properties but with similar effective flexibilities have modal contributions that evolve similarly over the phase of the heaving cycle and agreement in dominant vortex structures generated by the panel. NSF RTG 1043626.

  11. The Role of Molecule Clustering by Hydrogen Bond in Hydrous Ethanol on Laminar Burning Velocity

    Directory of Open Access Journals (Sweden)

    I Made Suarta

    2016-01-01

    Full Text Available The role of hydrogen bond molecule clustering in laminar burning velocities was observed. The water in hydrous ethanol can change the interaction between water-ethanol molecules. A certain amount of water can become oxygenated which increases the burning velocity. The hydrogen bond interaction pattern of ethanol and water molecules was modeled. Based on the molecular model, azeotropic behavior emerges from ethanol-water hydrogen bond, which is at a 95.1%v composition. The interaction with water molecule causes the ethanol molecule to be clustered with centered oxygenated compound. So, it supplies extra oxygen and provides intermolecular empty spaces that are easily infiltrated by the air. In the azeotropic composition, the molecular bond chain is the shortest, so hypothetically the burning velocity is anticipated to increase. The laminar burning velocity of ethanol fuel was tested in a cylindrical explosion bomb in lean, stoichiometric, and rich mixtures. The experimental result showed that the maximum burning velocity occurred at hydrous ethanol of 95.5%v composition. This discrepancy is the result of the addition of energy from 7.7% free ethanol molecules that are not clustered. At the rich mixture, the burning velocity of this composition is higher than that of anhydrous ethanol.

  12. Quantum atom-heteronuclear molecule dark state: Role of population imbalance

    International Nuclear Information System (INIS)

    Jing Hui; Cui Shuai

    2010-01-01

    Recently, the finite-number effect of initial atoms in coherent atom-molecule conversion was investigated by Zhao et al. [Phys. Rev. Lett. 101, 010401 (2008)]. Here, by extending to the atom-heteronuclear molecule dark state, we find that the initial populations imbalance of the atoms plays a significant role in quantum conversion rate and adiabatic fidelity. In particular, even for the finite total number of imbalanced two-species atoms, the mean-field conversion rate, contrary to the general belief, still can be remarkably close to the exact quantum results.

  13. Flexibility in change practices and job outcomes for nurses: exploring the role of subjective fit.

    Science.gov (United States)

    Newton, Cameron; Teo, Stephen T T; Pick, David; Yeung, Melissa; Salamonson, Yenna

    2013-12-01

    To integrate existing theoretical perspectives on change management, subjective fit and occupational stress to better understand the effects of change on employee adjustment. Although subjective fit with organizational goals and objectives has been shown to have positive effects on employee adjustment, its role in the organizational change-occupational stress context is not understood. This represents a caveat in research when considering the notion that those who feel that they fit with the organization's goals may be better equipped to reconcile and deal with change. A cross-sectional survey of nurses from public and non-profit sector hospitals was conducted. Data were collected from 252 public and non-profit sector nurses via online surveys. Data were collected from June-October in 2010. Structural equation modelling was used to test the direct and indirect effects among the focal variables. The results showed that public and non-profit nurses experience flexibility-limiting and flexibility-promoting change initiatives and that these are differentially related to the perception of administrative stressors and adjustment with these relationships directly and indirectly influenced by perceptions of subjective fit. Flexibility-limiting change initiatives led to lower levels of subjective fit, higher levels of administrative stressors and less favourable adjustment. On the other hand, flexibility-promoting change practices led to higher levels of subjective fit, lower levels of administrative stressors and ultimately better adjustment. The results further the theoretical understanding of the role of subjective fit in organizational change and occupational stress theories. © 2013 John Wiley & Sons Ltd.

  14. The Role of Vitamin D in the Immune System as a Pro-survival Molecule.

    Science.gov (United States)

    Chirumbolo, Salvatore; Bjørklund, Geir; Sboarina, Andrea; Vella, Antonio

    2017-05-01

    Vitamin D is a fascinating and attractive molecule that has gained particular attention in medicine in recent years. Its immunomodulatory and anti-inflammatory potential might resemble the activity of many nature-derived molecules (eg, flavonoids), but its role in biology was selected during a long evolutionary pathway to dampen the damaging effect of cell stress response and of the immune reaction. In this sense, this molecule can be considered an ancient hormone that serves, in its primary role, as a pro-survival agent. The goal of this review was to elucidate this topic. The article reviews current literature on the field, focusing on issues regarding the role of vitamin D in immunity. Vitamin D participates in the survival machinery used by the cell, and in particular it plays a major role in synchronizing calcium oscillatory signaling to allow cell autophagy or apoptosis during a stress response. Vitamin D should be better highlighted in its molecular action and vitamin D receptor genomics to conceive a more suited therapeutic supplementation protocol in clinics. Copyright © 2017 Elsevier HS Journals, Inc. All rights reserved.

  15. The Role of Immunoglobulin Superfamily Cell Adhesion Molecules in Cancer Metastasis

    Directory of Open Access Journals (Sweden)

    Chee Wai Wong

    2012-01-01

    Full Text Available Metastasis is a major clinical problem and results in a poor prognosis for most cancers. The metastatic pathway describes the process by which cancer cells give rise to a metastatic lesion in a new tissue or organ. It consists of interconnecting steps all of which must be successfully completed to result in a metastasis. Cell-cell adhesion is a key aspect of many of these steps. Adhesion molecules belonging to the immunoglobulin superfamily (Ig-SF commonly play a central role in cell-cell adhesion, and a number of these molecules have been associated with cancer progression and a metastatic phenotype. Surprisingly, the contribution of Ig-SF members to metastasis has not received the attention afforded other cell adhesion molecules (CAMs such as the integrins. Here we examine the steps in the metastatic pathway focusing on how the Ig-SF members, melanoma cell adhesion molecule (MCAM, L1CAM, neural CAM (NCAM, leukocyte CAM (ALCAM, intercellular CAM-1 (ICAM-1 and platelet endothelial CAM-1 (PECAM-1 could play a role. Although much remains to be understood, this review aims to raise the profile of Ig-SF members in metastasis formation and prompt further research that could lead to useful clinical outcomes.

  16. How does emotion influence different creative performances? The mediating role of cognitive flexibility.

    Science.gov (United States)

    Lin, Wei-Lun; Tsai, Ping-Hsun; Lin, Hung-Yu; Chen, Hsueh-Chih

    2014-01-01

    Cognitive flexibility is proposed to be one of the factors underlying how positive emotions can improve creativity. However, previous works have seldom set up or empirically measured an independent index to demonstrate its mediating effect, nor have they investigated its mediating role on different types of creative performances, which involve distinct processes. In this study, 120 participants were randomly assigned to positive, neutral or negative affect conditions. Their levels of cognitive flexibility were then measured by a switch task. Finally, their creative performances were calibrated by either an open-ended divergent thinking test or a closed-ended insight problem-solving task. The results showed that positive emotional states could reduce switch costs and enhance both types of creative performances. However, cognitive flexibility exhibited a full mediating effect only on the relationship between positive emotion and insight problem solving, but not between positive emotion and divergent thinking. Divergent thinking was instead more associated with arousal level. These results suggest that emotions might influence different creative performances through distinct mechanisms.

  17. The role of the ion-molecule and molecule-molecule interactions in the formation of the two-ion average force interaction potential

    CERN Document Server

    Ajrian, E A; Sidorenko, S N

    2002-01-01

    The effect of the ion-molecule and intermolecular interactions on the formation of inter-ion average force potentials is investigated within the framework of a classical ion-dipole model of electrolyte solutions. These potentials are shown to possess the Coulomb asymptotics at large distances while in the region of mean distances they reveal creation and disintegration of solvent-shared ion pairs. The calculation results provide a qualitatively authentic physical picture which is experimentally observed in strong electrolytes solutions. In particular, an increased interaction between an ion and a molecule enhances formation of ion pairs in which the ions are separated by one solvent molecule

  18. Comparison of several classical density functional theories for the adsorption of flexible chain molecules into cylindrical nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Hlushak, S. P., E-mail: stepan.hlushak@gmail.com [Department of Chemical and Biomolecular Engineering, Vanderbilt University, Nashville, Tennessee 37235 (United States); Institute for Condensed Matter Physics, Svientsitskoho 1, 79011 Lviv (Ukraine); Cummings, P. T. [Department of Chemical and Biomolecular Engineering, Vanderbilt University, Nashville, Tennessee 37235 (United States); Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); McCabe, C. [Department of Chemical and Biomolecular Engineering, Vanderbilt University, Nashville, Tennessee 37235 (United States); Department of Chemistry, Vanderbilt University, Nashville 37235 (United States)

    2013-12-21

    Adsorption of flexible oligomers into narrow cylindrical pores has been studied by means of several versions of classical density functional theory (CDFT) and Monte Carlo simulation. The adsorption process is interesting to study due to the competition between the entropic depletion of oligomers from the pores and the wall–oligomer attraction. It is also challenging to describe using current CDFTs, which tend to overestimate the amount of the adsorbed fluid. From a comparison of several different CDFT approaches, we find that this is due to the assumption of ideal or freely jointed chain conformations. Moreover, it is demonstrated that it is impossible to obtain a reasonable description of the adsorption isotherms without taking into account accurate contact values in the distribution functions describing the structure of the reference monomer fluid. At low densities, more accurate result are obtained in comparison with Monte Carlo simulation data when accurate contact values are incorporated into the theory rather than the more commonly used hard-sphere contact value. However, even the CDFT with accurate contact values still overestimates the amount of the adsorbed fluid due to the ideal or freely jointed chain approximation, used for the description of chain conformations in most CDFT approaches. We find that significant improvement can achieved by employing self-consistent field theory, which samples self-avoiding chain conformations and decreases the number of possible chain conformations, and, consequently, the amount of the adsorbed fluid.

  19. Comparison of several classical density functional theories for the adsorption of flexible chain molecules into cylindrical nanopores.

    Science.gov (United States)

    Hlushak, S P; Cummings, P T; McCabe, C

    2013-12-21

    Adsorption of flexible oligomers into narrow cylindrical pores has been studied by means of several versions of classical density functional theory (CDFT) and Monte Carlo simulation. The adsorption process is interesting to study due to the competition between the entropic depletion of oligomers from the pores and the wall-oligomer attraction. It is also challenging to describe using current CDFTs, which tend to overestimate the amount of the adsorbed fluid. From a comparison of several different CDFT approaches, we find that this is due to the assumption of ideal or freely jointed chain conformations. Moreover, it is demonstrated that it is impossible to obtain a reasonable description of the adsorption isotherms without taking into account accurate contact values in the distribution functions describing the structure of the reference monomer fluid. At low densities, more accurate result are obtained in comparison with Monte Carlo simulation data when accurate contact values are incorporated into the theory rather than the more commonly used hard-sphere contact value. However, even the CDFT with accurate contact values still overestimates the amount of the adsorbed fluid due to the ideal or freely jointed chain approximation, used for the description of chain conformations in most CDFT approaches. We find that significant improvement can achieved by employing self-consistent field theory, which samples self-avoiding chain conformations and decreases the number of possible chain conformations, and, consequently, the amount of the adsorbed fluid.

  20. Comparison of several classical density functional theories for the adsorption of flexible chain molecules into cylindrical nanopores

    International Nuclear Information System (INIS)

    Hlushak, S. P.; Cummings, P. T.; McCabe, C.

    2013-01-01

    Adsorption of flexible oligomers into narrow cylindrical pores has been studied by means of several versions of classical density functional theory (CDFT) and Monte Carlo simulation. The adsorption process is interesting to study due to the competition between the entropic depletion of oligomers from the pores and the wall–oligomer attraction. It is also challenging to describe using current CDFTs, which tend to overestimate the amount of the adsorbed fluid. From a comparison of several different CDFT approaches, we find that this is due to the assumption of ideal or freely jointed chain conformations. Moreover, it is demonstrated that it is impossible to obtain a reasonable description of the adsorption isotherms without taking into account accurate contact values in the distribution functions describing the structure of the reference monomer fluid. At low densities, more accurate result are obtained in comparison with Monte Carlo simulation data when accurate contact values are incorporated into the theory rather than the more commonly used hard-sphere contact value. However, even the CDFT with accurate contact values still overestimates the amount of the adsorbed fluid due to the ideal or freely jointed chain approximation, used for the description of chain conformations in most CDFT approaches. We find that significant improvement can achieved by employing self-consistent field theory, which samples self-avoiding chain conformations and decreases the number of possible chain conformations, and, consequently, the amount of the adsorbed fluid

  1. Role of transnasal flexible laryngo-oesophagoscopy (TNFLO) in investigating patients with globus symptoms.

    Science.gov (United States)

    Mohammed, H; Coates, M; Masterson, L; Chan, W Y; Hassan, Y; Nassif, R

    2017-12-01

    To explore the rationale for investigating patients presenting with globus symptoms. In this regard, we also assess the efficacy and safety of transnasal flexible laryngo-oesophagoscopy (TNFLO). A prospective study in a head and neck cancer centre of patients with persistent globus symptoms with normal flexible nasoendoscopy/indirect mirror laryngoscopy and failure of first-line medical treatment. The role of TNFLO in investigating these patients was assessed. A total of 218 patients were recruited in this study. Positive findings included upper aerodigestive cancers in two patients, other pathologies included reflux (four patients), cricopharyngeus-related pathologies (19 patients), candida (five patients). There were only five re-referrals of patients who were discharged following normal examination with TNFLO. In nine patients, TNFLO could not be completed and they went on to have other diagnostic procedures CONCLUSION: This article is the largest to date in the UK to assess the role of TNFLO in investigating patients with globus symptoms. TNFLO is equal to rigid endoscopy as a diagnostic tool. However, it is superior in terms of image clarity, ability to record video images and safety. © 2017 John Wiley & Sons Ltd.

  2. Insights into the role of protein molecule size and structure on interfacial properties using designed sequences

    Science.gov (United States)

    Dwyer, Mirjana Dimitrijev; He, Lizhong; James, Michael; Nelson, Andrew; Middelberg, Anton P. J.

    2013-01-01

    Mixtures of a large, structured protein with a smaller, unstructured component are inherently complex and hard to characterize at interfaces, leading to difficulties in understanding their interfacial behaviours and, therefore, formulation optimization. Here, we investigated interfacial properties of such a mixed system. Simplicity was achieved using designed sequences in which chemical differences had been eliminated to isolate the effect of molecular size and structure, namely a short unstructured peptide (DAMP1) and its longer structured protein concatamer (DAMP4). Interfacial tension measurements suggested that the size and bulk structuring of the larger molecule led to much slower adsorption kinetics. Neutron reflectometry at equilibrium revealed that both molecules adsorbed as a monolayer to the air–water interface (indicating unfolding of DAMP4 to give a chain of four connected DAMP1 molecules), with a concentration ratio equal to that in the bulk. This suggests the overall free energy of adsorption is equal despite differences in size and bulk structure. At small interfacial extensional strains, only molecule packing influenced the stress response. At larger strains, the effect of size became apparent, with DAMP4 registering a higher stress response and interfacial elasticity. When both components were present at the interface, most stress-dissipating movement was achieved by DAMP1. This work thus provides insights into the role of proteins' molecular size and structure on their interfacial properties, and the designed sequences introduced here can serve as effective tools for interfacial studies of proteins and polymers. PMID:23303222

  3. Role of adhesion molecules and inflammation in Venezuelan equine encephalitis virus infected mouse brain

    Directory of Open Access Journals (Sweden)

    Honnold Shelley P

    2011-04-01

    Full Text Available Abstract Background Neuroinvasion of Venezuelan equine encephalitis virus (VEEV and subsequent initiation of inflammation in the brain plays a crucial role in the outcome of VEEV infection in mice. Adhesion molecules expressed on microvascular endothelial cells in the brain have been implicated in the modulation of the blood brain barrier (BBB and inflammation in brain but their role in VEEV pathogenesis is not very well understood. In this study, we evaluated the expression of extracellular matrix and adhesion molecules genes in the brain of VEEV infected mice. Findings Several cell to cell adhesion molecules and extracellular matrix protein genes such as ICAM-1, VCAM-1, CD44, Cadherins, integrins, MMPs and Timp1 were differentially regulated post-VEEV infection. ICAM-1 knock-out (IKO mice infected with VEEV had markedly reduced inflammation in the brain and demonstrated a delay in the onset of clinical symptoms of disease. A differential regulation of inflammatory genes was observed in the IKO mice brain compared to their WT counterparts. Conclusions These results improve our present understanding of VEEV induced inflammation in mouse brain.

  4. Role of signaling lymphocytic activation molecule in T helper cell responses

    Directory of Open Access Journals (Sweden)

    Jan E. de Vries

    1998-01-01

    Full Text Available Signaling lymphocytic activation molecule (SLAM; CDw150 is a 70 kDa glycoprotein. Signaling lymphocytic activation molecule is constitutively expressed on memory T cells, CD56+ T cells, a subset of T cell receptor γδ+ cells, immature thymocytes and, at low levels, on a proportion of peripheral blood B cells. Signaling lymphocytic activation molecule is rapidly upregulated on all T and B cells after activation. Engagement of SLAM by F(ab’2 fragments of an anti-SLAM monoclonal antibody (mAb A12 enhances antigen-specific T cell proliferation. In addition, mAb A12 was directly mitogenic for T cell clones and activated T cells. T cell proliferation induced by mAb A12 is independent of interleukin (IL-2, IL-4, IL-12 and IL-15, but is cyclosporin A sensitive. Ligation of SLAM during antigen-specific T cell proliferation resulted in upregulation of interferon (IFN-γ production, even by allergen-specific T helper cell (Th 2 clones, whereas the levels of IL-4 and IL-5 production were only marginally affected. The mAb A12 was unable to induce IL-4 and IL-5 production by Th1 clones. Co-stimulation of skin-derived Der P1-specific Th2 cells from patients with atopic dermatitis via SLAM resulted in the generation of a population of IFN-γ-producing cells, thereby reverting their phenotype to a Th0 pattern. Signaling lymphocytic activation molecule is a high-affinity self ligand mediating homophilic cell interaction. In addition, soluble SLAM enhances both T and B cell proliferation. Collectively, these data indicate that SLAM molecules act both as receptors and ligands that are not only involved in T cell expansion but also drive the expanding T cells during immune responses into the Th0/Th1 pathway. This suggests that signaling through SLAM plays a role in directing Th0/Th1 development.

  5. Role of Dispersive Fluorous Interaction in the Solvation Dynamics of the Perfluoro Group Containing Molecules.

    Science.gov (United States)

    Mondal, Saptarsi; Chaterjee, Soumit; Halder, Ritaban; Jana, Biman; Singh, Prashant Chandra

    2017-08-17

    Perfluoro group containing molecules possess an important self-aggregation property through the fluorous (F···F) interaction which makes them useful for diverse applications such as medicinal chemistry, separation techniques, polymer technology, and biology. In this article, we have investigated the solvation dynamics of coumarin-153 (C153) and coumarin-6H (C6H) in ethanol (ETH), 2-fluoroethanol (MFE), and 2,2,2-trifluoroethanol (TFE) using the femtosecond upconversion technique and molecular dynamics (MD) simulation to understand the role of fluorous interaction between the solute and solvent molecules in the solvation dynamics of perfluoro group containing molecules. The femtosecond upconversion data show that the time scales of solvation dynamics of C6H in ETH, MFE, and TFE are approximately the same whereas the solvation dynamics of C153 in TFE is slow as compared to that of ETH and MFE. It has also been observed that the time scale of solvation dynamics of C6H in ETH and MFE is higher than that of C153 in the same solvents. MD simulation results show a qualitative agreement with the experimental data in terms of the time scale of the slow components of the solvation for all the systems. The experimental and simulation studies combined lead to the conclusion that the solvation dynamics of C6H in all solvents as well as C153 in ETH and MFE is mostly governed by the charge distribution of ester moieties (C═O and O) of dye molecules whereas the solvation of C153 in TFE is predominantly due to the dispersive fluorous interaction (F···F) between the perfluoro groups of the C153 and solvent molecules.

  6. Flexible Use of Predictive Cues beyond the Orbitofrontal Cortex: Role of the Submedius Thalamic Nucleus.

    Science.gov (United States)

    Alcaraz, Fabien; Marchand, Alain R; Vidal, Elisa; Guillou, Alexandre; Faugère, Angélique; Coutureau, Etienne; Wolff, Mathieu

    2015-09-23

    The orbitofrontal cortex (OFC) is known to play a crucial role in learning the consequences of specific events. However, the contribution of OFC thalamic inputs to these processes is largely unknown. Using a tract-tracing approach, we first demonstrated that the submedius nucleus (Sub) shares extensive reciprocal connections with the OFC. We then compared the effects of excitotoxic lesions of the Sub or the OFC on the ability of rats to use outcome identity to direct responding. We found that neither OFC nor Sub lesions interfered with the basic differential outcomes effect. However, more specific tests revealed that OFC rats, but not Sub rats, were disproportionally relying on the outcome, rather than on the discriminative stimulus, to guide behavior, which is consistent with the view that the OFC integrates information about predictive cues. In subsequent experiments using a Pavlovian contingency degradation procedure, we found that both OFC and Sub lesions produced a severe deficit in the ability to update Pavlovian associations. Altogether, the submedius therefore appears as a functionally relevant thalamic component in a circuit dedicated to the integration of predictive cues to guide behavior, previously conceived as essentially dependent on orbitofrontal functions. Significance statement: In the present study, we identify a largely unknown thalamic region, the submedius nucleus, as a new functionally relevant component in a circuit supporting the flexible use of predictive cues. Such abilities were previously conceived as largely dependent on the orbitofrontal cortex. Interestingly, this echoes recent findings in the field showing, in research involving an instrumental setup, an additional involvement of another thalamic nuclei, the parafascicular nucleus, when correct responding requires an element of flexibility (Bradfield et al., 2013a). Therefore, the present contribution supports the emerging view that limbic thalamic nuclei may contribute critically to

  7. Exploring the Moderating Role of Perceived Flexibility Advantages in Mobile Learning Continuance Intention (MLCI

    Directory of Open Access Journals (Sweden)

    Rui-Ting Huang

    2014-07-01

    Full Text Available The primary purpose of this study was to explore the key factors that could affect mobile learning continuance intention (MLCI, and examine the moderating effect of perceived flexibility advantages (PFA on the relationship between key mobile learning elements and continuance intention. Five hundred undergraduate students who had previously adopted mobile devices to learn English took part in this study. Partial least squares (PLS analysis was utilized to test the hypotheses in this study. It has been found that the perceived usefulness of mobile technology, subjective norm, and self-management of learning could be closely linked to mobile learning continuance intention. With particular respect to the moderating role of perceived flexibility advantages, it has been demonstrated that PFA could moderate the relationship between perceived usefulness of mobile technology and mobile learning continuance intention, as well as the association between subjective norm and mobile learning continuance intention, whereas PFA did not moderate the link between self-management of learning and mobile learning continuance intention.This report has further added to the body of knowledge in the field of mobile learning through empirical examination.

  8. The Role of Cell Adhesion Molecule Genes Regulating Neuroplasticity in Addiction

    Directory of Open Access Journals (Sweden)

    Dawn E. Muskiewicz

    2018-01-01

    Full Text Available A variety of genetic approaches, including twin studies, linkage studies, and candidate gene studies, has established a firm genetic basis for addiction. However, there has been difficulty identifying the precise genes that underlie addiction liability using these approaches. This situation became especially clear in genome-wide association studies (GWAS of addiction. Moreover, the results of GWAS brought into clarity many of the shortcomings of those early genetic approaches. GWAS studies stripped away those preconceived notions, examining genes that would not previously have been considered in the study of addiction, consequently creating a shift in our understanding. Most importantly, those studies implicated a class of genes that had not previously been considered in the study of addiction genetics: cell adhesion molecules (CAMs. Considering the well-documented evidence supporting a role for various CAMs in synaptic plasticity, axonal growth, and regeneration, it is not surprising that allelic variation in CAM genes might also play a role in addiction liability. This review focuses on the role of various cell adhesion molecules in neuroplasticity that might contribute to addictive processes and emphasizes the importance of ongoing research on CAM genes that have been implicated in addiction by GWAS.

  9. Interface Molecules of Angiostrongylus cantonensis: Their Role in Parasite Survival and Modulation of Host Defenses

    Directory of Open Access Journals (Sweden)

    Alessandra L. Morassutti

    2012-01-01

    Full Text Available Angiostrongylus cantonensis is a nematode parasite that causes eosinophilic meningoencephalitis in humans. Disease presents following the ingestion of third-stage larvae residing in the intermediate mollusk host and disease manifests as an acute inflammation of the meninges characterized by eosinophil infiltrates which release a battery of proinflammatory and cytotoxic agents in response to the pathogen. As a mechanism of neutralizing these host defenses, A. cantonensis expresses different molecules with immunomodulatory properties that are excreted or secreted (ES. In this paper we discuss the role of ES proteins on disease exacerbation and their potential use as therapeutic targets.

  10. The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

    Science.gov (United States)

    Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

    2013-04-25

    The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

  11. New Therapeutic Drugs from Bioactive Natural Molecules: the Role of Gut Microbiota Metabolism in Neurodegenerative Diseases.

    Science.gov (United States)

    Di Meo, Francesco; Donato, Stella; Di Pardo, Alba; Maglione, Vittorio; Filosa, Stefania; Crispi, Stefania

    2018-04-03

    The gut-brain axis is considered a neuroendocrine system, which connects brain and gastrointestinal tract and plays an important role in stress response. The homeostasis of gut-brain axis is important for healthy conditions and its alterations are associated to neurological disorders and neurodegenerative diseases. Gut microbiota is a dynamic ecosystem that can be altered by external factors such as diet composition, antibiotics or xenobiotics. Recent advances in gut microbiota analyses indicate that the gut bacterial community plays a key role in maintaining normal brain functions. Recent metagenomic analyses have elucidated that the relationship between gut and brain, either in normal or in pathological conditions, reflects the existence of a "microbiota-gut-brain" axis. Gut microbiota composition can be influenced by dietary ingestion of probiotics or natural bioactive molecules such as prebiotics and polyphenols. Their derivatives coming from microbiota metabolism can affect both gut bacterial composition and brain biochemistry. Modifications of microbiota composition by natural bioactive molecules could be used to restore the altered brain functions, which characterize neurodegenerative diseases, leading to consider these compounds as novel therapeutic strategies for the treatment of neuropathologies. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Molecular-dynamics simulation of lateral friction in contact-mode atomic force microscopy of alkane films: The role of molecular flexibility

    DEFF Research Database (Denmark)

    Soza, P.; Hansen, Flemming Yssing; Taub, H.

    2011-01-01

    than on a surface of molecules with the long axis perpendicular to the surface, in agreement with experimental results. A major dissipation mechanism is the molecular flexibility as manifested in the torsional motion about the molecules' C-C bonds. The generation of gauche defects as a result...

  13. Role of the adhesion molecule F3/Contactin in synaptic plasticity and memory.

    Science.gov (United States)

    Gulisano, Walter; Bizzoca, Antonella; Gennarini, Gianfranco; Palmeri, Agostino; Puzzo, Daniela

    2017-06-01

    Cell adhesion molecules (CAMs) have a pivotal role in building and maintaining synaptic structures during brain development participating in axonal elongation and pathfinding, glial guidance of neuronal migration, as well as myelination. CAMs expression persists in the adult brain particularly in structures undergoing postnatal neurogenesis and involved in synaptic plasticity and memory as the hippocampus. Among the neural CAMs, we have recently focused on F3/Contactin, a glycosylphosphatidyl inositol-anchored glycoprotein belonging to the immunoglobulin superfamily, involved in neuronal development, synaptic maintenance and organization of neuronal networks. Here, we discuss our recent data suggesting that F3/Contactin exerts a role in hippocampal synaptic plasticity and memory in adult and aged mice. In particular, we have studied long-term potentiation (LTP), spatial and object recognition memory, and phosphorylation of the transcription factor cAMP-Responsive-Element Binding protein (CREB) in a transgenic mouse model of F3/Contactin overexpression. We also investigated whether F3/Contactin might influence neuronal apoptosis and the production of amyloid-beta peptide (Aβ), known to be one of the main pathogenetic hallmarks of Alzheimer's disease (AD). In conclusion, a further understanding of F3/Contactin role in synaptic plasticity and memory might have interesting clinical outcomes in cognitive disorders, such as aging and AD, offering innovative therapeutic opportunities. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Role of nitric oxide and related molecules in schizophrenia pathogenesis: biochemical, genetic and clinical aspects

    Directory of Open Access Journals (Sweden)

    Regina F. Nasyrova

    2015-05-01

    Full Text Available Currently, schizophrenia is considered a multifactorial disease. Over the past 50 years, many investigators have considered the role of toxic free radicals in the etiology of schizophrenia. This is an area of active research which is still evolving. Here, we review the recent data and current concepts on the roles of nitric oxide (NO and related molecules in the pathogenesis of schizophrenia. NO is involved in storage, uptake and release of mediators and neurotransmitters, including glutamate, acetylcholine, noradrenaline, GABA, taurine and glycine. In addition, NO diffuses across cell membranes and activates its own extrasynaptic receptors. Further, NO is involved in peroxidation and reactive oxidative stress. Investigations reveal significant disturbances in NO levels in the brain structures (cerebellum, hypothalamus, hippocampus, striatum and fluids of subjects with schizophrenia. Given the roles of NO in central nervous system development, these changes may result in neurodevelopmental changes associated with schizophrenia. We describe here the recent literature on NOS gene polymorphisms on schizophrenia, which all point to consistent results. We also discuss how NO may be a new target for the therapy of mental disorders. Currently there have been 2 randomized double-blind placebo-controlled trials of L-lysine as an NOS inhibitor in the CNS.

  15. The Role of Learning Tasks on Attitude Change Using Cognitive Flexibility Hypertext Systems

    Science.gov (United States)

    Godshalk, Veronica M.; Harvey, Douglas M.; Moller, Leslie

    2004-01-01

    In this study, the authors examined the impact of task assignment on the effectiveness of a Web-based experiential exercise based on cognitive flexibility theory to enlighten learner attitudes toward the ill-structured topic of sexual harassment. In the research study, we sought to shed light on the use of a cognitive flexibility approach when…

  16. Role of Intercellular Adhesion Molecule-1 in Radiation-Induced Brain Injury

    International Nuclear Information System (INIS)

    Wu, K.-L.; Tu Ba; Li Yuqing; Wong, C. Shun

    2010-01-01

    Purpose: To determine the role of intercellular adhesion molecule-1 (ICAM-1) in the pathogenesis of brain injury after irradiation (IR). Methods and Materials: We assessed the expression of ICAM-1 in mouse brain after cranial IR and determined the histopathologic and behavioral changes in mice that were either wildtype (+/+) or knockout (-/-) of the ICAM-1 gene after IR. Results: There was an early dose-dependent increase in ICAM-1 mRNA and protein expression after IR. Increased ICAM-1 immunoreactivity was observed in endothelia and glia of ICAM-1+/+ mice up to 8 months after IR. ICAM-1-/- mice showed no expression. ICAM-1+/+ and ICAM-1-/- mice showed similar vascular abnormalities at 2 months after 10-17 Gy, and there was evidence for demyelination and inhibition of hippocampal neurogenesis at 8 months after 10 Gy. After 10 Gy, irradiated ICAM-1+/+ and ICAM-1-/- mice showed similar behavioral changes at 2-6 months in open field, light-dark chamber, and T-maze compared with age-matched genotype controls. Conclusion: There is early and late upregulation of ICAM-1 in the vasculature and glia of mouse brain after IR. ICAM-1, however, does not have a causative role in the histopathologic injury and behavioral dysfunction after moderate single doses of cranial IR.

  17. The role of medicaments, exosomes and miRNA molecules in modulation of macrophage immune activity

    Directory of Open Access Journals (Sweden)

    Katarzyna Nazimek

    2015-01-01

    Full Text Available Macrophages play an important role in innate immunity, in induction and orchestration of acquired immune response as well as in the maintenance of tissue homeostasis. Macrophages as antigen presenting cells induce or inhibit the development of immune response and as effector cells play an important role in innate immunity to infectious agents and in delayed--type hypersensitivity as well. Thus, either up- or down-regulation of their activity leads to the impairment of different biological processes. This often results in the development of immunological diseases or inflammatory response associated with metabolic, cardiovascular or neuroendocrine disorders. Therefore, the possibility of modulation of macrophage function should allow for elaboration of new effective therapeutic strategies. Noteworthy, interaction of medicaments with macrophages may directly mediate their therapeutic activity or is an additional beneficial effect increasing efficacy of treatment. Further, macrophage differentiation is regulated by miRNA-223, while expression of miRNA-146 and miRNA-155 may modulate and/or be a result of the current cell phenotype. Present review is focused on the current knowledge about the action of medicaments, microRNA molecules, exosomes and related vesicles on macrophages leading to modulation of their biological activity.

  18. Influence of semisynthetic modification of the scaffold of a contact domain of HbS on polymerization: role of flexible surface topology in polymerization inhibition.

    Science.gov (United States)

    Sonati, Srinivasulu; Bhutoria, Savita; Prabhakaran, Muthuchidambaran; Acharya, Seetharama A

    2018-02-01

    A new variant of HbS, HbS-Einstein with a deletion of segment α 23-26 in the B-helix, has been assembled by semisynthetic approach. B-helix of the α chain of cis αβ-dimer of HbS plays dominant role in the quinary interactions of deoxy HbS dimer. This B-helix is the primary scaffold that provides the orientation for the side chains of contact residues of this intermolecular contact domain. The design of HbS-Einstein has been undertaken to map the influence of perturbation of molecular surface topology and the flexibility of surface residues in the polymerization. The internal deletion exerts a strong inhibitory influence on Val-6 (β)-dependent polymerization, comparable to single contact site mutations and not for complete neutralization of Val-6(β)-dependent polymerization. The scaffold modification in cis-dimer is inhibitory, and is without any effect when present on the trans dimer. The flexibility changes in the surface topology in the region of scaffold modification apparently counteracts the intrinsic polymerization potential of the molecule. The inhibition is close to that of Le Lamentin mutation [His-20 (α) → Gln] wherein a mutation engineered without much change in flexibility of the contact domain. Interestingly, the chimeric HbS with swine-human chimeric α chain with multiple non-conservative mutations completely inhibits the Val-6(β)-dependent polymerization. The deformabilities of surface topology of chimeric HbS are comparable to HbS in spite of the multiple contact site mutations in the α-chain. We conclude that the design of antisickling Hbs for gene therapy of sickle cell disease should involve multiple mutations of intermolecular contact sites.

  19. Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

    Science.gov (United States)

    Meisel, Jayda E; Chang, Mayland

    2017-11-01

    The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The role of cognitive flexibility in cognitive restructuring skill acquisition among older adults.

    Science.gov (United States)

    Johnco, C; Wuthrich, V M; Rapee, R M

    2013-08-01

    Cognitive flexibility is one aspect of executive functioning that encompasses the ability to produce diverse ideas, consider response alternatives, and modify behaviors to manage changing circumstances. These processes are likely to be important for implementing cognitive restructuring. The present study investigated the impact of cognitive flexibility on older adults' ability to learn cognitive restructuring. Neuropsychological measures of cognitive flexibility were administered to 40 normal community-dwelling older adult volunteers and their ability to implement cognitive restructuring was coded and analyzed. Results indicated that the majority of participants showed good cognitive restructuring skill acquisition with brief training. The multiple regression analysis suggested that those with poorer cognitive flexibility on neuropsychological testing demonstrated poorer quality cognitive restructuring. In particular, perseverative thinking styles appear to negatively impact the ability to learn cognitive restructuring. Further research is needed to clarify whether older adults with poor cognitive flexibility can improve their cognitive restructuring skills with repetition over treatment or whether alternative skills should be considered. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  1. Mechanical Response of Single Filamin A (ABP-280) Molecules and Its Role in the Actin/Filamin A Gel

    Science.gov (United States)

    Sano, Ryoko; Furuike, Shou; Ito, Tadanao; Ohashi, Kazuyo; Yamazaki, Masahito

    2004-04-01

    Actin/filamin A gel plays important roles in mechanical response of cells. We found a force (50 to 220 pN)-induced unfolding of single filamin A molecules using AFM, and have proposed a hypothesis on the role of single filamin A in the novel property of viscoelasticity of actin/filamin A gel. We also investigated structure and its dynamics of actin/filamin A gel formed in a giant liposome using fluorescence microscopy.

  2. I want to be creative: exploring the role of hedonic contingency theory in the positive mood-cognitive flexibility link.

    Science.gov (United States)

    Hirt, Edward R; Devers, Erin E; McCrea, Sean M

    2008-02-01

    Three studies explored the role of hedonic contingency theory as an explanation for the link between positive mood and cognitive flexibility. Study 1 examined the determinants of activity choice for participants in happy, sad, or neutral moods. Consistent with hedonic contingency theory, happy participants weighted potential for creativity as well as the pleasantness of the task more heavily in their preference ratings. In Study 2, participants were given either a neutral or mood-threatening item generation task to perform. Results illustrated that happy participants exhibited greater cognitive flexibility in all cases; when confronted with a potentially mood-threatening task, happy participants were able to creatively transform the task so as to maintain positive mood and interest. Finally, Study 3 manipulated participants' beliefs that moods could or could not be altered. Results replicated the standard positive mood-increased cognitive flexibility effect in the nonmood-freezing condition, but no effects of mood on creativity were found in the mood-freezing condition. These studies indicate that the hedonic contingency theory may be an important contributing mechanism behind the positive mood-cognitive flexibility link. (c) 2008 APA, all rights reserved

  3. Current rectification in a single molecule diode: the role of electrode coupling.

    Science.gov (United States)

    Sherif, Siya; Rubio-Bollinger, Gabino; Pinilla-Cienfuegos, Elena; Coronado, Eugenio; Cuevas, Juan Carlos; Agraït, Nicolás

    2015-07-24

    We demonstrate large rectification ratios (> 100) in single-molecule junctions based on a metal-oxide cluster (polyoxometalate), using a scanning tunneling microscope (STM) both at ambient conditions and at low temperature. These rectification ratios are the largest ever observed in a single-molecule junction, and in addition these junctions sustain current densities larger than 10(5) A cm(-2). By following the variation of the I-V characteristics with tip-molecule separation we demonstrate unambiguously that rectification is due to asymmetric coupling to the electrodes of a molecule with an asymmetric level structure. This mechanism can be implemented in other type of molecular junctions using both organic and inorganic molecules and provides a simple strategy for the rational design of molecular diodes.

  4. The Role of Cognitive Flexibility in the Spatial Representation of Children's Drawings

    Science.gov (United States)

    Ebersbach, Mirjam; Hagedorn, Helena

    2011-01-01

    Representing the spatial appearance of objects and scenes in drawings is a difficult task for young children in particular. In the present study, the relationship between spatial drawing and cognitive flexibility was investigated. Seven- to 11-year-olds (N = 60) were asked to copy a three-dimensional model in a drawing. The use of depth cues as an…

  5. The Role of Flexible Work in the Transition from Higher Education into the Labour Market

    Science.gov (United States)

    Try, Sverre

    2004-01-01

    Using data from the Norwegian Graduate Survey from 1985 to 1999, the study investigates Norwegian graduate students' entry into the labour market. The study finds that more than half of the employed graduates enter the work force via a flexible job, that is either a temporary or a part-time job, and the proportion has increased during the period.…

  6. Theory of mind and context processing in schizophrenia: the role of cognitive flexibility.

    Science.gov (United States)

    Champagne-Lavau, Maud; Charest, Anick; Anselmo, Karyne; Rodriguez, Jean-Pierre; Blouin, Guy

    2012-12-30

    The present study sought to identify whether cognitive flexibility and context processing may impact theory of mind (ToM) ability in schizophrenia. Thirty two patients with schizophrenia and 29 matched healthy participants were tested individually on their ToM ability using a task involving attribution and comprehension of a speaker's ironic intent. This task made it possible to determine whether the degree of incongruity between contextual information and a target sentence has an impact on the attribution of ironic intent to the protagonists of a story. Participants were also assessed on their cognitive flexibility and working memory. The main results revealed that participants with schizophrenia correctly perceived contextual information cueing attribution of ironic intent to the protagonist of the stimulus, but they showed difficulty to correctly integrate this information, performing significantly worse than healthy participants when they attributed mental states. However, some participants with schizophrenia performed like healthy control participants on the ToM task while others did not. A lack of flexibility seems to differentiate the two schizophrenia subgroups thereby obtained, suggesting that cognitive flexibility has an impact on ToM performances in schizophrenia. These difficulties were not associated with clinical symptoms. Such results will have an impact on cognitive remediation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. The role of verbal labels on flexible memory retrieval at 12-months of age.

    Science.gov (United States)

    Taylor, Gemma; Liu, Hao; Herbert, Jane S

    2016-11-01

    The provision of verbal labels enhances 12-month-old infants' memory flexibility across a form change in a puppet imitation task (Herbert, 2011), although the mechanisms for this effect remain unclear. Here we investigate whether verbal labels can scaffold flexible memory retrieval when task difficulty increases and consider the mechanism responsible for the effect of language cues on early memory flexibility. Twelve-month-old infants were provided with English, Chinese, or empty language cues during a difficult imitation task, a combined change in the puppet's colour and form at the test (Hayne et al., 1997). Imitation performance by infants in the English language condition only exceeded baseline performance after the 10-min delay. Thus, verbal labels facilitated flexible memory retrieval on this task. There were no correlations between infants' language comprehension and imitation performance. Thus, it is likely that verbal labels facilitate both attention and categorisation during encoding and retrieval. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Flexible employment and nurses' intention to leave the profession: The role of support at work.

    Science.gov (United States)

    Zeytinoglu, Isik U; Denton, Margaret; Plenderleith, Jennifer Millen

    2011-02-01

    The objectives of this paper are to examine (1) the association between flexible employment and nurses' intention to leave the profession, and (2) whether or not support at work mediates the association between flexible employment and nurses' intention to leave the profession. Flexible employment is analyzed objectively using non-permanent contract, part-time employment status, casual employment status, involuntary hours and on-call work, and subjectively using job insecurity. Support at work refers to organizational, supervisor and peer support. Data come from our survey of 1396 nurses employed in three teaching hospitals in Southern Ontario. Descriptive statistics are provided. Bivariate correlations, hierarchical regression analysis and mediation tests are conducted. Compared to those in full-time employment, nurses in part-time employment do not intend to leave the profession. None of the other objective flexible employment factors are associated with intention to leave the profession. Perceived job insecurity is associated with intention to leave the profession. Low support at work contributes to intention to leave the profession and mediates the association between job insecurity and intention to leave the profession. The study provides evidence to health sector managers and policy makers that part-time employment, perceived job security and support at work are important factors to consider in efforts to retain nurses in the profession. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  9. Above-threshold ionization in multicenter molecules: The role of the initial state

    Science.gov (United States)

    Suárez, Noslen; Chacón, Alexis; Pisanty, Emilio; Ortmann, Lisa; Landsman, Alexandra S.; Picón, Antonio; Biegert, Jens; Lewenstein, Maciej; Ciappina, Marcelo F.

    2018-03-01

    A possible route to extract electronic and nuclear dynamics from molecular targets with attosecond temporal and nanometer spatial resolution is to employ recolliding electrons as "probes." The recollision process in molecules is, however, very challenging to treat using ab initio approaches. Even for the simplest diatomic systems, such as H2, today's computational capabilities are not enough to give a complete description of the electron and nuclear dynamics initiated by a strong laser field. As a consequence, approximate qualitative descriptions are called to play an important role. In this paper we extend the work presented in Suárez et al. [N. Suárez, A. Chacón, J. A. Pérez-Hernández, J. Biegert, M. Lewenstein, and M. F. Ciappina, High-order-harmonic generation in atomic and molecular systems, Phys. Rev. A 95, 033415 (2017), 10.1103/PhysRevA.95.033415] to three-center molecular targets. Additionally, we incorporate a more accurate description of the molecular ground state, employing information extracted from quantum chemistry software packages. This step forward allows us to include, in a detailed way, both the molecular symmetries and nodes present in the high-occupied molecular orbital. We are able, on the one hand, to keep our formulation as analytical as in the case of diatomics and, on the other hand, to still give a complete description of the underlying physics behind the above-threshold ionization process. The application of our approach to complex multicenter—with more than three centers—targets appears to be straightforward.

  10. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  11. Basic roles of key molecules connected with NMDAR signaling pathway on regulating learning and memory and synaptic plasticity

    Institute of Scientific and Technical Information of China (English)

    Hui Wang; Rui-Yun Peng

    2016-01-01

    With key roles in essential brain functions ranging from the long-term potentiation (LTP) to synaptic plasticity,the N-methyl-D-aspartic acid receptor (NMDAR) can be considered as one of the fundamental glutamate receptors in the central nervous system.The role of NMDA R was first identified in synaptic plasticity and has been extensively studied.Some molecules,such as Ca2+,postsynaptic density 95 (PSD-95),calcium/calmodulin-dependent protein kinase Ⅱ (CaMK Ⅱ),protein kinase A (PKA),mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate (cAMP) responsive element binding protein (CREB),are of special importance in learning and memory.This review mainly focused on the new research of key molecules connected with learning and memory,which played important roles in the NMDAR signaling pathway.

  12. Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

    NARCIS (Netherlands)

    Ordonez, Soledad R; Veldhuizen, Edwin J A; van Eijk, Martin; Haagsman, Henk P

    2017-01-01

    Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that

  13. Radiotherapy- and chemotherapy-induced normal tissue damage. The role of cytokines and adhesion molecules

    International Nuclear Information System (INIS)

    Plevova, P.

    2002-01-01

    Background. Ionising radiation and cytostatic agents used in cancer therapy exert damaging effects on normal tissues and induce a complex response at the cellular and molecular levels. Cytokines and adhesion molecules are involved in this response. Methods. Published data on the given topic have been reviewed. Results and conclusions. Various cytokines and adhesion molecules, including tumor necrosis factor α, interleukins- 1,-2,-4, and -6, interferon γ, granulocyte macrophage- and macrophage- colony stimulating factors, transforming growth factor β, platelet-derived growth factor, insulin-like growth factor I, fibroblast and epidermal growth factors, platelet-activating factor, intercellular adhesion molecule-1, vascular cell adhesion molecule-1, E- and P-selectins are involved in the response of normal tissues to ionizing radiation- and chemotherapy- induced normal tissues damage and are co-responsible for some side effects of these treatment modalities, including fever, anorexia and fatigue, suppression of hematopoiesis, both acute and late local tissue response. (author)

  14. The Role of Functional Flexibility to Improve Energy Efficiency in Energy Consumption of the Case Borojerdiha house in Kashan

    Directory of Open Access Journals (Sweden)

    Mohammad Javad Mahdavinejad

    2015-03-01

    Full Text Available Man raises level of his needs by falsifying the nature and construction of the built spaces. By examining various aspects and complex dimensions of the human, variable and different needs can be clearly seen. Therefore, an architectural construction, especially housing, should be able to set the access conditions to meet the highest level of the needs and achieve to the highest level of responsiveness to the needs of users. Thus, conditions such as flexibility, adaptability, variability and all the principles that lead to generate opportunities and capacities proportional to user's needs in a building has been double necessary. With looking at the traditional architecture, we find that, despite the limitations in manufacturing technology, the architects used their own strategies for responding to existing problems. Strategies such as the use of multi-functional space, embedding spaces in the three scales of tiny, medium and large scales as well as ability to separate or merge spaces, are some of these items. By knowing, however, Iran's traditional home space is flexible, in this study, we sought to answer the question whether this flexibility in space has a role in the amount of energy consumption of the building? If there is, it has an increasing or decreasing role? In order to answer this question, several examples of traditional houses in the hot and dry climates is simulated that, due to brevity it is not expressed in this study. Among them, for example, is expressed Boroujerdi House and energy consumption of the existing state compared with when a space had not seasonal versatility. Finally, it is concluded that flexibility, reduce energy consumption in traditional buildings.

  15. The role of stoichiometric flexibility in modelling forest ecosystem responses to nitrogen fertilization.

    Science.gov (United States)

    Meyerholt, Johannes; Zaehle, Sönke

    2015-12-01

    The response of the forest carbon (C) balance to changes in nitrogen (N) deposition is uncertain, partly owing to diverging representations of N cycle processes in dynamic global vegetation models (DGVMs). Here, we examined how different assumptions about the degree of flexibility of the ecosystem's C : N ratios contribute to this uncertainty, and which of these assumptions best correspond to the available data. We applied these assumptions within the framework of a DGVM and compared the results to responses in net primary productivity (NPP), leaf N concentration, and ecosystem N partitioning, observed at 22 forest N fertilization experiments. Employing flexible ecosystem pool C : N ratios generally resulted in the most convincing model-data agreement with respect to production and foliar N responses. An intermediate degree of stoichiometric flexibility in vegetation, where wood C : N ratio changes were decoupled from leaf and root C : N ratio changes, led to consistent simulation of production and N cycle responses to N addition. Assuming fixed C : N ratios or scaling leaf N concentration changes to other tissues, commonly assumed by DGVMs, was not supported by reported data. Between the tested assumptions, the simulated changes in ecosystem C storage relative to changes in C assimilation varied by up to 20%. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. Comparative Analysis of Immune Checkpoint Molecules and Their Potential Role in the Transmissible Tasmanian Devil Facial Tumor Disease

    Directory of Open Access Journals (Sweden)

    Andrew S. Flies

    2017-05-01

    Full Text Available Immune checkpoint molecules function as a system of checks and balances that enhance or inhibit immune responses to infectious agents, foreign tissues, and cancerous cells. Immunotherapies that target immune checkpoint molecules, particularly the inhibitory molecules programmed cell death 1 and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, have revolutionized human oncology in recent years, yet little is known about these key immune signaling molecules in species other than primates and rodents. The Tasmanian devil facial tumor disease is caused by transmissible cancers that have resulted in a massive decline in the wild Tasmanian devil population. We have recently demonstrated that the inhibitory checkpoint molecule PD-L1 is upregulated on Tasmanian devil (Sarcophilus harrisii facial tumor cells in response to the interferon-gamma cytokine. As this could play a role in immune evasion by tumor cells, we performed a thorough comparative analysis of checkpoint molecule protein sequences among Tasmanian devils and eight other species. We report that many of the key signaling motifs and ligand-binding sites in the checkpoint molecules are highly conserved across the estimated 162 million years of evolution since the last common ancestor of placental and non-placental mammals. Specifically, we discovered that the CTLA-4 (MYPPPY ligand-binding motif and the CTLA-4 (GVYVKM inhibitory domain are completely conserved across all nine species used in our comparative analysis, suggesting that the function of CTLA-4 is likely conserved in these species. We also found that cysteine residues for intra- and intermolecular disulfide bonds were also highly conserved. For instance, all 20 cysteine residues involved in disulfide bonds in the human 4-1BB molecule were also present in devil 4-1BB. Although many key sequences were conserved, we have also identified immunoreceptor tyrosine-based inhibitory motifs (ITIMs and immunoreceptor tyrosine-based switch

  17. Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP.

    Science.gov (United States)

    Lassalle, Michael W; Kondou, Shinobu

    2016-06-01

    Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T 1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

  18. Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP

    Directory of Open Access Journals (Sweden)

    Michael W. Lassalle

    2016-06-01

    Full Text Available Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

  19. Molecular locks and keys: the role of small molecules in phytohormone research

    Directory of Open Access Journals (Sweden)

    Sandra eFonseca

    2014-12-01

    Full Text Available Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signalling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signalling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function.Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signalling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated responses. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds.

  20. The Role of Compensation Criteria to Minimize Face-Time Bias and Support Faculty Career Flexibility

    Directory of Open Access Journals (Sweden)

    Lydia Pleotis Howell MD

    2016-02-01

    Full Text Available Work-life balance is important to recruitment and retention of the younger generation of medical faculty, but medical school flexibility policies have not been fully effective. We have reported that our school’s policies are underutilized due to faculty concerns about looking uncommitted to career or team. Since policies include leaves and accommodations that reduce physical presence, faculty may fear “face-time bias,” which negatively affects evaluation of those not “seen” at work. Face-time bias is reported to negatively affect salary and career progress. We explored face-time bias on a leadership level and described development of compensation criteria intended to mitigate face-time bias, raise visibility, and reward commitment and contribution to team/group goals. Leaders from 6 partner departments participated in standardized interviews and group meetings. Ten compensation plans were analyzed, and published literature was reviewed. Leaders did not perceive face-time issues but saw team pressure and perception of availability as performance motivators. Compensation plans were multifactor productivity based with many quantifiable criteria; few addressed team contributions. Using these findings, novel compensation criteria were developed based on a published model to mitigate face-time bias associated with team perceptions. Criteria for organizational citizenship to raise visibility and reward group outcomes were included. We conclude that team pressure and perception of availability have the potential to lead to bias and may contribute to underuse of flexibility policies. Recognizing organizational citizenship and cooperative effort via specific criteria in a compensation plan may enhance a culture of flexibility. These novel criteria have been effective in one pilot department.

  1. Emotional modulation of control dilemmas: the role of positive affect, reward, and dopamine in cognitive stability and flexibility.

    Science.gov (United States)

    Goschke, Thomas; Bolte, Annette

    2014-09-01

    Goal-directed action in changing environments requires a dynamic balance between complementary control modes, which serve antagonistic adaptive functions (e.g., to shield goals from competing responses and distracting information vs. to flexibly switch between goals and behavioral dispositions in response to significant changes). Too rigid goal shielding promotes stability but incurs a cost in terms of perseveration and reduced flexibility, whereas too weak goal shielding promotes flexibility but incurs a cost in terms of increased distractibility. While research on cognitive control has long been conducted relatively independently from the study of emotion and motivation, it is becoming increasingly clear that positive affect and reward play a central role in modulating cognitive control. In particular, evidence from the past decade suggests that positive affect not only influences the contents of cognitive processes, but also modulates the balance between complementary modes of cognitive control. In this article we review studies from the past decade that examined effects of induced positive affect on the balance between cognitive stability and flexibility with a focus on set switching and working memory maintenance and updating. Moreover, we review recent evidence indicating that task-irrelevant positive affect and performance-contingent rewards exert different and sometimes opposite effects on cognitive control modes, suggesting dissociations between emotional and motivational effects of positive affect. Finally, we critically review evidence for the popular hypothesis that effects of positive affect may be mediated by dopaminergic modulations of neural processing in prefrontal and striatal brain circuits, and we refine this "dopamine hypothesis of positive affect" by specifying distinct mechanisms by which dopamine may mediate effects of positive affect and reward on cognitive control. We conclude with a discussion of limitations of current research, point to

  2. Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Soledad R. Ordonez

    2017-10-01

    Full Text Available Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that form the first barrier of defense against fungal infections. These include host defense peptides, like LL-37 and defensins that can neutralize fungi by direct killing of the pathogen, and collectins, such as surfactant protein A and D, that can aggregate fungi and stimulate phagocytosis. In addition, these molecules have immunomodulatory activities which can aid in fungal clearance from the lung. However, existing observations are based on in vitro studies which do not reflect the complexity of the lung and its airway surface liquid. Ionic strength, pH, and the presence of mucus can have strong detrimental effects on antifungal activity, while the potential synergistic interplay between soluble effector molecules is largely unknown. In this review, we describe the current knowledge on soluble effector molecules that contribute to antifungal activity, the importance of environmental factors and discuss the future directions required to understand the innate antifungal defense in the lung.

  3. Role of Soluble Innate Effector Molecules in Pulmonary Defense against Fungal Pathogens

    Science.gov (United States)

    Ordonez, Soledad R.; Veldhuizen, Edwin J. A.; van Eijk, Martin; Haagsman, Henk P.

    2017-01-01

    Fungal infections of the lung are life-threatening but rarely occur in healthy, immunocompetent individuals, indicating efficient clearance by pulmonary defense mechanisms. Upon inhalation, fungi will first encounter the airway surface liquid which contains several soluble effector molecules that form the first barrier of defense against fungal infections. These include host defense peptides, like LL-37 and defensins that can neutralize fungi by direct killing of the pathogen, and collectins, such as surfactant protein A and D, that can aggregate fungi and stimulate phagocytosis. In addition, these molecules have immunomodulatory activities which can aid in fungal clearance from the lung. However, existing observations are based on in vitro studies which do not reflect the complexity of the lung and its airway surface liquid. Ionic strength, pH, and the presence of mucus can have strong detrimental effects on antifungal activity, while the potential synergistic interplay between soluble effector molecules is largely unknown. In this review, we describe the current knowledge on soluble effector molecules that contribute to antifungal activity, the importance of environmental factors and discuss the future directions required to understand the innate antifungal defense in the lung. PMID:29163395

  4. The role of side chain conformational flexibility in surface recognition by Tenebrio molitor antifreeze protein

    Science.gov (United States)

    Daley, Margaret E.; Sykes, Brian D.

    2003-01-01

    Two-dimensional nuclear magnetic resonance spectroscopy was used to investigate the flexibility of the threonine side chains in the β-helical Tenebrio molitor antifreeze protein (TmAFP) at low temperatures. From measurement of the 3Jαβ 1H-1H scalar coupling constants, the χ1 angles and preferred rotamer populations can be calculated. It was determined that the threonines on the ice-binding face of the protein adopt a preferred rotameric conformation at near freezing temperatures, whereas the threonines not on the ice-binding face sample many rotameric states. This suggests that TmAFP maintains a preformed ice-binding conformation in solution, wherein the rigid array of threonines that form the AFP-ice interface matches the ice crystal lattice. A key factor in binding to the ice surface and inhibition of ice crystal growth appears to be the close surface-to-surface complementarity between the AFP and crystalline ice, and the lack of an entropic penalty associated with freezing out motions in a flexible ligand. PMID:12824479

  5. Conformational flexibility of BECN1: Essential to its key role in autophagy and beyond: BECN1 Structure and Mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Mei, Yang [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Glover, Karen [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Su, Minfei [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050; Sinha, Sangita C. [Department of Chemistry and Biochemistry, North Dakota State University, Fargo North Dakota 58108-6050

    2016-08-13

    BECN1 (Beclin 1), a highly conserved eukaryotic protein, is a key regulator of autophagy, a cellular homeostasis pathway, and also participates in vacuolar protein sorting, endocytic trafficking, and apoptosis. BECN1 is important for embryonic development, the innate immune response, tumor suppression, and protection against neurodegenerative disorders, diabetes, and heart disease. BECN1 mediates autophagy as a core component of the class III phosphatidylinositol 3-kinase complexes. However, the exact mechanism by which it regulates the activity of these complexes, or mediates its other diverse functions is unclear. BECN1 interacts with several diverse protein partners, perhaps serving as a scaffold or interaction hub for autophagy. Based on extensive structural, biophysical and bioinformatics analyses, BECN1 consists of an intrinsically disordered region (IDR), which includes a BH3 homology domain (BH3D); a flexible helical domain (FHD); a coiled-coil domain (CCD); and a β-α-repeated autophagy-specific domain (BARAD). Each of these BECN1 domains mediates multiple diverse interactions that involve concomitant conformational changes. Thus, BECN1 conformational flexibility likely plays a key role in facilitating diverse protein interactions. Further, BECN1 conformation and interactions are also modulated by numerous post-translational modifications. A better structure-based understanding of the interplay between different BECN1 conformational and binding states, and the impact of post-translational modifications will be essential to elucidating the mechanism of its multiple biological roles.

  6. Unfolding Role of a Danger Molecule Adenosine Signaling in Modulation of Microbial Infection and Host Cell Response

    Directory of Open Access Journals (Sweden)

    Jaden S. Lee

    2018-01-01

    Full Text Available Ectonucleotidases CD39 and CD73, specific nucleotide metabolizing enzymes located on the surface of the host, can convert a pro-inflammatory environment driven by a danger molecule extracellular-ATP to an adenosine-mediated anti-inflammatory milieu. Accordingly, CD39/CD73 signaling has been strongly implicated in modulating the intensity, duration, and composition of purinergic danger signals delivered to host. Recent studies have eluted potential roles for CD39 and CD73 in selective triggering of a variety of host immune cells and molecules in the presence of pathogenic microorganisms or microbial virulence molecules. Growing evidence also suggests that CD39 and CD73 present complimentary, but likely differential, actions against pathogens to shape the course and severity of microbial infection as well as the associated immune response. Similarly, adenosine receptors A2A and A2B have been proposed to be major immunomodulators of adenosine signaling during chronic inflammatory conditions induced by opportunistic pathogens, such as oral colonizer Porphyromonas gingivalis. Therefore, we here review the recent studies that demonstrate how complex network of molecules in the extracellular adenosine signaling machinery and their interactions can reshape immune responses and may also be targeted by opportunistic pathogens to establish successful colonization in human mucosal tissues and modulate the host immune response.

  7. Role of seta angle and flexibility in the gecko adhesion mechanism

    Science.gov (United States)

    Hu, Congcong; Alex Greaney, P.

    2014-08-01

    A model is developed to describe the reversible nature of gecko dry adhesion. The central aspect of this model is that the seta can be easily peeled away from the contacting surface by a small moment at the contact tip. It is shown that this contact condition is very sensitive, but can result in robust adhesion if individual setae are canted and highly flexible. In analogy to the "cone of friction," we consider the "adhesion region"—the domain of normal and tangential forces that maintain adhesion. Results demonstrate that this adhesion region is highly asymmetric enabling the gecko to adhere under a variety of loading conditions associated with scuttling horizontally, vertically, and inverted. Moreover, under each of these conditions, there is a low energy path to de-adhesion. In this model, obliquely canted seta (as possessed by geckos) rather than vertically aligned fibers (common in synthetic dry adhesive) provides the most robust adhesion.

  8. Recombination and detachment in oxygen discharges: the role of metastable oxygen molecules

    International Nuclear Information System (INIS)

    Gudmundsson, J T

    2004-01-01

    A global (volume averaged) model of oxygen discharges is used to study the transition from a recombination dominated discharge to a detachment dominated discharge. The model includes the metastable oxygen molecules O 2 (a 1 Δ g ) and O 2 (b 1 Σ g + ) and the three Herzberg states O 2 (A 3 Σ u + , A' 3 Δ u , c 1 Σ u - ). Dissociative attachment of the oxygen molecule in the ground state O 2 ( 3 Σ g - ) and the metastable oxygen molecule O 2 (a 1 Δ g ) are the dominating channels for creation of the negative oxygen ion O - . At high pressures, dissociative attachment of the Herzberg states contributes significantly to the creation of the negative oxygen ion, O - . The detachment by a collision of the metastable oxygen molecule O 2 (b 1 Σ g + ) with the oxygen ion, O - , is a significant loss process for the O - at pressures above 10 mTorr. Its contribution to the loss is more significant at a lower applied power, but at the higher pressures it is always significant. Detachment by collision with O( 3 P) is also an important loss mechanism for O - . We find that ion-ion recombination is the dominating loss process for negative ions in oxygen discharges at low pressures and calculate the critical pressure where the contributions of recombination reactions and detachment reactions are equal. This critical pressure depends on the applied power, increases with applied power and is in the range 5-14 mTorr in the pressure and power range investigated

  9. Role of impurity molecules in radiation-initiated processes in solid carbohydrates

    International Nuclear Information System (INIS)

    Kavetskii, V.G.; Yudin, I.V.

    1992-01-01

    Extension of the use of ionizing radiation for sterilization of medicinal preparations is stimulating the study of radiation-initiated processes in solid polyhydroxyl matrixes containing impurities of various organic substances. Such investigations make it possible to establish common characteristics of the effect of impurity molecules on the radiolysis of organic crystals. The materials of the investigation were lactose and rhamnose, precipitated by slow evaporation of the solvent from saturated aqueous solutions with different dihydroxyacetone contents. 4 refs., 1 fig

  10. Apoptosis following interleukin-2 withdrawal from T cells: evidence for a regulatory role of CD18 (beta 2-integrin) molecules

    DEFF Research Database (Denmark)

    Röpke, C; Gladstone, P; Nielsen, M

    1996-01-01

    , these findings suggest that CD18 molecules (beta 2-integrins) play a regulatory role in the apoptotic response following cytokine withdrawal, and that the regulation is mediated, at least partly, through T-T cell interactions. Thus, apoptotic death following IL-2 deprivation appears to be under "social" control...... activated T cells. Thus, removal of IL-2 from proliferating T cells not only induces growth arrest, but triggers a massive cell death due to apoptosis. While the apoptotic response involves a series of well-described events, it remains less clear how apoptosis is regulated following IL-2 withdrawal. Here...... molecules (CD28, CD29, CD49d, CD80, CD86) did not. Secondly, IL-2 withdrawal resulted in a retarded apoptotic response in LFA-1 (CD11a/CD18) negative T cells obtained from a leukocyte adhesion deficiency (LAD) patient, as compared to LFA-1 positive T cell lines. Thirdly, co-culture of LFA-1 positive...

  11. Study on the role of active radicals on plasma sterilization inside small diameter flexible polymeric tubes

    Science.gov (United States)

    Mstsuura, Hiroto; Fujiyama, Takatomo; Okuno, Yasuki; Furuta, Masakazu; Okuda, Shuichi; Takemura, Yuichiro

    2015-09-01

    Recently, atmospheric pressure discharge plasma has gathered attention in various fields. Among them, plasma sterilization with many types of plasma source has studied for decades and its mechanism is still an open question. If active radicals produced in plasma has main contribution of killing bacterias, direct contact of the so-called plasma flame might not be necessary. To confirm this, sterilization inside small diameter flexible polymeric tubes is studied in present work. DBD type plasma jet is produce by flowing helium gas in a glass tube. A long polymeric tube is connected and plasma jet is introduced into it. Plasma flame length depends on helium gas flow rate, but limited to about 10 cm in our experimental condition. E.colis set at the exit plasma source is easily killed during 10 min irradiation. At the tube end (about 20 cm away from plasma source exit), sterilization is possible with 30 min operation. This result shows that active radical is produced with helium plasma and mist contained in sample, and it can be transferred more than 20 cm during it life time. More plasma diagnostic data will also be shown at the conference. This work was partially supported by the ''ZE Research Program, IAE(ZE27B-4).

  12. Here, There, and Everywhere: The Ubiquitous Distribution of the Immunosignaling Molecule Lysophosphatidylcholine and Its Role on Chagas Disease.

    Science.gov (United States)

    Silva-Neto, Mário Alberto C; Lopes, Angela H; Atella, Georgia C

    2016-01-01

    Chagas disease is a severe illness, which can lead to death if the patients are not promptly treated. The disease is caused by the protozoan parasite Trypanosoma cruzi, which is mostly transmitted by a triatomine insect vector. There are 8-10 million people infected with T. cruzi in the world, but the transmission of such disease by bugs occurs only in the Americas, especially Latin America. Chronically infected patients will develop cardiac diseases (30%) and up digestive, neurological, or mixed disorders (10%). Lysophosphatidylcholine (LPC) is the major phospholipid component of oxidized low-density lipoproteins associated with atherosclerosis-related tissue damage. Insect-derived LPC powerfully attracts inflammatory cells to the site of the insect bite, enhances parasite invasion, and inhibits the production of nitric oxide by T. cruzi-stimulated macrophages. The recognition of the ubiquitous presence of LPC on the vector saliva, its production by the parasite itself and its presence both on patient plasma and its role on diverse host × parasite interaction systems lead us to compare its distribution in nature with the title of the famous Beatles song "Here, There and Everywhere" recorded exactly 50 years ago in 1966. Here, we review the major findings pointing out the role of such molecule as an immunosignaling modulator of Chagas disease transmission. Also, we believe that future investigation of the connection of this ubiquity and the immune role of such molecule may lead in the future to novel methods to control parasite transmission, infection, and pathogenesis.

  13. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  14. Focused Role of an Organic Small-Molecule PBD on Performance of the Bistable Resistive Switching.

    Science.gov (United States)

    Li, Lei; Sun, Yanmei; Ai, Chunpeng; Lu, Junguo; Wen, Dianzhong; Bai, Xuduo

    2015-12-01

    An undoped organic small-molecule 2-(4-tert-butylphenyl)-5-(4-biphenylyl)-1,3,4-oxadiazole (PBD) and a kind of nanocomposite blending poly(methyl methacrylate) (PMMA) into PBD are employed to implement bistable resistive switching. For the bistable resistive switching indium tin oxide (ITO)/PBD/Al, its ON/OFF current ratio can touch 6. What is more, the ON/OFF current ratio, approaching to 10(4), is available due to the storage layer PBD:PMMA with the chemical composition 1:1 in the bistable resistive switching ITO/PBD:PMMA/Al. The capacity, data retention of more than 1 year and endurance performance (>10(4) cycles) of ITO/PBD:PMMA(1:1)/Al, exhibits better stability and reliability of the samples, which underpins the technique and application of organic nonvolatile memory.

  15. A gene pathway analysis highlights the role of cellular adhesion molecules in multiple sclerosis susceptibility

    DEFF Research Database (Denmark)

    Damotte, V; Guillot-Noel, L; Patsopoulos, N A

    2014-01-01

    adhesion molecule (CAMs) biological pathway using Cytoscape software. This network is a strong candidate, as it is involved in the crossing of the blood-brain barrier by the T cells, an early event in MS pathophysiology, and is used as an efficient therapeutic target. We drew up a list of 76 genes...... in interaction with other genes as a group. Pathway analysis is an alternative way to highlight such group of genes. Using SNP association P-values from eight multiple sclerosis (MS) GWAS data sets, we performed a candidate pathway analysis for MS susceptibility by considering genes interacting in the cell...... belonging to the CAM network. We highlighted 64 networks enriched with CAM genes with low P-values. Filtering by a percentage of CAM genes up to 50% and rejecting enriched signals mainly driven by transcription factors, we highlighted five networks associated with MS susceptibility. One of them, constituted...

  16. Vicinal 1H-1H NMR coupling constants from density functional theory as reliable tools for stereochemical analysis of highly flexible multichiral center molecules.

    Science.gov (United States)

    López-Vallejo, Fabian; Fragoso-Serrano, Mabel; Suárez-Ortiz, Gloria Alejandra; Hernández-Rojas, Adriana C; Cerda-García-Rojas, Carlos M; Pereda-Miranda, Rogelio

    2011-08-05

    A protocol for stereochemical analysis, based on the systematic comparison between theoretical and experimental vicinal (1)H-(1)H NMR coupling constants, was developed and applied to a series of flexible compounds (1-8) derived from the 6-heptenyl-5,6-dihydro-2H-pyran-2-one framework. The method included a broad conformational search, followed by geometry optimization at the DFT B3LYP/DGDZVP level, calculation of the vibrational frequencies, thermochemical parameters, magnetic shielding tensors, and the total NMR spin-spin coupling constants. Three scaling factors, depending on the carbon atom hybridizations, were found for the (1)H-C-C-(1)H vicinal coupling constants: f((sp3)-(sp3)) = 0.910, f((sp3)-(sp2)) = 0.929, and f((sp2)-(sp2))= 0.977. A remarkable correlation between the theoretical (J(pre)) and experimental (1)H-(1)H NMR (J(exp)) coupling constants for spicigerolide (1), a cytotoxic natural product, and some of its synthetic stereoisomers (2-4) demonstrated the predictive value of this approach for the stereochemical assignment of highly flexible compounds containing multiple chiral centers. The stereochemistry of two natural 6-heptenyl-5,6-dihydro-2H-pyran-2-ones (14 and 15) containing diverse functional groups in the heptenyl side chain was also analyzed by application of this combined theoretical and experimental approach, confirming its reliability. Additionally, a geometrical analysis for the conformations of 1-8 revealed that weak hydrogen bonds substantially guide the conformational behavior of the tetraacyloxy-6-heptenyl-2H-pyran-2-ones.

  17. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  18. Population distribution of flexible molecules from maximum entropy analysis using different priors as background information: application to the Φ, Ψ-conformational space of the α-(1-->2)-linked mannose disaccharide present in N- and O-linked glycoproteins.

    Science.gov (United States)

    Säwén, Elin; Massad, Tariq; Landersjö, Clas; Damberg, Peter; Widmalm, Göran

    2010-08-21

    The conformational space available to the flexible molecule α-D-Manp-(1-->2)-α-D-Manp-OMe, a model for the α-(1-->2)-linked mannose disaccharide in N- or O-linked glycoproteins, is determined using experimental data and molecular simulation combined with a maximum entropy approach that leads to a converged population distribution utilizing different input information. A database survey of the Protein Data Bank where structures having the constituent disaccharide were retrieved resulted in an ensemble with >200 structures. Subsequent filtering removed erroneous structures and gave the database (DB) ensemble having three classes of mannose-containing compounds, viz., N- and O-linked structures, and ligands to proteins. A molecular dynamics (MD) simulation of the disaccharide revealed a two-state equilibrium with a major and a minor conformational state, i.e., the MD ensemble. These two different conformation ensembles of the disaccharide were compared to measured experimental spectroscopic data for the molecule in water solution. However, neither of the two populations were compatible with experimental data from optical rotation, NMR (1)H,(1)H cross-relaxation rates as well as homo- and heteronuclear (3)J couplings. The conformational distributions were subsequently used as background information to generate priors that were used in a maximum entropy analysis. The resulting posteriors, i.e., the population distributions after the application of the maximum entropy analysis, still showed notable deviations that were not anticipated based on the prior information. Therefore, reparameterization of homo- and heteronuclear Karplus relationships for the glycosidic torsion angles Φ and Ψ were carried out in which the importance of electronegative substituents on the coupling pathway was deemed essential resulting in four derived equations, two (3)J(COCC) and two (3)J(COCH) being different for the Φ and Ψ torsions, respectively. These Karplus relationships are denoted

  19. Role of solvent environments in single molecule conductance used insulator-modified mechanically controlled break junctions

    Science.gov (United States)

    Muthusubramanian, Nandini; Maity, Chandan; Galan Garcia, Elena; Eelkema, Rienk; Grozema, Ferdinand; van der Zant, Herre; Kavli Institute of Nanoscience Collaboration; Department of Chemical Engineering Collaboration

    We present a method for studying the effects of polar solvents on charge transport through organic/biological single molecules by developing solvent-compatible mechanically controlled break junctions of gold coated with a thin layer of aluminium oxide using plasma enhanced atomic layer deposition (ALD). The optimal oxide thickness was experimentally determined to be 15 nm deposited at ALD operating temperature of 300°C which yielded atomically sharp electrodes and reproducible single-barrier tunnelling behaviour across a wide conductance range between 1 G0 and 10-7 G0. The insulator protected MCBJ devices were found to be effective in various solvents such as deionized water, phosphate buffered saline, methanol, acetonitrile and dichlorobenzene. The yield of molecular junctions using such insulated electrodes was tested by developing a chemical protocol for synthesizing an amphipathic form of oligo-phenylene ethynylene (OPE3-PEO) with thioacetate anchoring groups. This work has further applications in studying effects of solvation, dipole orientation and other thermodynamic interactions on charge transport. Eu Marie Curie Initial Training Network (ITN). MOLECULAR-SCALE ELECTRONICS: ``MOLESCO'' Project Number 606728.

  20. The Role of Low-Energy Electrons in Astrochemistry: A Tale of Two Molecules

    Science.gov (United States)

    Arumainayagam, Chris; Cambell, Jyoti; Leon Sanche, Michael Boyer, and Petra Swiderek.

    2016-06-01

    In the interstellar medium, UV photolysis of ice mantles encasing dust grains is thought to be the mechanism that drives the synthesis of “complex” molecules. The source of this reaction-initiating UV light is assumed to be local because externally-sourced UV radiation cannot pass through the ice-containing dark, dense molecular clouds. Externally sourced cosmic rays (Emax ~ 1020 eV), in addition to producing UV light within these clouds, also produce large numbers of low-energy (≤ 20 eV) secondary electrons. The goal of our studies is to understand the low-energy electron-induced processes that occur when high-energy cosmic rays interact with interstellar ices. Using electron stimulated desorption (ESD), post-irradiation temperature-programmed desorption (TPD), and infrared reflection absorption spectroscopy (IRAS), we have investigated the radiolysis initiated by electrons in condensed methanol and ammonia at ~ 90 K under ultrahigh vacuum (1×10-9 Torr) conditions. We have identified fifteen low-energy (≤ 20 eV) electron-induced methanol radiolysis products, many of which have been previously identified as being formed by methanol UV photolysis in the interstellar medium. We have also found evidence for the electron-induced formation from ammonia of hydrazine (N2H4), diazene (N2H2), cyclotriazane/triazene (N3H3) and triazane (N3H5). We have investigated the reaction yields’ dependence on film thickness, irradiation time, incident current, electron energy, and metal substrate. These results provide a basis from which we can begin to understand the mechanisms by which methanol and ammonia can form more complex species in cosmic ices. Studies such as ours may ultimately help us better understand the initial stages of the genesis of life.

  1. Here, There and Everywhere: The Ubiquitous Distribution of the Immunosignaling Molecule Lysophosphatidylcholine and its Role on Chagas Disease

    Directory of Open Access Journals (Sweden)

    Mario Alberto Cardoso Silva-Neto

    2016-02-01

    Full Text Available Chagas disease is a severe illness, which can lead to death if the patients are not promptly treated. The disease is caused by the protozoan parasite Trypanosoma cruzi, which is mostly transmitted by a triatomine insect vector. There are 8-10 million people infected with T. cruzi in the world, but the vector-borne transmission occurs only in the Americas, especially Latin America. About 30 % of chronically infected people develop cardiac diseases and up to 10 % develop digestive, neurological or mixed disorders. Lysophosphatydilcholine (LPC is the major phospholipid component of oxidized low-density lipoproteins associated with atherosclerosis-related tissue damage. Insect-derived LPC is a powerful chemoattractant for inflammatory cells at the site of the insect bite, enhances parasite invasion, and inhibits the production of nitric oxide (NO by T. cruzi-stimulated macrophages. The recognition of the ubiquitous presence of LPC on the vector saliva, its production by the parasite itself and its presence both on patient plasma as well as its role on diverse host x parasite interaction systems lead us to compare its distribution in nature with the title of the famous Beatles song Here, There and Everywhere recorded exactly 50 years ago in 1966. Here, we review the major findings pointing out the role of such molecule as an immunosignaling modulator of Chagas disease transmission. Also, we believe that future investigation of the connection of this ubiquity and the immune role of such molecule may lead in the future to novel methods to control parasite transmission, infection and pathogenesis.

  2. Toward a general mixed quantum/classical method for the calculation of the vibronic ECD of a flexible dye molecule with different stable conformers: Revisiting the case of 2,2,2-trifluoro-anthrylethanol.

    Science.gov (United States)

    Cerezo, Javier; Aranda, Daniel; Avila Ferrer, Francisco J; Prampolini, Giacomo; Mazzeo, Giuseppe; Longhi, Giovanna; Abbate, Sergio; Santoro, Fabrizio

    2018-06-01

    We extend a recently proposed mixed quantum/classical method for computing the vibronic electronic circular dichroism (ECD) spectrum of molecules with different conformers, to cases where more than one hindered rotation is present. The method generalizes the standard procedure, based on the simple Boltzmann average of the vibronic spectra of the stable conformers, and includes the contribution of structures that sample all the accessible conformational space. It is applied to the simulation of the ECD spectrum of (S)-2,2,2-trifluoroanthrylethanol, a molecule with easily interconvertible conformers, whose spectrum exhibits a pattern of alternating positive and negative vibronic peaks. Results are in very good agreement with experiment and show that spectra averaged over all the sampled conformational space can deviate significantly from the simple average of the contributions of the stable conformers. The present mixed quantum/classical method is able to capture the effect of the nonlinear dependence of the rotatory strength on the molecular structure and of the anharmonic couplings among the modes responsible for molecular flexibility. Despite its computational cost, the procedure is still affordable and promises to be useful in all cases where the ECD shape arises from a subtle balance between vibronic effects and conformational variety. © 2018 Wiley Periodicals, Inc.

  3. Studies on the role of unsaturation in the fatty acid surfactant molecule on the thermal conductivity of magnetite nanofluids.

    Science.gov (United States)

    Lenin, Ramanujam; Joy, Pattayil Alias

    2017-11-15

    To study the role of unsaturation in the surfactant molecule on the thermal conductivity of magnetite nanofluids, four different fatty acid (stearic, oleic, linoleic, and linolenic acids with different degree of unsaturation) coated magnetite nanoparticles of comparable size are prepared and dispersed in toluene. It is found that the nanofluid with the saturated fatty acid coated nanoparticles show larger viscosity than the fluid with the unsaturated fatty acid coated particles at all concentrations. Thermal conductivity studies show enhancement only above a critical concentration for all fluids. The critical concentration for thermal conductivity enhancement varies with the surfactant, possibly due to the difference in the degree of aggregation of the nanoparticles in the fluid, because of the difference in the conformation of the surfactant molecules on the nanoparticle's surface. The experimental thermal conductivity follows the Maxwell model at higher concentrations. From the overall studies, it is observed that the thermal conductivity of the fluids with aggregated or assembled nanoparticles shows slightly larger enhancement than that of the fluids with isolated particles. However, in the presence of a magnetic field, the fluids with isolated nanoparticles showed relatively larger enhancement, possibly due to the easy response of the isolated magnetite nanoparticles to the applied field. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Energy Flexibility in Retail Buildings

    DEFF Research Database (Denmark)

    Ma, Zheng; Billanes, Joy Dalmacio; Kjærgaard, Mikkel Baun

    2017-01-01

    Retail buildings has an important role for demand side energy flexibility because of their high energy consumption, variety of energy flexibility resources, and centralized control via building control systems. Energy flexibility requires agreements and collaborations among different actors......), with the discussion of the stakeholders’ roles and their interrelation in delivering energy flexibility with the influential factors to the actual implementation of energy flexible operation of their buildings. Based on a literature analysis, the results cover stakeholders’ types and roles, perceptions (drivers......, barriers, and benefits), energy management activities and technology adoptions, and the stakeholders’ interaction for the energy flexibility in retail buildings....

  5. The role of psychological flexibility in a self-help acceptance and commitment therapy intervention for psychological distress in a randomized controlled trial.

    Science.gov (United States)

    Fledderus, Martine; Bohlmeijer, Ernst T; Fox, Jean-Paul; Schreurs, Karlein M G; Spinhoven, Philip

    2013-03-01

    This study examined the role of psychological flexibility, as a risk factor and as a process of change, in a self-help Acceptance and Commitment Therapy (ACT) intervention for adults with mild to moderate depression and anxiety. Participants were randomized to the self-help programme with e-mail support (n=250), or to a waiting list control group (n=126). All participants completed measures before and after the intervention to assess depression, anxiety and psychological flexibility. Participants in the experimental condition also completed these measures during the intervention (after three and six weeks) and at a three-month follow-up. With multilevel modelling, it was shown that the effects of the intervention on psychological distress were stronger for participants with higher levels of psychological flexibility. Furthermore, our study showed that improved psychological flexibility mediated the effects of the ACT intervention. With a cross-lagged panel design, it was shown that especially improvements in psychological flexibility in the last three sessions of the intervention were important for further reductions in anxiety. To conclude, our study showed the importance of targeting psychological flexibility during an ACT intervention for a reduction in depressive and anxiety symptoms. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Functional role of stromal interaction molecule 1 (STIM1) in vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Takahashi, Yoichiro; Watanabe, Hiroyuki; Murakami, Manabu; Ono, Kyoichi; Munehisa, Yoshiko; Koyama, Takashi; Nobori, Kiyoshi; Iijima, Toshihiko; Ito, Hiroshi

    2007-01-01

    We investigated the functional role of STIM1, a Ca 2+ sensor in the endoplasmic reticulum (ER) that regulates store-operated Ca 2+ entry (SOCE), in vascular smooth muscle cells (VSMCs). STIM1 was mainly localized at the ER and plasma membrane. The knockdown of STIM1 expression by small interfering (si) RNA drastically decreased SOCE. In contrast, an EF-hand mutant of STIM1, STIM1 E87A , produced a marked increase in SOCE, which was abolished by co-transfection with siRNA to transient receptor potential canonical 1 (TRPC1). In addition, transfection with siRNA against STIM1 suppressed phosphorylation of cAMP-responsive element binding protein (CREB) and cell growth. These results suggest that STIM1 is an essential component of SOCE and that it is involved in VSMC proliferation

  7. The role of psychological flexibility in a self-help acceptance and commitment therapy intervention for psychological distress in a randomized controlled trial.

    NARCIS (Netherlands)

    Fledderus, M.; Bohlmeijer, Ernst Thomas; Fox, Gerardus J.A.; Schreurs, Karlein Maria Gertrudis; Spinhoven, Philip

    2013-01-01

    This study examined the role of psychological flexibility, as a risk factor and as a process of change, in a self-help Acceptance and Commitment Therapy (ACT) intervention for adults with mild to moderate depression and anxiety. Participants were randomized to the self-help programme with e-mail

  8. Role of Ethylene and Its Cross Talk with Other Signaling Molecules in Plant Responses to Heavy Metal Stress1

    Science.gov (United States)

    Thao, Nguyen Phuong; Khan, M. Iqbal R.; Thu, Nguyen Binh Anh; Hoang, Xuan Lan Thi; Asgher, Mohd; Khan, Nafees A.; Tran, Lam-Son Phan

    2015-01-01

    Excessive heavy metals (HMs) in agricultural lands cause toxicities to plants, resulting in declines in crop productivity. Recent advances in ethylene biology research have established that ethylene is not only responsible for many important physiological activities in plants but also plays a pivotal role in HM stress tolerance. The manipulation of ethylene in plants to cope with HM stress through various approaches targeting either ethylene biosynthesis or the ethylene signaling pathway has brought promising outcomes. This review covers ethylene production and signal transduction in plant responses to HM stress, cross talk between ethylene and other signaling molecules under adverse HM stress conditions, and approaches to modify ethylene action to improve HM tolerance. From our current understanding about ethylene and its regulatory activities, it is believed that the optimization of endogenous ethylene levels in plants under HM stress would pave the way for developing transgenic crops with improved HM tolerance. PMID:26246451

  9. The role of healed N-vacancy defective BC2N sheet and nanotube by NO molecule in oxidation of NO and CO gas molecules

    Science.gov (United States)

    Nematollahi, Parisa; Esrafili, Mehdi D.; Neyts, Erik C.

    2018-06-01

    In this study, the healing of N-vacancy boron carbonitride nanosheet (NV-BC2NNS) and nanotube (NV-BC2NNT) by NO molecule is studied by means of density functional theory calculations. Two different N-vacancies are considered in each of these structures in which the vacancy site is surrounded by either three B-atoms (NB) or by two B- and one C-atom (NBC). By means of the healed BC2NNS and BC2NNT as a support, the removal of two toxic gas molecules (NO and CO) are applicable. It should be noted that the obtained energy barriers of both healing and oxidizing processes are significantly lower than those of graphene, carbon nanotubes or boron nitride nanostructures. Also, at the end of the oxidation process, the pure BC2NNS or BC2NNT is obtained without any additional defects. Therefore, by using this method, we can considerably purify the defective BC2NNS/BC2NNT. Moreover, according to the thermochemistry calculations we can further confirm that the healing process of the NV-BC2NNS and NV-BC2NNT by NO are feasible at room temperature. So, we can claim that this study could be very helpful in both purifying the defective BC2NNS/BC2NNT while in the same effort removing toxic NO and CO gases.

  10. Flexibility within Fidelity

    Science.gov (United States)

    Kendall, Philip C.; Gosch, Elizabeth; Furr, Jami M.; Sood, Erica

    2008-01-01

    The authors address concerns regarding manual-based treatments, highlighting the role of flexibility and creativity. A cognitive-behavioral therapy for youth anxiety called the Coping Cat program demonstrates the flexible application of manuals and emphasizes the importance of a child-centered, personalized approach that involves the child in the…

  11. On flexibility

    OpenAIRE

    Weiss, Christoph R.; Briglauer, Wolfgang

    2000-01-01

    By building on theoretical work by Mills and Schumann (1985) and Ungern-Sternberg (1990) this paper provides evidence on the determinants of two dimensions of flexibility, the flexibility in adjusting aggregate output over time (tactical flexibility) as well as the ability to switch quickly between products (operational flexibility). Econometric analysis of a sample of 40.000 farms in Upper-Austria for the period 1980 to 1990 suggests that larger full-time farms operated by younger, better ed...

  12. Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: A peculiar role of geometry

    Energy Technology Data Exchange (ETDEWEB)

    Aryanpour, Karan [Department of Physics, University of Arizona, Tucson, Arizona 85721 (United States); Shukla, Alok [Department of Physics, Indian Institute of Technology, Powai, Mumbai 400076 (India); Mazumdar, Sumit [Department of Physics, University of Arizona, Tucson, Arizona 85721 (United States); College of Optical Sciences, University of Arizona, Tucson, Arizona 85721 (United States)

    2014-03-14

    We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D{sub 6h} point group symmetry versus ovalene with D{sub 2h} symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D{sub 6h} group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D{sub 2h} ovalene but not in those with D{sub 6h} symmetry.

  13. Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: A peculiar role of geometry

    International Nuclear Information System (INIS)

    Aryanpour, Karan; Shukla, Alok; Mazumdar, Sumit

    2014-01-01

    We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D 6h point group symmetry versus ovalene with D 2h symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D 6h group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D 2h ovalene but not in those with D 6h symmetry

  14. Electron correlations and two-photon states in polycyclic aromatic hydrocarbon molecules: a peculiar role of geometry.

    Science.gov (United States)

    Aryanpour, Karan; Shukla, Alok; Mazumdar, Sumit

    2014-03-14

    We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene, and circumcoronene, all possessing D(6h) point group symmetry versus ovalene with D(2h) symmetry, within the Pariser-Parr-Pople model of interacting π-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitatively different from single-particle descriptions. More remarkably, a peculiar role of molecular geometry is found. The consequence of electron correlations is far stronger for ovalene, where the lowest spin-singlet two-photon state is a quantum superposition of pairs of lowest spin triplet states, as in the linear polyenes. The same is not true for D(6h) group hydrocarbons. Our work indicates significant covalent character, in valence bond language, of the ground state, the lowest spin triplet state and a few of the lowest two-photon states in D(2h) ovalene but not in those with D(6h) symmetry.

  15. APS, an adaptor molecule containing PH and SH2 domains, has a negative regulatory role in B cell proliferation

    International Nuclear Information System (INIS)

    Iseki, Masanori; Kubo-Akashi, Chiyomi; Kwon, Sang-Mo; Yamaguchi, Akiko; Takatsu, Kiyoshi; Takaki, Satoshi

    2005-01-01

    Adaptor molecule containing PH and SH2 domains (APS) is an intracellular adaptor protein that forms part of an adaptor family along with Lnk and SH2-B. APS transcripts are expressed in various tissues including brain, kidney, and muscle, as well as in splenic B cells but not in T cells. We investigated the functions of APS in B cell development and activation by generating APS-transgenic (APS-Tg) mice that overexpressed APS in lymphocytes. The number of B-1 cells in the peritoneal cavity was reduced in APS-Tg mice, as were B-2 cells in the spleen. B cell development in the bone marrow was partially impaired at the transition stage from proliferating large pre-B to small pre-B cells. B cell proliferation induced by B cell receptor (BCR) crosslinking but not by other B cell mitogens was also impaired in APS-Tg mice. APS co-localized with BCR complexes and filamentous actin in activated APS-Tg B cells. Thus, APS appears to play novel negative regulatory roles in BCR signaling, actin reorganization pathways, and control of compartment sizes of B-lineage cells

  16. Biologic role of activated leukocyte cell adhesion molecule overexpression in breast cancer cell lines and clinical tumor tissue.

    Science.gov (United States)

    Hein, Sibyll; Müller, Volkmar; Köhler, Nadine; Wikman, Harriet; Krenkel, Sylke; Streichert, Thomas; Schweizer, Michaela; Riethdorf, Sabine; Assmann, Volker; Ihnen, Maike; Beck, Katrin; Issa, Rana; Jänicke, Fritz; Pantel, Klaus; Milde-Langosch, Karin

    2011-09-01

    The activated leukocyte cell adhesion molecule (ALCAM) is overexpressed in many mammary tumors, but controversial results about its role and prognostic impact in breast cancer have been reported. Therefore, we evaluated the biologic effects of ALCAM expression in two breast cancer cell lines and a larger cohort of mammary carcinomas. By stable transfections, MCF7 cells with ALCAM overexpression and MDA-MB231 cells with reduced ALCAM levels were generated and analyzed in functional assays and cDNA microarrays. In addition, an immunohistochemical study on 347 patients with breast cancer with long-term follow-up and analysis of disseminated tumor cells (DTCs) was performed. In both cell lines, high ALCAM expression was associated with reduced cell motility. In addition, ALCAM silencing in MDA-MB231 cells resulted in lower invasive potential, whereas high ALCAM expression was associated with increased apoptosis in both cell lines. Among genes which were differentially expressed in clones with altered ALCAM expression, there was an overlap of 15 genes between both cell lines, among them cathepsin D, keratin 7, gelsolin, and ets2 whose deregulation was validated by western blot analysis. In MDA-MB231 cells, we observed a correlation with VEGF expression which was validated by enzyme-linked immuno sorbent assay (ELISA). Our IHC results on primary breast carcinomas showed that ALCAM expression was associated with an estrogen receptor-positive phenotype. In addition, strong ALCAM immunostaining correlated with nodal involvement and the presence of tumor cells in bone marrow. By Kaplan-Meier analysis, strong ALCAM expression in ductal carcinomas correlated with shorter recurrence-free intervals (P=0.048) and overall survival (OAS, P=0.003). Our results indicate that the biologic role of ALCAM in breast cancer is complex, but overexpression might be relevant for outcome in ductal carcinomas.

  17. Role of ICAM-1 polymorphisms (G241R, K469E) in mediating its single-molecule binding ability: Atomic force microscopy measurements on living cells

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Rui [Chinese (301) General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China); Yi, Shaoqiong [Beijing Institute of Biotechnology, 20 Dongdajie, Fengtai, Beijing 100071 (China); Zhang, Xuejie [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China); Liu, Huiliang, E-mail: lhl518@vip.sina.com [Department of Cardiology, The General Hospital of Chinese People’s Armed Police Forces, Beijing 100039 (China); Fang, Xiaohong, E-mail: xfang@iccas.ac.cn [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China)

    2014-06-13

    Highlights: • We evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations. • AFM was used to measure single-molecule binding ability on living cells. • The SNP of ICAM-1 may induce changes in expressions rather than single-molecule binding ability. - Abstract: Atherosclerosis (As) is characterized by chronic inflammation and is a major cause of human mortality. ICAM-1-mediated adhesion of leukocytes in vessel walls plays an important role in the pathogenesis of atherosclerosis. Two single nucleotide polymorphisms (SNPs) of human intercellular adhesion molecule-1 (ICAM-1), G241R and K469E, are associated with a number of inflammatory diseases. SNP induced changes in ICAM-1 function rely not only on the expression level but also on the single-molecule binding ability which may be affected by single molecule conformation variations such as protein splicing and folding. Previous studies have shown associations between G241R/K469E polymorphisms and ICAM-1 gene expression. Nevertheless, few studies have been done that focus on the single-molecule forces of the above SNPs and their ligands. In the current study, we evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations – GK (G241/K469), GE (G241/E469), RK (R241/K469) and RE (R241/E469). No difference in adhesion ability was observed via cell adhesion assay or atomic force microscopy (AFM) measurement when comparing the GK, GE, RK, or RE genotypes of ICAM-1 to each other. On the other hand, flow cytometry suggested that there was significantly higher expression of GE genotype of ICAM-1 on transfected CHO cells. Thus, we concluded that genetic susceptibility to diseases related to ICAM-1 polymorphisms, G241R or K469E, might be due to the different expressions of ICAM-1 variants rather than to the single-molecule binding ability of ICAM-1.

  18. Flexible work arrangements, job satisfaction, and turnover intentions: the mediating role of work-to-family enrichment.

    Science.gov (United States)

    McNall, Laurel A; Masuda, Aline D; Nicklin, Jessica M

    2010-01-01

    The authors examined the relation between the availability of 2 popular types of flexible work arrangements (i.e., flextime and compressed workweek) and work-to-family enrichment and, in turn, the relation between work-to-family enrichment and (a) job satisfaction and (b) turnover intentions. In a sample of 220 employed working adults, hierarchical regression analyses showed that work-to-family enrichment mediated the relation between flexible work arrangements and both job satisfaction and turnover intentions, even after controlling for gender, age, marital status, education, number of children, and hours worked. Thus, the availability of flexible work arrangements such as flextime and compressed workweek seems to help employees experience greater enrichment from work to home, which, in turn, is associated with higher job satisfaction and lower turnover intentions. The authors discuss the implications for research and practice.

  19. Physisorption of three amine terminated molecules (TMBDA, BDA, TFBDA) on the Au(111) Surface: The Role of van der Waals Interaction

    Science.gov (United States)

    Aminpour, Maral; Le, Duy; Rahman, Talat S.

    2012-02-01

    Recently, the electronic properties and alignment of tetramethyl-1,4-benzenediamine (TMBDA), 1,4-benzenediamine (BDA) and tetrafluro-1,4-benzenediamine (TFBDA) molecules were studied experimentally. Discrepancies were found for both the binding energy and the molecule tilt angle with respect to the surface, when results were compared with density functional theory calculations [1]. We have included the effect of vdW interactions both between the molecules and the Au(111) surface and find binding energies which are in very good agreement with experiments. We also find that at low coverages each of these molecules would adsorb almost parallel to the surface. N-Au bond lengths and charge redistribution on adsorption of the molecules are also analyzed. Our calculations are based on DFT using vdW-DF exchange correlation functionals. For BDA (since we are aware of experimental data), we show that for higher coverage, inclusion of intermolecular van der Waals interaction leads to tilting of the molecules with respect to the surface and formation of line structures. Our results demonstrate the central role played by intermolecular interaction in pattern formation on this surface.[4pt] [1] M. Dell'Angela et al, Nano Lett. 2010, 10, 2470; M. Kamenetska et al, J. Phys. Chem. C, 2011, 115, 12625

  20. Designing structural supply chain flexibility

    NARCIS (Netherlands)

    Mulinski, Ksawery Jan

    2012-01-01

    In a continuously changing business environment the role of supply chain flexibility is constantly increasing. A flexible supply chain can ensure survival in quickly changing market conditions as well as enable sustainable growth. This thesis explores the topic of supply chain flexibility with focus

  1. Understanding tradeoffs in the supplier selection process : The role of flexibility, delivery, and value-added services/support

    NARCIS (Netherlands)

    Rhee, van der B.; Verma, R.; Plaschka, G.

    2009-01-01

    In this study, we present, based on econometric choice modeling framework, how manufacturing managers/executives trade-off between cost, delivery, flexibility, and service features in the supplier selection process for commodity raw materials, given acceptable quality. Empirical data for this study

  2. The influence of aging on outgroup stereotypes: the mediating role of cognitive and motivational facets of deficient flexibility.

    Science.gov (United States)

    Czarnek, Gabriela; Kossowska, Malgorzata; Sedek, Grzegorz

    2015-01-01

    BACKGROUND/STUDY CONTEXT: The current study was designed to examine previously reported findings about age-related changes in drawing stereotypic inferences; specifically, that older adults are more likely than younger adults to stereotype outgroup members. The study replicates previous research and extends it by exploring the cognitive and motivational facets of deficient flexibility underlying this effect and comparing stereotypes towards ingroup and outgroup members. In the experiment, younger and older adults read stories that allowed for stereotypic inferences. They also completed the Trail Making Test (TMT) and Need for Closure Scale (NFC) as cognitive and motivational measures of deficient flexibility. The results of the experiment revealed that, compared to younger participants, older adults were more likely to rely upon stereotypic inferences when they read a story about outgroup members; however, there were no age-group differences in using stereotypes when they read a story about ingroup members. In addition, the findings showed that making more stereotypical inferences by older versus younger adults in relation to outgroup members was mediated by cognitive (TMT) and motivational (NFC) facets of deficient flexibility. A major implication of these findings is that both cognitive and motivational facets of deficient flexibility contribute to the reliance of older adults on stereotypes compared with younger adults. However, this is only true when older adults process information about outgroup members, but not about ingroup members. Thus, the current research goes beyond previous results by providing direct evidence that ingroup-outgroup perception contributes to stereotyping among older participants.

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. Antioxidant role of glutathione S-transferases: 4-Hydroxynonenal, a key molecule in stress-mediated signaling.

    Science.gov (United States)

    Singhal, Sharad S; Singh, Sharda P; Singhal, Preeti; Horne, David; Singhal, Jyotsana; Awasthi, Sanjay

    2015-12-15

    4-Hydroxy-2-trans-nonenal (4HNE), one of the major end products of lipid peroxidation (LPO), has been shown to induce apoptosis in a variety of cell lines. It appears to modulate signaling processes in more than one way because it has been suggested to have a role in signaling for differentiation and proliferation. It has been known that glutathione S-transferases (GSTs) can reduce lipid hydroperoxides through their Se-independent glutathione-peroxidase activity and that these enzymes can also detoxify LPO end-products such as 4HNE. Available evidence from earlier studies together with results of recent studies in our laboratories strongly suggests that LPO products, particularly hydroperoxides and 4HNE, are involved in the mechanisms of stress-mediated signaling and that it can be modulated by the alpha-class GSTs through the regulation of the intracellular concentrations of 4HNE. We demonstrate that 4HNE induced apoptosis in various cell lines is accompanied with c-Jun-N-terminal kinase (JNK) and caspase-3 activation. Cells exposed to mild, transient heat or oxidative stress acquire the capacity to exclude intracellular 4HNE at a faster rate by inducing GSTA4-4 which conjugates 4HNE to glutathione (GSH), and RLIP76 which mediates the ATP-dependent transport of the GSH-conjugate of 4HNE (GS-HNE). The balance between formation and exclusion promotes different cellular processes - higher concentrations of 4HNE promote apoptosis; whereas, lower concentrations promote proliferation. In this article, we provide a brief summary of the cellular effects of 4HNE, followed by a review of its GST-catalyzed detoxification, with an emphasis on the structural attributes that play an important role in the interactions with alpha-class GSTA4-4. Taken together, 4HNE is a key signaling molecule and that GSTs being determinants of its intracellular concentrations, can regulate stress-mediated signaling, are reviewed in this article. Copyright © 2015 Elsevier Inc. All rights

  5. Antioxidant role of glutathione S-transferases: 4-Hydroxynonenal, a key molecule in stress-mediated signaling

    International Nuclear Information System (INIS)

    Singhal, Sharad S.; Singh, Sharda P.; Singhal, Preeti; Horne, David; Singhal, Jyotsana; Awasthi, Sanjay

    2015-01-01

    4-Hydroxy-2-trans-nonenal (4HNE), one of the major end products of lipid peroxidation (LPO), has been shown to induce apoptosis in a variety of cell lines. It appears to modulate signaling processes in more than one way because it has been suggested to have a role in signaling for differentiation and proliferation. It has been known that glutathione S-transferases (GSTs) can reduce lipid hydroperoxides through their Se-independent glutathione-peroxidase activity and that these enzymes can also detoxify LPO end-products such as 4HNE. Available evidence from earlier studies together with results of recent studies in our laboratories strongly suggests that LPO products, particularly hydroperoxides and 4HNE, are involved in the mechanisms of stress-mediated signaling and that it can be modulated by the alpha-class GSTs through the regulation of the intracellular concentrations of 4HNE. We demonstrate that 4HNE induced apoptosis in various cell lines is accompanied with c-Jun-N-terminal kinase (JNK) and caspase-3 activation. Cells exposed to mild, transient heat or oxidative stress acquire the capacity to exclude intracellular 4HNE at a faster rate by inducing GSTA4-4 which conjugates 4HNE to glutathione (GSH), and RLIP76 which mediates the ATP-dependent transport of the GSH-conjugate of 4HNE (GS-HNE). The balance between formation and exclusion promotes different cellular processes — higher concentrations of 4HNE promote apoptosis; whereas, lower concentrations promote proliferation. In this article, we provide a brief summary of the cellular effects of 4HNE, followed by a review of its GST-catalyzed detoxification, with an emphasis on the structural attributes that play an important role in the interactions with alpha-class GSTA4-4. Taken together, 4HNE is a key signaling molecule and that GSTs being determinants of its intracellular concentrations, can regulate stress-mediated signaling, are reviewed in this article. - Highlights: • GSTs are the major

  6. Modulation of dendritic cell and T cell cross-talk during aging: The potential role of checkpoint inhibitory molecules.

    Science.gov (United States)

    Gardner, Joanne K; Mamotte, Cyril D S; Jackaman, Connie; Nelson, Delia J

    2017-09-01

    Dendritic cells (DCs) undergo continuous changes throughout life, and there is evidence that elderly DCs have a reduced capacity to stimulate T cells, which may contribute to impaired anti-tumour immune responses in elderly people with cancer. Changes in checkpoint inhibitory molecules/pathways during aging may be one mechanism that impairs the ability of elderly DCs to activate T cells. However, little is currently known regarding the combined effects of aging and cancer on DC and T cell inhibitory molecules/pathways. In this review, we discuss our current understanding of the influence of aging and cancer on key DC and T cell inhibitory molecules/pathways, the potential underlying cellular and molecular mechanisms contributing to their modulation, and the possibility of therapeutically targeting inhibitory molecules in elderly cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP

    OpenAIRE

    Michael W. Lassalle; Shinobu Kondou

    2016-01-01

    Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play...

  8. An integrated approach of network-based systems biology, molecular docking, and molecular dynamics approach to unravel the role of existing antiviral molecules against AIDS-associated cancer.

    Science.gov (United States)

    Omer, Ankur; Singh, Poonam

    2017-05-01

    A serious challenge in cancer treatment is to reposition the activity of various already known drug candidates against cancer. There is a need to rewrite and systematically analyze the detailed mechanistic aspect of cellular networks to gain insight into the novel role played by various molecules. Most Human Immunodeficiency Virus infection-associated cancers are caused by oncogenic viruses like Human Papilloma Viruses and Epstein-Bar Virus. As the onset of AIDS-associated cancers marks the severity of AIDS, there might be possible interconnections between the targets and mechanism of both the diseases. We have explored the possibility of certain antiviral compounds to act against major AIDS-associated cancers: Kaposi's Sarcoma, Non-Hodgkin Lymphoma, and Cervical Cancer with the help of systems pharmacology approach that includes screening for targets and molecules through the construction of a series of drug-target and drug-target-diseases network. Two molecules (Calanolide A and Chaetochromin B) and the target "HRAS" were finally screened with the help of molecular docking and molecular dynamics simulation. The results provide novel antiviral molecules against HRAS target to treat AIDS defining cancers and an insight for understanding the pharmacological, therapeutic aspects of similar unexplored molecules against various cancers.

  9. Differential Role of CBT Skills, DBT Skills and Psychological Flexibility in Predicting Depressive versus Anxiety Symptom Improvement

    Science.gov (United States)

    Webb, Christian A.; Beard, Courtney; Kertz, Sarah J.; Hsu, Kean; Björgvinsson, Thröstur

    2016-01-01

    Objective Studies have reported associations between cognitive behavioral therapy (CBT) skill use and symptom improvement in depressed outpatient samples. However, little is known regarding the temporal relationship between different subsets of therapeutic skills and symptom change among relatively severely depressed patients receiving treatment in psychiatric hospital settings. Method Adult patients with major depression (N=173) receiving combined psychotherapeutic and pharmacological treatment at a psychiatric hospital completed repeated assessments of traditional CBT skills, DBT skills and psychological flexibility, as well as depressive and anxiety symptoms. Results Results indicated that only use of behavioral activation (BA) strategies significantly predicted depressive symptom improvement in this sample; whereas DBT skills and psychological flexibility predicted anxiety symptom change. In addition, a baseline symptom severity X BA strategies interaction emerged indicating that those patients with higher pretreatment depression severity exhibited the strongest association between use of BA strategies and depressive symptom improvement. Conclusions Findings suggest the importance of emphasizing the acquisition and regular use of BA strategies with severely depressed patients in short-term psychiatric settings. In contrast, an emphasis on the development of DBT skills and the cultivation of psychological flexibility may prove beneficial for the amelioration of anxiety symptoms. PMID:27057997

  10. The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

    Science.gov (United States)

    Henry, Jackson; Blair, Enrique P.

    2018-02-01

    Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

  11. Effect of hydration on the organo-noble gas molecule HKrCCH: role of krypton in the stabilization of hydrated HKrCCH complexes.

    Science.gov (United States)

    Biswas, Biswajit; Singh, Prashant Chandra

    2015-11-11

    The effect of hydration on the fluorine free organo-noble gas compound HKrCCH and the role of krypton in the stabilization of the hydrated HKrCCH complexes have been investigated using the quantum chemical calculations on the HKrCCH-(H2O)n=1-6 clusters. Structure and energetics calculations show that water stabilizes HKrCCH through the π hydrogen bond in which the OH group of water interacts with the C[triple bond, length as m-dash]C group of HKrCCH. A maximum of four water molecules can directly interact with the C[triple bond, length as m-dash]C of HKrCCH and after that only inter-hydrogen bonding takes place between the water molecules indicating that the primary hydration shell contains four water molecules. Atom in molecule analysis depicts that π hydrogen bonded complexes of the hydrated HKrCCH are cyclic structures in which the OKr interaction cooperates in the formation of strong O-HC[triple bond, length as m-dash]C interaction. Structure, energetics and charge analysis clearly established that krypton plays an important role in the stabilization as well as the formation of the primary hydration shell of hydrated HKrCCH complexes.

  12. Conflicting flexibility

    NARCIS (Netherlands)

    De Jong, P.; Schaap, A.

    2011-01-01

    New buildings are designed for first users. For a sustainable approach there are many advantages in designing in flexibility and adjustability in order to enable and facilitate the other sequential users. For the first investor this flexibility is translated into improved exit values due to

  13. Toward Additive-Free Small-Molecule Organic Solar Cells: Roles of the Donor Crystallization Pathway and Dynamics

    KAUST Repository

    Abdelsamie, Maged

    2015-09-29

    The ease with which small-molecule donors crystallize during solution processing is directly linked to the need for solvent additives. Donor molecules that get trapped in disordered (H1) or liquid crystalline (T1) mesophases require additive processing to promote crystallization, phase separation, and efficient light harvesting. A donor material (X2) that crystallizes directly from solution yields additive-free solar cells with an efficiency of 7.6%. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Role of flexible bronchoscopy and bronchoalveolar lavage in the diagnosis of pediatric acquired immunodeficiency syndrome-related pulmonary disease.

    Science.gov (United States)

    Birriel, J A; Adams, J A; Saldana, M A; Mavunda, K; Goldfinger, S; Vernon, D; Holzman, B; McKey, R M

    1991-06-01

    Flexible fiberoptic bronchoscopy with bronchoalveolar lavage was performed in 16 pediatric patients with the acquired immunodeficiency syndrome (AIDS) and deterioration in pulmonary function suggestive of opportunistic infection. In 62% of the patients Pneumocystis carinii was identified. Culture results showed a pure growth of Pseudomonas aeruginosa for one patient in addition to the Pneumocystis carinii. Bronchoscopy with lavage was well tolerated, with few complications even among patients with significant tachypnea and hypoxia. Because of its relative safety and effectiveness, this procedure should be considered the first invasive measurement used for evaluation of parenchymal lung disease in this population of patients.

  15. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  16. "I just had to be flexible and show good patience": management of interactional approaches to enact mentoring roles by peer mentors with developmental disabilities.

    Science.gov (United States)

    Schwartz, Ariel E; Kramer, Jessica M

    2017-06-08

    Peer mentoring may be an effective approach for fostering skill development for mentors and mentees with developmental disabilities. However, little is known about how mentors with developmental disabilities perceive and enact their roles. (1) How do young adults with developmental disabilities describe their role as a peer mentor in the context of instrumental peer mentoring? (2) How do they enact their perceived roles? Thematic analysis of semi-structured reflections completed by six mentors with developmental disabilities (ages 17-35) with multiple mentoring experiences. Mentors perceived themselves as professionals with a primary role of teaching, and for some mentoring relationships, a secondary role of developing an interpersonal relationship. To enact these roles, mentors used a supportive interactional approach characterized by actions such as encouragement and sharing examples and dispositions, such as flexibility and patience. Mentors monitored mentee learning and engagement within the mentoring session and, as needed, adjusted their approach to optimize mentee learning and engagement. To successfully manage their interactional approach, mentors used supports such as peer mentoring scripts, tip sheets, and supervisors. While mentors reported several actions for teaching, they may benefit from training to learn approaches to facilitate more consistent development of interpersonal relationships. Implications for Rehabilitation Peer mentoring may be an effective approach for fostering skill development for young adult mentors and mentees with developmental disabilities. In this study, young adult peer mentors with developmental disabilities perceived themselves as professionals with a primary role of teaching and a secondary role of developing an interpersonal relationship. Peer mentors used actions and dispositions that matched their perceived roles and supported mentees with developmental disabilities to engage in instrumental mentoring. With supports and

  17. Role of Feshbach resonances in enhancing the production of deeply bound ultracold LiRb molecules with laser pulses

    Science.gov (United States)

    Gacesa, Marko; Ghosal, Subhas; Côté, Robin

    2010-03-01

    We investigate the possibility of forming deeply bound LiRb molecules in a two-color photoassociation experiment. Ultracold ^6Li and ^87Rb atoms colliding in the vicinity of a magnetic Feshbach resonance are photoassociated into an excited electronic state. A wavepacket is then formed by exciting a few vibrational levels of the excited state and allowed to propagate. We calculate the time-dependent overlaps between the wave packet and the lowest vibrational levels of the ground state. After the optimal overlap is obtained we use the second laser pulse to dump the wave packet and efficiently populate the deeply bound ro-vibrational levels of ^6Li^87Rb in the ground state. The resulting combination of Feshbach-optimized photoassociation (FOPA) with the time-dependent pump-dump approach will produce a large number of stable ultracold molecules in the ground state. This technique is general and applicable to other systems.

  18. Workability and Requests for Flexible Work Arrangements Among Older Adults: The Role of a Time and Place Management Intervention.

    Science.gov (United States)

    Morelock, Jeremiah C; McNamara, Tay K; James, Jacquelyn B

    2017-11-01

    This article investigates the effect of an intervention on the workability of older adults (i.e., the competence, health, and other mental and physical characteristics that workers need to meet the demands of their jobs). We used data from health care workers ( N = 437) who participated in a "time and place management" (TPM) intervention. Although related to flexible work options that aim to give workers more choice and control over the time and place of their work, TPM is conceptually distinct in that it focuses on the processes and guidelines necessary to the successful management of choice and control rather than the options alone. We focused on how the TPM intervention moderated the relationship between age and workability over time, with a particular focus on variation by baseline workability. Our results indicated that the intervention can benefit older workers with low workability.

  19. Electron Correlations and Two-Photon States in Polycyclic Aromatic Hydrocarbon Molecules: A Peculiar Role of Geometry

    OpenAIRE

    Aryanpour, K.; Shukla, A.; Mazumdar, S.

    2013-01-01

    We present numerical studies of one- and two-photon excited states ordering in a number of polycyclic aromatic hydrocarbon molecules: coronene, hexa-peri-hexabenzocoronene and circumcoronene, all possessing $D_{6h}$ point group symmetry versus ovalene with $D_{2h}$ symmetry, within the Pariser-Parr-Pople model of interacting $\\pi$-electrons. The calculated energies of the two-photon states as well as their relative two-photon absorption cross-sections within the interacting model are qualitat...

  20. New Roles Assigned to the α1–β1 (and α2–β2 Interface of the Human Hemoglobin Molecule from Physiological to Cellular

    Directory of Open Access Journals (Sweden)

    Yoshiaki Sugawara

    2011-11-01

    Full Text Available Cellular life is reliant upon rapid and efficient responses to internal and external conditions. The basic molecular events associated with these processes are the structural transitions of the proteins (structural protein allostery involved. From this view, the human hemoglobin (Hb molecule (α2β2 holds a special position in this field. Hb has two types of αβ interface (i.e., α1β1 [and α2β2] and α1β2 [and α2β1]. The latter α1–β2 (and α2–β1 interface is known to be associated with cooperative O2 binding, and exhibits principal roles if the molecule goes from its deoxy to oxy quaternary structure. However, the role of the former α1–β1 (and α2–β2 interface has been unclear for a long time. In this regard, important and intriguing observations have been accumulating. A new role was attributed first as stabilizing the HbO2 tetramer against acidic autoxidation. That is, the α1–β1 (and α2–β2 interface produces a conformational constraint in the β chain whereby the distal (E7 histidine (His residue is tilted slightly away from the bound O2 so as to prevent proton-catalyzed displacement of O2– by a solvent water molecule. The β chains thus acquire pH-dependent delayed autoxidation in the HbO2 tetramer. The next role was suggested by our studies searching for similar phenomena in normal human erythrocytes under mild heating. Tilting of the distal (E7 His in turn triggered degradation of the Hb molecule to hemichrome, and subsequent clustering of Heinz bodies within the erythrocyte. As Heinz body-containing red cells become trapped in the spleen, it was demonstrated that the α1–β1 (and α2–β2 interface may exert delicate control of the fate (removal of its own erythrocyte. Herein we review and summarize the related results and current interpretation of the oxidative behavior of human Hb, emphasizing the correlation between hemichrome emergence and Heinz-body formation, and specifically discuss the new roles

  1. Role of the vaccinia virus O3 protein in cell entry can be fulfilled by its Sequence flexible transmembrane domain

    Energy Technology Data Exchange (ETDEWEB)

    Satheshkumar, P.S.; Chavre, James; Moss, Bernard, E-mail: bmoss@nih.gov

    2013-09-15

    The vaccinia virus O3 protein, a component of the entry–fusion complex, is encoded by all chordopoxviruses. We constructed truncation mutants and demonstrated that the transmembrane domain, which comprises two-thirds of this 35 amino acid protein, is necessary and sufficient for interaction with the entry–fusion complex and function in cell entry. Nevertheless, neither single amino acid substitutions nor alanine scanning mutagenesis revealed essential amino acids within the transmembrane domain. Moreover, replication-competent mutant viruses were generated by randomization of 10 amino acids of the transmembrane domain. Of eight unique viruses, two contained only two amino acids in common with wild type and the remainder contained one or none within the randomized sequence. Although these mutant viruses formed normal size plaques, the entry–fusion complex did not co-purify with the mutant O3 proteins suggesting a less stable interaction. Thus, despite low specific sequence requirements, the transmembrane domain is sufficient for function in entry. - Highlights: • The 35 amino acid O3 protein is required for efficient vaccinia virus entry. • The transmembrane domain of O3 is necessary and sufficient for entry. • Mutagenesis demonstrated extreme sequence flexibility compatible with function.

  2. Role of Electroosmosis in the Permeation of Neutral Molecules: CymA and Cyclodextrin as an Example.

    Science.gov (United States)

    Bhamidimarri, Satya Prathyusha; Prajapati, Jigneshkumar Dahyabhai; van den Berg, Bert; Winterhalter, Mathias; Kleinekathöfer, Ulrich

    2016-02-02

    To quantify the flow of small uncharged molecules into and across nanopores, one often uses ion currents. The respective ion-current fluctuations caused by the presence of the analyte make it possible to draw some conclusions about the direction and magnitude of the analyte flow. However, often this flow appears to be asymmetric with respect to the applied voltage. As a possible reason for this asymmetry, we identified the electroosmotic flow (EOF), which is the water transport associated with ions driven by the external transmembrane voltage. As an example, we quantify the contribution of the EOF through a nanopore by investigating the permeation of α-cyclodextrin through CymA, a cyclodextrin-specific channel from Klebsiella oxytoca. To understand the results from electrophysiology on a molecular level, all-atom molecular dynamics simulations are used to detail the effect of the EOF on substrate entry to and exit from a CymA channel in which the N-terminus has been deleted. The combined experimental and computational results strongly suggest that one needs to account for the significant contribution of the EOF when analyzing the penetration of cyclodextrins through the CymA pore. This example study at the same time points to the more general finding that the EOF needs to be considered in translocation studies of neutral molecules and, at least in many cases, should be able to help in discriminating between translocation and binding events. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. Role Of Adhesion Molecules Vcam-1 And Ve-Cadherin In Endothelium Dysfunction Development At Hemorrhagic Fever With Renal Syndrome

    Directory of Open Access Journals (Sweden)

    А.А. Baygildina

    2009-12-01

    Full Text Available The research goal is to determine the changes in concentration of both sVCAM-1 and VE-cadherin in blood serum of patients suffered from hemorrhagic fever with renal syndrome (HFRS. 87 patients aged 15-65 were examined. Concentrations of both sVCAM-1 and VE- cadherin in blood serum by means of "Bender MedSystems" (Austria ELISA test were determined. It was shown that in both medium severe and severe forms of HFRS statistically the significant rise of sVCAM-1 concentration in blood with high indices in oliguric period took place. Complicated form was characterized by high indices of sVCAM-1 level in fever period, extremely decreasing in concentration in oliguric period and tendency to normalizing in clinical convalescence period. VE-cadherin level in blood was predominantly lower than control in all the observed groups with the exception of fever period in group with medium severe disease form. Negative correlation of normal intensity between adhesion molecules levels in blood was revealed. In conclusion it is necessary to point out that high VCAM-1 expression by endotheliocytes evidences the development of an adhesion form of endothelial dysfunction, low VE-cadherin production in a base for development of angiogenic form of endothelial dysfunction and changes in expression of these adhesion molecules that have adaptive metabolic response to macroorganism of HFRS pathogenic action

  4. Role of N2 molecules in pulse discharge production of I atoms for a pulsed chemical oxygen-iodine laser

    International Nuclear Information System (INIS)

    Kochetov, I V; Napartovich, A P; Vagin, N P; Yuryshev, N N

    2011-01-01

    A pulsed electric discharge is the most effective means to turn chemical oxygen-iodine laser (COIL) operation into the pulse mode by fast production of iodine atoms. Experimental studies and numerical simulations are performed on a pulsed COIL initiated by an electric discharge in a mixture CF 3 I : N 2 : O 2 ( 3 X) : O 2 (a 1 Δ g ) flowing out of a chemical singlet oxygen generator. A transverse pulsed discharge is realized at various iodide pressures. The model comprises a system of kinetic equations for neutral and charged species, the electric circuit equation, the gas thermal balance equation and the photon balance equation. Reaction rate coefficients for processes involving electrons are repeatedly re-calculated by the electron Boltzmann equation solver when the plasma parameters are changed. The processes accounted for in the Boltzmann equation include direct and stepwise excitation and ionization of atoms and molecules, dissociation of molecules, electron attachment processes, electron-ion recombination, electron-electron collisions and second-kind collisions. The last processes are particularly important because of a high singlet oxygen concentration in gas flow from the singlet oxygen chemical generator. A conclusion is drawn about satisfactory agreement between the theory and the experiment.

  5. The flexible loop L1 of the H3K4 demethylase JARID1B ARID domain has a crucial role in DNA-binding activity

    International Nuclear Information System (INIS)

    Yao, Wenming; Peng, Yu; Lin, Donghai

    2010-01-01

    JARID1B, a member of the JmjC demethylase family, has a crucial role in H3K4me3 demethylation. The ARID domain is a potential DNA-binding domain of JARID1B. Previous studies indicate that a GC-rich DNA motif is the specific target of the ARID domain. However, the details of the interaction between the ARID domain and duplex DNA require further study. Here, we utilized NMR spectroscopy to assign the backbone amino acids and mapped the DNA-binding sites of the human JARID1B ARID domain. Perturbations to 1 H- 15 N correlation spectra revealed that the flexible loop L1 of ARID was the main DNA-binding interface. EMSA and intrinsic fluorescence experiments demonstrated that mutations on loop L1 strongly reduced the DNA-binding activity of JARID1B ARID. Furthermore, transfection of mutant forms resulted in a distinct loss of intrinsic H3K4 demethylase activity, implying that the flexible loop L1 made a major contribution to sustaining the DNA-binding ability of JARID1B ARID domain.

  6. Studying neuroprotective effect of Atorvastatin as a small molecule drug on high glucose-induced neurotoxicity in undifferentiated PC12 cells: role of NADPH oxidase.

    Science.gov (United States)

    Rayegan, Samira; Dehpour, Ahmad Reza; Sharifi, Ali Mohammad

    2017-02-01

    Overproduction of reactive oxygen species (ROS) by NADPH oxidase (NOX) activation has been considered the essential mechanism induced by hyperglycemia in various tissues. However, there is no comprehensive study on the role of NOXs in high glucose (HG)-induced toxic effect in neural tissues. Recently, a therapeutic strategy in oxidative related pathologies has been introduced by blocking the undesirable actions of NOX enzymes by small molecules. The protective roles of Statins in ameliorating oxidative stress by NOX inhibition have been shown in some tissues except neural. We hypothesized then, that different NOXs may have role in HG-induced neural cell injury. Furthermore, we postulate that Atorvastatin as a small molecule may modulate this NOXs activity to protect neural cells. Undifferentiated PC12 cells were treated with HG (140 mM/24 h) in the presence and absence of Atorvastatin (1 μM/96 h). The cell viability was measured by MTT assay and the gene and protein expressions profile of NOX (1-4) were determined by RT-PCR and western blotting, respectively. Levels of ROS and malondialdehyde (MDA) were also evaluated. Gene and protein expression levels of NOX (1-4) and consequently ROS and MDA levels were elevated in HG-treated PC12 cells. Atorvastatin could significantly decrease HG-induced NOXs, ROS and MDA elevation and improve impaired cell viability. It can be concluded that HG could elevate NOXs activity, ROS and MDA levels in neural tissues and Atorvastatin as a small molecule NOX inhibitor drug may prevent and delay diabetic complications, particularly neuropathy.

  7. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  8. Workplace flexibility.

    Science.gov (United States)

    Scordato, C; Harris, J

    1990-01-01

    Whether your organization is in a growth pattern or downsizing, you are probably facing change. To gain some insight into your options, here is an in-depth look at the problems and benefits of some flexible work arrangements from a just published study by Catalyst.

  9. Flexibility conflict?

    NARCIS (Netherlands)

    Delsen, L.W.M.; Bauer, F.; Groß, H.; Sieglen, G.

    2002-01-01

    The chapter deals with the presupposed conflict of interests between employers and employees resulting from a decoupling of operating hours and working times. It starts from the notion that both long operating hours and flexibility are relative concepts. As there is some discretion, the ultimate

  10. Coherent control of interfering wave packets in dissociating HD+ molecules: the role of phase and delay time

    International Nuclear Information System (INIS)

    Qin, Chaochao; Zhang, Lili; Zhang, Xianzhou; Liu, Yufang; Qiu, Xuejun

    2016-01-01

    The coherent control of interference between dissociating wave packets of the HD + molecules generated by a pair of time-delayed and phase-locked femtosecond laser pulses is theoretically studied by using the time-dependent quantum wave packet method. The density function in both coordinate and momentum representation are presented and discussed. It is demonstrated that the interference pattern is observed in both coordinate and momentum density functions. The interference undergoes a π-phase shift when the delay time between the two phase-locked femtosecond laser pulses is changed by half an optical period. In particular, the number of interference fringes, the fringe spacing in the R-dependent density distribution |ψ(R)| 2 , and the modulation period of the energy-dependent distribution of the fragments P(E) can be tuned by two phase-locked femtosecond pulses. (paper)

  11. The role of phosphatidylinositol 3-kinase in neural cell adhesion molecule-mediated neuronal differentiation and survival

    DEFF Research Database (Denmark)

    Ditlevsen, Dorte K; Køhler, Lene B; Pedersen, Martin Volmer

    2003-01-01

    The neural cell adhesion molecule, NCAM, is known to stimulate neurite outgrowth from primary neurones and PC12 cells presumably through signalling pathways involving the fibroblast growth factor receptor (FGFR), protein kinase A (PKA), protein kinase C (PKC), the Ras-mitogen activated protein...... kinase (MAPK) pathway and an increase in intracellular Ca2+ levels. Stimulation of neurones with the synthetic NCAM-ligand, C3, induces neurite outgrowth through signalling pathways similar to the pathways activated through physiological, homophilic NCAM-stimulation. We present here data indicating...... that phosphatidylinositol 3-kinase (PI3K) is required for NCAM-mediated neurite outgrowth from PC12-E2 cells and from cerebellar and dopaminergic neurones in primary culture, and that the thr/ser kinase Akt/protein kinase B (PKB) is phosphorylated downstream of PI3K after stimulation with C3. Moreover, we present data...

  12. Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

    International Nuclear Information System (INIS)

    Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A.

    2015-01-01

    Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m 2 g −1 ) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10 −3 S cm −1 at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g −1 , ∼39 Wh kg −1 and ∼19 kW kg −1 , respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10 4 charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better performance over LiTFSI-based gel.

  13. Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

    Energy Technology Data Exchange (ETDEWEB)

    Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A., E-mail: sahashmi@physics.du.ac.in

    2015-08-01

    Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m{sup 2} g{sup −1}) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10{sup −3} S cm{sup −1} at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g{sup −1}, ∼39 Wh kg{sup −1} and ∼19 kW kg{sup −1}, respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10{sup 4} charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better

  14. Molecular Properties by Quantum Monte Carlo: An Investigation on the Role of the Wave Function Ansatz and the Basis Set in the Water Molecule

    Science.gov (United States)

    Zen, Andrea; Luo, Ye; Sorella, Sandro; Guidoni, Leonardo

    2014-01-01

    Quantum Monte Carlo methods are accurate and promising many body techniques for electronic structure calculations which, in the last years, are encountering a growing interest thanks to their favorable scaling with the system size and their efficient parallelization, particularly suited for the modern high performance computing facilities. The ansatz of the wave function and its variational flexibility are crucial points for both the accurate description of molecular properties and the capabilities of the method to tackle large systems. In this paper, we extensively analyze, using different variational ansatzes, several properties of the water molecule, namely, the total energy, the dipole and quadrupole momenta, the ionization and atomization energies, the equilibrium configuration, and the harmonic and fundamental frequencies of vibration. The investigation mainly focuses on variational Monte Carlo calculations, although several lattice regularized diffusion Monte Carlo calculations are also reported. Through a systematic study, we provide a useful guide to the choice of the wave function, the pseudopotential, and the basis set for QMC calculations. We also introduce a new method for the computation of forces with finite variance on open systems and a new strategy for the definition of the atomic orbitals involved in the Jastrow-Antisymmetrised Geminal power wave function, in order to drastically reduce the number of variational parameters. This scheme significantly improves the efficiency of QMC energy minimization in case of large basis sets. PMID:24526929

  15. Deleted in Malignant Brain Tumors 1 is a versatile mucin-like molecule likely to play a differential role in digestive tract cancer

    DEFF Research Database (Denmark)

    Mollenhauer, J; Herbertz, S; Helmke, B

    2001-01-01

    Deleted in Malignant Brain Tumors 1 (DMBT1) has been proposed as a candidate tumor suppressor gene for brain, lung, and digestive tract cancer. In particular, alterations of the gene and/or a loss of expression have been observed in gastric, colorectal, and esophageal carcinomas. Initial evidence...... has accumulated that DMBT1 may represent a multifunctional protein. Because the consequences of a loss of DMBT1 function may be different depending on its original function in a particular tissue, we wondered if it is appropriate to assume a uniform role for DMBT1 in digestive tract carcinomas. We...... hypothesized that a systematic characterization of DMBT1 in the human alimentary tract would be useful to improve the understanding of this molecule and its role in digestive tract carcinomas. Our data indicate that the expression pattern and subcellular distribution of DMBT1 in the human alimentary tract...

  16. Single-molecule resolution of protein dynamics on polymeric membrane surfaces: the roles of spatial and population heterogeneity.

    Science.gov (United States)

    Langdon, Blake B; Mirhossaini, Roya B; Mabry, Joshua N; Sriram, Indira; Lajmi, Ajay; Zhang, Yanxia; Rojas, Orlando J; Schwartz, Daniel K

    2015-02-18

    Although polymeric membranes are widely used in the purification of protein pharmaceuticals, interactions between biomolecules and membrane surfaces can lead to reduced membrane performance and damage to the product. In this study, single-molecule fluorescence microscopy provided direct observation of bovine serum albumin (BSA) and human monoclonal antibody (IgG) dynamics at the interface between aqueous buffer and polymeric membrane materials including regenerated cellulose and unmodified poly(ether sulfone) (PES) blended with either polyvinylpyrrolidone (PVP), polyvinyl acetate-co-polyvinylpyrrolidone (PVAc-PVP), or polyethylene glycol methacrylate (PEGM) before casting. These polymer surfaces were compared with model surfaces composed of hydrophilic bare fused silica and hydrophobic trimethylsilane-coated fused silica. At extremely dilute protein concentrations (10(-3)-10(-7) mg/mL), protein surface exchange was highly dynamic with protein monomers desorbing from the surface within ∼1 s after adsorption. Protein oligomers (e.g., nonspecific dimers, trimers, or larger aggregates), although less common, remained on the surface for 5 times longer than monomers. Using newly developed super-resolution methods, we could localize adsorption sites with ∼50 nm resolution and quantify the spatial heterogeneity of the various surfaces. On a small anomalous subset of the adsorption sites, proteins adsorbed preferentially and tended to reside for significantly longer times (i.e., on "strong" sites). Proteins resided for shorter times overall on surfaces that were more homogeneous and exhibited fewer strong sites (e.g., PVAc-PVP/PES). We propose that strong surface sites may nucleate protein aggregation, initiated preferentially by protein oligomers, and accelerate ultrafiltration membrane fouling. At high protein concentrations (0.3-1.0 mg/mL), fewer strong adsorption sites were observed, and surface residence times were reduced. This suggests that at high concentrations

  17. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  18. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  19. Flexible licensing

    Directory of Open Access Journals (Sweden)

    Martyn Jansen

    2012-07-01

    Full Text Available The case is presented for a more flexible approach to licensing online library resources. Today's distributed education environment creates pressure for UK higher and further education institutions (HEI/FEIs to form partnerships and to develop educational products and roll them out across the globe. Online library resources are a key component of distributed education and yet existing licensing agreements struggle to keep pace with the increasing range of users and purposes for which they are required. This article describes the process of developing a flexible approach to licensing and proposes a new model licence for online library resources which has the adaptability needed in this new global educational landscape. These ideas have been presented and discussed at various workshops across Eduserv's and JISC Collections' higher education and publisher communities, and further consultation is ongoing.

  20. Role of "Aplysia" Cell Adhesion Molecules during 5-HT-Induced Long-Term Functional and Structural Changes

    Science.gov (United States)

    Han, Jin-Hee; Lim, Chae-Seok; Lee, Yong-Seok; Kandel, Eric R.; Kaang, Bong-Kiun

    2004-01-01

    We previously reported that five repeated pulses of 5-HT lead to down-regulation of the TM-apCAM isoform at the surface of "Aplysia" sensory neurons (SNs). We here examined whether apCAM down-regulation is required for 5-HT-induced long-term facilitation. We also analyzed the role of the cytoplasmic and extracellular domains by overexpressing…

  1. Elucidating the role of surface passivating ligand structural parameters in hole wave function delocalization in semiconductor cluster molecules.

    Science.gov (United States)

    Teunis, Meghan B; Nagaraju, Mulpuri; Dutta, Poulami; Pu, Jingzhi; Muhoberac, Barry B; Sardar, Rajesh; Agarwal, Mangilal

    2017-09-28

    This article describes the mechanisms underlying electronic interactions between surface passivating ligands and (CdSe) 34 semiconductor cluster molecules (SCMs) that facilitate band-gap engineering through the delocalization of hole wave functions without altering their inorganic core. We show here both experimentally and through density functional theory calculations that the expansion of the hole wave function beyond the SCM boundary into the ligand monolayer depends not only on the pre-binding energetic alignment of interfacial orbitals between the SCM and surface passivating ligands but is also strongly influenced by definable ligand structural parameters such as the extent of their π-conjugation [π-delocalization energy; pyrene (Py), anthracene (Anth), naphthalene (Naph), and phenyl (Ph)], binding mode [dithiocarbamate (DTC, -NH-CS 2 - ), carboxylate (-COO - ), and amine (-NH 2 )], and binding head group [-SH, -SeH, and -TeH]. We observe an unprecedentedly large ∼650 meV red-shift in the lowest energy optical absorption band of (CdSe) 34 SCMs upon passivating their surface with Py-DTC ligands and the trend is found to be Ph- wave function delocalization rather than carrier trapping and/or phonon-mediated relaxation. Taken together, knowledge of how ligands electronically interact with the SCM surface is crucial to semiconductor nanomaterial research in general because it allows the tuning of electronic properties of nanomaterials for better charge separation and enhanced charge transfer, which in turn will increase optoelectronic device and photocatalytic efficiencies.

  2. E3 ligase Hei10: a multifaceted structure-based signaling molecule with roles within and beyond meiosis

    Science.gov (United States)

    De Muyt, Arnaud; Zhang, Liangran; Piolot, Tristan; Kleckner, Nancy; Espagne, Eric; Zickler, Denise

    2014-01-01

    Human enhancer of invasion-10 (Hei10) mediates meiotic recombination and also plays roles in cell proliferation. Here we explore Hei10’s roles throughout the sexual cycle of the fungus Sordaria with respect to localization and effects of null, RING-binding, and putative cyclin-binding (RXL) domain mutations. Hei10 makes three successive types of foci. Early foci form along synaptonemal complex (SC) central regions. At some of these positions, depending on its RING and RXL domains, Hei10 mediates development and turnover of two sequential types of recombination complexes, each demarked by characteristic amplified Hei10 foci. Integration with ultrastructural data for recombination nodules further reveals that recombination complexes differentiate into three types, one of which corresponds to crossover recombination events during or prior to SC formation. Finally, Hei10 positively and negatively modulates SUMO localization along SCs by its RING and RXL domains, respectively. The presented findings suggest that Hei10 integrates signals from the SC, associated recombination complexes, and the cell cycle to mediate both the development and programmed turnover/evolution of recombination complexes via SUMOylation/ubiquitination. Analogous cell cycle-linked assembly/disassembly switching could underlie localization and roles for Hei10 in centrosome/spindle pole body dynamics and associated nuclear trafficking. We suggest that Hei10 is a unique type of structure-based signal transduction protein. PMID:24831702

  3. The Role of Low-Energy (less than 20 eV) Electrons in Astrochemistry: A Tale of Two Molecules

    Science.gov (United States)

    Arumainayagam, Chris

    2016-07-01

    In the interstellar medium, UV photolysis of ice mantles encasing dust grains is thought to be the mechanism that drives the synthesis of "complex" molecules. The source of this reaction-initiating UV light is assumed to be local because externally-sourced UV radiation cannot pass through the ice-containing dark, dense molecular clouds. Externally sourced cosmic rays (E_{max} ˜10^{20} eV), in addition to producing UV light within these clouds, also produce large numbers of low-energy (≤ 20 eV) secondary electrons. The goal of our studies is to understand the low-energy electron-induced processes that occur when high-energy cosmic rays interact with interstellar ices. Using electron stimulated desorption (ESD), post-irradiation temperature-programmed desorption (TPD), and infrared reflection absorption spectroscopy (IRAS), we have investigated the radiolysis initiated by electrons in condensed methanol and ammonia at ˜90K under ultrahigh vacuum (1 × 10^{-9} Torr) conditions. We have identified fifteen low-energy electron-induced methanol radiolysis products, many of which have been previously identified as being formed by methanol UV photolysis in the interstellar medium. We have also found evidence for the electron-induced formation from ammonia of hydrazine (N_2 H_4), diazene (N_2 H_2), cyclotriazane/triazene (N_3 H_3) and triazane (N_3 H_5). We have investigated the reaction yields' dependence on film thickness, irradiation time, incident current, electron energy, and metal substrate. These results provide a basis from which we can begin to understand the mechanisms by which methanol and ammonia can form more complex species in cosmic ices. Studies such as ours may ultimately help us better understand the initial stages of the genesis of life.

  4. Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Yang; Wang, Jianhua, E-mail: wjh@cqu.edu.cn; Liu, Chundong [Chongqing University, Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering (China)

    2016-09-15

    With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer’s disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F{sub i} and the nonspecific force F{sub 0} between a single Aβ–Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F{sub i} between a single Aβ–Aβ pair in the presence of Cu{sup 2+}, Zn{sup 2+}, Ca{sup 2+} and Al{sup 3+} increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

  5. Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

    Science.gov (United States)

    Xie, Yang; Wang, Jianhua; Liu, Chundong

    2016-09-01

    With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer's disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F i and the nonspecific force F 0 between a single Aβ-Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F i between a single Aβ-Aβ pair in the presence of Cu2+, Zn2+, Ca2+ and Al3+ increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

  6. Probing the role of metal cations on the aggregation behavior of amyloid β-peptide at a single molecule level by AFM

    International Nuclear Information System (INIS)

    Xie, Yang; Wang, Jianhua; Liu, Chundong

    2016-01-01

    With the development of nanotechnology, understanding of intermolecular interactions on a single molecule level by atomic force spectroscopy (AFM) has played an important role in molecular biology and biomedical science. In recent years, some research suggested that the presence of metal cations is an important regulator in the processes of misfolding and aggregation of the amyloid β-protein (Aβ), which may be an important etiological factor of Alzheimer’s disease. However, the knowledge on the principle of interactions between Aβ and metal cations at the single molecule level is still poor understood. In this paper, the amyloid β-protein (Aβ) was fabricated on substrate of mixed thiol-modified gold nanoparticles using self-assembled monolayer method and the adhesion force in the longitudinal direction between metal cations and Aβ42 were investigated by AFM. The role of metal ions on Aβ aggregation is discussed from the perspective of single molecular force. The force results showed that the specific adhesion force F_i and the nonspecific force F_0 between a single Aβ–Aβ pair in control experiment were calculated as 42 ± 3 and 80 pN, respectively. However, F_i between a single Aβ–Aβ pair in the presence of Cu"2"+, Zn"2"+, Ca"2"+ and Al"3"+ increased dramatically to 84 ± 6, 89 ± 3, 73 ± 5, 95 ± 5 pN successively, which indicated that unbinding between Aβ proteins is accelerated in the presence of metal cations. What is more, the imaging results showed that substoichiometric copper cations accelerate the formation of fibrils within 3 days. The combined atomic force spectroscopy and imaging analysis indicate that metal cations play a role in promoting the aggregating behavior of Aβ42.

  7. A new look at immune privilege of the eye: dual role for the vision-related molecule retinoic acid.

    Science.gov (United States)

    Zhou, Ru; Horai, Reiko; Mattapallil, Mary J; Caspi, Rachel R

    2011-10-15

    The eye is an immunologically privileged and profoundly immunosuppressive environment. Early studies reported inhibition of T cell proliferation, IFN-γ production, and generation of regulatory T cells (Tregs) by aqueous humor (AH) and identified TGF-β as a critical factor. However, T cell subsets including Foxp3(+) Treg and Th17 were unknown at that time, as was the role of retinoic acid (RA) in Treg induction. Consequently, the effect of the ocular microenvironment on T cell lineage commitment and function, and the role of RA in this process, had not been explored. We now use gene-manipulated mice and highly purified T cell populations to demonstrate that AH suppresses lineage commitment and acquisition of Th1 and Th17 effector function of naive T cells, manifested as reduction of lineage-specific transcription factors and cytokines. Instead, AH promoted its massive conversion to Foxp3(+) Tregs that expressed CD25, GITR, CTLA-4, and CD103 and were functionally suppressive. TGF-β and RA were both needed and synergized for Treg conversion by AH, with TGF-β-enhancing T cell expression of RA receptor α. Newly converted Foxp3(+) Tregs were unstable, but were stabilized upon continued exposure to AH or by the DNA demethylating agent 5-aza-2'-deoxycytidine. In contrast, T cells already committed to effector function were resistant to the suppressive and Treg-inducing effects of AH. We conclude that RA in the eye plays a dual role: in vision and in immune privilege. Nevertheless, primed effector T cells are relatively insensitive to AH, helping to explain their ability to induce uveitis despite an inhibitory ocular microenvironment.

  8. Flexible Consumption

    DEFF Research Database (Denmark)

    Holm Jacobsen, Peter; Pallesen, Trine

    This report presents the first findings from our qualitative study of consumer behaviour vis-à-vis flexible consumption. The main of objective of this report is to present our first round of data from Bornholm, and to assist the design of products/services designed in WP6. In the report, we adopt...... the perspective of the consumer: what does living in a demand response setup look like to participants – and what kinds of behaviour and interest motivate – and emerge from – their participation in EcoGrid 2.0....

  9. Flexible Capitalism

    DEFF Research Database (Denmark)

    Approaching “work” as at heart a practice of exchange, this volume explores sociality in work environments marked by the kind of structural changes that have come to define contemporary “flexible” capitalism. It introduces anthropological exchange theory to a wider readership, and shows how...... the perspective offers new ways to enquire about the flexible capitalism’s social dimensions. The essays contribute to a trans-disciplinary scholarship on contemporary economic practice and change by documenting how, across diverse settings, “gift-like” socialities proliferate, and even sustain the intensified...

  10. Emmprin (basigin/CD147): matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression.

    Science.gov (United States)

    Nabeshima, Kazuki; Iwasaki, Hiroshi; Koga, Kaori; Hojo, Hironobu; Suzumiya, Junji; Kikuchi, Masahiro

    2006-07-01

    Emmprin (basigin, CD147) is a cell surface glycoprotein that belongs to the immunoglobulin superfamily. It is highly expressed on the surface of tumor cells and stimulates adjacent fibroblasts or tumor cells to produce matrix metalloproteinases. Moreover, it has recently been shown that emmprin also stimulates expression of vascular endothelial growth factor and hyaluronan, which leads to angiogenesis and anchorage-independent growth/multidrug resistance, respectively. These findings have made emmprin an important molecule in tumor progression and, thus, more attractive as a target for antitumor treatment. However, other functions of emmprin, including as an activator of T cells, a chaperone for monocarboxylate transporters, a receptor for cyclophilin A and a neural recognition molecule, are also being identified in physiological and pathological conditions. Therefore, it is essential to develop specific means to control particular functions of emmprin, for which elucidation of each mechanism is crucial. This review will discuss the role of emmprin in tumor progression and recent advances in the molecular mechanisms of diverse phenomena regulated by emmprin.

  11. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  12. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  13. Sucrose in Cyanobacteria: From a Salt-Response Molecule to Play a Key Role in Nitrogen Fixation

    Directory of Open Access Journals (Sweden)

    María A. Kolman

    2015-01-01

    Full Text Available In the biosphere, sucrose is mainly synthesized in oxygenic photosynthetic organisms, such as cyanobacteria, green algae and land plants, as part of the carbon dioxide assimilation pathway. Even though its central position in the functional biology of plants is well documented, much less is known about the role of sucrose in cyanobacteria. In those prokaryotes, sucrose accumulation has been associated with salt acclimation, and considered as a compatible solute in low-salt tolerant strains. In the last years, functional characterizations of sucrose metabolizing enzymes, metabolic control analysis, cellular localization of gene expressions, and reverse genetic experiments have revealed that sucrose metabolism is crucial in the diazotrophic growth of heterocystic strains, and besides, that it can be connected to glycogen synthesis. This article briefly summarizes the current state of knowledge of sucrose physiological functions in modern cyanobacteria and how they might have evolved taking into account the phylogenetic analyses of sucrose enzymes.

  14. Business Models for Power System Flexibility

    DEFF Research Database (Denmark)

    Boscan, Luis; Poudineh, Rahmatallah

    2016-01-01

    As intermittent, renewable resources gain more share in the generation mix, the need for power system flexibility increases more than ever. Parallel to this, technological change and the emergence of new players bringing about innovative solutions are boosting the development of flexibility...... business models will play an important role in ensuring sufficiency and efficiency of flexibility services....

  15. Phytohormones and microRNAs as sensors and regulators of leaf senescence: assigning macro roles to small molecules.

    Science.gov (United States)

    Sarwat, Maryam; Naqvi, Afsar Raza; Ahmad, Parvaiz; Ashraf, Muhammad; Akram, Nudrat Aisha

    2013-12-01

    Ageing or senescence is an intricate and highly synchronized developmental phase in the life of plant parts including leaf. Senescence not only means death of a plant part, but during this process, different macromolecules undergo degradation and the resulting components are transported to other parts of the plant. During the period from when a leaf is young and green to the stage when it senesces, a multitude of factors such as hormones, environmental factors and senescence associated genes (SAGs) are involved. Plant hormones including salicylic acid, abscisic acid, jasmonic acid and ethylene advance leaf senescence, whereas others like cytokinins, gibberellins, and auxins delay this process. The environmental factors which generally affect plant development and growth, can hasten senescence, the examples being nutrient dearth, water stress, pathogen attack, radiations, high temperature and light intensity, waterlogging, and air, water or soil contamination. Other important influences include carbohydrate accumulation and high carbon/nitrogen level. To date, although several genes involved in this complex process have been identified, still not much information exists in the literature on the signalling mechanism of leaf senescence. Now, the Arabidopsis mutants have paved our way and opened new vistas to elucidate the signalling mechanism of leaf senescence for which various mutants are being utilized. Recent studies demonstrating the role of microRNAs in leaf senescence have reinforced our knowledge of this intricate process. This review provides a comprehensive and critical analysis of the information gained particularly on the roles of several plant growth regulators and microRNAs in regulation of leaf senescence. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Skill Flexibility among Schoolteachers: Operationalization and Organizational Implications.

    Science.gov (United States)

    Rosenblatt, Zehava; Inbal, Batia

    1999-01-01

    Investigates effects of skill flexibility on Israeli secondary teachers' work attitudes and job performance. Both role and functional flexibility were associated with improved teachers' work performance; role flexibility is linked to high organizational commitment and low powerlessness. Principals appreciate skill flexibility, but organizational…

  17. Flexible nanovectors

    International Nuclear Information System (INIS)

    Pugno, Nicola M

    2008-01-01

    In this paper we show that the control of adhesion in highly flexible (a property that could be crucial for smart drug delivery but which is still ignored in the literature) nanovectors can help in smartly targeting and delivering the drug. The existence of and the conditions for activating and controlling a super-adhesive state are addressed. Even if such a state has never been observed in nanovectors, our calculations, as well as observations in spiders and geckos, suggest its existence and feasible control. Control of the competition between the drag and the adhesive force is exploited to improve the targeting ability and a hierarchical model is applied to describe a real vasculature. The high flexibility of the nanovector is used to smartly deliver the drug only during adhesion by nanopumping or, as a limiting case, by the new concept of 'adhesion induced nanovector implosion'; a liquid drop analogy is utilized for the calculations. Fast (pumping) and slow (diffusion) drug deliveries can thus be separately controlled by controlling the size and shape of the nanovector. Multiple stage nanovectors are also briefly discussed, mimicking aerospace vector strategies.

  18. Flexible nanovectors

    Science.gov (United States)

    Pugno, Nicola M.

    2008-11-01

    In this paper we show that the control of adhesion in highly flexible (a property that could be crucial for smart drug delivery but which is still ignored in the literature) nanovectors can help in smartly targeting and delivering the drug. The existence of and the conditions for activating and controlling a super-adhesive state are addressed. Even if such a state has never been observed in nanovectors, our calculations, as well as observations in spiders and geckos, suggest its existence and feasible control. Control of the competition between the drag and the adhesive force is exploited to improve the targeting ability and a hierarchical model is applied to describe a real vasculature. The high flexibility of the nanovector is used to smartly deliver the drug only during adhesion by nanopumping or, as a limiting case, by the new concept of 'adhesion induced nanovector implosion'; a liquid drop analogy is utilized for the calculations. Fast (pumping) and slow (diffusion) drug deliveries can thus be separately controlled by controlling the size and shape of the nanovector. Multiple stage nanovectors are also briefly discussed, mimicking aerospace vector strategies.

  19. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  20. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  1. A role for iron and oxygen chemistry in preserving soft tissues, cells and molecules from deep time.

    Science.gov (United States)

    Schweitzer, Mary H; Zheng, Wenxia; Cleland, Timothy P; Goodwin, Mark B; Boatman, Elizabeth; Theil, Elizabeth; Marcus, Matthew A; Fakra, Sirine C

    2014-01-22

    The persistence of original soft tissues in Mesozoic fossil bone is not explained by current chemical degradation models. We identified iron particles (goethite-αFeO(OH)) associated with soft tissues recovered from two Mesozoic dinosaurs, using transmission electron microscopy, electron energy loss spectroscopy, micro-X-ray diffraction and Fe micro-X-ray absorption near-edge structure. Iron chelators increased fossil tissue immunoreactivity to multiple antibodies dramatically, suggesting a role for iron in both preserving and masking proteins in fossil tissues. Haemoglobin (HB) increased tissue stability more than 200-fold, from approximately 3 days to more than two years at room temperature (25°C) in an ostrich blood vessel model developed to test post-mortem 'tissue fixation' by cross-linking or peroxidation. HB-induced solution hypoxia coupled with iron chelation enhances preservation as follows: HB + O2 > HB - O2 > -O2 > +O2. The well-known O2/haeme interactions in the chemistry of life, such as respiration and bioenergetics, are complemented by O2/haeme interactions in the preservation of fossil soft tissues.

  2. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  3. Consumer Central Energy Flexibility in Office Buildings

    DEFF Research Database (Denmark)

    Billanes, Joy Dalmacio; Ma, Zheng; Jørgensen, Bo Nørregaard

    2017-01-01

    Energy flexibility in buildings will play an important role in the smart energy system. Office buildings have more potentials to provide energy flexibility to the grid compared to other types of buildings, due to the existing building management, control systems and large energy consumption....... Consumers in office buildings (building owners/managers and occupants) take a main role for adopting and engaging in building energy flexibility. In this paper provides a systematic review of consumer central energy flexibility in office buildings with the discussion of social, technical and business...... can boost energy flexibility in the office buildings....

  4. Single molecule detection, thermal fluctuation and life

    Science.gov (United States)

    YANAGIDA, Toshio; ISHII, Yoshiharu

    2017-01-01

    Single molecule detection has contributed to our understanding of the unique mechanisms of life. Unlike artificial man-made machines, biological molecular machines integrate thermal noises rather than avoid them. For example, single molecule detection has demonstrated that myosin motors undergo biased Brownian motion for stepwise movement and that single protein molecules spontaneously change their conformation, for switching to interactions with other proteins, in response to thermal fluctuation. Thus, molecular machines have flexibility and efficiency not seen in artificial machines. PMID:28190869

  5. The possible role of bacterial signal molecules N-acyl homoserine lactones in the formation of diatom-biofilm (Cylindrotheca sp.)

    International Nuclear Information System (INIS)

    Yang, Cuiyun; Fang, Shengtao; Chen, Dehui; Wang, Jianhua; Liu, Fanghua; Xia, Chuanhai

    2016-01-01

    Bacterial quorum sensing signal molecules N-acyl homoserine lactones (AHLs) (C10-HSL, 3-OXO-C10-HSL and 3-OH-C10-HSL) as possible chemical cues were employed to investigate the role in the formation of fouling diatom-biofilm (Cylindrotheca sp.). Results showed that AHLs promoted Chlorophyll a (Chl.a) and extracellular polymeric substance (EPS) contents in the diatom-biofilm. In the presence of AHLs-inhibitor 3, 4-Dibromo-2(5)H-furanone, which was used to avoid the possible interference of AHLs from bacteria, AHLs also increased the Chl.a and EPS contents. Scanning electron microscope and confocal laser scanning microscope analysis further demonstrated that AHLs promoted the formation of the diatom-biofilm. Non-invasive micro-test technique showed that AHLs promoted Ca 2+ efflux in Cylindrotheca sp., which implied that Ca 2+ might be correlated with AHLs-induced positive effect on the formation of diatom-biofilm. This study provides direct evidences that AHLs play an important role in developing the diatom-biofilm and AHLs-inhibitors might be promising active agents in marine antifouling. - Highlights: •AHLs effectively increase Chl.a and EPS contents in diatom-biofilm. •SEM and CLSM further demonstrate that AHLs promote the formation of diatom-biofilm. •AHLs trigger algal cellular Ca 2+ efflux. •AHLs-inhibitors might be promising active agents in marine antifouling.

  6. Evidence supporting a role for astrocytes in the regulation of cognitive flexibility and neuronal oscillations through the Ca2+ binding protein S100β.

    Science.gov (United States)

    Brockett, Adam T; Kane, Gary A; Monari, Patrick K; Briones, Brandy A; Vigneron, Pierre-Antoine; Barber, Gabriela A; Bermudez, Andres; Dieffenbach, Uma; Kloth, Alexander D; Buschman, Timothy J; Gould, Elizabeth

    2018-01-01

    The medial prefrontal cortex (mPFC) is important for cognitive flexibility, the ability to switch between two task-relevant dimensions. Changes in neuronal oscillations and alterations in the coupling across frequency ranges have been correlated with attention and cognitive flexibility. Here we show that astrocytes in the mPFC of adult male Sprague Dawley rats, participate in cognitive flexibility through the astrocyte-specific Ca2+ binding protein S100β, which improves cognitive flexibility and increases phase amplitude coupling between theta and gamma oscillations. We further show that reduction of astrocyte number in the mPFC impairs cognitive flexibility and diminishes delta, alpha and gamma power. Conversely, chemogenetic activation of astrocytic intracellular Ca2+ signaling in the mPFC enhances cognitive flexibility, while inactivation of endogenous S100β among chemogenetically activated astrocytes in the mPFC prevents this improvement. Collectively, our work suggests that astrocytes make important contributions to cognitive flexibility and that they do so by releasing a Ca2+ binding protein which in turn enhances coordinated neuronal oscillations.

  7. Conformational flexibility of aspartame.

    Science.gov (United States)

    Toniolo, Claudio; Temussi, Pierandrea

    2016-05-01

    L-Aspartyl-L-phenylalanine methyl ester, better known as aspartame, is not only one of the most used artificial sweeteners, but also a very interesting molecule with respect to the correlation between molecular structure and taste. The extreme conformational flexibility of this dipeptide posed a huge difficulty when researchers tried to use it as a lead compound to design new sweeteners. In particular, it was difficult to take advantage of its molecular model as a mold to infer the shape of the, then unknown, active site of the sweet taste receptor. Here, we follow the story of the 3D structural aspects of aspartame from early conformational studies to recent docking into homology models of the receptor. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 376-384, 2016. © 2016 Wiley Periodicals, Inc.

  8. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  9. Human NK cells selective targeting of colon cancer-initiating cells: A role for natural cytotoxicity receptors and MHC class i molecules

    KAUST Repository

    Tallerico, Rossana

    2013-01-23

    Tumor cell populations have been recently proposed to be composed of two compartments: tumor-initiating cells characterized by a slow and asymmetrical growth, and the "differentiated" cancer cells with a fast and symmetrical growth. Cancer stem cells or cancer-initiating cells (CICs) play a crucial role in tumor recurrence. The resistance of CICs to drugs and irradiation often allows them to survive traditional therapy. NK cells are potent cytotoxic lymphocytes that can recognize tumor cells. In this study, we have analyzed the NK cell recognition of tumor target cells derived from the two cancer cell compartments of colon adenocarcinoma lesions. Our data demonstrate that freshly purified allogeneic NK cells can recognize and kill colorectal carcinoma- derived CICs whereas the non-CIC counterpart of the tumors (differentiated tumor cells), either autologous or allogeneic, is less susceptible to NK cells. This difference in the NK cell susceptibility correlates with higher expression on CICs of ligands for NKp30 and NKp44 in the natural cytotoxicity receptor (NCR) group of activating NK receptors. In contrast, CICs express lower levels of MHC class I, known to inhibit NK recognition, on their surface than do the "differentiated" tumor cells. These data have been validated by confocal microscopy where NCR ligands and MHC class I molecule membrane distribution have been analyzed. Moreover, NK cell receptor blockade in cytotoxicity assays demonstrates that NCRs play a major role in the recognition of CIC targets. This study strengthens the idea that biology-based therapy harnessing NK cells could be an attractive opportunity in solid tumors. Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved.

  10. Human NK cells selective targeting of colon cancer-initiating cells: A role for natural cytotoxicity receptors and MHC class i molecules

    KAUST Repository

    Tallerico, Rossana; Todaro, Matilde; Di Franco, Simone; MacCalli, Cristina; Garofalo, Cinzia; Sottile, Rosa; Palmieri, Camillo; Tirinato, Luca; Pangigadde, Pradeepa N.; La Rocca, Rosanna; Mandelboim, Ofer; Stassi, Giorgio; Di Fabrizio, Enzo M.; Parmiani, Giorgio; Moretta, Alessandro; Dieli, Francesco; Kã rre, Klas; Carbone, Ennio

    2013-01-01

    Tumor cell populations have been recently proposed to be composed of two compartments: tumor-initiating cells characterized by a slow and asymmetrical growth, and the "differentiated" cancer cells with a fast and symmetrical growth. Cancer stem cells or cancer-initiating cells (CICs) play a crucial role in tumor recurrence. The resistance of CICs to drugs and irradiation often allows them to survive traditional therapy. NK cells are potent cytotoxic lymphocytes that can recognize tumor cells. In this study, we have analyzed the NK cell recognition of tumor target cells derived from the two cancer cell compartments of colon adenocarcinoma lesions. Our data demonstrate that freshly purified allogeneic NK cells can recognize and kill colorectal carcinoma- derived CICs whereas the non-CIC counterpart of the tumors (differentiated tumor cells), either autologous or allogeneic, is less susceptible to NK cells. This difference in the NK cell susceptibility correlates with higher expression on CICs of ligands for NKp30 and NKp44 in the natural cytotoxicity receptor (NCR) group of activating NK receptors. In contrast, CICs express lower levels of MHC class I, known to inhibit NK recognition, on their surface than do the "differentiated" tumor cells. These data have been validated by confocal microscopy where NCR ligands and MHC class I molecule membrane distribution have been analyzed. Moreover, NK cell receptor blockade in cytotoxicity assays demonstrates that NCRs play a major role in the recognition of CIC targets. This study strengthens the idea that biology-based therapy harnessing NK cells could be an attractive opportunity in solid tumors. Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved.

  11. A structural study of [CpM(CO)3H] (M = Cr, Mo and W) by single-crystal X-ray diffraction and DFT calculations: sterically crowded yet surprisingly flexible molecules.

    Science.gov (United States)

    Burchell, Richard P L; Sirsch, Peter; Decken, Andreas; McGrady, G Sean

    2009-08-14

    The single-crystal X-ray structures of the complexes [CpCr(CO)3H] 1, [CpMo(CO)3H] 2 and [CpW(CO)3H] 3 are reported. The results indicate that 1 adopts a structure close to a distorted three-legged piano stool geometry, whereas a conventional four-legged piano stool arrangement is observed for 2 and 3. Further insight into the equilibrium geometries and potential energy surfaces of all three complexes was obtained by DFT calculations. These show that in the gas phase complex 1 also prefers a geometry close to a four-legged piano stool in line with its heavier congeners, and implying strong packing forces at work for 1 in the solid state. Comparison with their isolelectronic group 7 tricarbonyl counterparts [CpM(CO)3] (M = Mn 4 and Re 5) illustrates that 1, 2 and 3 are sterically crowded complexes. However, a surprisingly soft bending potential is evident for the M-H moiety, whose order (1 approximately = 2 < 3) correlates with the M-H bond strength rather than with the degree of congestion at the metal centre, indicating electronic rather than steric control of the potential. The calculations also reveal cooperative motions of the hydride and carbonyl ligands in the M(CO)3H unit, which allow the M-H moiety to move freely, in spite of the closeness of the four basal ligands, helping to explain the surprising flexibility of the crowded coordination sphere observed for this family of high CN complexes.

  12. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  13. Trypanosoma cruzi Evades the Complement System as an Efficient Strategy to Survive in the Mammalian Host: The Specific Roles of Host/Parasite Molecules and Trypanosoma cruzi Calreticulin

    Directory of Open Access Journals (Sweden)

    Galia Ramírez-Toloza

    2017-09-01

    Full Text Available American Trypanosomiasis is an important neglected reemerging tropical parasitism, infecting about 8 million people worldwide. Its agent, Trypanosoma cruzi, exhibits multiple mechanisms to evade the host immune response and infect host cells. An important immune evasion strategy of T. cruzi infective stages is its capacity to inhibit the complement system activation on the parasite surface, avoiding opsonizing, immune stimulating and lytic effects. Epimastigotes, the non-infective form of the parasite, present in triatomine arthropod vectors, are highly susceptible to complement-mediated lysis while trypomastigotes, the infective form, present in host bloodstream, are resistant. Thus T. cruzi susceptibility to complement varies depending on the parasite stage (amastigote, trypomastigotes or epimastigote and on the T. cruzi strain. To avoid complement-mediated lysis, T. cruzi trypomastigotes express on the parasite surface a variety of complement regulatory proteins, such as glycoprotein 58/68 (gp58/68, T. cruzi complement regulatory protein (TcCRP, trypomastigote decay-accelerating factor (T-DAF, C2 receptor inhibitor trispanning (CRIT and T. cruzi calreticulin (TcCRT. Alternatively, or concomitantly, the parasite captures components with complement regulatory activity from the host bloodstream, such as factor H (FH and plasma membrane-derived vesicles (PMVs. All these proteins inhibit different steps of the classical (CP, alternative (AP or lectin pathways (LP. Thus, TcCRP inhibits the CP C3 convertase assembling, gp58/68 inhibits the AP C3 convertase, T-DAF interferes with the CP and AP convertases assembling, TcCRT inhibits the CP and LP, CRIT confers ability to resist the CP and LP, FH is used by trypomastigotes to inhibit the AP convertases and PMVs inhibit the CP and LP C3 convertases. Many of these proteins have similar molecular inhibitory mechanisms. Our laboratory has contributed to elucidate the role of TcCRT in the host

  14. Flexible Electronics Research Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Flexible Electronics Research Facility designs, synthesizes, tests, and fabricates materials and devices compatible with flexible substrates for Army information...

  15. Diethyl hexyl phthalate-induced changes in insulin signaling molecules and the protective role of antioxidant vitamins in gastrocnemius muscle of adult male rat

    International Nuclear Information System (INIS)

    Srinivasan, Chinnapaiyan; Khan, Adam Ismail; Balaji, Venkataraman; Selvaraj, Jayaraman; Balasubramanian, Karundevi

    2011-01-01

    Diethyl hexyl phthalate (DEHP) is an endocrine disruptor, it influences various organ systems in human beings and experimental animals. DEHP reduced the serum testosterone and increased the blood glucose, estradiol, T 3 and T 4 in rats. However, the effect of DEHP on insulin signaling and glucose oxidation in skeletal muscle is not known. Adult male albino rats were divided into four groups: Group I: Control; Groups II and III: DEHP treated (dissolved in olive oil at a dose of 10 and 100 mg/kg body weight, respectively, once daily through gastric intubation for 30 days); and Group IV: DEHP (100 mg/kg body weight) plus vitamins E (50 mg/kg body weight) and C (100 mg/kg body weight) dissolved in olive oil and distilled water, respectively, once daily through gastric intubation for 30 days. On completion of treatment, animals were euthanized and perfused (whole body); gastrocnemius muscle was dissected out and subjected to assessment of various parameters. DEHP treatment increased the H 2 O 2 , hydroxyl radical levels and lipid peroxidation which disrupt the membrane integrity and insulin receptor. DEHP impaired the insulin signal transduction, glucose uptake and oxidation through decreased expression of plasma membrane GLUT4, which may partly be responsible for the elevation of fasting blood glucose level. The present study suggests that DEHP exposure affects glucose oxidation in skeletal muscle and is mediated through enhanced lipid peroxidation, impaired insulin signaling and GLUT4 expression in plasma membrane. Antioxidant vitamins (C and E) have a protective role against the adverse effect of DEHP. -- Highlights: ► DEHP treatment significantly decreased serum insulin and testosterone levels. ► Increased ROS and decreased glucose uptake were observed in DEHP treated animals. ► Impaired insulin signaling in gastrocnemius muscle was observed in DEHP treatment. ► Vitamins C and E alter ROS, glucose uptake, oxidation and insulin signaling molecules.

  16. Analysis of global gene expression profile of rice in response to methylglyoxal indicates its possible role as a stress signal molecule

    Directory of Open Access Journals (Sweden)

    Charanpreet eKaur

    2015-09-01

    Full Text Available Methylglyoxal (MG is a toxic metabolite produced primarily as a byproduct of glycolysis. Being a potent glycating agent, it can readily bind macromolecules like DNA, RNA or proteins, modulating their expression and activity. In plants, despite the known inhibitory effects of MG on growth and development, still limited information is available about the molecular mechanisms and response pathways elicited upon elevation in MG levels. To gain insight into the molecular basis of MG response, we have investigated changes in global gene expression profiles in rice upon exposure to exogenous MG using GeneChip microarrays. Initially, growth of rice seedlings was monitored in response to increasing MG concentrations which could retard plant growth in a dose-dependent manner. Upon exposure to 10 mM concentration of MG, a total of 1685 probe sets were up- or down-regulated by more than 1.5-fold in shoot tissues within 16 h. These were classified into ten functional categories. The genes involved in signal transduction such as, protein kinases and transcription factors, were significantly over-represented in the perturbed transcriptome, of which several are known to be involved in abiotic and biotic stress response indicating a cross-talk between MG-responsive and stress-responsive signal transduction pathways. Through in silico studies, we could predict 7-8 bp long conserved motif as a possible MG-responsive element (MGRE in the 1 kb upstream region of genes that were more than ten-fold up- or down-regulated in the analysis. Since several perturbations were found in signaling cascades in response to MG, we hereby suggest that it plays an important role in signal transduction probably acting as a stress signal molecule.

  17. Glucose: an Energy Currency and Structural Precursor in Articular Cartilage and Bone with Emerging Roles as an Extracellular Signalling Molecule and Metabolic Regulator

    Directory of Open Access Journals (Sweden)

    Ali eMobasheri

    2012-12-01

    Full Text Available In the musculoskeletal system glucose serves as an essential source of energy for the development, growth and maintenance of bone and articular cartilage. It is particularly needed for skeletal morphogenesis during embryonic growth and foetal development. Glucose is vital for osteogenesis and chondrogenesis, and is used as a precursor for the synthesis of glycosaminoglycans, glycoproteins and glycolipids. Glucose sensors are present in tissues and organs that carry out bulk glucose fluxes (i.e. intestine, kidney and liver. The beta cells of the pancreatic islets of Langerhans respond to changes in glucose concentration by varying the rate of insulin synthesis and secretion. Neuronal cells in the hypothalamus are also capable of sensing extracellular glucose. Glucosensing neurons use glucose as a signalling molecule to alter their action potential frequency in response to variations in ambient glucose levels. Skeletal muscle and adipose tissue can respond to changes in circulating glucose but much less is known about glucosensing in bone and cartilage. Recent research suggests that bone cells can influence (and be influenced by systemic glucose metabolism. This focused review article discusses what we know about glucose transport and metabolism in bone and cartilage and highlights recent studies that have linked glucose metabolism, insulin signalling and osteocalcin activity in bone and cartilage. These new findings in bone cells raise important questions about nutrient sensing, uptake, storage and processing mechanisms and how they might contribute to overall energy homeostasis in health and disease. The role of glucose in modulating anabolic and catabolic gene expression in normal and osteoarthritic chondrocytes is also discussed. In summary, cartilage and bone cells are sensitive to extracellular glucose and adjust their gene expression and metabolism in response to varying extracellular glucose concentrations.

  18. A real options model to assess the role of flexibility in forestry and agroforestry adoption and disadoption in the Lower Mississippi Alluvial Valley

    Science.gov (United States)

    Gregory E. Frey; D. Evan Mercer; Frederick W. Cubbage; Robert C. Abt

    2013-01-01

    Efforts to restore the Lower Mississippi Alluvial Valley’s forests have not achieved desired levels of ecosystem services production.We examined how the variability of returns and the flexibility to change or postpone decisions (option value) affects the economic potential of forestry and agroforestry systems to keep private land in production while still providing...

  19. Oxidative stress parameters induced by exposure to either cadmium or 17β-estradiol on Mytilus galloprovincialis hemocytes. The role of signaling molecules

    International Nuclear Information System (INIS)

    Koutsogiannaki, Sophia; Franzellitti, Silvia; Fabbri, Elena; Kaloyianni, Martha

    2014-01-01

    Highlights: •Oxidative parameters in Mytilus galloprovincialis hemocytes were measured. •Comparison between cadmium and 17β-estradiol cytotoxicity is discussed. •NHE, PKC, PI3-K, NADPH oxidase, NO synthase, JNK involvement was observed. •Protective role of cAMP is suggested. •Signaling molecules studied could constitute novel biomarkers. -- Abstract: The aim of the present study was to determine and compare the possible effects of exposure to an estrogen, 17β-estradiol and to a metal, cadmium on oxidative parameters of Mytilus galloprovincialis hemocytes and to elucidate the signaling pathways that probably mediate the studied effects exerted by these two chemicals. In addition, it was of interest to investigate if the studied parameters could constitute biomarkers for aquatic pollution monitoring. Our results suggest that micromolar concentrations of either cadmium or 17β-estradiol affected the redox status of mussels by modulating oxidative parameters and antioxidant enzymes gene expression in mussel M. galloprovincialis hemocytes. In particular, our results showed that treatment of hemocytes with either 5 μM of cadmium chloride or with 25 nM of 17β-estradiol for 30 min caused significant increased ROS production; this led to oxidative damage exemplified by significant increased DNA damage, protein carbonylation and lipid peroxidation, as well as increased mRNA levels of the antioxidant enzymes catalase (CAT), superoxide dismoutase (SOD) and glutathione S-transferase (GST). Furthermore, our results suggest that either cadmium or 17β-estradiol signal is mediated either through one of the already known pathways initiated by photatidyl-inositol 3-kinase (PI3 K) and reaching Na + /H + exchanger (NHE) probably through protein kinase C (PKC) or a kinase-mediated signaling pathway that involves in most of the cases NHE, PKC, Ca 2+ -dependent PKC isoforms, PI3-K, NADPH oxidase, nitric oxide (NO) synthase, c-Jun N-terminal kinase (JNK) and cyclic adenosine

  20. Oxidative stress parameters induced by exposure to either cadmium or 17β-estradiol on Mytilus galloprovincialis hemocytes. The role of signaling molecules

    Energy Technology Data Exchange (ETDEWEB)

    Koutsogiannaki, Sophia [Laboratory of Animal Physiology, Zoology Department, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki (Greece); Franzellitti, Silvia [University of Bologna, Interdepartment Centre for Environmental Science Research, via S. Alberto 163, 48123 Ravenna (Italy); Fabbri, Elena [University of Bologna, Interdepartment Centre for Environmental Science Research, via S. Alberto 163, 48123 Ravenna (Italy); University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna (Italy); Kaloyianni, Martha, E-mail: kaloyian@bio.auth.gr [Laboratory of Animal Physiology, Zoology Department, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki (Greece)

    2014-01-15

    Highlights: •Oxidative parameters in Mytilus galloprovincialis hemocytes were measured. •Comparison between cadmium and 17β-estradiol cytotoxicity is discussed. •NHE, PKC, PI3-K, NADPH oxidase, NO synthase, JNK involvement was observed. •Protective role of cAMP is suggested. •Signaling molecules studied could constitute novel biomarkers. -- Abstract: The aim of the present study was to determine and compare the possible effects of exposure to an estrogen, 17β-estradiol and to a metal, cadmium on oxidative parameters of Mytilus galloprovincialis hemocytes and to elucidate the signaling pathways that probably mediate the studied effects exerted by these two chemicals. In addition, it was of interest to investigate if the studied parameters could constitute biomarkers for aquatic pollution monitoring. Our results suggest that micromolar concentrations of either cadmium or 17β-estradiol affected the redox status of mussels by modulating oxidative parameters and antioxidant enzymes gene expression in mussel M. galloprovincialis hemocytes. In particular, our results showed that treatment of hemocytes with either 5 μM of cadmium chloride or with 25 nM of 17β-estradiol for 30 min caused significant increased ROS production; this led to oxidative damage exemplified by significant increased DNA damage, protein carbonylation and lipid peroxidation, as well as increased mRNA levels of the antioxidant enzymes catalase (CAT), superoxide dismoutase (SOD) and glutathione S-transferase (GST). Furthermore, our results suggest that either cadmium or 17β-estradiol signal is mediated either through one of the already known pathways initiated by photatidyl-inositol 3-kinase (PI3 K) and reaching Na{sup +}/H{sup +} exchanger (NHE) probably through protein kinase C (PKC) or a kinase-mediated signaling pathway that involves in most of the cases NHE, PKC, Ca{sup 2+}-dependent PKC isoforms, PI3-K, NADPH oxidase, nitric oxide (NO) synthase, c-Jun N-terminal kinase (JNK) and

  1. The Relationship Between Posttraumatic Stress Disorder and Chronic Pain in People Seeking Treatment for Chronic Pain: The Mediating Role of Psychological Flexibility.

    Science.gov (United States)

    Åkerblom, Sophia; Perrin, Sean; Rivano Fischer, Marcelo; McCracken, Lance M

    2018-06-01

    The symptoms of posttraumatic stress disorder (PTSD) and chronic pain are thought to interact to increase the severity and impact of both conditions, but the mechanisms by which they interact remain unclear. This study examines the relationship between PTSD and chronic pain and whether indices of Psychological Flexibility mediate the relationship between these 2 conditions. Standardized self-report measures of PTSD, pain severity, pain interference, depression, and psychological flexibility (pain-related acceptance, committed action, cognitive fusion, and values-based action) were obtained from 315 people seeking treatment for chronic pain who also reported at least 1 traumatic experience. People seeking treatment for chronic pain and reporting symptoms consistent with a current diagnosis of PTSD had significantly higher levels of pain severity, pain interference, depression, and cognitive fusion and lower levels of pain-related acceptance and committed action than those reporting symptoms below the diagnostic threshold for PTSD. Pain-related acceptance, committed action, cognitive fusion, and depression mediated the relationship between PTSD and pain severity/interference, with pain-related acceptance being the strongest mediator from the Psychological Flexibility model. Processes from the Psychological Flexibility model were identified as mediators of the relationship between PTSD and chronic pain in people seeking treatment for chronic pain. The Psychological Flexibility model may be useful as an overarching model to help understand the relationship between PTSD and chronic pain. It is possible that targeting pain-related acceptance, committed action, and cognitive fusion (among other processes) in the treatment of chronic pain may produce corresponding improvements in comorbid symptoms of PTSD when these are present and may reduce impacts of PTSD on outcomes of chronic pain. Conversely, targeting of these processes in the treatment of PTSD may produce similar

  2. Balance and flexibility.

    Science.gov (United States)

    2003-12-01

    The 'work-life balance' and flexible working are currently key buzz terms in the NHS. Those looking for more information on these topics should visit Flexibility at www.flexibility.co.uk for a host of resources designed to support new ways of working, including information on flexible workers and flexible rostering, the legal balancing act for work-life balance and home working.

  3. Single-Molecule Nanomagnets

    Science.gov (United States)

    Friedman, Jonathan R.; Sarachik, Myriam P.

    2010-04-01

    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  4. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  5. Diethyl hexyl phthalate-induced changes in insulin signaling molecules and the protective role of antioxidant vitamins in gastrocnemius muscle of adult male rat

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, Chinnapaiyan; Khan, Adam Ismail; Balaji, Venkataraman; Selvaraj, Jayaraman; Balasubramanian, Karundevi, E-mail: kbala82@rediffmail.com

    2011-12-15

    Diethyl hexyl phthalate (DEHP) is an endocrine disruptor, it influences various organ systems in human beings and experimental animals. DEHP reduced the serum testosterone and increased the blood glucose, estradiol, T{sub 3} and T{sub 4} in rats. However, the effect of DEHP on insulin signaling and glucose oxidation in skeletal muscle is not known. Adult male albino rats were divided into four groups: Group I: Control; Groups II and III: DEHP treated (dissolved in olive oil at a dose of 10 and 100 mg/kg body weight, respectively, once daily through gastric intubation for 30 days); and Group IV: DEHP (100 mg/kg body weight) plus vitamins E (50 mg/kg body weight) and C (100 mg/kg body weight) dissolved in olive oil and distilled water, respectively, once daily through gastric intubation for 30 days. On completion of treatment, animals were euthanized and perfused (whole body); gastrocnemius muscle was dissected out and subjected to assessment of various parameters. DEHP treatment increased the H{sub 2}O{sub 2}, hydroxyl radical levels and lipid peroxidation which disrupt the membrane integrity and insulin receptor. DEHP impaired the insulin signal transduction, glucose uptake and oxidation through decreased expression of plasma membrane GLUT4, which may partly be responsible for the elevation of fasting blood glucose level. The present study suggests that DEHP exposure affects glucose oxidation in skeletal muscle and is mediated through enhanced lipid peroxidation, impaired insulin signaling and GLUT4 expression in plasma membrane. Antioxidant vitamins (C and E) have a protective role against the adverse effect of DEHP. -- Highlights: Black-Right-Pointing-Pointer DEHP treatment significantly decreased serum insulin and testosterone levels. Black-Right-Pointing-Pointer Increased ROS and decreased glucose uptake were observed in DEHP treated animals. Black-Right-Pointing-Pointer Impaired insulin signaling in gastrocnemius muscle was observed in DEHP treatment. Black

  6. Scaling of the dynamics of flexible Lennard-Jones chains

    DEFF Research Database (Denmark)

    Veldhorst, Arno; Dyre, J. C.; Schrøder, Thomas

    2014-01-01

    functions of excess entropy) which has been observed in simulations of both molecular and polymeric systems. Doing molecular dynamics simulations of flexible Lennard-Jones chains (LJC) with rigid bonds, we here provide the first detailed test of the isomorph theory applied to flexible chain molecules. We...

  7. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

    Science.gov (United States)

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

    2013-03-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Discrete Visible Luminescence of Helium Atoms and Molecules Desorbing from Helium Clusters: The Role of Electronic, Vibrational, and Rotational Energy Transfer

    International Nuclear Information System (INIS)

    von Haeften, K.; von Pietrowski, R.; Moeller, T.; Joppien, M.; Moussavizadeh, L.; de Castro, A.R.

    1997-01-01

    Discrete visible and near-infrared luminescence of a beam of photoexcited helium clusters is reported. The emission lines are attributed to free helium atoms and molecules desorbing from clusters in electronically excited states. Depending on the excitation energy, various atomic and molecular singlet and triplet states are involved in the relaxation process. With increasing cluster size the intensity of molecular transitions becomes dominant. The temperature of ejected molecules could be estimated to T vib ∼2500 K and T rot ∼450 K and is much higher than that of the cluster itself. copyright 1997 The American Physical Society

  9. Role of Conserved Disulfide Bridges and Aromatic Residues in Extracellular Loop 2 of Chemokine Receptor CCR8 for Chemokine and Small Molecule Binding

    DEFF Research Database (Denmark)

    Barington, Line; Rummel, Pia C; Lückmann, Michael

    2016-01-01

    and aromatic residues in extracellular loop 2 (ECL2) for ligand binding and activation in the chemokine receptor CCR8. We used IP3 accumulation and radioligand binding experiments to determine the impact of receptor mutagenesis on both chemokine and small molecule agonist and antagonist binding and action...... in CCR8. We find that the 7 transmembrane (7TM) receptor conserved disulfide bridge (7TM bridge) linking transmembrane helix (TM)III and ECL2 is crucial for chemokine and small molecule action, whereas the chemokine receptor conserved disulfide bridge between the N terminus and TMVII is needed only...

  10. Wearable Flexible Sensors: A Review

    KAUST Repository

    Nag, Anindya

    2017-05-18

    The paper provides a review on some of the significant research work done on wearable flexible sensors (WFS). Sensors fabricated with flexible materials have been attached to a person along with the embedded system to monitor a parameter and transfer the significant data to the monitoring unit for further analyses. The use of wearable sensors has played a quite important role to monitor physiological parameters of a person to minimize any malfunctioning happening in the body. The paper categorizes the work according to the materials used for designing the system, the network protocols and different types of activities that were being monitored. The challenges faced by the current sensing systems and future opportunities for the wearable flexible sensors regarding its market values are also briefly explained in the paper.

  11. Wearable Flexible Sensors: A Review

    KAUST Repository

    Nag, Anindya; Mukhopadhyay, Subhas Chandra; Kosel, Jü rgen

    2017-01-01

    The paper provides a review on some of the significant research work done on wearable flexible sensors (WFS). Sensors fabricated with flexible materials have been attached to a person along with the embedded system to monitor a parameter and transfer the significant data to the monitoring unit for further analyses. The use of wearable sensors has played a quite important role to monitor physiological parameters of a person to minimize any malfunctioning happening in the body. The paper categorizes the work according to the materials used for designing the system, the network protocols and different types of activities that were being monitored. The challenges faced by the current sensing systems and future opportunities for the wearable flexible sensors regarding its market values are also briefly explained in the paper.

  12. No Relationship between Hamstring Flexibility and Hamstring Injuries in Male Amateur Soccer Players

    NARCIS (Netherlands)

    Van Doormaal, Mitchell C M; Van Der Horst, Nick; Backx, Frank J G; Smits, Dirk Wouter; Huisstede, Bionka M A

    2017-01-01

    BACKGROUND: In soccer, although hamstring flexibility is thought to play a major role in preventing hamstring injuries, the relationship between hamstring flexibility and hamstring injuries remains unclear. PURPOSE: To investigate the relationship between hamstring flexibility and hamstring injuries

  13. Flexible cultural repertoires

    DEFF Research Database (Denmark)

    Lindegaard, Marie Rosenkrantz; Zimmermann, Francisca

    2017-01-01

    Despite extensive studies of street culture and the risks of offending and victimization in urban marginalized areas, little is known about the role of cultural repertoires for variation in victimization risks among young men not involved in crime. Based on two ethnographic studies, conducted...... independently of the authors in neighbouring township areas of Cape Town, we offer insights into patterns of victimization among young men not involved in crime who live and attend school in the townships. Young men WHO perform decent cultural repertoires are highly exposed to victimization due to their moral...... rejection of crime-involved youth. Young men who perform flexible cultural repertoires, by incorporating and shifting between gang and decent repertoires, experience low victimization due to their adaptation to crime-involved youth. Findings emphasize the importance of detailed investigations of the way...

  14. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. Flexible magnetoimpedance sensor

    KAUST Repository

    Li, Bodong; Kavaldzhiev, Mincho; Kosel, Jü rgen

    2015-01-01

    Flexible magnetoimpedance (MI) sensors fabricated using a NiFe/Cu/NiFe tri-layer on Kapton substrate have been studied. A customized flexible microstrip transmission line was employed to investigate the MI sensors's magnetic field and frequency

  16. The Role of Compensation Criteria to Minimize Face-Time Bias and Support Faculty Career Flexibility: An Approach to Enhance Career Satisfaction in Academic Pathology.

    Science.gov (United States)

    Howell, Lydia Pleotis; Elsbach, Kimberly D; Villablanca, Amparo C

    2016-01-01

    Work-life balance is important to recruitment and retention of the younger generation of medical faculty, but medical school flexibility policies have not been fully effective. We have reported that our school's policies are underutilized due to faculty concerns about looking uncommitted to career or team. Since policies include leaves and accommodations that reduce physical presence, faculty may fear "face-time bias," which negatively affects evaluation of those not "seen" at work. Face-time bias is reported to negatively affect salary and career progress. We explored face-time bias on a leadership level and described development of compensation criteria intended to mitigate face-time bias, raise visibility, and reward commitment and contribution to team/group goals. Leaders from 6 partner departments participated in standardized interviews and group meetings. Ten compensation plans were analyzed, and published literature was reviewed. Leaders did not perceive face-time issues but saw team pressure and perception of availability as performance motivators. Compensation plans were multifactor productivity based with many quantifiable criteria; few addressed team contributions. Using these findings, novel compensation criteria were developed based on a published model to mitigate face-time bias associated with team perceptions. Criteria for organizational citizenship to raise visibility and reward group outcomes were included. We conclude that team pressure and perception of availability have the potential to lead to bias and may contribute to underuse of flexibility policies. Recognizing organizational citizenship and cooperative effort via specific criteria in a compensation plan may enhance a culture of flexibility. These novel criteria have been effective in one pilot department.

  17. Flexible Carpooling: Exploratory Study

    OpenAIRE

    Dorinson, Diana; Gay, Deanna; Minett, Paul; Shaheen, Susan

    2009-01-01

    Energy consumption could be reduced if more people shared rides rather than driving alone yet carpooling represents a small proportion of all potential carpoolers. Prior research has found that many who might carpool were concerned about reduced flexibility with carpooling. If flexibility is one of the barriers how could carpooling be organized to be more flexible? In Northern Virginia a flexible system has evolved where there are 3,500 single-use carpools per day. In another example there ...

  18. Melting mechanism in monolayers of flexible rod-shaped molecules

    DEFF Research Database (Denmark)

    Hansen, Flemming Yssing; Taub, H.

    1992-01-01

    The melting of butane and hexane monolayers adsorbed on a graphite basal-plane surface has been studied by molecular-dynamics simulations and experimentally by neutron diffraction. The simulation results are qualitatively consistent with the observed diffraction patterns and suggest a general...

  19. The Flexibility of Organization and the flexibility of product – premises of organizational success

    OpenAIRE

    Todorut, Amalia Venera

    2008-01-01

    Flexibility represents the ability of a manufactural system to adapt to some diversified tasks of production, thus to assure an economic efficiency – the rapport time/cost should be optimum, with insignificant structure changes within a long period of time. The central role of flexibility is to permit the survival and the success of the organizations in a turbulent circumstance, which is characteristic to the new world tendencies. The more flexible the organization becomes, the better it resp...

  20. Flexibility at Work: A Study of Further Education.

    Science.gov (United States)

    Edwards, Richard; Clarke, Julia; Harrison, Roger; Reeve, Fiona

    2001-01-01

    Interviews with 50 further education managers, lecturers, and students in Britain identified complex ways in which flexibility is experienced: (1) lecturers feel increasingly busy trying to provide flexibility; (2) role boundaries are becoming more and more fuzzy in the flexible workplace; and (3) there are notions of "good" and…

  1. Etude de la formation de resonances electroniques et de leur role dans la fragmentation neutre de molecules d'interet biologique

    Science.gov (United States)

    Lepage, Martin

    1998-12-01

    Cette these est presentee a la Faculte de medecine de l'Universite de Sherbrooke en vue de l'obtention du grade de Ph.D. en Radiobiologie. Elle contient des resultats experimentaux enregistres avec un spectrometre d'electrons a haute resolution. Ces resultats portent sur la formation de resonances electroniques en phase condensee et de differents canaux pour leur decroissance. En premier lieu, nous presentons des mesures d'excitations vibrationnelles de l'oxygene dilue en matrice d'argon pour des energies des electrons incidents de 1 a 20 eV. Les resultats suggerent que le temps de vie des resonances de l'oxygene est modifie par la densite d'etats d'electrons dans la bande de conduction de l'argon. Nous presentons aussi des spectres de pertes d'energie d'electrons des molecules de tetrahydrofuranne (THF) et d'acetone. Dans les deux cas, la position en energie des pertes associees aux excitations vibrationnelles est en excellent accord avec les resultats trouves dans la litterature. Les fonctions d'excitation de ces modes revelent la presence de plusieurs nouvelles resonances electroniques. Nous comparons les resonances du THF et celles de la molecule de cyclopentane en phase gazeuse. Nous proposons une origine commune aux resonances ce qui implique qu'elles ne sont pas necessairement attribuees a l'excitation des electrons non-apparies de l'oxygene du THF. Nous proposons une nouvelle methode basee sur la spectroscopie par pertes d'energie des electrons pour detecter la production de fragments neutres qui demeurent a l'interieur d'un film mince condense a basse temperature. Cette methode se base sur la detection des excitations electroniques du produit neutre. Nous presentons des resultats de la production de CO dans un film de methanol. Le taux de production de CO en fonction de l'energie incidente des electrons est calibre en termes d'une section efficace totale de diffusion des electrons. Les resultats indiquent une augmentation lineaire du taux de production de

  2. The effect of micro-environment on luminescence of aequorin: the role of amino acids and explicit water molecules on spectroscopic properties of coelenteramide.

    Science.gov (United States)

    Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min

    2013-10-05

    Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Can flexibility help you float?

    Science.gov (United States)

    Burton, L. J.; Bush, J. W. M.

    2012-10-01

    We consider the role of flexibility in the weight-bearing characteristics of bodies floating at an interface. Specifically, we develop a theoretical model for a two-dimensional thin floating plate that yields the maximum stable plate load and optimal stiffness for weight support. Plates small relative to the capillary length are primarily supported by surface tension, and their weight-bearing potential does not benefit from flexibility. Above a critical size comparable to the capillary length, flexibility assists interfacial flotation. For plates on the order of and larger than the capillary length, deflection from an initially flat shape increases the force resulting from hydrostatic pressure, allowing the plate to support a greater load. In this large plate limit, the shape that bears the most weight is a semicircle, which displaces the most fluid above the plate for a fixed plate length. Exact results for maximum weight-bearing plate shapes are compared to analytic approximations made in the limits of large and small plate sizes. The value of flexibility for floating to a number of biological organisms is discussed in light of our study.

  4. The role of tetragonal-metal-organic framework-5 loadings with extra ZnO molecule on the gas separation performance of mixed matrix membrane

    International Nuclear Information System (INIS)

    Arjmandi, Mehrzad; Pakizeh, Majid; Pirouzram, Omid

    2015-01-01

    The effect of more ZnO molecule in tetragonal structure of MOF-5 than cubic structure on the gas permeation properties of T-MOF-5/polyetherimide mixed matrix membranes was investigated. T-MOF-5 was first successfully synthesized and carefully characterized by XRD, FTIR, SEM and N 2 adsorption technique at 77 K. Novel T-MOF-5/PEI MMMs were prepared using solution casting method and characterized by FTIR and SEM. The SEM pictures of the MMMs showed that T-MOF-5 nanocrystals changed the morphology of PEI and exhibited acceptable contacts between the filler particles and the polymer chains. Gas permeation properties of these membranes with different T-MOF-5 contents were studied for pure H 2 , CO 2 , CH 4 and N 2 gases. Permeation measurement showed that the all gases' permeability, diffusivity and solubility were increased with T-MOF-5 loading. H 2 permeability and the ideal selectivity of H 2 /CO 2 and H 2 /CH 4 in MMM with 25 wt% loading of T-MOF-5 nanocrystals were increased. This behavior was attributed to more ZnO molecule in T-MOF-5 structure. The experimental gas permeations through T-MOF-5/PEI nanocomposite with different filler loadings were fitted on Higuchi model. Good agreement between the experimental data and the predicted gas permeability was obtained

  5. The role of tetragonal-metal-organic framework-5 loadings with extra ZnO molecule on the gas separation performance of mixed matrix membrane

    Energy Technology Data Exchange (ETDEWEB)

    Arjmandi, Mehrzad; Pakizeh, Majid [Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Pirouzram, Omid [Kurdistan University, Kurdistan (Iran, Islamic Republic of)

    2015-06-15

    The effect of more ZnO molecule in tetragonal structure of MOF-5 than cubic structure on the gas permeation properties of T-MOF-5/polyetherimide mixed matrix membranes was investigated. T-MOF-5 was first successfully synthesized and carefully characterized by XRD, FTIR, SEM and N{sub 2} adsorption technique at 77 K. Novel T-MOF-5/PEI MMMs were prepared using solution casting method and characterized by FTIR and SEM. The SEM pictures of the MMMs showed that T-MOF-5 nanocrystals changed the morphology of PEI and exhibited acceptable contacts between the filler particles and the polymer chains. Gas permeation properties of these membranes with different T-MOF-5 contents were studied for pure H{sub 2}, CO{sub 2}, CH{sub 4} and N{sub 2} gases. Permeation measurement showed that the all gases' permeability, diffusivity and solubility were increased with T-MOF-5 loading. H{sub 2} permeability and the ideal selectivity of H{sub 2}/CO{sub 2} and H{sub 2}/CH{sub 4} in MMM with 25 wt% loading of T-MOF-5 nanocrystals were increased. This behavior was attributed to more ZnO molecule in T-MOF-5 structure. The experimental gas permeations through T-MOF-5/PEI nanocomposite with different filler loadings were fitted on Higuchi model. Good agreement between the experimental data and the predicted gas permeability was obtained.

  6. Further evidence of the in vivo role of erythropoietin or companion molecules induced by hypoxia on proliferation and continuing differentiation of BFU-e in PCDC

    International Nuclear Information System (INIS)

    Harigaya, K.; Cronkite, E.P.; Miller, M.E.; Moccia, G.

    1981-01-01

    Normal and plethoric bone marrow cells were grown in plasma clot diffusion chambers (PCDC) implanted into the peritoneum of normal mice or mice submitted to 7 h of hypoxia (23,000 ft) daily, on a single day or on 2 consecutive days at different times after implantation of the PCDC's. Daily discontinuous hypoxia (DDH) produced more 6-day bursts than other treatments. Hypoxia on days 1 and 2 after implantation was nearly as effective as DDH on day-6 bursts. Erythropoietin (Ep) levels were measured by bioassay on both diffusion chamber (DC) contents and serum. Serum Ep levels peaked after a 7-hr hypoxic exposure while the DC content Ep levels were in the nondetectable range. The data implies that either higher than normal Ep levels or a companion molecule(s) produced by hypoxia are required for 1 to 2 days early in the culture period to force an increasing number of BFU-d-e down the erythrocytic pathway and thus increase red cell production at times of need in vivo

  7. Office flexible cystoscopy.

    Science.gov (United States)

    Kavoussi, L R; Clayman, R V

    1988-11-01

    Since the development of the first purpose-built flexible cystoscope in 1984, flexible cystoscopy has become an accepted diagnostic and therapeutic modality. Indeed, it is estimated that more than 10 per cent of practicing urologists are already familiar with this technology. The flexible cystoscope has markedly extended the urologist's ability to examine the bladder, and it has become a valuable adjunct to the rigid cystoscope. Although the operation of this instrument is vastly different from that of its rigid counterpart, with practice, the technique can be learned. After experience is obtained with diagnostic flexible cystoscopy, the urologist will likely prefer this new instrument for bladder inspection, as it provides for a more thorough yet less morbid and less expensive examination. In the future, the development of improved and smaller instrumentation will further extend the therapeutic indications for flexible cystoscopy. Indeed, advances in laser technology are already providing the urologist with 300- to 600-micron (0.9 to 1.8F) flexible probes capable of incision (KTP laser), fulguration (Nd:YAG laser), and stone disintegration (tunable dye laser). Lastly, the skills obtained in using the flexible cystoscope are all readily applicable to the development of dexterity with the already available flexible nephroscope and the more recently developed flexible ureteroscope.

  8. Simulating charge transport in flexible systems

    Directory of Open Access Journals (Sweden)

    Timothy Clark

    2015-12-01

    Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

  9. Role of cloned carotenoid genes expressed in Escherichia coli in protecting against inactivation by near-UV light and specific phototoxic molecules

    International Nuclear Information System (INIS)

    Tuveson, R.W.; Larson, R.A.; Kagan, J.

    1988-01-01

    Genes controlling carotenoid synthesis were cloned from Erwinia herbicola and expressed in an Escherichia coli strain. Carotenoids protect against high fluences of near-UV (NUV; 320 to 400 nm) but not against far-UV (200-300 nm). Protection of E. coli cells was not observed following treatment with either psoralen or 8-methoxypsoralen plus NUV. However, significant protection of cells producing carotenoids was observed with three photosensitizing molecules activated by NUV (alpha-terthienyl, harmine, and phenylheptatriyne) which are thought to have the membrane as an important lethal target. Protection of carotenoid-producing cells against inactivation was not observed with acridine orange plus visible light but was seen with toluidine blue O plus visible light

  10. A novel role for small molecule glycomimetics in the protection against lipid-induced endothelial dysfunction: Involvement of Akt/eNOS and Nrf2/ARE signaling.

    Science.gov (United States)

    Mahmoud, Ayman M; Wilkinson, Fiona L; Jones, Alan M; Wilkinson, James A; Romero, Miguel; Duarte, Juan; Alexander, M Yvonne

    2017-01-01

    Glycomimetics are a diverse array of saccharide-inspired compounds, designed to mimic the bioactive functions of glycosaminoglycans. Therefore, glycomimetics represent a unique source of novel therapies to target aberrant signaling and protein interactions in a wide range of diseases. We investigated the protective effects of four newly synthesized small molecule glycomimetics against lipid-induced endothelial dysfunction, with an emphasis on nitric oxide (NO) and oxidative stress. Four aromatic sugar mimetics were synthesized by the stepwise transformation of 2,5-dihydroxybenzoic acid to derivatives (C1-C4) incorporating sulfate groups to mimic the structure of heparan sulfate. Glycomimetic-treated human umbilical vein endothelial cells (HUVECs) were exposed to palmitic acid to model lipid-induced oxidative stress. Palmitate-induced impairment of NO production was restored by the glycomimetics, through activation of Akt/eNOS signaling. Furthermore, C1-C4 significantly inhibited palmitate-induced reactive oxygen species (ROS) production, lipid peroxidation, and activity and expression of NADPH oxidase. These effects were attributed to activation of the Nrf2/ARE pathway and downstream activation of cellular antioxidant and cytoprotective proteins. In ex vivo vascular reactivity studies, the glycomimetics (C1-C4) also demonstrated a significant improvement in endothelium-dependent relaxation and decreased ROS production and NADPH oxidase activity in isolated mouse thoracic aortic rings exposed to palmitate. The small molecule glycomimetics, C1-C4, protect against lipid-induced endothelial dysfunction through up-regulation of Akt/eNOS and Nrf2/ARE signaling pathways. Thus, carbohydrate-derived therapeutics are a new class of glycomimetic drugs targeting endothelial dysfunction, regarded as the first line of defense against vascular complications in cardiovascular disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Organizational flexibility estimation

    OpenAIRE

    Komarynets, Sofia

    2013-01-01

    By the help of parametric estimation the evaluation scale of organizational flexibility and its parameters was formed. Definite degrees of organizational flexibility and its parameters for the Lviv region enterprises were determined. Grouping of the enterprises under the existing scale was carried out. Special recommendations to correct the enterprises behaviour were given.

  12. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-05-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  13. Flexible magnetoimpidence sensor

    KAUST Repository

    Kavaldzhiev, Mincho

    2015-05-01

    Recently, flexible electronic devices have attracted increasing interest, due to the opportunities they promise for new applications such as wearable devices, where the components are required to flex during normal use[1]. In this light, different magnetic sensors, like microcoil, spin valve, giant magnetoresistance (GMR), magnetoimpedance (MI), have been studied previously on flexible substrates.

  14. Flexible position probe assembly

    International Nuclear Information System (INIS)

    Schmitz, J.J.

    1977-01-01

    The combination of a plurality of tubular transducer sections and a flexible supporting member extending through the tubular transducer sections forms a flexible elongated probe of a design suitable for monitoring the level of an element, such as a nuclear magnetically permeable control rod or liquid. 3 claims, 23 figures

  15. Flexible Carbon Aerogels

    Directory of Open Access Journals (Sweden)

    Marina Schwan

    2016-09-01

    Full Text Available Carbon aerogels are highly porous materials with a large inner surface area. Due to their high electrical conductivity they are excellent electrode materials in supercapacitors. Their brittleness, however, imposes certain limitations in terms of applicability. In that context, novel carbon aerogels with varying degree of flexibility have been developed. These highly porous, light aerogels are characterized by a high surface area and possess pore structures in the micrometer range, allowing for a reversible deformation of the aerogel network. A high ratio of pore size to particle size was found to be crucial for high flexibility. For dynamic microstructural analysis, compression tests were performed in-situ within a scanning electron microscope allowing us to directly visualize the microstructural flexibility of an aerogel. The flexible carbon aerogels were found to withstand between 15% and 30% of uniaxial compression in a reversible fashion. These findings might stimulate further research and new application fields directed towards flexible supercapacitors and batteries.

  16. Global Sourcing Flexibility

    DEFF Research Database (Denmark)

    Ørberg Jensen, Peter D.; Petersen, Bent

    2013-01-01

    the higher costs (but decreased risk for value chain disruption) embedded in a more flexible global sourcing model that allows the firm to replicate and/or relocate activities across multiple locations. We develop a model and propositions on facilitating and constraining conditions of global sourcing...... sourcing flexibility. Here we draw on prior research in the fields of organizational flexibility, international business and global sourcing as well as case examples and secondary studies. In the second part of the paper, we discuss the implications of global sourcing flexibility for firm strategy...... and operations against the backdrop of the theory-based definition of the construct. We discuss in particular the importance of global sourcing flexibility for operational performance stability, and the trade-off between specialization benefits, emerging from location and service provider specialization, versus...

  17. A review on the role of nutraceuticals as simple as se(2+) to complex organic molecules such as glycyrrhizin that prevent as well as cure diseases.

    Science.gov (United States)

    Jose, Regi; Sajitha, G R; Augusti, K T

    2014-04-01

    Nutraceuticals are nutritional medicines which are present in edible food items. Most of them are antioxidants with various other biological properties viz, anti inflammatory, anti atherogenic, anticancer, anti viral, anti aging properties etc. They are as simple as minerals like Se(2+) to complex organic molecules such as glycyrrhizin (Ca(2+), K(+) salts of glycyrrhizic acid). They can prevent as well as cure various diseases. Most of the medical people are not aware of the importance of the nutraceuticals as such matters are not part of their text books. Many still think that vitamins are the major nutritional medicines. Actually other dietary principles like terpenes, carotenes, phytosterols, polyphenols, flavanoids, di and poly sulphides, their sulfoxides and their precursor amino acids are necessary to scavenge free radicals in the body which are reactive oxygen species to protect and maintain the vitamin levels in the body. They down regulate the activities of those enzymes which are increased in diseases and they increase those that remove oxidants and detoxify carcinogens. They are immune boosters too. Recently glucosinolates, non toxic alkaloids, certain proteins and even fiber are included in the list of nutraceuticals.

  18. High-Throughput Flow Cytometry Screening Reveals a Role for Junctional Adhesion Molecule A as a Cancer Stem Cell Maintenance Factor

    Directory of Open Access Journals (Sweden)

    Justin D. Lathia

    2014-01-01

    Full Text Available Stem cells reside in niches that regulate the balance between self-renewal and differentiation. The identity of a stem cell is linked with the ability to interact with its niche through adhesion mechanisms. To identify targets that disrupt cancer stem cell (CSC adhesion, we performed a flow cytometry screen on patient-derived glioblastoma (GBM cells and identified junctional adhesion molecule A (JAM-A as a CSC adhesion mechanism essential for self-renewal and tumor growth. JAM-A was dispensable for normal neural stem/progenitor cell (NPC function, and JAM-A expression was reduced in normal brain versus GBM. Targeting JAM-A compromised the self-renewal of CSCs. JAM-A expression negatively correlated to GBM patient prognosis. Our results demonstrate that GBM-targeting strategies can be identified through screening adhesion receptors and JAM-A represents a mechanism for niche-driven CSC maintenance.

  19. Small molecules: the missing link in the central dogma.

    Science.gov (United States)

    Schreiber, Stuart L

    2005-07-01

    Small molecules have critical roles at all levels of biological complexity and yet remain orphans of the central dogma. Chemical biologists, working with small molecules, expand our understanding of these central elements of life.

  20. Beneficial effects of carbon monoxide-releasing molecule-2 (CORM-2) on acute doxorubicin cardiotoxicity in mice: Role of oxidative stress and apoptosis

    International Nuclear Information System (INIS)

    Soni, Hitesh; Pandya, Gaurav; Patel, Praful; Acharya, Aviseka; Jain, Mukul; Mehta, Anita A.

    2011-01-01

    Doxorubicin (DXR) has been used in variety of human malignancies for decades. Despite its efficacy in cancer, clinical usage is limited because of its cardiotoxicity, which has been associated with oxidative stress and apoptosis. Carbon monoxide-releasing molecules (CORMs) have been shown to reduce the oxidative damage and apoptosis. The present study investigated the effects of CORM-2, a fast CO-releaser, against DXR-induced cardiotoxicity in mice using biochemical, histopathological and gene expression approaches. CORM-2 (3, 10 and 30 mg/kg/day) was administered intraperitoneally (i.p.) for 10 days and terminated the study on day 11. DXR (20 mg/kg, i.p.) was injected before 72 h of termination. Mice treated with DXR showed cardiotoxicity as evidenced by elevation of serum creatine kinase (CK) and lactate dehydrogenase (LDH), tissue malondialdehyde (MDA), caspase-3 and decrease the level of total antioxidant status (TAS) in heart tissues. Pre- and post-treatment with CORM-2 (30 mg/kg, i.p.) elicited significant improvement in CK, LDH, MDA, caspase-3 and TAS levels. Histopathological studies showed that cardiac damage with DXR has been reversed with CORM-2 + DXR treatment. There was dramatic decrease in hematological count in DXR-treated mice, which has been improved with CORM-2. Furthermore, there was also elevation of mRNA expression of heme oxygenase-1, hypoxia inducible factor-1 alpha, vascular endothelial growth factor and decrease in inducible-nitric oxide synthase expression upon treatment with CORM-2 that might be linked to cardioprotection. These data suggest that CORM-2 treatment provides cardioprotection against acute doxorubicin-induced cardiotoxicity in mice and this effect may be attributed to CORM-2-mediated antioxidant and anti-apoptotic properties.

  1. Interaction between vegetable oil based plasticizer molecules and polyvinyl chloride, and their plasticization effect

    Science.gov (United States)

    Haryono, Agus; Triwulandari, Evi; Jiang, Pingping

    2017-01-01

    Plasticizer molecules are low molecular weight compounds that are widely used in polymer industries especially in polyvinyl chloride (PVC) resin. As an additive in PVC resin, the important role of plasticizer molecules is to improve the flexibility and processability of PVC by lowering the glass transition temperature (Tg). However, the commercial plasticizer like di(2-ethylhexyl)phthalate (DEHP) is known to cause liver cancer, at least in laboratory rats. DEHP can leach out from PVC into blood, certain drug solutions and fatty foods, which has been detected in the bloodstream of patients undergoing transfusion. Vegetable oil based plasticizers have some attractive properties such as non-toxic, bio-degradable, good heat and light stability, renewable resources, and environmentally friendly. Here we discussed the main results and development of vegetable oil based plasticizer, and especially palm oil based plasticizer. The interaction between plasticizer and polymer was discussed from the properties of the plasticized polymeric material.

  2. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    Science.gov (United States)

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Flexible Word Classes

    DEFF Research Database (Denmark)

    • First major publication on the phenomenon • Offers cross-linguistic, descriptive, and diverse theoretical approaches • Includes analysis of data from different language families and from lesser studied languages This book is the first major cross-linguistic study of 'flexible words', i.e. words...... that cannot be classified in terms of the traditional lexical categories Verb, Noun, Adjective or Adverb. Flexible words can - without special morphosyntactic marking - serve in functions for which other languages must employ members of two or more of the four traditional, 'specialised' word classes. Thus......, flexible words are underspecified for communicative functions like 'predicating' (verbal function), 'referring' (nominal function) or 'modifying' (a function typically associated with adjectives and e.g. manner adverbs). Even though linguists have been aware of flexible world classes for more than...

  4. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-01-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent

  5. Flexibility in insulin prescription

    Directory of Open Access Journals (Sweden)

    Sanjay Kalra

    2016-01-01

    Full Text Available This communication explores the concept of flexibility, a propos insulin preparations and insulin regimes used in the management of type 2 diabetes. The flexibility of an insulin regime or preparation is defined as their ability to be injected at variable times, with variable injection-meal time gaps, in a dose frequency and quantum determined by shared decision making, with a minimal requirement of glucose monitoring and health professional consultation, with no compromise on safety, efficiency and tolerability. The relative flexibility of various basal, prandial and dual action insulins, as well as intensive regimes, is compared. The biopsychosocial model of health is used to assess the utility of different insulins while encouraging a philosophy of flexible insulin usage.

  6. Flexibility in radiation protection legislation

    International Nuclear Information System (INIS)

    Beaver, P.F.; Gill, J.R.

    1980-01-01

    The UK approach to radiation protection legislation is described in detail. The advantages are outlined of a flexible approach whereby the objectives of the legislation are clearly identified but the means of achieving these are left open or qualified by terms such as 'where reasonably practicable'. The roles and viewpoints of management and unions in such an approach are discussed especially with respect to legislation such as the Health and Safety at Work Act. Specific topics include requirements for notification of use, criteria for controlled areas and the tasks of the radiation protection adviser. (UK)

  7. Flexible displays, rigid designs?

    DEFF Research Database (Denmark)

    Hornbæk, Kasper

    2015-01-01

    Rapid technological progress has enabled a wide range of flexible displays for computing devices, but the user experience--which we're only beginning to understand--will be the key driver for successful designs.......Rapid technological progress has enabled a wide range of flexible displays for computing devices, but the user experience--which we're only beginning to understand--will be the key driver for successful designs....

  8. Role of an indole-thiazolidine molecule PPAR pan-agonist and COX inhibitor on inflammation and microcirculatory damage in acute gastric lesions.

    Directory of Open Access Journals (Sweden)

    José Roberto Santin

    Full Text Available The present study aimed to show the in vivo mechanisms of action of an indole-thiazolidine molecule peroxisome-proliferator activated receptor pan-agonist (PPAR pan and cyclooxygenase (COX inhibitor, LYSO-7, in an ethanol/HCl-induced (Et/HCl gastric lesion model. Swiss male mice were treated with vehicle, LYSO-7 or Bezafibrate (p.o. 1 hour before oral administration of Et/HCl (60%/0.03M. In another set of assays, animals were injected i.p. with an anti-granulocyte antibody, GW9962 or L-NG-nitroarginine methyl ester (L-NAME before treatment. One hour after Et/HCl administration, neutrophils were quantified in the blood and bone marrow and the gastric microcirculatory network was studied in situ. The gastric tissue was used to quantify the percentage of damaged area, as well as myeloperoxidase (MPO, inducible nitric oxide synthase (iNOS, endothelial nitric oxide synthase (eNOS protein and PPARγ protein and gene expression. Acid secretion was evaluated by the pylorus ligation model. LYSO-7 or Bezafibrate treatment reduced the necrotic area. LYSO-7 treatment enhanced PPARγ gene and protein expression in the stomach, and impaired local neutrophil influx and stasis of the microcirculatory network caused by Et/HCl administration. The effect seemed to be due to PPARγ agonist activity, as the LYSO-7 effect was abolished in GW9962 pre-treated mice. The reversal of microcirculatory stasis, but not neutrophil influx, was mediated by nitric oxide (NO, as L-NAME pre-treatment abolished the LYSO-7-mediated reestablishment of microcirculatory blood flow. This effect may depend on enhanced eNOS protein expression in injured gastric tissue. The pH and concentration of H(+ in the stomach were not modified by LYSO-7 treatment. In addition, LYSO-7 may induce less toxicity, as 28 days of oral treatment did not induce weight loss, as detected in pioglitazone treated mice. Thus, we show that LYSO-7 may be an effective treatment for gastric lesions by controlling

  9. EVALUATION OF THE ROLE OF INTERLEUKIN-8 (IL -8), SOLUBLE INTERCELLULAR ADHESION MOLECULE-1(SICAM-1) AND EOSINOPHIL CATIONIC PROTEIN (ECP) IN PATHOGENESIS OF BRONCHIAL ASTHMA

    International Nuclear Information System (INIS)

    EL-NASHAR, N.A.; MOSTAFA, A.M.E.; AHMED, S.M.; ABDEL-LATIF, A.

    2008-01-01

    Bronchial asthma remains a leading cause of chronic illness in children. Current theories of the pathogenesis of asthma suggest that airway inflammation is an important determinant of bronchial hyperactivity .The interaction of several inflammatory cells, soluble mediators and adhesion molecules may be important determinants of asthma. Since a better understanding of the underlying mechanisms leading to asthma pathology may yield more specific immunological strategies for the treatment of this disease, this study was designed to investigate the contribution of these markers to airway inflammation. The present study included 25 children with asthma and 15 control children. The asthma cases were 18 males and 7 females ( mean age= 9.36 ± 2.16 years). According to the severity of asthma, patients were classified as mild (n=10), moderate (n=9) and severe (n=6) asthma. They were further classified into allergic asthmatics (extrinsic atopic, n=10) and non-allergic (intrinsic asthmatics, n=15). Estimations of serum levels of IL-8, sICAM-1(by ELISA) and ECP (by flouroimmunoassay) were done. The results of this study revealed that serum levels of IL-8 were significantly higher in asthmatics than in controls. Also, serum levels of it were significantly higher in cases with severe and cases with moderate asthma than in cases with mild asthma. Serum levels of sICAM-1 were significantly higher in asthmatic than in control children, in severe than in moderate, and in both than in mild asthma cases. Levels of ECP were significantly higher in asthmatics than in controls. Also, serum levels of it were related to asthma severity. Furthermore, the three biomarkers showed higher expression in allergic asthmatics versus non- allergies. There were positive correlations of IL-8, sICAM-1, ECP and IgE with each other in asthmatic children that may indicate interaction of these markers in regulation and persistence of inflammatory cascade in asthma through different mechanisms. In

  10. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  11. Subtype-Selective Small Molecule Inhibitors Reveal a Fundamental Role for Nav1.7 in Nociceptor Electrogenesis, Axonal Conduction and Presynaptic Release

    Science.gov (United States)

    Estacion, Mark; Turner, Jamie; Mis, Malgorzata A.; Wilbrey, Anna; Payne, Elizabeth C.; Gutteridge, Alex; Cox, Peter J.; Doyle, Rachel; Printzenhoff, David; Lin, Zhixin; Marron, Brian E.; West, Christopher; Swain, Nigel A.; Storer, R. Ian; Stupple, Paul A.; Castle, Neil A.; Hounshell, James A.; Rivara, Mirko; Randall, Andrew; Dib-Hajj, Sulayman D.; Krafte, Douglas; Waxman, Stephen G.; Patel, Manoj K.; Butt, Richard P.; Stevens, Edward B.

    2016-01-01

    Human genetic studies show that the voltage gated sodium channel 1.7 (Nav1.7) is a key molecular determinant of pain sensation. However, defining the Nav1.7 contribution to nociceptive signalling has been hampered by a lack of selective inhibitors. Here we report two potent and selective arylsulfonamide Nav1.7 inhibitors; PF-05198007 and PF-05089771, which we have used to directly interrogate Nav1.7’s role in nociceptor physiology. We report that Nav1.7 is the predominant functional TTX-sensitive Nav in mouse and human nociceptors and contributes to the initiation and the upstroke phase of the nociceptor action potential. Moreover, we confirm a role for Nav1.7 in influencing synaptic transmission in the dorsal horn of the spinal cord as well as peripheral neuropeptide release in the skin. These findings demonstrate multiple contributions of Nav1.7 to nociceptor signalling and shed new light on the relative functional contribution of this channel to peripheral and central noxious signal transmission. PMID:27050761

  12. Subtype-Selective Small Molecule Inhibitors Reveal a Fundamental Role for Nav1.7 in Nociceptor Electrogenesis, Axonal Conduction and Presynaptic Release.

    Directory of Open Access Journals (Sweden)

    Aristos J Alexandrou

    Full Text Available Human genetic studies show that the voltage gated sodium channel 1.7 (Nav1.7 is a key molecular determinant of pain sensation. However, defining the Nav1.7 contribution to nociceptive signalling has been hampered by a lack of selective inhibitors. Here we report two potent and selective arylsulfonamide Nav1.7 inhibitors; PF-05198007 and PF-05089771, which we have used to directly interrogate Nav1.7's role in nociceptor physiology. We report that Nav1.7 is the predominant functional TTX-sensitive Nav in mouse and human nociceptors and contributes to the initiation and the upstroke phase of the nociceptor action potential. Moreover, we confirm a role for Nav1.7 in influencing synaptic transmission in the dorsal horn of the spinal cord as well as peripheral neuropeptide release in the skin. These findings demonstrate multiple contributions of Nav1.7 to nociceptor signalling and shed new light on the relative functional contribution of this channel to peripheral and central noxious signal transmission.

  13. The Role of Anisotropic Exchange in Single Molecule Magnets: A CASSCF/NEVPT2 Study of the Fe4 SMM Building Block [Fe2(OCH32(dbm4] Dimer

    Directory of Open Access Journals (Sweden)

    Alessandro Lunghi

    2016-09-01

    Full Text Available The rationalisation of single molecule magnets’ (SMMs magnetic properties by quantum mechanical approaches represents a major task in the field of the Molecular Magnetism. The fundamental interpretative key of molecular magnetism is the phenomenological Spin Hamiltonian and the understanding of the role of its different terms by electronic structure calculations is expected to steer the rational design of new and more performing SMMs. This paper deals with the ab initio calculation of isotropic and anisotropic exchange contributions in the Fe(III dimer [Fe 2 (OCH 3 2 (dbm 4 ]. This system represents the building block of one of the most studied Single Molecule Magnets ([Fe 4 RC(CH 2 O 3 2 (dpm 6 ] where R can be an aliphatic chain or a phenyl group just to name the most common functionalization groups and its relatively reduced size allows the use of a high computational level of theory. Calculations were performed using CASSCF and NEVPT2 approaches on the X-ray geometry as assessment of the computational protocol, which has then be used to evinced the importance of the outer coordination shell nature through organic ligand modelization. Magneto-structural correlations as function of internal degrees of freedom for isotropic and anisotropic exchange contributions are also presented, outlining, for the first time, the extremely rapidly changing nature of the anisotropic exchange coupling.

  14. Performance measurement of supply chain flexibility using witness

    Directory of Open Access Journals (Sweden)

    Rituraj Chandrakar

    2012-10-01

    Full Text Available In today’s global scenario of intense competition and environmental uncertainty flexibility in supply chain has an important role to play for the existence of any supply chain business. A need to be responsive to the constantly changing market scenario and cater to the customer needs, a certain degree of flexibility is required, which requires the coordination of many plants to produce and deliver goods to customers located in different places, and suppliers, which provide each plant with the required components. This paper intends to measure the degree of flexibility required for a two stage supply chain and assessing both the supplier flexibility and the assembler flexibility. In this paper, nine configurations of the SC are considered resulting from the combination of the three degrees of supplier and manufacturer flexibility, i.e. no flexibility, limited flexibility and total flexibility, respectively. Simulation model representing the different flexibility configurations are evaluated and the performance of each configuration analyzed to determine the flexibility configuration suitable to a supply chain. In particular the performance analysis of lead time, work-in-process, service level and cost are measured to determine the suitable flexibility.

  15. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  16. Intrinsic flexibility of porous materials; theory, modelling and the flexibility window of the EMT zeolite framework

    International Nuclear Information System (INIS)

    Fletcher, Rachel E.; Wells, Stephen A.; Leung, Ka Ming; Edwards, Peter P.; Sartbaeva, Asel

    2015-01-01

    Framework materials possess intrinsic flexibility which can be investigated using geometric simulation. We review framework flexibility properties in energy materials and present novel results on the flexibility window of the EMT zeolite framework containing 18-crown-6 ether as a structure directing agent (SDA). Framework materials have structures containing strongly bonded polyhedral groups of atoms connected through their vertices. Typically the energy cost for variations of the inter-polyhedral geometry is much less than the cost of distortions of the polyhedra themselves – as in the case of silicates, where the geometry of the SiO 4 tetrahedral group is much more strongly constrained than the Si—O—Si bridging angle. As a result, framework materials frequently display intrinsic flexibility, and their dynamic and static properties are strongly influenced by low-energy collective motions of the polyhedra. Insight into these motions can be obtained in reciprocal space through the ‘rigid unit mode’ (RUM) model, and in real-space through template-based geometric simulations. We briefly review the framework flexibility phenomena in energy-relevant materials, including ionic conductors, perovskites and zeolites. In particular we examine the ‘flexibility window’ phenomenon in zeolites and present novel results on the flexibility window of the EMT framework, which shed light on the role of structure-directing agents. Our key finding is that the crown ether, despite its steric bulk, does not limit the geometric flexibility of the framework

  17. Cold Rydberg molecules

    Science.gov (United States)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  18. Flexible transparent electrode

    Science.gov (United States)

    Demiryont, Hulya; Shannon, Kenneth C., III; Moorehead, David; Bratcher, Matthew

    2011-06-01

    This paper presents the properties of the EclipseTECTM transparent conductor. EclipseTECTM is a room temperature deposited nanostructured thin film coating system comprised of metal-oxide semiconductor elements. The system possesses metal-like conductivity and glass-like transparency in the visible region. These highly conductive TEC films exhibit high shielding efficiency (35dB at 1 to 100GHz). EclipseTECTM can be deposited on rigid or flexible substrates. For example, EclipseTECTM deposited on polyethylene terephthalate (PET) is extremely flexible that can be rolled around a 9mm diameter cylinder with little or no reduction in electrical conductivity and that can assume pre-extension states after an applied stress is relieved. The TEC is colorless and has been tailored to have high visible transmittance which matches the eye sensitivity curve and allows the viewing of true background colors through the coating. EclipseTECTM is flexible, durable and can be tailored at the interface for applications such as electron- or hole-injecting OLED electrodes as well as electrodes in flexible displays. Tunable work function and optical design flexibility also make EclipseTECTM well-suited as a candidate for grid electrode replacement in next-generation photovoltaic cells.

  19. Flexible magnetoimpedance sensor

    International Nuclear Information System (INIS)

    Li, Bodong; Kavaldzhiev, Mincho N.; Kosel, Jürgen

    2015-01-01

    Flexible magnetoimpedance (MI) sensors fabricated using a NiFe/Cu/NiFe tri-layer on Kapton substrate have been studied. A customized flexible microstrip transmission line was employed to investigate the MI sensors's magnetic field and frequency responses and their dependence on the sensors's deflection. For the first time, the impedance characteristic is obtained through reflection coefficient analysis over a wide range of frequencies from 0.1 MHz to 3 GHz and for deflections ranging from zero curvature to a radius of 7.2 cm. The sensor element maintains a high MI ratio of up to 90% and magnetic sensitivity of up to 9.2%/Oe over different bending curvatures. The relationship between the curvature and material composition is discussed based on the magnetostriction effect and stress simulations. The sensor's large frequency range, simple fabrication process and high sensitivity provide a great potential for flexible electronics and wireless applications. - Highlights: • A flexible magnetoimpedance (MI) sensor is developed. • Studies are carried out using a flexible microstrip transmission line. • An MI ratio of up to 90% is obtained. • The effect of magnetostriction is studied

  20. Education for Flexible Personality

    Directory of Open Access Journals (Sweden)

    Bogomir Novak

    1998-12-01

    Full Text Available Flexible personality transforms both cultural environment and itself. Post-modern personality is both contemplative and active. On one hand, it is subject to inner imagination of a creative act, and on the other hand, to creation of a tangible product What is more, flexible personality is also autonomous, mature, healthy and well balanced, as well as stable and responsive to the demand for change. Due to ever quicker changes, flexible personality is a must. And it is a task. The impact of professional work of adults on the education of children, however, is being conditioned by the exrigid family and rigid enterprises or institutions in which adults are employed. Nevertheless, flexible educational style is not repressive, as it used to be, nor permissive and totally concentrated on the child. It is a choice between the two qualities. The educators' style is dependent on their attitude towards life (play and self-education and not only towards work. Nowadays, flexibility is a way towards quality management of social and personal changes.

  1. Flexible Foam Model.

    Energy Technology Data Exchange (ETDEWEB)

    Neilsen, Michael K.; Lu, Wei-Yang; Werner, Brian T.; Scherzinger, William M.; Lo, Chi S.

    2018-03-01

    Experiments were performed to characterize the mechanical response of a 15 pcf flexible polyurethane foam to large deformation at different strain rates and temperatures. Results from these experiments indicated that at room temperature, flexible polyurethane foams exhibit significant nonlinear elastic deformation and nearly return to their original undeformed shape when unloaded. However, when these foams are cooled to temperatures below their glass transition temperature of approximately -35 o C, they behave like rigid polyurethane foams and exhibit significant permanent deformation when compressed. Thus, a new model which captures this dramatic change in behavior with temperature was developed and implemented into SIERRA with the name Flex_Foam to describe the mechanical response of both flexible and rigid foams to large deformation at a variety of temperatures and strain rates. This report includes a description of recent experiments. Next, development of the Flex Foam model for flexible polyurethane and other flexible foams is described. Selection of material parameters are discussed and finite element simulations with the new Flex Foam model are compared with experimental results to show behavior that can be captured with this new model.

  2. Multiphoton dissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Schulz, P.A.

    1979-10-01

    The dynamics of infrared multiphoton excitation and dissociation of SF 6 was investigated under collision free conditions by a crossed laser-molecular beam method. In order to understand the excitation mechanism and to elucidate the requirements of laser intensity and energy fluence, a series of experiments were carried out to measure the dissociation yield dependences on energy fluence, vibrational temperature of SF 6 , the pulse duration of the CO 2 laser and the frequency in both one and two laser experiments. Translational energy distributions of the SF 5 dissociation product measured by time of flight and angular distributions and the dissociation lifetime of excited SF 6 as inferred from the observation of secondary dissociation of SF 5 into SF 4 and F during the laser pulse suggest that the dynamics of dissociation of excited molecules is dominated by complete energy randomization and rapid intramolecular energy transfer on a nanosecond timescale, and can be adequately described by RRKM theory. An improved phenomenological model including the initial intensity dependent excitation, a rate equation describing the absorption and stimulated emission of single photons, and the unimolecular dissociation of excited molecules is constructed based on available experimental results. The model shows that the energy fluence of the laser determines the excitation of molecules in the quasi-continuum and the excess energy with which molecules dissociate after the laser pulse. The role played by the laser intensity in multiphoton dissociation is more significant than just that of overcoming the intensity dependent absorption in the lowest levels. 63 references

  3. Essential role of cofilin-1 in regulating thrombin-induced RelA/p65 nuclear translocation and intercellular adhesion molecule 1 (ICAM-1) expression in endothelial cells.

    Science.gov (United States)

    Fazal, Fabeha; Bijli, Kaiser M; Minhajuddin, Mohd; Rein, Theo; Finkelstein, Jacob N; Rahman, Arshad

    2009-07-31

    Activation of RhoA/Rho-associated kinase (ROCK) pathway and the associated changes in actin cytoskeleton induced by thrombin are crucial for activation of NF-kappaB and expression of its target gene ICAM-1 in endothelial cells. However, the events acting downstream of RhoA/ROCK to mediate these responses remain unclear. Here, we show a central role of cofilin-1, an actin-binding protein that promotes actin depolymerization, in linking RhoA/ROCK pathway to dynamic alterations in actin cytoskeleton that are necessary for activation of NF-kappaB and thereby expression of ICAM-1 in these cells. Stimulation of human umbilical vein endothelial cells with thrombin resulted in Ser(3) phosphorylation/inactivation of cofilin and formation of actin stress fibers in a ROCK-dependent manner. RNA interference knockdown of cofilin-1 stabilized the actin filaments and inhibited thrombin- and RhoA-induced NF-kappaB activity. Similarly, constitutively inactive mutant of cofilin-1 (Cof1-S3D), known to stabilize the actin cytoskeleton, inhibited NF-kappaB activity by thrombin. Overexpression of wild type cofilin-1 or constitutively active cofilin-1 mutant (Cof1-S3A), known to destabilize the actin cytoskeleton, also impaired thrombin-induced NF-kappaB activity. Additionally, depletion of cofilin-1 was associated with a marked reduction in ICAM-1 expression induced by thrombin. The effect of cofilin-1 depletion on NF-kappaB activity and ICAM-1 expression occurred downstream of IkappaBalpha degradation and was a result of impaired RelA/p65 nuclear translocation and consequently, RelA/p65 binding to DNA. Together, these data show that cofilin-1 occupies a central position in RhoA-actin pathway mediating nuclear translocation of RelA/p65 and expression of ICAM-1 in endothelial cells.

  4. Essential Role of Cofilin-1 in Regulating Thrombin-induced RelA/p65 Nuclear Translocation and Intercellular Adhesion Molecule 1 (ICAM-1) Expression in Endothelial Cells*

    Science.gov (United States)

    Fazal, Fabeha; Bijli, Kaiser M.; Minhajuddin, Mohd; Rein, Theo; Finkelstein, Jacob N.; Rahman, Arshad

    2009-01-01

    Activation of RhoA/Rho-associated kinase (ROCK) pathway and the associated changes in actin cytoskeleton induced by thrombin are crucial for activation of NF-κB and expression of its target gene ICAM-1 in endothelial cells. However, the events acting downstream of RhoA/ROCK to mediate these responses remain unclear. Here, we show a central role of cofilin-1, an actin-binding protein that promotes actin depolymerization, in linking RhoA/ROCK pathway to dynamic alterations in actin cytoskeleton that are necessary for activation of NF-κB and thereby expression of ICAM-1 in these cells. Stimulation of human umbilical vein endothelial cells with thrombin resulted in Ser3 phosphorylation/inactivation of cofilin and formation of actin stress fibers in a ROCK-dependent manner. RNA interference knockdown of cofilin-1 stabilized the actin filaments and inhibited thrombin- and RhoA-induced NF-κB activity. Similarly, constitutively inactive mutant of cofilin-1 (Cof1-S3D), known to stabilize the actin cytoskeleton, inhibited NF-κB activity by thrombin. Overexpression of wild type cofilin-1 or constitutively active cofilin-1 mutant (Cof1-S3A), known to destabilize the actin cytoskeleton, also impaired thrombin-induced NF-κB activity. Additionally, depletion of cofilin-1 was associated with a marked reduction in ICAM-1 expression induced by thrombin. The effect of cofilin-1 depletion on NF-κB activity and ICAM-1 expression occurred downstream of IκBα degradation and was a result of impaired RelA/p65 nuclear translocation and consequently, RelA/p65 binding to DNA. Together, these data show that cofilin-1 occupies a central position in RhoA-actin pathway mediating nuclear translocation of RelA/p65 and expression of ICAM-1 in endothelial cells. PMID:19483084

  5. Role of Spontaneous Brain Activity in Explicit and Implicit Aspects of Cognitive Flexibility under Socially Conflicting Situations: A Resting-state fMRI Study using Fractional Amplitude of Low-frequency Fluctuations.

    Science.gov (United States)

    Fujino, Junya; Tei, Shisei; Jankowski, Kathryn F; Kawada, Ryosaku; Murai, Toshiya; Takahashi, Hidehiko

    2017-12-26

    We are constantly exposed to socially conflicting situations in everyday life, and cognitive flexibility is essential for adaptively coping with such difficulties. Flexible goal choice and pursuit are not exclusively conscious, and therefore cognitive flexibility involves both explicit and implicit forms of processing. However, it is unclear how individual differences in explicit and implicit aspects of flexibility are associated with neural activity in a resting state. Here, we measured intrinsic fractional amplitude of low-frequency fluctuations (fALFF) by resting-state functional magnetic resonance imaging (RS-fMRI) as an indicator of regional brain spontaneous activity, together with explicit and implicit aspects of cognitive flexibility using the Cognitive Flexibility Scale (CFS) and Implicit Association Test (IAT). Consistent with the dual processing theory, there was a strong association between explicit aspects of flexibility (CFS score) and "rationalism" thinking style and between implicit aspects (IAT effect) and "experientialism." The level of explicit flexibility was also correlated with fALFF values in the left lateral prefrontal cortex, whereas the level of implicit flexibility was correlated with fALFF values in the right cerebellum. Furthermore, the fALFF values in both regions predicted individual preference for flexible decision-making strategy in a vignettes simulation task. These results add to our understanding of the neural mechanisms underlying flexible decision-making for solving social conflicts. More generally, our findings highlight the utility of RS-fMRI combined with both explicit and implicit psychometric measures for better understanding individual differences in social cognition. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  6. Natural flexible dermal armor.

    Science.gov (United States)

    Yang, Wen; Chen, Irene H; Gludovatz, Bernd; Zimmermann, Elizabeth A; Ritchie, Robert O; Meyers, Marc A

    2013-01-04

    Fish, reptiles, and mammals can possess flexible dermal armor for protection. Here we seek to find the means by which Nature derives its protection by examining the scales from several fish (Atractosteus spatula, Arapaima gigas, Polypterus senegalus, Morone saxatilis, Cyprinius carpio), and osteoderms from armadillos, alligators, and leatherback turtles. Dermal armor has clearly been developed by convergent evolution in these different species. In general, it has a hierarchical structure with collagen fibers joining more rigid units (scales or osteoderms), thereby increasing flexibility without significantly sacrificing strength, in contrast to rigid monolithic mineral composites. These dermal structures are also multifunctional, with hydrodynamic drag (in fish), coloration for camouflage or intraspecies recognition, temperature and fluid regulation being other important functions. The understanding of such flexible dermal armor is important as it may provide a basis for new synthetic, yet bioinspired, armor materials. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Flexible magnetoimpedance sensor

    KAUST Repository

    Li, Bodong

    2015-03-01

    Flexible magnetoimpedance (MI) sensors fabricated using a NiFe/Cu/NiFe tri-layer on Kapton substrate have been studied. A customized flexible microstrip transmission line was employed to investigate the MI sensors\\'s magnetic field and frequency responses and their dependence on the sensors\\'s deflection. For the first time, the impedance characteristic is obtained through reflection coefficient analysis over a wide range of frequencies from 0.1 MHz to 3 GHz and for deflections ranging from zero curvature to a radius of 7.2 cm. The sensor element maintains a high MI ratio of up to 90% and magnetic sensitivity of up to 9.2%/Oe over different bending curvatures. The relationship between the curvature and material composition is discussed based on the magnetostriction effect and stress simulations. The sensor\\'s large frequency range, simple fabrication process and high sensitivity provide a great potential for flexible electronics and wireless applications.

  8. Vibrationally coupled electron transport through single-molecule junctions

    Energy Technology Data Exchange (ETDEWEB)

    Haertle, Rainer

    2012-04-26

    Single-molecule junctions are among the smallest electric circuits. They consist of a molecule that is bound to a left and a right electrode. With such a molecular nanocontact, the flow of electrical currents through a single molecule can be studied and controlled. Experiments on single-molecule junctions show that a single molecule carries electrical currents that can even be in the microampere regime. Thereby, a number of transport phenomena have been observed, such as, for example, diode- or transistor-like behavior, negative differential resistance and conductance switching. An objective of this field, which is commonly referred to as molecular electronics, is to relate these transport phenomena to the properties of the molecule in the contact. To this end, theoretical model calculations are employed, which facilitate an understanding of the underlying transport processes and mechanisms. Thereby, one has to take into account that molecules are flexible structures, which respond to a change of their charge state by a profound reorganization of their geometrical structure or may even dissociate. It is thus important to understand the interrelation between the vibrational degrees of freedom of a singlemolecule junction and the electrical current flowing through the contact. In this thesis, we investigate vibrational effects in electron transport through singlemolecule junctions. For these studies, we calculate and analyze transport characteristics of both generic and first-principles based model systems of a molecular contact. To this end, we employ a master equation and a nonequilibrium Green's function approach. Both methods are suitable to describe this nonequilibrium transport problem and treat the interactions of the tunneling electrons on the molecular bridge non-perturbatively. This is particularly important with respect to the vibrational degrees of freedom, which may strongly interact with the tunneling electrons. We show in detail that the resulting

  9. Molecule of the Month

    Indian Academy of Sciences (India)

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  10. Molecule of the Month

    Indian Academy of Sciences (India)

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  11. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  12. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  13. Role of Magnetic Exchange Interactions in the Magnetization Relaxation of {3d-4f} Single-Molecule Magnets: A Theoretical Perspective.

    Science.gov (United States)

    Singh, Saurabh Kumar; Beg, Mohammad Faizan; Rajaraman, Gopalan

    2016-01-11

    Combined density functional and ab initio calculations are performed on two isomorphous tetranuclear {Ni3 (III) Ln(III) } star-type complexes [Ln=Gd (1), Dy (2)] to shed light on the mechanism of magnetic exchange in 1 and the origin of the slow magnetization relaxation in complex 2. DFT calculations correctly reproduce the sign and magnitude of the J values compared to the experiments for complex 1. Acute ∢Ni-O-Gd bond angles present in 1 instigate a significant interaction between the 4fxyz orbital of the Gd(III) ion and 3d${{_{x{^{2}}- y{^{2}}}}}$ orbital of the Ni(II) ions, leading to rare and strong antiferromagnetic Ni⋅⋅⋅Gd interactions. Calculations reveal the presence of a strong next-nearest-neighbour Ni⋅⋅⋅Ni antiferromagnetic interaction in complex 1 leading to spin frustration behavior. CASSCF+RASSI-SO calculations performed on complex 2 suggest that the octahedral environment around the Dy(III) ion is neither strong enough to stabilize the mJ |±15/2〉 as the ground state nor able to achieve a large ground-state-first-excited-state gap. The ground-state Kramers doublet for the Dy(III) ion is found to be the mJ |±13/2〉 state with a significant transverse anisotropy, leading to very strong quantum tunneling of magnetization (QTM). Using the POLY_ANISO program, we have extracted the JNiDy interaction as -1.45 cm(-1) . The strong Ni⋅⋅⋅Dy and next-nearest-neighbour Ni⋅⋅⋅Ni interactions are found to quench the QTM to a certain extent, resulting in zero-field SMM behavior for complex 2. The absence of any ac signals at zero field for the structurally similar [Dy(AlMe4 )3 ] highlights the importance of both the Ni⋅⋅⋅Dy and the Ni⋅⋅⋅Ni interactions in the magnetization relaxation of complex 2. To the best of our knowledge, this is the first time that the roles of both the Ni⋅⋅⋅Dy and Ni⋅⋅⋅Ni interactions in magnetization relaxation of a {3d-4f} molecular magnet have been established. © 2016

  14. Software industrial flexible

    OpenAIRE

    Díaz Araya, Daniel; Muñoz, Leandro; Sirerol, Daniel; Oviedo, Sandra; Ibáñez, Francisco S.

    2012-01-01

    En este trabajo se pretende investigar y proponer técnicas, métodos y tecnologías que permitan el desarrollo de software flexible en ambientes industriales. El objetivo es generar métodos y técnicas para facilitar el desarrollo de software flexible en ambientes industriales. Las áreas de investigación son los sistemas de scheduling de producción, la generación de software para plataformas de hardware abiertas y la innovación.

  15. Production Flexibility and Hedging

    Directory of Open Access Journals (Sweden)

    Georges Dionne

    2015-12-01

    Full Text Available We extend the analysis on hedging with price and output uncertainty by endogenizing the output decision. Specifically, we consider the joint determination of output and hedging in the case of flexibility in production. We show that the risk-averse firm always maintains a short position in the futures market when the futures price is actuarially fair. Moreover, in the context of an example, we show that the presence of production flexibility reduces the incentive to hedge for all risk averse agents.

  16. The flexibility of flexicurity

    DEFF Research Database (Denmark)

    Jensen, Carsten Strøby

    2011-01-01

    by a special relation between flexibility, social security and active labour market policy, where a high level of social security is seen as a precondition for a labour market characterized by flexibility. In this article it is argued that the Danish labour market is characterized by having not just one model...... of flexicurity, but two. These two models cover different parts of the labour market and different segments of employees. The first model (the blue-collar flexicurity model) – the one that is often focused on in the literature – covers primarily skilled and unskilled workers on the labour market. The second...

  17. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  18. Bacterial Vaginosis Bacterial and Epithelial Cell Adhesion Molecules

    Directory of Open Access Journals (Sweden)

    Şayeste Demirezen

    2016-05-01

    molecules. The most important adhesion molecules of epithelium are cadherins, fibronectins, Toll like receptors and carbohydrates. In bacteria, pilis, lypopolysaccaharide and biofilm have primary importance. In this review, the adhesion molecules are discussed in detail and their roles in formation of clue cell are clarified.

  19. Molecular Design of Branched and Binary Molecules at Ordered Interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Genson, Kirsten Larson [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    This study examined five different branched molecular architectures to discern the effect of design on the ability of molecules to form ordered structures at interfaces. Photochromic monodendrons formed kinked packing structures at the air-water interface due to the cross-sectional area mismatch created by varying number of alkyl tails and the hydrophilic polar head group. The lower generations formed orthorhombic unit cell with long range ordering despite the alkyl tails tilted to a large degree. Favorable interactions between liquid crystalline terminal groups and the underlying substrate were observed to compel a flexible carbosilane dendrimer core to form a compressed elliptical conformation which packed stagger within lamellae domains with limited short range ordering. A twelve arm binary star polymer was observed to form two dimensional micelles at the air-water interface attributed to the higher polystyrene block composition. Linear rod-coil molecules formed a multitude of packing structures at the air-water interface due to the varying composition. Tree-like rod-coil molecules demonstrated the ability to form one-dimensional structures at the air-water interface and at the air-solvent interface caused by the preferential ordering of the rigid rod cores. The role of molecular architecture and composition was examined and the influence chemically competing fragments was shown to exert on the packing structure. The amphiphilic balance of the different molecular series exhibited control on the ordering behavior at the air-water interface and within bulk structures. The shell nature and tail type was determined to dictate the preferential ordering structure and molecular reorganization at interfaces with the core nature effect secondary.

  20. Flexibility as a service

    NARCIS (Netherlands)

    Aalst, van der W.M.P.; Adams, M.; Hofstede, ter A.H.M.; Pesic, M.; Schonenberg, H.; Chen, L.; Liu, C.; Liu, Q.; Deng, K.

    2009-01-01

    The lack of flexibility is often seen as an inhibitor for the successful application of workflow technology. Many researchers have proposed different ways of addressing this problem and some of these ideas have been implemented in commercial systems. However, a "one size fits all" approach is likely

  1. Valuing Flexibility. Phase 2

    Science.gov (United States)

    2012-10-29

    Quarterly (2): 38-49. Cormier, P., Olewnik, A., and Lewis, K. 2008. An Approach to Quantifying Design Flexibility for Mass Customization in Early...C. Clarkson, P., and Zanker, W. 2004. Change and customisation in complex engineering domains, Res Eng Des 15(1), 1–21. Ekstrom, M. and Bjornsson, H

  2. Flexible Query Answering Systems

    DEFF Research Database (Denmark)

    This book constitutes the refereed proceedings of the 12th International Conference on Flexible Query Answering Systems, FQAS 2017, held in London, UK, in June 2017. The 21 full papers presented in this book together with 4 short papers were carefully reviewed and selected from 43 submissions...

  3. Flexible metal bellows

    CERN Multimedia

    CERN PhotoLab

    1975-01-01

    A set of flexible metal bellows being fatigue-tested by repeated offset motion. Such bellows assemblies were used in the SPS vacuum system at places where , for instance, beam stoppers and collimators had to be moved frequently in and out of the beam path.

  4. Flexible energy systems

    DEFF Research Database (Denmark)

    Lund, Henrik

    2003-01-01

    The paper discusses and analyses diffent national strategies and points out key changes in the energy system in order to achieve a system which can benefit from a high percentage of wind and CHP without having surplus production problems, introduced here as a flexible energy system....

  5. A flexible WLAN receiver

    NARCIS (Netherlands)

    Schiphorst, Roelof; Hoeksema, F.W.; Slump, Cornelis H.

    2003-01-01

    Flexible radio receivers are also called Software Defined Radios (SDRs) [1], [2]. The focus of our SDR project [3] is on designing the front end, from antenna to demodulation in bits, of a °exible, multi-standard WLAN receiver. We try to combine an instance of a (G)FSK receiver (Bluetooth) with an

  6. Toward Generalization of Iterative Small Molecule Synthesis.

    Science.gov (United States)

    Lehmann, Jonathan W; Blair, Daniel J; Burke, Martin D

    2018-02-01

    Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the "building block approach", i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach.

  7. Toward Generalization of Iterative Small Molecule Synthesis

    Science.gov (United States)

    Lehmann, Jonathan W.; Blair, Daniel J.; Burke, Martin D.

    2018-01-01

    Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the “building block approach”, i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach. PMID:29696152

  8. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  9. Flexible Work Styles in the Corporate Research Center.

    Science.gov (United States)

    Baker, Katherine

    2000-01-01

    Explores the appropriateness for flexible work schedules for corporate librarians and provides insight into the benefits of flexible work arrangements in other industries. Highlights include technological changes that have changed roles and made resources available electronically; telecommuters; job sharing; and the effects of flexible…

  10. Thermodynamic and structural study of two-dimensional phase transitions within films of molecules physi-sorbed on graphite; the role of orientational order in wetting and roughening phenomena

    International Nuclear Information System (INIS)

    Angerand, Francois

    1987-01-01

    Two-dimensional phase transitions within films physi-sorbed upon the basal face of graphite have been investigated using two experimental methods: volumetric measurements of adsorption isotherms and neutron diffraction. Our main objective was to study the role played by orientational order in these films, its influence on their thermodynamic and structural properties, and its significance in wetting and roughening phenomena, which are indirectly accessible from adsorption studies. A comparative study of the adsorption isotherms of two molecules having comparable dipole moments, NH 3 and C 2 H 3 F, discloses very dissimilar behaviours, due to the fact that hydrogen bonding is involved in the interaction between NH 3 , but not C 2 H 3 F, molecules. The impossibility of such a bond for the interaction of the adsorbate with the substrate results in a poor cohesion energy of the NH 3 ad-film in comparison with those of its bulk condensed phases. The situation is opposite for the film of C 2 H 3 F which behaves almost as a rare gas film. From multilayer adsorption isotherms of CO it is shown that graphite (0001) is perfectly wet by the plastic (orientationally disordered) crystal phase, β-CO, whereas it is incompletely wet by the low-temperature crystal phase α-CO, in which the molecules are orientationally ordered. The critical temperatures of two-dimensional condensation have been measured for the successive ad-layers, up to the fifth. They seem to converge towards a value of 65 K, which we consider as representing the temperature of the roughening transition of the (0001) face of β-CO. A neutron diffraction study of the monolayers of N 2 O and C(CD 3 ) 4 adsorbed on graphite has been carried out. For N 2 O our results suggest a structure more involved than conjectured. For C(CD 3 ) 4 we have evidence for a triple point at 178 K. The crystal monolayer has a compact hexagonal structure. (author) [fr

  11. In Silico Mechanistic Profiling to Probe Small Molecule Binding to Sulfotransferases

    Science.gov (United States)

    Martiny, Virginie Y.; Carbonell, Pablo; Lagorce, David; Villoutreix, Bruno O.; Moroy, Gautier; Miteva, Maria A.

    2013-01-01

    Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug–drug interactions. We focus on sulfotransferases (SULTs), a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD) simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands’ binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes. PMID:24039991

  12. In silico mechanistic profiling to probe small molecule binding to sulfotransferases.

    Directory of Open Access Journals (Sweden)

    Virginie Y Martiny

    Full Text Available Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug-drug interactions. We focus on sulfotransferases (SULTs, a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands' binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes.

  13. Rosetta Ligand docking with flexible XML protocols.

    Science.gov (United States)

    Lemmon, Gordon; Meiler, Jens

    2012-01-01

    RosettaLigand is premiere software for predicting how a protein and a small molecule interact. Benchmark studies demonstrate that 70% of the top scoring RosettaLigand predicted interfaces are within 2Å RMSD from the crystal structure [1]. The latest release of Rosetta ligand software includes many new features, such as (1) docking of multiple ligands simultaneously, (2) representing ligands as fragments for greater flexibility, (3) redesign of the interface during docking, and (4) an XML script based interface that gives the user full control of the ligand docking protocol.

  14. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  15. Spins of adsorbed molecules investigated by the detection of Kondo resonance

    Science.gov (United States)

    Komeda, Tadahiro

    2014-12-01

    Surface magnetism has been one of the platforms to explore the magnetism in low dimensions. It is also a key component for the development of quantum information processes, which utilizes the spin degree of freedom. The Kondo resonance is a phenomenon that is caused by an interaction between an isolated spin and conduction electrons. First observed in the 1930s as an anomalous increase in the low-temperature resistance of metals embedded with magnetic atoms, the Kondo physics mainly studied the effects of bulk magnetic impurities in the resistivity. In the last 15 years it has undergone a revival by a scanning tunneling microscope (STM) which enables the measurement of the Kondo resonance at surfaces using an atomic scale point contact. The detection of the Kondo resonance can be a powerful tool to explore surface magnetism. In this article, I review recent studies of the surface spin of adsorbed molecules by the detection of the Kondo resonance. Researches on metal phthalocyanine (MPc) and porphyrin molecules will be examined. In addition, the Kondo resonance for double-decker lanthanoide Pc molecules will be discussed. Some of the double-decker Pc molecules show single-molecule magnet (SMM) behavior, which attracts attention as a material for electronic devices. For both classes, the ligand plays a crucial role in determining the parameters of the Kondo resonance, such as the Kondo temperature and the change of the shape from peak to Fano-dip. In addition, the spin in delocalized molecular orbital forms the Kondo resonance, which shows significant differences from the Kondo resonance formed by the metal spins. Since molecular orbital can be tuned in a flexible manner by the design of the molecule, the Kondo resonance formed by delocalized molecular orbital might expand the knowledge of this field.

  16. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  17. Molecules to Materials

    Indian Academy of Sciences (India)

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  18. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  19. Quantum dot molecules

    CERN Document Server

    Wu, Jiang

    2014-01-01

    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  20. Molecule of the Month

    Indian Academy of Sciences (India)

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  1. The influence of flexible branches in flexible polymers

    International Nuclear Information System (INIS)

    Wescott, J.T.

    1998-06-01

    In this work the influence of branches in flexible polymer systems has been investigated by consideration of (1) the behaviour of isolated poly-α-olefin chains and (2) the p -T phase behaviour of poly(4-methylpentene-1)(P4MP1). Molecular dynamics simulations of isolated poly-α-olefins were performed in order to gauge directly the effect of molecular structure on chain dimensions, flexibility (via the persistence length) and shape. Under Θ-conditions the addition of short linear branches was shown to increase the flexibility of the backbone. In conditions of good solvent, however, the effect of longer and bulkier branches was to increase the persistence length and average size of the coil with the arrangement of side chain atoms making a small difference. The side branches themselves also affected the solvent conditions experienced by the backbone, behaving much like bound solvent. Consideration of ethylene-α-olefin copolymers, where the branch content was varied from 0-50%, showed that under good solvent conditions the branches increased the chain stiffness only when the gap between side branches was less than five backbone carbon atoms. The backbone torsions were also shown to play an important role in determining these trends. For comparison with the above simulations, persistence length values for polyethylene (= 7.3±0.2A) and P4MP1 (=7.6±0.3A) were measured experimentally by neutron scattering in dilute solution. A value of 6.7±0.5 for the characteristic ratio of PE was also calculated. To investigate the role of a bulky side group in crystalline phases, wide angle X-ray diffraction experiments using a Hikosaka pressure cell were performed on P4MP1. Computer modelling, utilising the experimental data obtained, determined the structure of a disordered phase produced at room temperature and a new high pressure/high temperature phase. The disordered phase was found to be due to a collapse of the backbone combined with some disordering of the side chains

  2. Ionic Liquid Mediated Dispersion and Support of Functional Molecules on Cellulose Fibers for Stimuli-Responsive Chromic Paper Devices.

    Science.gov (United States)

    Koga, Hirotaka; Nogi, Masaya; Isogai, Akira

    2017-11-22

    Functional molecules play a significant role in the development of high-performance composite materials. Functional molecules should be well dispersed (ideally dissolved) and supported within an easy-to-handle substrate to take full advantage of their functionality and ensure easy handling. However, simultaneously achieving the dissolution and support of functional molecules remains a challenge. Herein, we propose the combination of a nonvolatile ionic liquid and an easy-to-handle cellulose paper substrate for achieving this goal. First, the photochromic molecule, i.e., diarylethene, was dissolved in the ionic liquid 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([bmim]NTf 2 ). Then, diarylethene/[bmim]NTf 2 was supported on cellulose fibers within the paper, through hydrogen bonding between [bmim] cations of the ionic liquid and the abundant hydroxyl groups of cellulose. The as-prepared paper composites exhibited reversible, rapid, uniform, and vivid coloration and bleaching upon ultraviolet and visible light irradiation. The photochromic performance was superior to that of the paper prepared in the absence of [bmim]NTf 2 . This concept could be applied to other functional molecules. For example, lithium perchlorate/[bmim] tetrafluoroborate supported within cellulose paper acted as a flexible electrolyte to provide a paper-based electrochromic device. These findings are expected to further the development of composite materials with high functionality and practicality.

  3. Electric moments in molecule interferometry

    International Nuclear Information System (INIS)

    Eibenberger, Sandra; Gerlich, Stefan; Arndt, Markus; Tuexen, Jens; Mayor, Marcel

    2011-01-01

    We investigate the influence of different electric moments on the shift and dephasing of molecules in a matter wave interferometer. Firstly, we provide a quantitative comparison of two molecules that are non-polar yet polarizable in their thermal ground state and that differ in their stiffness and response to thermal excitations. While C 25 H 20 is rather rigid, its larger derivative C 49 H 16 F 52 is additionally equipped with floppy side chains and vibrationally activated dipole moment variations. Secondly, we elucidate the role of a permanent electric dipole momentby contrasting the quantum interference pattern of a (nearly) non-polar and a polar porphyrin derivative. We find that a high molecular polarizability and even sizeable dipole moment fluctuations are still well compatible with high-contrast quantum interference fringes. The presence of permanent electric dipole moments, however, can lead to a dephasing and rapid degradation of the quantum fringe pattern already at moderate electric fields. This finding is of high relevance for coherence experiments with large organic molecules, which are generally equipped with strong electric moments.

  4. Lumbopelvic flexibility modulates neuromuscular responses during trunk flexion-extension.

    Science.gov (United States)

    Sánchez-Zuriaga, Daniel; Artacho-Pérez, Carla; Biviá-Roig, Gemma

    2016-06-01

    Various stimuli such as the flexibility of lumbopelvic structures influence the neuromuscular responses of the trunk musculature, leading to different load sharing strategies and reflex muscle responses from the afferents of lumbopelvic mechanoreceptors. This link between flexibility and neuromuscular response has been poorly studied. The aim of this study was to investigate the relationship between lumbopelvic flexibility and neuromuscular responses of the erector spinae, hamstring and abdominal muscles during trunk flexion-extension. Lumbopelvic movement patterns were measured in 29 healthy women, who were separated into two groups according to their flexibility during trunk flexion-extension. The electromyographic responses of erector spinae, rectus abdominis and biceps femoris were also recorded. Subjects with greater lumbar flexibility had significantly less pelvic flexibility and vice versa. Subjects with greater pelvic flexibility had a higher rate of relaxation and lower levels of hamstring activation during maximal trunk flexion. The neuromuscular response patterns of the hamstrings seem partially modulated by pelvic flexibility. Not so with the lumbar erector spinae and lumbar flexibility, despite the assertions of some previous studies. The results of this study improve our knowledge of the relationships between trunk joint flexibility and neuromuscular responses, a relationship which may play a role in low back pain. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Diffusion in flexible pipes

    Energy Technology Data Exchange (ETDEWEB)

    Brogaard Kristensen, S.

    2000-06-01

    This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)

  6. Flexible cryogenic conduit

    International Nuclear Information System (INIS)

    Brindza, P.D.; Wines, R.R.; Takacs, J.J.

    1999-01-01

    A flexible and relatively low cost cryogenic conduit is described. The flexible cryogenic conduit of the present invention comprises a first inner corrugated tube with single braided serving, a second outer corrugated tube with single braided serving concentric with the inner corrugated tube, and arranged outwardly about the periphery of the inner corrugated tube and between the inner and outer corrugated tubes: a superinsulation layer; a one half lap layer of polyester ribbon; a one half lap layer of copper ribbon; a spirally wound refrigeration tube; a second one half lap layer of copper ribbon; a second one half lap layer of polyester ribbon; a second superinsulation layer; a third one half lap layer of polyester ribbon; and a spirally wound stretchable and compressible filament

  7. Diffusion in flexible pipes

    Energy Technology Data Exchange (ETDEWEB)

    Brogaard Kristensen, S

    2000-06-01

    This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)

  8. Flexible Laser Metal Cutting

    DEFF Research Database (Denmark)

    Villumsen, Sigurd; Jørgensen, Steffen Nordahl; Kristiansen, Morten

    2014-01-01

    This paper describes a new flexible and fast approach to laser cutting called ROBOCUT. Combined with CAD/CAM technology, laser cutting of metal provides the flexibility to perform one-of-a-kind cutting and hereby realises mass production of customised products. Today’s laser cutting techniques...... possess, despite their wide use in industry, limitations regarding speed and geometry. Research trends point towards remote laser cutting techniques which can improve speed and geometrical freedom and hereby the competitiveness of laser cutting compared to fixed-tool-based cutting technology...... such as punching. This paper presents the concepts and preliminary test results of the ROBOCUT laser cutting technology, a technology which potentially can revolutionise laser cutting....

  9. Flexible training under threat.

    Science.gov (United States)

    Houghton, Anita; Eaton, Jennifer

    2002-10-01

    As the number of women in medicine and the general demand for a better work-life balance rises, flexible training is an increasingly important mechanism for maintaining the medical workforce. The new pay deal, together with entrenched cultural attitudes, are potential threats. Ways forward include more substantive part-time posts, more part-time opportunities at consultant level, and using positive experiences as a way of tackling attitudes in the less accepting specialties.

  10. Flexible weapons architecture design

    OpenAIRE

    Pyant, William C.

    2015-01-01

    Present day air-delivered weapons are of a closed architecture, with little to no ability to tailor the weapon for the individual engagement. The closed architectures require weaponeers to make the target fit the weapon instead of fitting the individual weapons to a target. The concept of a flexible weapons aims to modularize weapons design using an open architecture shell into which different modules are inserted to achieve the desired target fractional damage while reducing cost and civilia...

  11. Industrial Fuel Flexibility Workshop

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2006-09-01

    On September 28, 2006, in Washington, DC, ITP and Booz Allen Hamilton conducted a fuel flexibility workshop with attendance from various stakeholder groups. Workshop participants included representatives from the petrochemical, refining, food and beverage, steel and metals, pulp and paper, cement and glass manufacturing industries; as well as representatives from industrial boiler manufacturers, technology providers, energy and waste service providers, the federal government and national laboratories, and developers and financiers.

  12. Flexible Land Administration

    DEFF Research Database (Denmark)

    Enemark, Stig

    2014-01-01

    Security of tenure is widely considered to be the missing piece of the puzzle when it comes to eradication of poverty. And, as explained in the previous issue of Geoinformatics, the European Union is now placing land rights at the heart of EU development policy. This article presents a way forwar...... in terms of building flexible and "fit-for-purpose" land administration systems in developing countries. This will ensure security of tenure for all and sustainable management of the use of land....

  13. Doing Identity Work: Fuzzy Boundaries and Flexibility in Further Education.

    Science.gov (United States)

    Harrison, Roger; Clarke, Julia; Reeve, Fiona; Edwards, Richard

    2003-01-01

    Case studies of three further education teachers illustrate different identity positions and discourses. What emerges is a complex image of teachers exploiting blurred role boundaries in the flexible workplace. (Contains 27 references.) (SK)

  14. PTFE films with improved flexibility

    Science.gov (United States)

    Muraca, R. F.; Koch, A. A.

    1972-01-01

    Development and application of flexible polytetrafluroethylene films for expulsion bladders in spacecraft propellant tanks are described. Flexibility of material is obtained by reducing crystallinity through annealing and quenching in water. Physical and mechanical properties of material are presented.

  15. Enzyme hydration, activity and flexibility : A neutron scattering approach

    International Nuclear Information System (INIS)

    Kurkal-Siebert, V.; Finney, J.L.; Daniel, R.M.; Smith, Jeremy C.

    2006-01-01

    Recent measurements have demonstrated enzyme activity at hydrations as low as 3%. The question of whether the hydration-induced enzyme flexibility is important for activity is addressed by performing picosecond dynamic neutron scattering experiments on pig liver esterase powders at various temperatures as well as solutions. At all temperatures and hydrations investigated here, significant quasielastic scattering intensity is found in the protein, indicating the presence of anharmonic, diffusive motion. As the hydration increases a temperature-dependent dynamical transition appears and strengthens involving additional diffusive motion. At low temperature, increasing hydration resulted in lower flexibility of the enzyme. At higher temperatures, systems containing sufficient number of water molecules interacting with the protein exhibit increased flexibility. The implication of these results is that, although the additional hydration-induced diffusive motion and flexibility at high temperatures in the enzyme detected here may be related to increased activity, they are not required for the enzyme to function

  16. Intersystem crossing in complex molecules

    International Nuclear Information System (INIS)

    Pappalardo, R.G.

    1980-01-01

    The general question of singlet-triplet intersystem crossing is addressed in the context of large organic molecules, i.e., ''complex'' molecules capable of self-relaxation in the absence of collisions. Examples of spectral properties of such molecules in the vapor phase are discussed, relying on extensive Russian literature in this area. Formal expressions for the relaxation rate in the electronic excited states are derived on the basis of the formalism of collision theory, and are applied to the specific case of intersystem crossing. The derivation of the ''energy-gap'' law for triplet-singlet conversion in aromatic hydrocarbons is briefly outlined. The steep rise of internal conversion rates as a function of excess excitation energy, and its competition with the intersystem crossing process, are reviewed for the case of naphthalene vapor. A general expression for the spin-orbit interaction Hamiltonian in molecular systems is outlined. Experimental observations on singlet-triplet conversion rates and the factors that can drastically affect such rates are discussed, with emphasis on the ''in- ternal'' and ''external'' heavy-atom effects. Basic relations of ESR spectroscopy and magnetophotoselection are reviewed. Technological implications of the singlet-triplet crossing in complex molecules are discussed in the context of chelate lasers, dye lasers and luminescent displays. Effects related to singlet-triplet crossing, and generally to excited-state energy-transfer in biological systems, are exemplified by the role of aromatic amino-acids in the phosphorescence of proteins, by some recent studies of energy-transfer in models of biomembranes, and by the clustering of triplet-energy donor-acceptor pairs in micelles

  17. Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Giulia Menconi

    2015-04-01

    Full Text Available In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TAn repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TAn repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in

  18. Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

    Science.gov (United States)

    Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

    2015-04-01

    In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a

  19. Flexible automated manufacturing for SMEs

    DEFF Research Database (Denmark)

    Grube Hansen, David; Bilberg, Arne; Madsen, Erik Skov

    2017-01-01

    SMEs are in general highly flexible and agile in order to accommodate the customer demands in the paradigm of High Mix-Low Volume manufacturing. The flexibility and agility have mainly been enabled by manual labor, but as we are entering the technology and data driven fourth industrial revolution......, where augmented operators and machines work in cooperation in a highly flexible and productive manufacturing system both an opportunity and a need has raised for developing highly flexible and efficient automation....

  20. Augmented-plane-wave calculations on small molecules

    International Nuclear Information System (INIS)

    Serena, P.A.; Baratoff, A.; Soler, J.M.

    1993-01-01

    We have performed ab initio calculations on a wide range of small molecules, demonstrating the accuracy and flexibility of an alternative method for calculating the electronic structure of molecules, solids, and surfaces. It is based on the local-density approximation (LDA) for exchange and correlation and the nonlinear augmented-plane-wave method. Very accurate atomic forces are obtained directly. This allows for implementation of Car-Parrinello-like techniques to determine simultaneously the self-consistent electron wave functions and the equilibrium atomic positions within an iterative scheme. We find excellent agreement with the best existing LDA-based calculations and remarkable agreement with experiment for the equilibrium geometries, vibrational frequencies, and dipole moments of a wide variety of molecules, including strongly bound homopolar and polar molecules, hydrogen-bound and electron-deficient molecules, and weakly bound alkali and noble-metal dimers, although binding energies are overestimated

  1. Global Analysis of Flexible Risers

    DEFF Research Database (Denmark)

    Banke, Lars

    1996-01-01

    Flexible pipes are often a technically attractive alternative to the traditional steel pipe. Often commercial utilisation of oil/gas fields depends on the use of flexible pipes. An example is when floating production vessels are used, where the flexible pipe follows the wave induced motions...

  2. MOLECULES IN η CARINAE

    International Nuclear Information System (INIS)

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.

    2012-01-01

    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  3. Small molecule probes for cellular death machines.

    Science.gov (United States)

    Li, Ying; Qian, Lihui; Yuan, Junying

    2017-08-01

    The past decade has witnessed a significant expansion of our understanding about the regulated cell death mechanisms beyond apoptosis. The application of chemical biological approaches had played a major role in driving these exciting discoveries. The discovery and use of small molecule probes in cell death research has not only revealed significant insights into the regulatory mechanism of cell death but also provided new drug targets and lead drug candidates for developing therapeutics of human diseases with huge unmet need. Here, we provide an overview of small molecule modulators for necroptosis and ferroptosis, two non-apoptotic cell death mechanisms, and discuss the molecular pathways and relevant pathophysiological mechanisms revealed by the judicial applications of such small molecule probes. We suggest that the development and applications of small molecule probes for non-apoptotic cell death mechanisms provide an outstanding example showcasing the power of chemical biology in exploring novel biological mechanisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Electron Accumulative Molecules.

    Science.gov (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  5. Flexible Query Answering Systems

    DEFF Research Database (Denmark)

    This book constitutes the refereed proceedings of the 10th International Conference on Flexible Query Answering Systems, FQAS 2013, held in Granada, Spain, in September 2013. The 59 full papers included in this volume were carefully reviewed and selected from numerous submissions. The papers...... are organized in a general session train and a parallel special session track. The general session train covers the following topics: querying-answering systems; semantic technology; patterns and classification; personalization and recommender systems; searching and ranking; and Web and human...

  6. Flexibility and Control : An empirical study relating production flexibility to the design of performance management systems

    NARCIS (Netherlands)

    Van Veen-Dirks, P.M.G.

    2002-01-01

    A critical challenge facing organizations is the design of management control systems, which play a key role in evaluating the achievement of organizational and individual objectives. This thesis addresses the design of management control (performance management) systems in the current flexible

  7. Sustainable development of the wind power industry in a complex environment: a flexibility study

    International Nuclear Information System (INIS)

    Zhao, Zhen-Yu; Zhu, Jiang; Zuo, Jian

    2014-01-01

    As a new and developing green energy business in emerging economies such as China, the wind power industry chain faces some complex issues that are further compounded by turbulent internal and external environments. To deal with the complex environment, the wind power industry needs to improve its level of flexibility so that it can become more adaptable to the changing environment. Hence it is important to explore the dynamics of the wind power industry chain flexibility with respect to the ever changing environment. This study uses questionnaire surveys and expert interviews to identify the influential flexibility components of the wind power industry chain. Subsequently a fuzzy cognitive mapping (FCM) methodology was used to establish a flexibility operating mechanism model. The research found that special attention should be paid to competition flexibility, technology flexibility, and intellectual property and talent flexibility. Policies play a pivotal role in regulating the driving effects of these components of flexibility with the aim being long term sustainability of a healthy level of overall flexibility of the wind power industry chain. This should in turn facilitate the sustainable development of the industry. - Highlights: • Wind power industry shall improve flexibility to deal with complex environment. • Critical components of flexibility of wind power industry chain were identified. • An operating mechanism model for flexibility of wind power industry is proposed. • Fuzzy cognitive mapping method is employed to model the dynamics of flexibility. • Policies play a pivotal role in fostering an industry environment toward flexibility

  8. An overview of carbon materials for flexible electrochemical capacitors.

    Science.gov (United States)

    He, Yongmin; Chen, Wanjun; Gao, Caitian; Zhou, Jinyuan; Li, Xiaodong; Xie, Erqing

    2013-10-07

    Under the background of the quick development of lightweight, flexible, and wearable electronic devices in our society, a flexible and highly efficient energy management strategy is needed for their counterpart energy-storage systems. Among them, flexible electrochemical capacitors (ECs) have been considered as one of the most promising candidates because of their significant advantages in power and energy densities, and unique properties of being flexible, lightweight, low-cost, and environmentally friendly compared with current energy storage devices. In a common EC, carbon materials play an irreplaceable and principal role in its energy-storage performance. Up till now, most progress towards flexible ECs technologies has mostly benefited from the continuous development of carbon materials. As a result, in view of the dual remarkable highlights of ECs and carbon materials, a summary of recent research progress on carbon-based flexible EC electrode materials is presented in this review, including carbon fiber (CF, consisting of carbon microfiber-CMF and carbon nanofiber-CNF) networks, carbon nanotube (CNT) and graphene coatings, CNT and/or graphene papers (or films), and freestanding three-dimensional (3D) flexible carbon-based macroscopic architectures. Furthermore, some promising carbon materials for great potential applications in flexible ECs are introduced. Finally, the trends and challenges in the development of carbon-based electrode materials for flexible ECs and their smart applications are analyzed.

  9. Movable MEMS Devices on Flexible Silicon

    KAUST Repository

    Ahmed, Sally

    2013-05-05

    Flexible electronics have gained great attention recently. Applications such as flexible displays, artificial skin and health monitoring devices are a few examples of this technology. Looking closely at the components of these devices, although MEMS actuators and sensors can play critical role to extend the application areas of flexible electronics, fabricating movable MEMS devices on flexible substrates is highly challenging. Therefore, this thesis reports a process for fabricating free standing and movable MEMS devices on flexible silicon substrates; MEMS flexure thermal actuators have been fabricated to illustrate the viability of the process. Flexure thermal actuators consist of two arms: a thin hot arm and a wide cold arm separated by a small air gap; the arms are anchored to the substrate from one end and connected to each other from the other end. The actuator design has been modified by adding etch holes in the anchors to suit the process of releasing a thin layer of silicon from the bulk silicon substrate. Selecting materials that are compatible with the release process was challenging. Moreover, difficulties were faced in the fabrication process development; for example, the structural layer of the devices was partially etched during silicon release although it was protected by aluminum oxide which is not attacked by the releasing gas . Furthermore, the thin arm of the thermal actuator was thinned during the fabrication process but optimizing the patterning and etching steps of the structural layer successfully solved this problem. Simulation was carried out to compare the performance of the original and the modified designs for the thermal actuators and to study stress and temperature distribution across a device. A fabricated thermal actuator with a 250 μm long hot arm and a 225 μm long cold arm separated by a 3 μm gap produced a deflection of 3 μm before silicon release, however, the fabrication process must be optimized to obtain fully functioning

  10. Stochastic Dynamics Underlying Cognitive Stability and Flexibility.

    Directory of Open Access Journals (Sweden)

    Kai Ueltzhöffer

    2015-06-01

    Full Text Available Cognitive stability and flexibility are core functions in the successful pursuit of behavioral goals. While there is evidence for a common frontoparietal network underlying both functions and for a key role of dopamine in the modulation of flexible versus stable behavior, the exact neurocomputational mechanisms underlying those executive functions and their adaptation to environmental demands are still unclear. In this work we study the neurocomputational mechanisms underlying cue based task switching (flexibility and distractor inhibition (stability in a paradigm specifically designed to probe both functions. We develop a physiologically plausible, explicit model of neural networks that maintain the currently active task rule in working memory and implement the decision process. We simplify the four-choice decision network to a nonlinear drift-diffusion process that we canonically derive from a generic winner-take-all network model. By fitting our model to the behavioral data of individual subjects, we can reproduce their full behavior in terms of decisions and reaction time distributions in baseline as well as distractor inhibition and switch conditions. Furthermore, we predict the individual hemodynamic response timecourse of the rule-representing network and localize it to a frontoparietal network including the inferior frontal junction area and the intraparietal sulcus, using functional magnetic resonance imaging. This refines the understanding of task-switch-related frontoparietal brain activity as reflecting attractor-like working memory representations of task rules. Finally, we estimate the subject-specific stability of the rule-representing attractor states in terms of the minimal action associated with a transition between different rule states in the phase-space of the fitted models. This stability measure correlates with switching-specific thalamocorticostriatal activation, i.e., with a system associated with flexible working memory

  11. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  12. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  13. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  14. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  15. OMG: Open molecule generator

    NARCIS (Netherlands)

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.

    2012-01-01

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  16. Molecule-based magnets

    Indian Academy of Sciences (India)

    Administrator

    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  17. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  18. Asymmetric Flexible Supercapacitor Stack

    Directory of Open Access Journals (Sweden)

    Leela Mohana Reddy A

    2008-01-01

    Full Text Available AbstractElectrical double layer supercapacitor is very significant in the field of electrical energy storage which can be the solution for the current revolution in the electronic devices like mobile phones, camera flashes which needs flexible and miniaturized energy storage device with all non-aqueous components. The multiwalled carbon nanotubes (MWNTs have been synthesized by catalytic chemical vapor deposition technique over hydrogen decrepitated Mischmetal (Mm based AB3alloy hydride. The polymer dispersed MWNTs have been obtained by insitu polymerization and the metal oxide/MWNTs were synthesized by sol-gel method. Morphological characterizations of polymer dispersed MWNTs have been carried out using scanning electron microscopy (SEM, transmission electron microscopy (TEM and HRTEM. An assymetric double supercapacitor stack has been fabricated using polymer/MWNTs and metal oxide/MWNTs coated over flexible carbon fabric as electrodes and nafion®membrane as a solid electrolyte. Electrochemical performance of the supercapacitor stack has been investigated using cyclic voltammetry, galvanostatic charge-discharge, and electrochemical impedance spectroscopy.

  19. Exotic helium molecules

    International Nuclear Information System (INIS)

    Portier, M.

    2007-12-01

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  20. OMG: Open Molecule Generator.

    Science.gov (United States)

    Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas

    2012-09-17

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  1. OMG: Open Molecule Generator

    Directory of Open Access Journals (Sweden)

    Peironcely Julio E

    2012-09-01

    Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  2. Graphene-Tapered ZnO Nanorods Array as a Flexible Antireflection Layer

    Directory of Open Access Journals (Sweden)

    Taeseup Song

    2015-01-01

    Full Text Available Flexible solar cells have drawn a great deal of attention due to their various advantages including deformable and wearable characteristics. In the solar cells, the antireflection layer plays an important role in the improvement in the conversion efficiency by increasing the light transmission and suppressing the Fresnel refraction. For the successful implantation of the antireflection layer into the flexible solar cells, the flexible mechanical property of the antireflection layer is also necessary. However, the study on flexible antireflection layer for the flexible solar cells or optoelectronics is still lacking. In this study, we report the graphene-tapered ZnO nanorods array as a flexible antireflection layer for the application in flexible solar cells. Flexible two-dimensional graphene sheet and the tapered morphology of ZnO nanorods enable conformal coverage on the flexible substrate with curved surface and significant improvements in antireflection properties, respectively.

  3. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  4. Kidney injury molecule-1 in renal disease

    NARCIS (Netherlands)

    Waanders, Femke; van Timmeren, Mirjan M.; Stegeman, Coen A.; Bakker, Stephan J. L.; van Goor, Harry

    Kidney injury molecule-1 (KIM-1) is a marker for renal proximal tubular damage, the hallmark of virtually all proteinuric, toxic and ischaemic kidney diseases. KIM-1 has gained increasing interest because of its possible pathophysiological role in modulating tubular damage and repair. In this

  5. 'Women’s work penalty' in the access to flexible working arrangements across Europe

    OpenAIRE

    Chung, Heejung

    2018-01-01

    Do women and workers in female dominated workplaces have better access to flexible working arrangements? Given women’s roles in caregiving and due to the ‘flexibility stigma’ that may come with the use of flexible working arrangements, women and workers in female-dominated workplaces are expected to have greater access. However, flexible working arrangements are also used for performance enhancing purposes, hence, following the gendered rewards/organisation literature, men and workers in male...

  6. On flexible and rigid nouns

    DEFF Research Database (Denmark)

    Rijkhoff, Jan

    2010-01-01

    classes. Finally this article wants to claim that the distinction between rigid and flexible noun categories (a) adds a new dimension to current classifications of parts of speech systems, (b) correlates with certain grammatical phenomena (e.g. so-called number discord), and (c) helps to explain the parts......This article argues that in addition to the major flexible lexical categories in Hengeveld’s classification of parts of speech systems (Contentive, Non-Verb, Modifier), there are also flexible word classes within the rigid lexical category Noun (Set Noun, Sort Noun, General Noun). Members...... by the flexible item in the external world. I will then argue that flexible word classes constitute a proper category (i.e. they are not the result of a merger of some rigid word classes) in that members of flexible word categories display the same properties regarding category membership as members of rigid word...

  7. On flexible and rigid nouns

    DEFF Research Database (Denmark)

    Rijkhoff, Jan

    2008-01-01

    Studies in Language 32-3 (2008), 727-752. Special issue: Parts of Speech: Descriptive tools, theoretical constructs Jan Rijkhoff - On flexible and rigid nouns This article argues that in addition to the flexible lexical categories in Hengeveld’s classification of parts-of-speech systems (Contentive......, Non-Verb, Modifier), there are also flexible word classes within the rigid lexical category Noun (Set Noun, Sort Noun, General Noun). Members of flexible word classes are characterized by their vague semantics, which in the case of nouns means that values for the semantic features Shape...... and Homogeneity are either left undetermined or they are specified in such a way that they do not quite match the properties of the kind of entity denoted by the flexible item in the external world. I will then argue that flexible word classes constitute a proper category (i.e. they are not the result of a merger...

  8. Towards Flexible Transparent Electrodes Based on Carbon and Metallic Materials

    Directory of Open Access Journals (Sweden)

    Minghui Luo

    2017-01-01

    Full Text Available Flexible transparent electrodes (FTEs with high stability and scalability are in high demand for the extremely widespread applications in flexible optoelectronic devices. Traditionally, thin films of indium thin oxide (ITO served the role of FTEs, but film brittleness and scarcity of materials limit its further application. This review provides a summary of recent advances in emerging transparent electrodes and related flexible devices (e.g., touch panels, organic light-emitting diodes, sensors, supercapacitors, and solar cells. Mainly focusing on the FTEs based on carbon nanomaterials (e.g., carbon nanotubes and graphene and metal materials (e.g., metal grid and metal nanowires, we discuss the fabrication techniques, the performance improvement, and the representative applications of these highly transparent and flexible electrodes. Finally, the challenges and prospects of flexible transparent electrodes will be summarized.

  9. Flexible Language Interoperability

    DEFF Research Database (Denmark)

    Ekman, Torbjörn; Mechlenborg, Peter; Schultz, Ulrik Pagh

    2007-01-01

    Virtual machines raise the abstraction level of the execution environment at the cost of restricting the set of supported languages. Moreover, the ability of a language implementation to integrate with other languages hosted on the same virtual machine typically constrains the features...... of the language. In this paper, we present a highly flexible yet efficient approach to hosting multiple programming languages on an object-oriented virtual machine. Our approach is based on extending the interface of each class with language-specific wrapper methods, offering each language a tailored view...... of a given class. This approach can be deployed both on a statically typed virtual machine, such as the JVM, and on a dynamic virtual machine, such as a Smalltalk virtual machine. We have implemented our approach to language interoperability on top of a prototype virtual machine for embedded systems based...

  10. Flexible helical yarn swimmers.

    Science.gov (United States)

    Zakharov, A P; Leshansky, A M; Pismen, L M

    2016-09-01

    We investigate the motion of a flexible Stokesian flagellar swimmer realised as a yarn made of two intertwined elastomer fibres, one active, that can reversibly change its length in response to a local excitation causing transition to the nematic state or swelling, and the other one, a passive isotropic elastomer with identical mechanical properties. A propagating chemical wave may provide an excitation mechanism ensuring a constant length of the excited region. Generally, the swimmer moves along a helical trajectory, and the propagation and rotation velocity are very sensitive to the ratio of the excited region to the pitch of the yarn, as well as to the size of a carried load. External excitation by a moving actuating beam is less effective, unless the direction of the beam is adjusted to rotation of the swimmer.

  11. Flexible weapons architecture design

    Science.gov (United States)

    Pyant, William C., III

    Present day air-delivered weapons are of a closed architecture, with little to no ability to tailor the weapon for the individual engagement. The closed architectures require weaponeers to make the target fit the weapon instead of fitting the individual weapons to a target. The concept of a flexible weapons aims to modularize weapons design using an open architecture shell into which different modules are inserted to achieve the desired target fractional damage while reducing cost and civilian casualties. This thesis shows that the architecture design factors of damage mechanism, fusing, weapons weight, guidance, and propulsion are significant in enhancing weapon performance objectives, and would benefit from modularization. Additionally, this thesis constructs an algorithm that can be used to design a weapon set for a particular target class based on these modular components.

  12. Bitter and sweet tasting molecules: It's complicated.

    Science.gov (United States)

    Di Pizio, Antonella; Ben Shoshan-Galeczki, Yaron; Hayes, John E; Niv, Masha Y

    2018-04-19

    "Bitter" and "sweet" are frequently framed in opposition, both functionally and metaphorically, in regard to affective responses, emotion, and nutrition. This oppositional relationship is complicated by the fact that some molecules are simultaneously bitter and sweet. In some cases, a small chemical modification, or a chirality switch, flips the taste from sweet to bitter. Molecules humans describe as bitter are recognized by a 25-member subfamily of class A G-protein coupled receptors (GPCRs) known as TAS2Rs. Molecules humans describe as sweet are recognized by a TAS1R2/TAS1R3 heterodimer of class C GPCRs. Here we characterize the chemical space of bitter and sweet molecules: the majority of bitter compounds show higher hydrophobicity compared to sweet compounds, while sweet molecules have a wider range of sizes. Importantly, recent evidence indicates that TAS1Rs and TAS2Rs are not limited to the oral cavity; moreover, some bitterants are pharmacologically promiscuous, with the hERG potassium channel, cytochrome P450 enzymes, and carbonic anhydrases as common off-targets. Further focus on polypharmacology may unravel new physiological roles for tastant molecules. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  14. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  15. Photonic Molecule Lasers Revisited

    Science.gov (United States)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  16. Interstellar molecules and masers

    International Nuclear Information System (INIS)

    Nguyen-Q-Rieu; Guibert, J.

    1978-01-01

    The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr

  17. Anti-cancer Lead Molecule

    KAUST Repository

    Sagar, Sunil

    2014-04-17

    Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

  18. Anti-cancer Lead Molecule

    KAUST Repository

    Sagar, Sunil; Kaur, Mandeep; Esau, Luke E.

    2014-01-01

    Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

  19. Single-molecule conductance of redox molecules in electrochemical scanning tunneling microscopy

    DEFF Research Database (Denmark)

    Haiss, W.; Albrecht, Tim; van Zalinge, H.

    2007-01-01

    of a maximum in the I-tunneling versus electrode potential relationship can be fitted by a "soft" gating concept. This arises from large configurational fluctuations of the molecular bridge linked to the gold contacts by flexible chains. This view is incorporated in a formalism that is well-suited for data...... analysis and reproduces in all important respects the 6V6 data for physically sound values of the appropriate parameters. This study demonstrates that fluctuations of isolated configurationally "soft" molecules can dominate charge transport patterns and that theoretical frameworks for compact monolayers...

  20. FlavorDB: a database of flavor molecules

    OpenAIRE

    Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; NK, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet

    2017-01-01

    Abstract Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and ...

  1. Dissociation of Vertical Semiconductor Diatomic Artificial Molecules

    International Nuclear Information System (INIS)

    Pi, M.; Emperador, A.; Barranco, M.; Garcias, F.; Muraki, K.; Tarucha, S.; Austing, D. G.

    2001-01-01

    We investigate the dissociation of few-electron circular vertical semiconductor double quantum dot artificial molecules at 0T as a function of interdot distance. A slight mismatch introduced in the fabrication of the artificial molecules from nominally identical constituent quantum wells induces localization by offsetting the energy levels in the quantum dots by up to 2meV, and this plays a crucial role in the appearance of the addition energy spectra as a function of coupling strength particularly in the weak coupling limit

  2. Trunk Flexibility Improvement in Response to Powered Assisted Exercise

    Directory of Open Access Journals (Sweden)

    B.S. Bains

    2016-07-01

    Full Text Available Background study: Flexibility in human spine has always plays an important role in dexterity and seamless ambulatory activities. When optimum range is not maintained by the trunk column, due to lack of flexibility, the posture gets affected resulting in reduce trunk rotation flexibility and mobility hence loss of complete trunk rotation. Objective: The purpose of this study is to determine the effect of Shapemaster Power Assisted Exercise Equipment (SPAEE on trunk flexibility. Methodology: Twenty healthy individual ages between 40 to 60 years were randomly divided into control and exercise groups. Shapemaster exercise program performed two times per week for 5 weeks and 45 minutes per session. Before and after 10 sessions of Shapemaster exercise protocol, Seated trunk rotation test was used to measure trunk flexibility. Results: Repeated measurement ANOVA were used to analysis data between groups. The results of this study illustrated that after 10th sessions trunk flexibility significantly improved (F (1.0, 18 = 11.732, p < 0.003. Conclusion: In conclusion results were determined that SPAEE is safe and it did effectively enhance flexibility among individual healthy adults. Keyword: Shapemaster Power Assisted Exercise Equipment (SPAEE, Trunk Flexibility, Healthy individual

  3. Towards automated visual flexible endoscope navigation.

    Science.gov (United States)

    van der Stap, Nanda; van der Heijden, Ferdinand; Broeders, Ivo A M J

    2013-10-01

    The design of flexible endoscopes has not changed significantly in the past 50 years. A trend is observed towards a wider application of flexible endoscopes with an increasing role in complex intraluminal therapeutic procedures. The nonintuitive and nonergonomical steering mechanism now forms a barrier in the extension of flexible endoscope applications. Automating the navigation of endoscopes could be a solution for this problem. This paper summarizes the current state of the art in image-based navigation algorithms. The objectives are to find the most promising navigation system(s) to date and to indicate fields for further research. A systematic literature search was performed using three general search terms in two medical-technological literature databases. Papers were included according to the inclusion criteria. A total of 135 papers were analyzed. Ultimately, 26 were included. Navigation often is based on visual information, which means steering the endoscope using the images that the endoscope produces. Two main techniques are described: lumen centralization and visual odometry. Although the research results are promising, no successful, commercially available automated flexible endoscopy system exists to date. Automated systems that employ conventional flexible endoscopes show the most promising prospects in terms of cost and applicability. To produce such a system, the research focus should lie on finding low-cost mechatronics and technologically robust steering algorithms. Additional functionality and increased efficiency can be obtained through software development. The first priority is to find real-time, robust steering algorithms. These algorithms need to handle bubbles, motion blur, and other image artifacts without disrupting the steering process.

  4. Adsorption of metalorganic molecules on metal-semiconductor systems

    Energy Technology Data Exchange (ETDEWEB)

    Brand, Christian; Schmeidel, Jedrzej; Chen, Wei; Tegenkamp, Christoph; Pfnuer, Herbert [Institut fuer Festkoerperphysik, Leibniz Universitaet Hannover (Germany)

    2011-07-01

    The controlled implementation of single molecules in appropriate contact assemblies is the ultimate realization of an ultra-small device structure. Besides extremely high integration densities the functionalities of the devices are adjustable by chemical synthesis. However, the interaction of the molecule with its environment is decisive. The adsorption of ferrocene-1,1'-dithiol (FDT) on Ag-{radical}(3) reconstructions on nominally flat and vicinal Si(111) substrates has been studied. The FDT was chosen because of its large conductance and high structural flexibility with respect to rotation of the two cyclopentadienyl (Cp) rings. The reconstruction is a prototype of a highly conductive low dimensional electron gas on a technologically relevant substrate. The adsorption of intact molecules takes place predominantly at defect sites, e.g. vacancy and step structures. Submolecular resolution showing the Cp-ring structure was obtained at perfect terrace sites. Due to chemisorption of the S-atoms at hollow sites the molecule axis is oriented parallel to the substrate. The initial rotational flexibility is frozen and only tow different rotated configurations were found. The adsorption geometry is confirmed by VASP calculations. Recently, Ag reconstructions on Si(557) substrates have been used. The effect of the uniaxial step configuration towards the adsorption of the FDT molecules is discussed.

  5. Special Issue: Flexible Work Arrangements.

    Science.gov (United States)

    Olmstead, Barney, Ed.

    1996-01-01

    Section 1 contains five chapters on flexible work arrangements, self-employment, working from home, part-time professionals, job sharing, and temporary employment. Section 2 includes reviews of four books on working flexibly, concluding with a list of 23 additional readings. (SK)

  6. Measuring and Comparing Energy Flexibilities

    DEFF Research Database (Denmark)

    Valsomatzis, Emmanouil; Hose, Katja; Pedersen, Torben Bach

    2015-01-01

    induced by time and amount individually, and by their com- bination. To this end, we introduce several flexibility measures that take into account the combined effect of time and energy on flex-offer flexibility and discuss their respective pros and cons through a number of realistic examples....

  7. Sensor Technologies on Flexible Substrates

    Science.gov (United States)

    Koehne, Jessica

    2016-01-01

    NASA Ames has developed sensor technologies on flexible substrates integrated into textiles for personalized environment monitoring and human performance evaluation. Current technologies include chemical sensing for gas leak and event monitoring and biological sensors for human health and performance monitoring. Targeted integration include next generation EVA suits and flexible habitats.

  8. Functional aspects of protein flexibility

    DEFF Research Database (Denmark)

    Teilum, Kaare; Olsen, Johan G; Kragelund, Birthe B

    2009-01-01

    this into an intuitive perception of protein function is challenging. Flexibility is of overwhelming importance for protein function, and the changes in protein structure during interactions with binding partners can be dramatic. The present review addresses protein flexibility, focusing on protein-ligand interactions...

  9. Flexible ring seal

    International Nuclear Information System (INIS)

    Abbes, Claude; Gournier, Andre; Rouaud, Christian; Villepoix, Raymond de.

    1976-01-01

    The invention concerns a flexible metal ring seal, able to ensure a perfect seal between two bearings due to the crushing and elastic deformation properties akin to similar properties in elastomers. Various designs of seal of this kind are already known, particularly a seal made of a core formed by a helical wire spring with close-wound turns and with high axial compression ratio, closed on itself and having the shape of an annulus. This wire ring is surrounded by at least one envelope having at rest the shape of a toroidal surface of which the generating circle does not close on itself. In a particular design mode, the seal in question can include, around the internal spring, two envelopes of which one in contact with the spring is composed of a low ductility elastic metal, such as mild steel or stainless steel and the other is, on the contrary, made of a malleable metal, such as copper or nickel. The first envelope evenly distributes the partial crushing of the spring, when the seal is tightened, on the second envelope which closely fits the two surfaces between which the seal operates. The stress-crushing curve characteristic of the seal comprises two separate parts, the first with a relatively sharp slope corresponds to the start of the seal compression phase, enabling at least some of these curves to reach the requisite seal threshold very quickly, then, beyond this, a second part, practically flat, where the stress is appreciably constant for a wide operating bracket [fr

  10. Flexible piezotronic strain sensor.

    Science.gov (United States)

    Zhou, Jun; Gu, Yudong; Fei, Peng; Mai, Wenjie; Gao, Yifan; Yang, Rusen; Bao, Gang; Wang, Zhong Lin

    2008-09-01

    Strain sensors based on individual ZnO piezoelectric fine-wires (PFWs; nanowires, microwires) have been fabricated by a simple, reliable, and cost-effective technique. The electromechanical sensor device consists of a single electrically connected PFW that is placed on the outer surface of a flexible polystyrene (PS) substrate and bonded at its two ends. The entire device is fully packaged by a polydimethylsiloxane (PDMS) thin layer. The PFW has Schottky contacts at its two ends but with distinctly different barrier heights. The I- V characteristic is highly sensitive to strain mainly due to the change in Schottky barrier height (SBH), which scales linear with strain. The change in SBH is suggested owing to the strain induced band structure change and piezoelectric effect. The experimental data can be well-described by the thermionic emission-diffusion model. A gauge factor of as high as 1250 has been demonstrated, which is 25% higher than the best gauge factor demonstrated for carbon nanotubes. The strain sensor developed here has applications in strain and stress measurements in cell biology, biomedical sciences, MEMS devices, structure monitoring, and more.

  11. Orthogonal flexible Rydberg aggregates

    Science.gov (United States)

    Leonhardt, K.; Wüster, S.; Rost, J. M.

    2016-02-01

    We study the link between atomic motion and exciton transport in flexible Rydberg aggregates, assemblies of highly excited light alkali-metal atoms, for which motion due to dipole-dipole interaction becomes relevant. In two one-dimensional atom chains crossing at a right angle adiabatic exciton transport is affected by a conical intersection of excitonic energy surfaces, which induces controllable nonadiabatic effects. A joint exciton-motion pulse that is initially governed by a single energy surface is coherently split into two modes after crossing the intersection. The modes induce strongly different atomic motion, leading to clear signatures of nonadiabatic effects in atomic density profiles. We have shown how this scenario can be exploited as an exciton switch, controlling direction and coherence properties of the joint pulse on the second of the chains [K. Leonhardt et al., Phys. Rev. Lett. 113, 223001 (2014), 10.1103/PhysRevLett.113.223001]. In this article we discuss the underlying complex dynamics in detail, characterize the switch, and derive our isotropic interaction model from a realistic anisotropic one with the addition of a magnetic bias field.

  12. SOCMA study urges flexibility

    International Nuclear Information System (INIS)

    Kirschner, E.

    1993-01-01

    In implementing the 1990 Pollution Prevention Act, regulators and legislators should hold off on cookie-cutter, numerical goal-based requirements to allow for site and process specific programs, says a study sponsored by the Synthetic Organic Chemicals Manufacturers Association (SOCMA; Washington). Companies should have that flexibility to target their resources toward those activities that reduce pollution cost effectively, says SOCMA environmental quality committee chairman Art Gillen, who is also BASF director of environmental regulatory affairs. The study - conducted by Woodward-Clyde Consultants (Denver) - examines four batch and custom chemical manufacturing films. As in the Clean Air Act, the batch processing of SOCMA-member plants should be considered in new regulations, Gillen says. For example, the study found that most wastes are from shutdowns and cleanouts, and there are frequent charges in waste streams and raw materials. Those characteristics do not lend themselves to annual reduction goals. Also, specific goals could have a wide range of costs: measures to reduce stack air emissions run from $18/lb to $1,106/lb. SOCMA says it will present the study to Congress and the Environmental Protection Agency

  13. Integrated engineering increases flexibility

    International Nuclear Information System (INIS)

    Smith, Ray

    1991-01-01

    Integrated Engineering (IE) can be used to describe the best use of increasingly rare good engineering talent in an increasingly competive world. A number of organisations are now moving towards IE without any general agreement on a precise definition. The engineering division of British Nuclear Fuels (BNFL) is one such organisation. This feature covers the reasoning behind the decision, and our experience to date. BNFL engineering division is responsible primarily for the provision of major facilities on BNFL operational sites. This provision includes feasibility, front end and detailed design, procurement, installation and commissioning. Task force working has been used for some of the large projects. But the future workload is expected to comprise many more smaller projects. At the same time, equipment is becoming more complex and the need for mutual understanding and appreciation between disciplines is increasing. To meet this increasing need for flexibility, BNFL has decided to move to the matrix structure of project management and functional departments described in the article. (Author)

  14. Quark chemistry: charmonium molecules

    International Nuclear Information System (INIS)

    De Rujula, A.; Jaffe, R.L.

    1977-01-01

    The theoretical and experimental evidence for two quark-two antiquark hadrons is reviewed. Concentration is placed on predictions for S-wave ''charmonium molecules,'' built of a c anti c charmonium pair and a light quark-antiquark pair. Their spectrum and quantum numbers are predicted and an estimate of their decay couplings and their prediction in monochromatic pion decays from charmonium resonances produced in e + e - -annihilation is given. Some S-wave charmonium resonances should be detectable in these decays, but typical branching ratios are only at the 1% level. 19 references

  15. Organizational Learning, Strategic Flexibility and Business Model Innovation: An Empirical Research Based on Logistics Enterprises

    Science.gov (United States)

    Bao, Yaodong; Cheng, Lin; Zhang, Jian

    Using the data of 237 Jiangsu logistics firms, this paper empirically studies the relationship among organizational learning capability, business model innovation, strategic flexibility. The results show as follows; organizational learning capability has positive impacts on business model innovation performance; strategic flexibility plays mediating roles on the relationship between organizational learning capability and business model innovation; interaction among strategic flexibility, explorative learning and exploitative learning play significant roles in radical business model innovation and incremental business model innovation.

  16. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  17. Torque Measurement at the Single Molecule Level

    Science.gov (United States)

    Forth, Scott; Sheinin, Maxim Y.; Inman, James; Wang, Michelle D.

    2017-01-01

    Methods for exerting and measuring forces on single molecules have revolutionized the study of the physics of biology. However, it is often the case that biological processes involve rotation or torque generation, and these parameters have been more difficult to access experimentally. Recent advances in the single molecule field have led to the development of techniques which add the capability of torque measurement. By combining force, displacement, torque, and rotational data, a more comprehensive description of the mechanics of a biomolecule can be achieved. In this review, we highlight a number of biological processes for which torque plays a key mechanical role. We describe the various techniques that have been developed to directly probe the torque experienced by a single molecule, and detail a variety of measurements made to date using these new technologies. We conclude by discussing a number of open questions and propose systems of study which would be well suited for analysis with torsional measurement techniques. PMID:23541162

  18. High performance photovoltaic applications using solution-processed small molecules.

    Science.gov (United States)

    Chen, Yongsheng; Wan, Xiangjian; Long, Guankui

    2013-11-19

    Energy remains a critical issue for the survival and prosperity of humancivilization. Many experts believe that the eventual solution for sustainable energy is the use of direct solar energy as the main energy source. Among the options for renewable energy, photovoltaic technologies that harness solar energy offer a way to harness an unlimited resource and minimum environment impact in contrast with other alternatives such as water, nuclear, and wind energy. Currently, almost all commercial photovoltaic technologies use Si-based technology, which has a number of disadvantages including high cost, lack of flexibility, and the serious environmental impact of the Si industry. Other technologies, such as organic photovoltaic (OPV) cells, can overcome some of these issues. Today, polymer-based OPV (P-OPV) devices have achieved power conversion efficiencies (PCEs) that exceed 9%. Compared with P-OPV, small molecules based OPV (SM-OPV) offers further advantages, including a defined structure for more reproducible performance, higher mobility and open circuit voltage, and easier synthetic control that leads to more diversified structures. Therefore, while largely undeveloped, SM-OPV is an important emerging technology with performance comparable to P-OPV. In this Account, we summarize our recent results on solution-processed SM-OPV. We believe that solution processing is essential for taking full advantage of OPV technologies. Our work started with the synthesis of oligothiophene derivatives with an acceptor-donor-acceptor (A-D-A) structure. Both the backbone conjugation length and electron withdrawing terminal groups play an important role in the light absorption, energy levels and performance of the devices. Among those molecules, devices using a 7-thiophene-unit backbone and a 3-ethylrhodanine (RD) terminal unit produced a 6.1% PCE. With the optimized conjugation length and terminal unit, we borrowed from the results with P-OPV devices to optimize the backbone. Thus we

  19. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  20. Flexibility in fuel manufacturing

    International Nuclear Information System (INIS)

    Reparaz, A.; Stavig, W.E.; McLees, R.B.

    1987-01-01

    From its inception Exxon Nuclear has produced both BWR and PWR fuels. This is reflected in a product line that, to date, includes over 20 fuel designs. These range from 6x6 design at one end of the spectrum to the recently introduced 17x17 design. The benefits offered include close tailoring of the fuel design to match the customer's requirements, and the ability to rapidly introduce product changes, such as the axial blanket design, with a minimal impact on manufacturing. This flexibility places a number of demands on the manufacturing organization. Close interfaces must be established, and maintained, between the marketing, product design, manufacturing, purchasing and quality organizations, and the information flows must be immediate and accurate. Production schedules must be well planned and must be maintained or revised to reflect changing circumstances. Finally, the manufacturing facilities must be designed to allow rapid switchover between product designs with minor tooling changes and/or rerouting of product flows to alternate work stations. Among the tools used to manage the flow of information and to maintain the tight integration necessary between the various manufacturing, engineering and quality organizations is a commercially available, computerized planning and tracking system, AMAPS. A real-time production data collection system has been designed which gathers data from each production work station for use by the shop floor control module of AMAPS. Accuracy of input to the system is improved through extensive use of bar codes to gather information on the product as it moves through and between work stations. This computerized preparation of material tracing has an impact on direct manufacturing records, quality control records, nuclear material records and accounting and inventory records. This is of benefit to both Exxon Nuclear and its customers

  1. Risks of flexible ureterorenoscopy

    DEFF Research Database (Denmark)

    Osther, Palle J S

    2018-01-01

    . Knowledge on normal upper urinary tract physiology are crucial for understanding how these harmful effects of fURS may be avoided or minimized. The pathophysiology of intrarenal pressure increases and ureteral access will be discussed as a basis for understanding preventive measures. Role of antibiotics...

  2. Incentivizing Flexibility in System Operations

    Energy Technology Data Exchange (ETDEWEB)

    Milligan, Michael [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Bloom, Aaron P [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Townsend, Aaron [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Ela, Erik [Electric Power Research Institute; Botterud, Audun [Argonne National Laboratory; Levin, Todd [Argonne National Laboratory

    2018-02-15

    Defining flexibility has been a challenge that a number of industry members and researchers have attempted to address in recent years. With increased variability and uncertainty of variable generation (VG), the resources on the system will have to be more flexible to adjust output, so that power output ranges, power ramp rates, and energy duration sustainability are sufficient to meet the needs of balancing supply with demand at various operational timescales. This chapter discusses whether existing market designs provide adequate incentives for resources to offer their flexibility into the market to meet the increased levels of variability and uncertainty introduced by VG in the short-term operational time frame. It presents a definition of flexibility and discusses how increased levels of VG require increased needs for flexibility on power systems. Following this introductory material, the chapter examines how existing market designs ensure that resources have the right incentives to provide increased flexibility, and then discusses a number of emerging market design elements that impact flexibility incentives.

  3. Synthesis of molecules in interstellar clouds and star formation

    International Nuclear Information System (INIS)

    Ghosh, K.K.; Ghosh, S.N.

    1981-01-01

    Study of the formation and destruction processes of interstellar molecules may throw certain light on interstellar medium. Formation and destruction processes of some interstellar molecules are proposed on the basis of laboratory data. The abundances of these molecules are calculated under steady-state condition. The calculated values are then compared with the observed values, obtained by different investigators. It appears that gas phase ion-neutral reactions are capable of synthesizing most interstellar molecules. The role of ion-neutral reactions to star formation has also been discussed. (author)

  4. Protection of a PWR nuclear power stations against corrosion using hydrogen molecules to capture oxygen molecules

    International Nuclear Information System (INIS)

    Nahili, M.

    2004-01-01

    A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)

  5. Aggregating and Disaggregating Flexibility Objects

    DEFF Research Database (Denmark)

    Siksnys, Laurynas; Valsomatzis, Emmanouil; Hose, Katja

    2015-01-01

    In many scientific and commercial domains we encounter flexibility objects, i.e., objects with explicit flexibilities in a time and an amount dimension (e.g., energy or product amount). Applications of flexibility objects require novel and efficient techniques capable of handling large amounts...... and aiming at energy balancing during aggregation. In more detail, this paper considers the complete life cycle of flex-objects: aggregation, disaggregation, associated requirements, efficient incremental computation, and balance aggregation techniques. Extensive experiments based on real-world data from...

  6. Lanthanide single molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry

    2015-10-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  7. Lanthanide single molecule magnets

    CERN Document Server

    Tang, Jinkui

    2015-01-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  8. Molecules in the Spotlight

    Energy Technology Data Exchange (ETDEWEB)

    Cryan, James

    2010-01-26

    SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new forms of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.

  9. Magnetic field modification of ultracold molecule-molecule collisions

    International Nuclear Information System (INIS)

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

    2009-01-01

    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  10. Designing flexible procurement systems

    OpenAIRE

    Hughes, Will

    1990-01-01

    The systems used for the procurement of buildings are organizational systems. They involve people in a series of strategic decisions, and a pattern of roles, responsibilities and relationships that combine to form the organizational structure of the project. To ensure effectiveness of the building team, this organizational structure needs to be contingent upon the environment within which the construction project takes place. In addition, a changing environment means that the organizational s...

  11. Controlling single-molecule junction conductance by molecular interactions

    Science.gov (United States)

    Kitaguchi, Y.; Habuka, S.; Okuyama, H.; Hatta, S.; Aruga, T.; Frederiksen, T.; Paulsson, M.; Ueba, H.

    2015-01-01

    For the rational design of single-molecular electronic devices, it is essential to understand environmental effects on the electronic properties of a working molecule. Here we investigate the impact of molecular interactions on the single-molecule conductance by accurately positioning individual molecules on the electrode. To achieve reproducible and precise conductivity measurements, we utilize relatively weak π-bonding between a phenoxy molecule and a STM-tip to form and cleave one contact to the molecule. The anchoring to the other electrode is kept stable using a chalcogen atom with strong bonding to a Cu(110) substrate. These non-destructive measurements permit us to investigate the variation in single-molecule conductance under different but controlled environmental conditions. Combined with density functional theory calculations, we clarify the role of the electrostatic field in the environmental effect that influences the molecular level alignment. PMID:26135251

  12. Flexible Thermoelectric Generators on Silicon Fabric

    KAUST Repository

    Sevilla, Galo T.

    2012-01-01

    In this work, the development of a Thermoelectric Generator on Flexible Silicon Fabric is explored to extend silicon electronics for flexible platforms. Low cost, easily deployable plastic based flexible electronics are of great interest for smart

  13. Indexing molecules with chemical graph identifiers.

    Science.gov (United States)

    Gregori-Puigjané, Elisabet; Garriga-Sust, Rut; Mestres, Jordi

    2011-09-01

    Fast and robust algorithms for indexing molecules have been historically considered strategic tools for the management and storage of large chemical libraries. This work introduces a modified and further extended version of the molecular equivalence number naming adaptation of the Morgan algorithm (J Chem Inf Comput Sci 2001, 41, 181-185) for the generation of a chemical graph identifier (CGI). This new version corrects for the collisions recognized in the original adaptation and includes the ability to deal with graph canonicalization, ensembles (salts), and isomerism (tautomerism, regioisomerism, optical isomerism, and geometrical isomerism) in a flexible manner. Validation of the current CGI implementation was performed on the open NCI database and the drug-like subset of the ZINC database containing 260,071 and 5,348,089 structures, respectively. The results were compared with those obtained with some of the most widely used indexing codes, such as the CACTVS hash code and the new InChIKey. The analyses emphasize the fact that compound management activities, like duplicate analysis of chemical libraries, are sensitive to the exact definition of compound uniqueness and thus still depend, to a minor extent, on the type and flexibility of the molecular index being used. Copyright © 2011 Wiley Periodicals, Inc.

  14. Flexible metal-organic framework compounds: In situ studies for selective CO{sub 2} capture

    Energy Technology Data Exchange (ETDEWEB)

    Allen, A.J., E-mail: andrew.allen@nist.gov [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Espinal, L.; Wong-Ng, W. [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Queen, W.L. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); The Molecular Foundry, Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA 94720 (United States); Brown, C.M. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE 19716 (United States); Kline, S.R. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Kauffman, K.L. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); Culp, J.T. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); URS Corporation, South Park, PA 15219 (United States); Matranga, C. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States)

    2015-10-25

    Results are presented that explore the dynamic structural changes occurring in two highly flexible nanocrystalline metal-organic framework (MOF) compounds during the adsorption and desorption of pure gases and binary mixtures. The Ni(1,2-bis(4-pyridyl)ethylene)[Ni(CN){sub 4}] and catena-bis(dibenzoylmethanato)-(4,4′-bipyridyl)nickel(II) chosen for this study are 3-D and 1-D porous coordination polymers (PCP) with a similar gate opening pressure response for CO{sub 2} isotherms at 303 K, but with differing degrees of flexibility for structural change to accommodate guest molecules. As such, they serve as a potential model system for evaluating the complex kinetics associated with dynamic structure changes occurring in response to gas adsorption in flexible MOF systems. Insights into the crystallographic changes occurring as the MOF pore structure expands and contracts in response to interactions with CO{sub 2}, N{sub 2}, and CO{sub 2}/N{sub 2} mixtures have been obtained from in situ small-angle neutron scattering and neutron diffraction, combined with ex situ X-ray diffraction structure measurements. The role of structure in carbon capture functionality is discussed with reference to the ongoing characterization challenges and a possible materials-by-design approach. - Graphical abstract: We present in situ small-angle neutron scattering results for two flexible metal-organic frameworks (MOFs). The figure shows that for one (NiBpene, high CO{sub 2} adsorption) the intensity of the Bragg peak for the expandable d-spacing most associated with CO{sub 2} adsorption varies approximately with the isotherm, while for the other (NiDBM-Bpy, high CO{sub 2} selectivity) the d-spacing, itself, varies with the isotherm. The cartoons show the proposed modes of structural change. - Highlights: • Dynamic structures of two flexible MOF CO{sub 2} sorbent compounds are compared in situ. • These porous solid sorbents serve as models for pure & dual gas adsorption. • Different

  15. Flexibility of trunnion piping elbows

    International Nuclear Information System (INIS)

    Lewis, G.D.; Chao, Y.J.

    1987-01-01

    Flexibility factors and stress indices for piping component such as straight pipe, elbows, butt-welding tees, branch connections, and butt-welding reducers are contained in the code, but many of the less common piping components, like the trunnion elbow, do not have flexibility factors or stress indices defined. The purpose of this paper is to identify the in-plane and out-of-plane flexibility factors in accordance with code procedures for welded trunnions attached to the tangent centerlines of long radius elbows. This work utilized the finite element method as applicable to plates and shells for calculating the relative rotations of the trunnion elbow-ends for in-plane and out-of-plane elbow moment loadings. These rotations are used to derive the corresponding in-plane and out-of-plane flexibility factors. (orig./GL)

  16. Distributed flexibility in inertial swimmers

    Science.gov (United States)

    Floryan, Daniel; Rowley, Clarence W.; Smits, Alexander J.

    2017-11-01

    To achieve fast and efficient swimming, the flexibility of the propulsive surfaces is an important feature. To better understand the effects of distributed flexibility (either through inhomogeneous material properties, varying geometry, or both) we consider the coupled solid and fluid mechanics of the problem. Here, we develop a simplified model of a flexible swimmer, using Euler-Bernoulli theory to describe the solid, Theodorsen's theory to describe the fluid, and a Blasius boundary layer to incorporate viscous effects. Our primary aims are to understand how distributed flexibility affects the thrust production and efficiency of a swimmer with imposed motion at its leading edge. In particular, we examine the modal shapes of the swimmer to gain physical insight into the observed trends. Supported under ONR MURI Grant N00014-14-1-0533, Program Manager Robert Brizzolara.

  17. Vibrations of a molecule in an external force field.

    Science.gov (United States)

    Okabayashi, Norio; Peronio, Angelo; Paulsson, Magnus; Arai, Toyoko; Giessibl, Franz J

    2018-05-01

    The oscillation frequencies of a molecule on a surface are determined by the mass distribution in the molecule and the restoring forces that occur when the molecule bends. The restoring force originates from the atomic-scale interaction within the molecule and with the surface, which plays an essential role in the dynamics and reactivity of the molecule. In 1998, a combination of scanning tunneling microscopy with inelastic tunneling spectroscopy revealed the vibrational frequencies of single molecules adsorbed on a surface. However, the probe tip itself exerts forces on the molecule, changing its oscillation frequencies. Here, we combine atomic force microscopy with inelastic tunneling spectroscopy and measure the influence of the forces exerted by the tip on the lateral vibrational modes of a carbon monoxide molecule on a copper surface. Comparing the experimental data to a mechanical model of the vibrating molecule shows that the bonds within the molecule and with the surface are weakened by the proximity of the tip. This combination of techniques can be applied to analyze complex molecular vibrations and the mechanics of forming and loosening chemical bonds, as well as to study the mechanics of bond breaking in chemical reactions and atomic manipulation.

  18. Determinants of flexible work arrangements

    OpenAIRE

    Sarbu, Miruna

    2014-01-01

    Flexible work arrangements such as allowing employees to work at home are used in firms, especially since information and communication technologies have become so widespread. Using individual-level data from 10,884 German employees, this paper analyses the determinants of working at home as a form of flexible work arrangements. The analysis is based on descriptive analyses and a discrete choice model using a probit estimation approach. The results reveal that men have a higher...

  19. Workplace flexibility across the lifespan

    OpenAIRE

    Bal, Pieter; Jansen, Paul G W

    2016-01-01

    As demographic changes impact the workplace, governments, organizations and workers arelooking for ways to sustain optimal working lives at higher ages. Workplace flexibility has beenintroduced as a potential way workers can have more satisfying working lives until theirretirement ages. This paper presents a critical review of the literature on workplace flexibilityacross the lifespan. It discusses how flexibility has been conceptualized across differentdisciplines, and postulates a definitio...

  20. Flexible packaging for PV modules

    Science.gov (United States)

    Dhere, Neelkanth G.

    2008-08-01

    Economic, flexible packages that provide needed level of protection to organic and some other PV cells over >25-years have not yet been developed. However, flexible packaging is essential in niche large-scale applications. Typical configuration used in flexible photovoltaic (PV) module packaging is transparent frontsheet/encapsulant/PV cells/flexible substrate. Besides flexibility of various components, the solder bonds should also be flexible and resistant to fatigue due to cyclic loading. Flexible front sheets should provide optical transparency, mechanical protection, scratch resistance, dielectric isolation, water resistance, UV stability and adhesion to encapsulant. Examples are Tefzel, Tedlar and Silicone. Dirt can get embedded in soft layers such as silicone and obscure light. Water vapor transmittance rate (WVTR) of polymer films used in the food packaging industry as moisture barriers are ~0.05 g/(m2.day) under ambient conditions. In comparison, light emitting diodes employ packaging components that have WVTR of ~10-6 g/(m2.day). WVTR of polymer sheets can be improved by coating them with dense inorganic/organic multilayers. Ethylene vinyl acetate, an amorphous copolymer used predominantly by the PV industry has very high O2 and H2O diffusivity. Quaternary carbon chains (such as acetate) in a polymer lead to cleavage and loss of adhesional strength at relatively low exposures. Reactivity of PV module components increases in presence of O2 and H2O. Adhesional strength degrades due to the breakdown of structure of polymer by reactive, free radicals formed by high-energy radiation. Free radical formation in polymers is reduced when the aromatic rings are attached at regular intervals. This paper will review flexible packaging for PV modules.

  1. Flexible forms of working hours

    OpenAIRE

    Knapp, Viktor

    2017-01-01

    66 Abstract - Flexible forms of working hours This diploma thesis deals with the flexible forms of working hours and its goal is to describe this issue in intelligible and comprehensive way. It is being very interesting and current theme which is to a great extent not subject to direct legal regulations and provides its contracting parties with a big amount of freedom of contract. This fact assists in bigger flexibilization of labour market and represents a significant instrument in the fight...

  2. Electron-excited molecule interactions

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Tennessee Univ., Knoxville, TN

    1991-01-01

    In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

  3. Developmental constraints on behavioural flexibility.

    Science.gov (United States)

    Holekamp, Kay E; Swanson, Eli M; Van Meter, Page E

    2013-05-19

    We suggest that variation in mammalian behavioural flexibility not accounted for by current socioecological models may be explained in part by developmental constraints. From our own work, we provide examples of constraints affecting variation in behavioural flexibility, not only among individuals, but also among species and higher taxonomic units. We first implicate organizational maternal effects of androgens in shaping individual differences in aggressive behaviour emitted by female spotted hyaenas throughout the lifespan. We then compare carnivores and primates with respect to their locomotor and craniofacial adaptations. We inquire whether antagonistic selection pressures on the skull might impose differential functional constraints on evolvability of skulls and brains in these two orders, thus ultimately affecting behavioural flexibility in each group. We suggest that, even when carnivores and primates would theoretically benefit from the same adaptations with respect to behavioural flexibility, carnivores may nevertheless exhibit less behavioural flexibility than primates because of constraints imposed by past adaptations in the morphology of the limbs and skull. Phylogenetic analysis consistent with this idea suggests greater evolutionary lability in relative brain size within families of primates than carnivores. Thus, consideration of developmental constraints may help elucidate variation in mammalian behavioural flexibility.

  4. Contagious flexibility? A study on whether schedule flexibility facilitates work-life enrichment.

    Science.gov (United States)

    Pedersen, Vivi Bach; Jeppesen, Hans Jeppe

    2012-08-01

    Schedule flexibility defines an important generating resource for work-life enrichment; however, our knowledge about how such spillovers take place is limited. This multiple case study examines how workers from different working time contexts with varying levels of schedule flexibility experience work-life interplay. Given the adopted explorative design, it is important to interpret the findings in a tentative light. Nonetheless, the study offers important insight into work-life enrichment that may guide future research in this field. The findings indicate that schedule flexibility may act as a boundary-spanning resource owing to the agency potential it offers workers. Thus, it seemed that flexible schedule opportunities enabled workers to engage more fully in personal life activities, which in turn had a positive influence on their work involvement through positive affect. Such positive role engagements appeared, however, to be greatly determined by workers' boundary management and by time conditions of work and family. In conclusion, the major findings and limitation of the study are discussed against existing research and theory. © 2012 The Authors. Scandinavian Journal of Psychology © 2012 The Scandinavian Psychological Associations.

  5. Organic Molecules in Meteorites

    Science.gov (United States)

    Martins, Zita

    2015-08-01

    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (meteorites contain soluble organic molecules with different abundances and distributions, which may reflect the extension of aqueous alteration or thermal metamorphism on the meteorite parent bodies. Extensive aqueous alteration on the meteorite parent body may result on 1) the decomposition of α-amino acids [5, 6]; 2) synthesis of β- and γ-amino acids [2, 6-9]; 3) higher relative abundances of alkylated polycyclic aromatic hydrocarbons (PAHs) [6, 10]; and 4) higher L-enantiomer excess (Lee) value of isovaline [6, 11, 12].The soluble organic content of carbonaceous meteorites may also have a contribution from Fischer-Tropsch/Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502

  6. Tunnelling of a molecule

    International Nuclear Information System (INIS)

    Jarvis, P.D.; Bulte, D.P.

    1998-01-01

    A quantum-mechanical description of tunnelling is presented for a one-dimensional system with internal oscillator degrees of freedom. The 'charged diatomic molecule' is frustrated on encountering a barrier potential by its centre of charge not being coincident with its centre of mass, resulting in transitions amongst internal states. In an adiabatic limit, the tunnelling of semiclassical coherent-like oscillator states is shown to exhibit the Hartman and Bueuttiker-Landauer times t H and t BL , with the time dependence of the coherent state parameter for the tunnelled state given by α(t) = α e -iω(t+Δt) , Δt = t H - it BL . A perturbation formalism is developed, whereby the exact transfer matrix can be expanded to any desired accuracy in a suitable limit. An 'intrinsic' time, based on the oscillator transition rate during tunnelling, transmission or reflection, is introduced. In simple situations the resulting intrinsic tunnelling time is shown to vanish to lowest order. In the general case a particular (nonzero) parametrisation is inferred, and its properties discussed in comparison with the literature on tunnelling times for both wavepackets and internal clocks. Copyright (1998) CSIRO Australia

  7. Single molecule tracking

    Science.gov (United States)

    Shera, E. Brooks

    1988-01-01

    A detection system is provided for identifying individual particles or molecules having characteristic emission in a flow train of the particles in a flow cell. A position sensitive sensor is located adjacent the flow cell in a position effective to detect the emissions from the particles within the flow cell and to assign spatial and temporal coordinates for the detected emissions. A computer is then enabled to predict spatial and temporal coordinates for the particle in the flow train as a function of a first detected emission. Comparison hardware or software then compares subsequent detected spatial and temporal coordinates with the predicted spatial and temporal coordinates to determine whether subsequently detected emissions originate from a particle in the train of particles. In one embodiment, the particles include fluorescent dyes which are excited to fluoresce a spectrum characteristic of the particular particle. Photones are emitted adjacent at least one microchannel plate sensor to enable spatial and temporal coordinates to be assigned. The effect of comparing detected coordinates with predicted coordinates is to define a moving sample volume which effectively precludes the effects of background emissions.

  8. Theoretical Investigations Regarding Single Molecules

    DEFF Research Database (Denmark)

    Pedersen, Kim Georg Lind

    Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...

  9. Biofuels: from microbes to molecules

    National Research Council Canada - National Science Library

    Lu, Xuefeng

    2014-01-01

    .... The production of different biofuel molecules including hydrogen, methane, ethanol, butanol, higher chain alcohols, isoprenoids and fatty acid derivatives, from genetically engineered microbes...

  10. Labelled molecules, modern research implements

    International Nuclear Information System (INIS)

    Pichat, L.; Langourieux, Y.

    1974-01-01

    Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr

  11. Role of band 3 in the erythrocyte membrane structural changes under thermal fluctuations -multi scale modeling considerations.

    Science.gov (United States)

    Pajic-Lijakovic, Ivana

    2015-12-01

    An attempt was made to discuss and connect various modeling approaches on various time and space scales which have been proposed in the literature in order to shed further light on the erythrocyte membrane rearrangement caused by the cortex-lipid bilayer coupling under thermal fluctuations. Roles of the main membrane constituents: (1) the actin-spectrin cortex, (2) the lipid bilayer, and (3) the trans membrane protein band 3 and their course-consequence relations were considered in the context of the cortex non linear stiffening and corresponding anomalous nature of energy dissipation. The fluctuations induce alternating expansion and compression of the membrane parts in order to ensure surface and volume conservation. The membrane structural changes were considered within two time regimes. The results indicate that the cortex non linear stiffening and corresponding anomalous nature of energy dissipation are related to the spectrin flexibility distribution and the rate of its changes. The spectrin flexibility varies from purely flexible to semi flexible. It is influenced by: (1) the number of band 3 molecules attached to single spectrin filaments, and (2) phosphorylation of the actin-junctions. The rate of spectrin flexibility changes depends on the band 3 molecules rearrangement.

  12. Growing interstellar molecules with ion-molecule reactions

    International Nuclear Information System (INIS)

    Bohme, D.K.

    1989-01-01

    Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

  13. The Development of the Ventral Prefrontal Cortex and Social Flexibility

    Science.gov (United States)

    Nelson, Eric E.; Guyer, Amanda E.

    2011-01-01

    Over the last several years a number of studies in both humans and animals have suggested that the orbitofrontal and ventrolateral prefrontal cortices play an important role in generating flexible behavior. We suggest that input from these brain regions contribute to three functions involved in generating flexible behavior within social contexts: valuation, inhibition, and rule use. Recent studies have also demonstrated that the prefrontal cortex undergoes a prolonged course of maturation that extends well after puberty. Here, we review evidence that the prolonged development of these prefrontal regions parallels a slowly emerging ability for flexible social behavior. We also speculate on the possibility that sensitive periods for organizing social behavior may be embedded within this developmental time-fame. Finally, we discuss the role of prefrontal cortex in adolescent mood and anxiety disorders, particularly as orbitofrontal and ventrolateral prefrontal cortices are engaged in a social context. PMID:21804907

  14. FlavorDB: a database of flavor molecules.

    Science.gov (United States)

    Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh

    2018-01-04

    Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

    Science.gov (United States)

    Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

    2007-11-06

    The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

  16. Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

    KAUST Repository

    Serag, Maged F.

    2014-10-06

    Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

  17. Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

    KAUST Repository

    Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

    2014-01-01

    Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

  18. Living in a Flexible Space

    Science.gov (United States)

    Canepa, Simona

    2017-10-01

    How long does a space or an object have to last? If in the past an object or a building manufacturing was designed to last as much as possible, nowadays it is designed to have a life related to the time in which it will be used. Flexibility is what characterizes a space, it’s the ability to be variable and adaptable to changes in the lives of users or in relation to the use which these will make over time. The evolution of the labour market, the difficulty of inserting within it and the need to push more and more frequent move today in the trial of living space models increasingly flexible: people, especially young people, are forced to move on territory outlining a new condition to which the flexible nomadic dwellings offer an adequate response, ensuring high functional performance in confined spaces.

  19. Balancing energy flexibilities through aggregation

    DEFF Research Database (Denmark)

    Valsomatzis, Emmanouil; Hose, Katja; Pedersen, Torben Bach

    2014-01-01

    One of the main goals of recent developments in the Smart Grid area is to increase the use of renewable energy sources. These sources are characterized by energy fluctuations that might lead to energy imbalances and congestions in the electricity grid. Exploiting inherent flexibilities, which exist...... in both energy production and consumption, is the key to solving these problems. Flexibilities can be expressed as flex-offers, which due to their high number need to be aggregated to reduce the complexity of energy scheduling. In this paper, we discuss balance aggregation techniques that already during...... aggregation aim at balancing flexibilities in production and consumption to reduce the probability of congestions and reduce the complexity of scheduling. We present results of our extensive experiments....

  20. FLEXIBLE BUDGET OF SPORT COMPETITIONS

    Directory of Open Access Journals (Sweden)

    Dragan Vukasović

    2009-11-01

    Full Text Available Manager of sport competition has right to decide and also to take responsibility for costs, income and financial results. From economic point of wiev flexible budget and planning cost calculations is top management base for analyzing success level of sport competition. Flexible budget is made before sport competition with few output level, where one is always from static plan-master plan. At the end of competition when we have results, we make report of plan executing and we also analyzing plan variances. Results of comparation between achieved and planning level of static budget can be acceptable if achieved level is approximate to budget level or if we analyzing results from gross or net income. Flexible budget become very important in case of world eco- nomic crises

  1. Flexible Query Answering Systems 2006

    DEFF Research Database (Denmark)

    -computer interaction. The overall theme of the FQAS conferences is innovative query systems aimed at providing easy, flexible, and intuitive access to information. Such systems are intended to facilitate retrieval from information repositories such as databases, libraries, and the World-Wide Web. These repositories......This volume constitutes the proceedings of the Seventh International Conference on Flexible Query Answering Systems, FQAS 2006, held in Milan, Italy, on June 7--10, 2006. FQAS is the premier conference for researchers and practitioners concerned with the vital task of providing easy, flexible...... are typically equipped with standard query systems which are often inadequate, and the focus of FQAS is the development of query systems that are more expressive, informative, cooperative, and productive. These proceedings contain contributions from invited speakers and 53 original papers out of about 100...

  2. Flexible wings in flapping flight

    Science.gov (United States)

    Moret, Lionel; Thiria, Benjamin; Zhang, Jun

    2007-11-01

    We study the effect of passive pitching and flexible deflection of wings on the forward flapping flight. The wings are flapped vertically in water and are allowed to move freely horizontally. The forward speed is chosen by the flapping wing itself by balance of drag and thrust. We show, that by allowing the wing to passively pitch or by adding a flexible extension at its trailing edge, the forward speed is significantly increased. Detailed measurements of wing deflection and passive pitching, together with flow visualization, are used to explain our observations. The advantage of having a wing with finite rigidity/flexibility is discussed as we compare the current results with our biological inspirations such as birds and fish.

  3. Impact of Building Design Parameters on Thermal Energy Flexibility in a Low-Energy Building

    OpenAIRE

    Sarran, Lucile; Foteinaki, Kyriaki; Gianniou, Panagiota; Rode, Carsten

    2017-01-01

    This work focuses on demand-side management potential for the heating grid in residential buildings. The possibility to increase the flexibility provided to the heat network through specific building design is investigated. The role of different parts of the building structure on thermal flexibility is assessed through a parameter variation on a building model. Different building designs are subjected to heat cut-offs, and flexibility is evaluated with respect to comfort preservation and heat...

  4. Neural Correlates of Attentional Flexibility during Approach and Avoidance Motivation

    Science.gov (United States)

    Calcott, Rebecca D.; Berkman, Elliot T.

    2015-01-01

    Dynamic, momentary approach or avoidance motivational states have downstream effects on eventual goal success and overall well being, but there is still uncertainty about how those states affect the proximal neurocognitive processes (e.g., attention) that mediate the longer-term effects. Attentional flexibility, or the ability to switch between different attentional foci, is one such neurocognitive process that influences outcomes in the long run. The present study examined how approach and avoidance motivational states affect the neural processes involved in attentional flexibility using fMRI with the aim of determining whether flexibility operates via different neural mechanisms under these different states. Attentional flexibility was operationalized as subjects’ ability to switch between global and local stimulus features. In addition to subjects’ motivational state, the task context was manipulated by varying the ratio of global to local trials in a block in light of recent findings about the moderating role of context on motivation-related differences in attentional flexibility. The neural processes involved in attentional flexibility differ under approach versus avoidance states. First, differences in the preparatory activity in key brain regions suggested that subjects’ preparedness to switch was influenced by motivational state (anterior insula) and the interaction between motivation and context (superior temporal gyrus, inferior parietal lobule). Additionally, we observed motivation-related differences the anterior cingulate cortex during switching. These results provide initial evidence that motivation-induced behavioral changes may arise via different mechanisms in approach versus avoidance motivational states. PMID:26000735

  5. Flexible working hours and well-being in Finland.

    Science.gov (United States)

    Kandolin, I; Härmä, M; Toivanen, M

    2001-12-01

    Flexibility of working hours became more prevalent in the 1990s in Finland. According to a representative survey on Finnish wage and salary earners (n = 1790) at the beginning of 2000, a great majority of male (76%) and female (65%) employees regularly worked overtime and/or had irregular working hours every month. These employees were flexible in meeting the needs of their companies/employers. Individual flexibility of working hours was far less common, only one third of male and female employees were able to regulate their working hours. A better balance between company-controlled and individual flexibility would, however, improve the well-being of employees. Employees working overtime without being allowed to regulate their working hours felt more symptoms of distress and had more conflicts in combining workplace and family roles than those who could individually determine their working hours flexibly. An investment in individually determined flexibility, for example by means of participatory planning, would improve the well-being of employees, and thus also improve the productivity of the organization.

  6. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  7. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  8. [Flexibility competencies: emotional organization management].

    Science.gov (United States)

    Caballero Muñoz, Domingo; Blanco Prieto, Antonio

    2007-11-01

    The aim of this article is to analyse the transferral of flexibility from contemporary organizations to workers. Through the approach of management by competencies, organizations try to develop in their workers behaviours that are related to efficient job performance. In order to appraise the importance of this approach, we used a critical-rational perspective to discuss the productivity demands that are characteristic of advanced industrial societies. The article shows how the link between workers' flexibility management and their emotional competencies affects their lives, which, like the organizations, should be versatile and adaptable to change.

  9. Polymer electronics a flexible technology

    CERN Document Server

    Technology, Rapra

    2009-01-01

    The worldwide market for polymer electronic products has been estimated to be worth up to £15 billion by 2015 and the opportunity for new markets could be as high as £125 billion by 2025.'The rapid development of polymer electronics has revealed the possibility for transforming the electronics market by offering lighter, flexible and more cost effective alternatives to conventional materials and products. With applications ranging from printed, flexible conductors and novel semiconductor components to intelligent labels and large area displays and solar panels, products that were previously un

  10. Constructive episodic simulation, flexible recombination, and memory errors.

    Science.gov (United States)

    Schacter, Daniel L; Carpenter, Alexis C; Devitt, Aleea; Roberts, Reece P; Addis, Donna Rose

    2018-01-01

    According to Mahr & Csibra (M&C), the view that the constructive nature of episodic memory is related to its role in simulating future events has difficulty explaining why memory is often accurate. We hold this view, but disagree with their conclusion. Here we consider ideas and evidence regarding flexible recombination processes in episodic retrieval that accommodate both accuracy and distortion.

  11. Flexibility and Sharing of Childcare Duties in Black Families.

    Science.gov (United States)

    Wilson, Melvin N.; And Others

    1990-01-01

    The findings of a survey of 64 Black families do not support the hypothesis of role flexibility and sharing in Black households. The mothers in the sample, 78 percent of whom were employed, were primarily responsible for household maintenance and child rearing. (DM)

  12. Development of Flexible Pneumatic Cylinder with Built-in Flexible Linear Encoder and Flexible Bending Sensor

    Science.gov (United States)

    Akagi, Tetsuya; Dohta, Shujiro; Matsushita, Hisashi; Fukuhara, Akimasa

    The purpose of this study is to develop a lightweight and intelligent soft actuator which can be safely attached to the human body. A novel flexible pneumatic cylinder that can be used even if it is deformed by external force had been proposed. The cylinder can realize both pushing and pulling motions even if the cylinder bends. In this paper, a flexible pneumatic cylinder with a built-in flexible linear encoder is proposed and tested. The encoder can detect the cylinder displacement even if the cylinder bends. In the next step, to realize an intelligent flexible cylinder, it is essential to recognize the angle of deflection of the cylinder to estimate the direction of the external force. Therefore, a flexible bending sensor that can measure the directional angle by attaching it to the end of the cylinder is also proposed and tested. The tested bending sensor also consists of four inexpensive photo-reflectors set on the circumferential surface to the cylinder tube every 90 degrees from the center of the tube. By measuring the distance between the photo reflector and the surface of the tube at each point, the bending directional angle of the cylinder can be obtained. A low cost measuring system using a micro-computer incorporating a programmed Up/Down counter to measure the displacement of the cylinder is also developed. As a result, it was confirmed that the measuring accuracy of the bending directional angle was good, less than 0.7 degrees as a standard deviation.

  13. Multiscale weighted colored graphs for protein flexibility and rigidity analysis

    Science.gov (United States)

    Bramer, David; Wei, Guo-Wei

    2018-02-01

    Protein structural fluctuation, measured by Debye-Waller factors or B-factors, is known to correlate to protein flexibility and function. A variety of methods has been developed for protein Debye-Waller factor prediction and related applications to domain separation, docking pose ranking, entropy calculation, hinge detection, stability analysis, etc. Nevertheless, none of the current methodologies are able to deliver an accuracy of 0.7 in terms of the Pearson correlation coefficients averaged over a large set of proteins. In this work, we introduce a paradigm-shifting geometric graph model, multiscale weighted colored graph (MWCG), to provide a new generation of computational algorithms to significantly change the current status of protein structural fluctuation analysis. Our MWCG model divides a protein graph into multiple subgraphs based on interaction types between graph nodes and represents the protein rigidity by generalized centralities of subgraphs. MWCGs not only predict the B-factors of protein residues but also accurately analyze the flexibility of all atoms in a protein. The MWCG model is validated over a number of protein test sets and compared with many standard methods. An extensive numerical study indicates that the proposed MWCG offers an accuracy of over 0.8 and thus provides perhaps the first reliable method for estimating protein flexibility and B-factors. It also simultaneously predicts all-atom flexibility in a molecule.

  14. Most promising flexible generators for the wind dominated market

    International Nuclear Information System (INIS)

    Vorushylo, I.; Keatley, P.; Hewitt, NJ

    2016-01-01

    The intermittent nature of wind power and other forms of variable renewable energy requires complementary dispatchable flexible generators in order to guarantee the efficient, reliable and secure operation of electricity systems. The most popular solution to date has been peaking plant, usually in the form of open-cycle-gas- turbines (OCGT). Energy storage technologies have so far been considered too expensive, however technology development, as well as challenging renewable targets could potentially make storage economically viable. Although new advanced flexible combined-cycle gas turbines (CCGT) have been developed by some manufacturers, they have not yet been investigated in electricity market models. This paper describes a techno-economic assessment of the most suitable flexible technologies for the wind-dominated all Ireland electricity market (the Single Electricity Market (SEM)). The analysis is conducted by considering the impact of a series of policy scenarios which are compared in an electricity market model. The comparison is quantified using three primary metrics: technical benefits to the system, economic advantages to the consumer and investment viability. Modelling results suggest that advanced CCGT and energy storage solutions are the most advantageous, however they need strong governmental support to attract potential investors and guarantee deployment in the market. - Highlights: •Future efficiency and stability of the wind dominated require flexible generators. •Energy storage systems are the most technically advantageous flexible generators. •The advanced flexible CCGT is the most efficient solution from an economic point of view. •Traditional peaking plants (OCGT) is the least advantageous flexible generator. •The governments will play a key role in integration of the flexible technologies.

  15. Probing Protein Multidimensional Conformational Fluctuations by Single-Molecule Multiparameter Photon Stamping Spectroscopy

    Science.gov (United States)

    2015-01-01

    Conformational motions of proteins are highly dynamic and intrinsically complex. To capture the temporal and spatial complexity of conformational motions and further to understand their roles in protein functions, an attempt is made to probe multidimensional conformational dynamics of proteins besides the typical one-dimensional FRET coordinate or the projected conformational motions on the one-dimensional FRET coordinate. T4 lysozyme hinge-bending motions between two domains along α-helix have been probed by single-molecule FRET. Nevertheless, the domain motions of T4 lysozyme are rather complex involving multiple coupled nuclear coordinates and most likely contain motions besides hinge-bending. It is highly likely that the multiple dimensional protein conformational motions beyond the typical enzymatic hinged-bending motions have profound impact on overall enzymatic functions. In this report, we have developed a single-molecule multiparameter photon stamping spectroscopy integrating fluorescence anisotropy, FRET, and fluorescence lifetime. This spectroscopic approach enables simultaneous observations of both FRET-related site-to-site conformational dynamics and molecular rotational (or orientational) motions of individual Cy3-Cy5 labeled T4 lysozyme molecules. We have further observed wide-distributed rotational flexibility along orientation coordinates by recording fluorescence anisotropy and simultaneously identified multiple intermediate conformational states along FRET coordinate by monitoring time-dependent donor lifetime, presenting a whole picture of multidimensional conformational dynamics in the process of T4 lysozyme open-close hinge-bending enzymatic turnover motions under enzymatic reaction conditions. By analyzing the autocorrelation functions of both lifetime and anisotropy trajectories, we have also observed the dynamic and static inhomogeneity of T4 lysozyme multidimensional conformational fluctuation dynamics, providing a fundamental

  16. Molecular model for solubility of gases in flexible polymers

    DEFF Research Database (Denmark)

    Neergaard, Jesper; Hassager, Ole; Szabo, Peter

    1999-01-01

    We propose a model for a priori prediction of the solubility of gases in flexible polymers. The model is based on the concept of ideal solubility of gases in liquids. According to this concept, the mole fraction of gases in liquids is given by Raoult's law with the total pressure and the vapor...... pressure of the gas, where the latter may have to be extrapolated. However, instead of considering each polymer molecule as a rigid structure, we estimate the effective number of degrees of freedom from an equivalent freely jointed bead-rod model for the flexible polymer. In this model, we associate...... the length of the rods with the molecular weight corresponding to a Kuhn step. The model provides a tool for crude estimation of the gas solubility on the basis of only the monomer unit of the polymer and properties of the gas. A comparison with the solubility data for several gases in poly...

  17. Synthesis of interlocked molecules by olefin metathesis

    Science.gov (United States)

    Clark, Paul Gregory

    A large body of work in the Grubbs group has focused on the development of functional-group tolerant ruthenium alkylidene catalysts that perform a number of olefin metathesis reactions. These catalysts have seen application in a wide range of fields, including classic total synthesis as well as polymer and materials chemistry. One particular family of compounds, interlocked molecules, has benefitted greatly from these advances in catalyst stability and activity. This thesis describes several elusive and challenging interlocked architectures whose syntheses have been realized through the utilization of different types of ruthenium-catalyzed olefin metathesis reactions. Ring-closing olefin metathesis has enabled the synthesis of a [c2]daisy-chain dimer with the ammonium binding site near the cap of the dimer. A deprotonated DCD possessing such a structural attribute will more forcefully seek to restore coordinating interactions upon reprotonation, enhancing its utility as a synthetic molecular actuator. Dimer functionalization facilitated incorporation into linear polymers, with a 48% size increase of an unbound, extended analogue of the polymer demonstrating slippage of the dimer units. Ongoing work is directed at further materials studies, in particular, exploring the synthesis of macroscopic networks containing the DCD units and analyzing the correlation between molecular-scale extension-contraction manipulations and resulting macro-scale changes. A "clipping" approach to a polycatenated cyclic polymer, a structure that resembles a molecular "charm bracelet", has been described. The use of ring-opening metathesis polymerization of a carbamate monomer in the presence of a chain transfer agent allowed for the synthesis of a linear polymer that was subsequently functionalized and cyclized to the corresponding cyclic analogue. This cyclic polymer was characterized through a variety of techniques, and subjected to further functionalization reactions, affording a cyclic

  18. Cell Adhesion Molecules and Ubiquitination—Functions and Significance

    Science.gov (United States)

    Homrich, Mirka; Gotthard, Ingo; Wobst, Hilke; Diestel, Simone

    2015-01-01

    Cell adhesion molecules of the immunoglobulin (Ig) superfamily represent the biggest group of cell adhesion molecules. They have been analyzed since approximately 40 years ago and most of them have been shown to play a role in tumor progression and in the nervous system. All members of the Ig superfamily are intensively posttranslationally modified. However, many aspects of their cellular functions are not yet known. Since a few years ago it is known that some of the Ig superfamily members are modified by ubiquitin. Ubiquitination has classically been described as a proteasomal degradation signal but during the last years it became obvious that it can regulate many other processes including internalization of cell surface molecules and lysosomal sorting. The purpose of this review is to summarize the current knowledge about the ubiquitination of cell adhesion molecules of the Ig superfamily and to discuss its potential physiological roles in tumorigenesis and in the nervous system. PMID:26703751

  19. Single Molecule Electronics and Devices

    Science.gov (United States)

    Tsutsui, Makusu; Taniguchi, Masateru

    2012-01-01

    The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345

  20. RASPA: molecular simulation software for adsorption and diffusion in flexible nanoporous materials

    NARCIS (Netherlands)

    Dubbeldam, D.; Calero, S.; Ellis, D.E.; Snurr, R.Q.

    2016-01-01

    A new software package, RASPA, for simulating adsorption and diffusion of molecules in flexible nanoporous materials is presented. The code implements the latest state-of-the-art algorithms for molecular dynamics and Monte Carlo (MC) in various ensembles including symplectic/measure-preserving

  1. Method for analyzing structural changes of flexible metal-organic frameworks induced by adsorbates

    NARCIS (Netherlands)

    Dubbeldam, D.; Krishna, R.; Snurr, R.Q.

    2009-01-01

    Metal−organic frameworks (MOFs) have crystal structures that exhibit unusual flexibility. An extreme example is that of the "breathing MOF" MIL-53 that expands or shrinks to admit guest molecules like CO2 and water. We present a powerful simulation tool to quickly calculate unit cell shape and size

  2. Taming Time with Flexible Work.

    Science.gov (United States)

    Stamps, David

    1995-01-01

    Because of increasing incidence of burnout among midlevel managers, many companies are reducing workload schedules, an arrangement that would have been unthinkable 10 years ago. Surveys have made the case that flexible work arrangements increase employee happiness and, therefore, productivity. (JOW)

  3. Flexible working motivates all staff.

    Science.gov (United States)

    2001-04-01

    A recent survey has demolished the myth that work-life balance is only of interest to women with children. The survey, commissioned by Lloyds TSB on behalf of the Employers for Work Life Balance organisation, shows that young workers and men are equally interested in flexible working arrangements that allow them to pursue interests outside of work.

  4. Distribution method optimization : inventory flexibility

    NARCIS (Netherlands)

    Asipko, D.

    2010-01-01

    This report presents the outcome of the Logistics Design Project carried out for Nike Inc. This project has two goals: create a model to measure a flexibility aspect of the inventory usage in different Nike distribution channels, and analyze opportunities of changing the decision model of splitting

  5. Flexible spintronic devices on Kapton

    DEFF Research Database (Denmark)

    Bedoya-Pinto, Amilcar; Donolato, Marco; Gobbi, Marco

    2014-01-01

    Magnetic tunnel junctions and nano-sized domain-wall conduits have been fabricated on the flexible substrate Kapton. Despite the delicate nature of tunneling barriers and zig-zag shaped nanowires, the devices show an outstanding integrity and robustness upon mechanical bending. High values of ben...

  6. Flexible Bistable Cholesteric Reflective Displays

    Science.gov (United States)

    Yang, Deng-Ke

    2006-03-01

    Cholesteric liquid crystals (ChLCs) exhibit two stable states at zero field condition-the reflecting planar state and the nonreflecting focal conic state. ChLCs are an excellent candidate for inexpensive and rugged electronic books and papers. This paper will review the display cell structure,materials and drive schemes for flexible bistable cholesteric (Ch) reflective displays.

  7. Requirements for flexible learner monitoring

    NARCIS (Netherlands)

    Glahn, Christian; Specht, Marcus; Koper, Rob

    2007-01-01

    Glahn, C., Specht, M., & Koper, R. (2007). Requirements for flexible learner monitoring. In T. Navarette, J. Blat & R. Koper (Eds.). Proceedings of the 3rd TENCompetence Open Workshop 'Current Research on IMS Learning Design and Lifelong Competence Development Infrastructures' (pp. 89-96). June,

  8. Flexible Schedules and Shift Work.

    Science.gov (United States)

    Beers, Thomas M.

    2000-01-01

    Flexible work hours have gained prominence, as more than 25 million workers (27.6% of all full-time workers) can now vary their schedules. However, there has been little change since the mid-1980s in the proportion who work a shift other than a regular daytime shift. (JOW)

  9. Easy and flexible mixture distributions

    DEFF Research Database (Denmark)

    Fosgerau, Mogens; Mabit, Stefan L.

    2013-01-01

    We propose a method to generate flexible mixture distributions that are useful for estimating models such as the mixed logit model using simulation. The method is easy to implement, yet it can approximate essentially any mixture distribution. We test it with good results in a simulation study...

  10. Functional flexibility and team performance

    NARCIS (Netherlands)

    Molleman, E.; Slomp, J.

    1999-01-01

    This study deals with workforce flexibility defined in terms of 'multifunctionality' and 'redundancy'. These concepts refer, respectively, to the number of different tasks a worker has mastered and the number of workers that are qualified to do a specific task. A third factor to be considered is

  11. Flexible Work Schedules. ERIC Digest.

    Science.gov (United States)

    Kerka, Sandra

    Flexible work schedules are one response to changes in the composition of the work force, new life-styles, and changes in work attitudes. Types of alternative work schedules are part-time and temporary employment, job sharing, and flextime. Part-time workers are a diverse group--women, the very young, and older near-retirees. Although part-time…

  12. Light Management in Flexible OLEDs

    NARCIS (Netherlands)

    Harkema, S.; Pendyala, R.K.; Geurts, C.G.C.; Helgers, P.L.J.; Levell, J.W.; Wilson, J.S.; MacKerron, D.

    2014-01-01

    Organic light-emitting diodes (OLEDs) are a promising lighting technology. In particular OLEDs fabricated on plastic foils are believed to hold the future. These planar devices are subject to various optical losses, which requires sophisticated light management solutions. Flexible OLEDs on plastic

  13. Rationality, decision flexibility and pensions

    NARCIS (Netherlands)

    Koç, Emre

    2015-01-01

    In this thesis several different aspects of the standard economic theory (SET) are examined. One of the premises of the SET is that whether or not an agent has choice flexibility does not influence his behavior. In the first chapter of the thesis we design an experiment to test the validity of this

  14. Flexible devices: from materials, architectures to applications

    Science.gov (United States)

    Zou, Mingzhi; Ma, Yue; Yuan, Xin; Hu, Yi; Liu, Jie; Jin, Zhong

    2018-01-01

    Flexible devices, such as flexible electronic devices and flexible energy storage devices, have attracted a significant amount of attention in recent years for their potential applications in modern human lives. The development of flexible devices is moving forward rapidly, as the innovation of methods and manufacturing processes has greatly encouraged the research of flexible devices. This review focuses on advanced materials, architecture designs and abundant applications of flexible devices, and discusses the problems and challenges in current situations of flexible devices. We summarize the discovery of novel materials and the design of new architectures for improving the performance of flexible devices. Finally, we introduce the applications of flexible devices as key components in real life. Project supported by the National Key R&D Program of China (Nos. 2017YFA0208200, 2016YFB0700600, 2015CB659300), the National Natural Science Foundation of China (Nos. 21403105, 21573108), and the Fundamental Research Funds for the Central Universities (No. 020514380107).

  15. Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

    Energy Technology Data Exchange (ETDEWEB)

    Serer, María I.; Bonomi, Hernán R. [IIBBA–CONICET, Avenida Patricias Argentinas 435, C1405BWE Buenos Aires (Argentina); Guimarães, Beatriz G. [Synchrotron SOLEIL, L’Orme des Merisiers, Saint-Aubin BP 48, 91192 Gif-sur-Yvette CEDEX (France); Rossi, Rolando C. [Universidad de Buenos Aires, Junín 956, C1113AAD Buenos Aires (Argentina); Goldbaum, Fernando A.; Klinke, Sebastián, E-mail: sklinke@leloir.org.ar [IIBBA–CONICET, Avenida Patricias Argentinas 435, C1405BWE Buenos Aires (Argentina)

    2014-05-01

    This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one molecule of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C{sub 3} symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity.

  16. Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

    International Nuclear Information System (INIS)

    Serer, María I.; Bonomi, Hernán R.; Guimarães, Beatriz G.; Rossi, Rolando C.; Goldbaum, Fernando A.; Klinke, Sebastián

    2014-01-01

    This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one molecule of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C 3 symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity

  17. Literacy processes cognitive flexibility in learning and teaching

    CERN Document Server

    Cartwright, Kelly B

    2015-01-01

    Reading and writing instruction require individuals--both students and teachers--to flexibly process many kinds of information, from a variety of sources. This is the first book to provide an in-depth examination of cognitive flexibility: how it develops across the lifespan; its role in specific literacy processes, such as phonemic awareness, word recognition, and comprehension; and implications for improving literacy instruction and teacher education. The contributors include leading researchers in literacy, psychology, and cognitive development, who summarize the current state of the science

  18. Single Molecule Nanoelectrochemistry in Electrical Junctions.

    Science.gov (United States)

    Nichols, Richard J; Higgins, Simon J

    2016-11-15

    gating. This has been referred to as to a "single molecule transistor configuration" with the gate voltage being provided by the controllable potential achieved through the electrochemical double layer. It is shown how the electrolyte medium can control such gating, with ionic liquids providing more efficient gate coupling than aqueous electrolytes. Control of the conductance of viologen molecular wires can also be achieved by encapsulating the viologen redox moiety within a molecular cage, thereby controlling its immediate environment. Molecular conductance can also be gated through multiple redox states. This has been shown for the redox moiety pyrrolo-tetrathiafulvalene, which undergoes single molecule electrochemical transistor gating through three redox states in molecular junctions. Charge transport through this junction follows a two-step hopping mechanism, demonstrating the role of the redox center in electron transfer across the molecular bridge. Recent electrolyte gating studies of rigid, conjugated redox-active metal complexes with tailored terpyridine coordinating ligands and anchors are also presented. These aforementioned studies have all been performed with gold electrode contacts. The Account concludes with recent data showing that it is now possible to study single molecule electrochemical gating with nickel electrodes. This opens up new perspectives for studying interfacial charge transfer with a wide variety of other electrode materials including semiconductor electrodes and also points toward future opportunities for coupling molecular spintronics and nanoelectrochemistry.

  19. Spin tunneling in magnetic molecules

    Science.gov (United States)

    Kececioglu, Ersin

    In this thesis, we will focus on spin tunneling in a family of systems called magnetic molecules such as Fe8 and Mn12. This is comparatively new, in relation to other tunneling problems. Many issues are not completely solved and/or understood yet. The magnetic molecule Fe 8 has been observed to have a rich pattern of degeneracies in its magnetic spectrum. We focus on these degeneracies from several points of view. We start with the simplest anisotropy Hamiltonian to describe the Fe 8 molecule and extend our discussion to include higher order anisotropy terms. We give analytical expressions as much as we can, for the degeneracies in the semi-classical limit in both cases. We reintroduce jump instantons to the instanton formalism. Finally, we discuss the effect of the environment on the molecule. Our results, for all different models and techniques, agree well with both experimental and numerical results.

  20. Experimental decoherence in molecule interferometry

    International Nuclear Information System (INIS)

    Hackermueller, L.; Hornberger, K.; Stibor, A.; Zeilinger, A.; Arndt, M.; Kiesewetter, G.

    2005-01-01

    Full text: We present three mechanisms of decoherence that occur quite naturally in matter wave interferometer with large molecules. One way molecules can lose coherence is through collision with background gas particles. We observe a loss of contrast with increasing background pressure for various types of gases. We can understand this phenomenon quantitatively with a new model for collisional decoherence which corrects older models by a factor of 2 π;. The second experiment studies the thermal emission of photons related to the high internal energy of the interfering molecules. When sufficiently many or sufficiently short photons are emitted inside the interferometer, the fringe contrast is lost. We can continuously vary the temperature of the molecules and compare the loss of contrast with a model based on decoherence theory. Again we find good quantitative agreement. A third mechanism that influences our interference pattern is dephasing due to vibrations of the interference gratings. By adding additional vibrations we study this effect in more detail. (author)

  1. Specialization and Flexibility in Port Cargo Handling

    Directory of Open Access Journals (Sweden)

    Hakkı KİŞİ

    2016-11-01

    Full Text Available Cargo handling appears to be the fundamental function of ports. In this context, the question of type of equipment and capacity rate need to be tackled with respect to cargo handling principles. The purpose of this study is to discuss the types of equipment to be used in ports, relating the matter to costs and capacity. The question is studied with a basic economic theoretical approach. Various conditions like port location, size, resources, cargo traffic, ships, etc. are given parameters to dictate the type and specification of the cargo handling equipment. Besides, a simple approach in the context of cost capacity relation can be useful in deciding whether to use specialized or flexible equipment. Port equipment is sometimes expected to be flexible to handle various types of cargo as many as possible and sometimes to be specialized to handle one specific type of cargo. The cases that might be suitable for those alternatives are discussed from an economic point of view in this article. Consequently, effectiveness and efficiency criteria play important roles in determining the handling equipment in ports.

  2. Integrated flexible capacity and inventory management under flexible capacity uncertainty

    OpenAIRE

    Paç, Mehmet Fazıl

    2006-01-01

    Cataloged from PDF version of article. In a manufacturing environment with volatile demand, inventory management can be coupled with dynamic capacity adjustments for handling the fluctuations more effectively. In this study we consider the integrated management of inventory and flexible capacity management under seasonal stochastic demand and uncertain labor supply. The capacity planning problem is investigated from the workforce planning perspective. We consider a manufactu...

  3. Flexible Learning Environments: Leveraging the Affordances of Flexible Delivery and Flexible Learning

    Science.gov (United States)

    Hill, Janette R.

    2006-01-01

    The purpose of this article is to explore the key features of "flexible learning environments" (FLEs). Key principles associated with FLEs are explained. Underlying tenets and support mechanisms necessary for the implementation of FLEs are described. Similarities and differences in traditional learning and FLEs are explored. Finally, strategies…

  4. Photoionization of atoms and molecules

    International Nuclear Information System (INIS)

    Samson, J.A.R.

    1976-01-01

    A literature review on the present state of knowledge in photoionization is presented. Various experimental techniques that have been developed to study photoionization, such as fluorescence and photoelectron spectroscopy, mass spectroscopy, are examined. Various atoms and molecules were chosen to illustrate these techniques, specifically helium and xenon atoms and hydrogen molecules. Specialized photoionization such as in positive and negative ions, excited states, and free radicals is also treated. Absorption cross sections and ionization potentials are also discussed

  5. Low pressure tritiation of molecules

    International Nuclear Information System (INIS)

    Moran, T.F.; Powers, J.C.; Lively, M.O.

    1980-01-01

    A method is described of tritiating sensitive biological molecules by depositing molecules of the substance to be tritiated on a supporting substrate in an evacuated vacuum chamber near, but not in the path of, an electron beam which traverses the chamber, admitting tritium gas into the chamber, and subjecting the tritium to the electron beam. Vibrationally excited tritium gas species are generated which collide and react with the substance thus incorporating tritium atoms into the substance. (U.K.)

  6. Graphene-based materials for flexible supercapacitors.

    Science.gov (United States)

    Shao, Yuanlong; El-Kady, Maher F; Wang, Lisa J; Zhang, Qinghong; Li, Yaogang; Wang, Hongzhi; Mousavi, Mir F; Kaner, Richard B

    2015-06-07

    The demand for flexible/wearable electronic devices that have aesthetic appeal and multi-functionality has stimulated the rapid development of flexible supercapacitors with enhanced electrochemical performance and mechanical flexibility. After a brief introduction to flexible supercapacitors, we summarize current progress made with graphene-based electrodes. Two recently proposed prototypes for flexible supercapacitors, known as micro-supercapacitors and fiber-type supercapacitors, are then discussed. We also present our perspective on the development of graphene-based electrodes for flexible supercapacitors.

  7. Global bending quantum number and the absence of monodromy in the HCN-CNH molecule

    NARCIS (Netherlands)

    Efstathiou, K; Joyeux, M; Sadovskií, D. A.

    We introduce and analyze a model system based on a deformation of a spherical pendulum that can be used to reproduce large amplitude bending vibrations of flexible triatomic molecules with two stable linear equilibria. On the basis of our model and the recent vibrational potential [ J. Chem. Phys.

  8. Flavonoids – Small Molecules, High Hopes

    Directory of Open Access Journals (Sweden)

    Sandu Mariana

    2017-07-01

    Full Text Available This brief review takes a look at flavonoids, a wide class of polyphenols, which are regarded as plant secondary metabolites. Their roles in plants are diverse and little understood. They can act as growth hormone modulators, phytoalexins, they offer UV protection, contribute to pollen viability and can function as signaling molecules in establishing symbiotic relationships. Flavonoids were also found to have a range of beneficial effects for the human body. Their anticancer, antioxidant, anti-inflammatory and cardioprotective activity, as well as their antibacterial, antiviral and antihelmintic properties make them promising candidates for the design of new drugs.

  9. Excipients used in lyophilization of small molecules

    Directory of Open Access Journals (Sweden)

    Ankit Baheti

    2010-03-01

    Full Text Available This review deals with the excipients used in various lyophilized formulations of small molecules. The role of excipients such as bulking agents, buffering agents, tonicity modifiers, antimicrobial agents, surfactants and co-solvents has been discussed. Additionally, a decision making process for their incorporation into the formulation matrix has been proposed. A list of ingredients used in lyophilized formulations marketed in USA has been created based on a survey of the Physician Desk Reference (PDR and the Handbook on Injectable Drugs. Information on the recommended quantities of various excipients has also been provided, based on the details given in the Inactive Ingredient Guide (IIG.

  10. The novel 2Fe–2S outer mitochondrial protein mitoNEET displays conformational flexibility in its N-terminal cytoplasmic tethering domain

    International Nuclear Information System (INIS)

    Conlan, Andrea R.; Paddock, Mark L.; Axelrod, Herbert L.; Cohen, Aina E.; Abresch, Edward C.; Wiley, Sandra; Roy, Melinda; Nechushtai, Rachel; Jennings, Patricia A.

    2009-01-01

    The crystal structure of the anti-diabetic drug target mitoNEET obtained from a GFP fusion construct (1.4 Å resolution, R factor = 20.2%) shows that the CDGSH 2Fe–2S binding domains are superimposable with previously determined non-fused constructs. However, there is considerable flexibility in the position of the outer mitochondrial tethering arms resulting in two different conformations in the crystal structure. A primary role for mitochondrial dysfunction is indicated in the pathogenesis of insulin resistance. A widely used drug for the treatment of type 2 diabetes is pioglitazone, a member of the thiazolidinedione class of molecules. MitoNEET, a 2Fe–2S outer mitochondrial membrane protein, binds pioglitazone [Colca et al. (2004 ▶), Am. J. Physiol. Endocrinol. Metab.286, E252–E260]. The soluble domain of the human mitoNEET protein has been expressed C-terminal to the superfolder green fluorescent protein and the mitoNEET protein has been isolated. Comparison of the crystal structure of mitoNEET isolated from cleavage of the fusion protein (1.4 Å resolution, R factor = 20.2%) with other solved structures shows that the CDGSH domains are superimposable, indicating proper assembly of mitoNEET. Furthermore, there is considerable flexibility in the position of the cytoplasmic tethering arms, resulting in two different conformations in the crystal structure. This flexibility affords multiple orientations on the outer mitochondrial membrane

  11. [Aerodynamic focusing of particles and heavy molecules

    International Nuclear Information System (INIS)

    de la Mora, J.F.

    1990-01-01

    By accelerating a gas containing suspended particles or large molecules through a converging nozzle, the suspended species may be focused and therefore used to write fine lines on a surface. Our objective was to study the limits on how narrow this focal region could be as a function of particle size. We find that, for monodisperse particles with masses m p some 3.6 x 10 5 times larger than the molecular mass m of the carrier gas (diameters above some 100 angstrom), there is no fundamental obstacle to directly write submicron features. However, this conclusion has been verified experimentally only with particles larger than 0.1 μm. Experimental, theoretical and numerical studies on the defocusing role of Brownian motion for very small particles or heavy molecules have shown that high resolution (purely aerodynamic) focusing is impossible with volatile molecules whose masses are typically smaller than 1000 Dalton. For these, the minimal focal diameter after optimization appears to be 5√(m/m p ) times the nozzle diameter d n . But combinations of focused lasers and aerodynamic focusing appear as promising for direct writing with molecular precursors. Theoretical and numerical schemes capable of predicting the evolution of the focusing beam, including Brownian motion effects, have been developed, although further numerical work would be desirable. 11 refs

  12. [Flexibility of cognitive activity depends on its context].

    Science.gov (United States)

    Kostandov, É A

    2010-01-01

    The main purpose of this survey is to explain the importance of set-shifting for a flexible cognitive activity. Working memory overload may result in set-shifting slowdown, i.e., in a more rigid set and in a less flexible cognitive activity. This effect displays itself in an increase of erroneous perceptions of external stimuli. Set rigidity level also depends on the cognitive activity context (i.e., on the type of external stimuli the person has to deal with). We analyzed EEG-coherence function and induced synchronization/desynchronization responses in theta (4-7 Hz) and low alpha (8-10 Hz) bands. Basing on these data, we discuss the role of tonic and phasic forms of cortico-hippocampal and fronto-thalamic systems' activation in cognitive activity flexibility.

  13. Flexible anodized aluminum oxide membranes with customizable back contact materials.

    Science.gov (United States)

    Nadimpally, B; Jarro, C A; Mangu, R; Rajaputra, S; Singh, V P

    2016-12-16

    Anodized aluminum oxide (AAO) membranes were fabricated using flexible substrate/carrier material. This method facilitates the use of AAO templates with many different materials as substrates that are otherwise incompatible with most anodization techniques. Thin titanium (Ti) and tungsten (W) layers were employed as interlayer materials. Titanium enhances adhesion. Tungsten not only helps eliminate the barrier layer but also plays a critical role in enabling the use of flexible substrates. The resulting flexible templates provide new, exciting opportunities in photovoltaic and other device applications. CuInSe 2 nanowires were electrochemically deposited into porous AAO templates with molybdenum (Mo) as the back contact material. The feasibility of using any material to form a contact with semiconductor nanowires has been demonstrated for the first time enabling new avenues in photovoltaic applications.

  14. Flexible anodized aluminum oxide membranes with customizable back contact materials

    Science.gov (United States)

    Nadimpally, B.; Jarro, C. A.; Mangu, R.; Rajaputra, S.; Singh, V. P.

    2016-12-01

    Anodized aluminum oxide (AAO) membranes were fabricated using flexible substrate/carrier material. This method facilitates the use of AAO templates with many different materials as substrates that are otherwise incompatible with most anodization techniques. Thin titanium (Ti) and tungsten (W) layers were employed as interlayer materials. Titanium enhances adhesion. Tungsten not only helps eliminate the barrier layer but also plays a critical role in enabling the use of flexible substrates. The resulting flexible templates provide new, exciting opportunities in photovoltaic and other device applications. CuInSe2 nanowires were electrochemically deposited into porous AAO templates with molybdenum (Mo) as the back contact material. The feasibility of using any material to form a contact with semiconductor nanowires has been demonstrated for the first time enabling new avenues in photovoltaic applications.

  15. Study of molecule-metal interfaces by means of the normal incidence X-ray standing wave technique

    International Nuclear Information System (INIS)

    Mercurio, Giuseppe

    2012-01-01

    Functional surfaces based on monolayers of organic molecules are currently subject of an intense research effort due to their applications in molecular electronics, sensing and catalysis. Because of the strong dependence of organic based devices on the local properties of the molecule-metal interface, a direct investigation of the interface chemistry is of paramount importance. In this context, the bonding distance, measured by means of the normal incidence X-ray standing wave technique (NIXSW), provides a direct access to the molecule-metal interactions. At the same time, NIXSW adsorption heights are used to benchmark different density functional theory (DFT) schemes and determine the ones with predictive power for similar systems. This work investigates the geometric and chemical properties of different molecule/metal interfaces, relevant to molecular electronics and functional surfaces applications, primarily by means of the NIXSW technique. All NIXSW data are analyzed with the newly developed open source program Torricelli, which is thoroughly documented in the thesis. In order to elucidate the role played by the substrate within molecule/metal interfaces, the prototype organic molecule 3,4,9,10-perylene-tetracarboxylic-dianhydride (PTCDA) is explored on the Ag(110) surface. The molecule results more distorted and at smaller bonding distances on the more reactive Ag(110) surface, in comparison with the Ag(100), the Ag(111) and Au(111) substrates. This conclusion follows from the detailed molecular adsorption geometry obtained from the differential analysis of nonequivalent carbon and oxygen species (including a careful error analysis). Subsequently, the chemisorptive PTCDA/Ag(110) interaction is tuned by the co-deposition of an external alkali metal, namely K. As a consequence, the functional groups of PTCDA unbind from the surface, which, in turn, undergoes major reconstruction. In fact, the resulting nanopatterned surface consists of alternated up and down

  16. Thermal ion-molecule reactions in oxygen-containing molecules

    International Nuclear Information System (INIS)

    Kumakura, Minoru

    1981-02-01

    The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)

  17. Fabrication of air-stable n-type carbon nanotube thin-film transistors on flexible substrates using bilayer dielectrics.

    Science.gov (United States)

    Li, Guanhong; Li, Qunqing; Jin, Yuanhao; Zhao, Yudan; Xiao, Xiaoyang; Jiang, Kaili; Wang, Jiaping; Fan, Shoushan

    2015-11-14

    Single-walled carbon nanotube (SWNT) thin-film transistors hold great potential for flexible electronics. However, fabrication of air-stable n-type devices by methods compatible with standard photolithography on flexible substrates is challenging. Here, we demonstrated that by using a bilayer dielectric structure of MgO and atomic layer deposited (ALD) Al2O3 or HfO2, air-stable n-type devices can be obtained. The mechanism for conduction type conversion was elucidated and attributed to the hole depletion in SWNT, the decrease of the trap state density by MgO assimilating adsorbed water molecules in the vicinity of SWNT, and the energy band bending because of the positive fixed charges in the ALD layer. The key advantage of the method is the relatively low temperature (120 or 90 °C) required here for the ALD process because we need not employ this step to totally remove the absorbates on the SWNTs. This advantage facilitates the integration of both p-type and n-type transistors through a simple lift off process and compact CMOS inverters were demonstrated. We also demonstrated that the doping of SWNTs in the channel plays a more important role than the Schottky barriers at the metal contacts in carbon nanotube thin-film transistors, unlike the situation in individual SWNT-based transistors.

  18. The effects of workplace flexibility on health behaviors: a cross-sectional and longitudinal analysis.

    Science.gov (United States)

    Grzywacz, Joseph G; Casey, Patrick R; Jones, Fiona A

    2007-12-01

    To examine the cross-sectional and longitudinal associations between workplace flexibility and health behaviors, and estimate the potential importance of flexibility for effective worksite health promotion programs. Cross-sectional and longitudinal health risk appraisal data were obtained from US based employees of a multinational pharmaceutical company (n = 3193). Examined health behaviors were hours of sleep, physical activity frequency, health education seminar attendance, frequency of practicing personal resilience techniques, and self-appraised lifestyle. Self-reported flexibility in the workplace was the primary independent variable. Each health behavior, except regular attendance in health education seminars, was positively related to perceived flexibility in cross-sectional analyses. Sleep and self-appraised lifestyle were significantly related to changes in perceived flexibility over time. Workplace flexibility may contribute to positive lifestyle behaviors, and may play an important role in effective worksite health promotion programs.

  19. Behavioral Flexibility Is Increased by Optogenetic Inhibition of Neurons in the Nucleus Accumbens Shell during Specific Time Segments

    Science.gov (United States)

    Aquili, Luca; Liu, Andrew W.; Shindou, Mayumi; Shindou, Tomomi; Wickens, Jeffery R.

    2014-01-01

    Behavioral flexibility is vital for survival in an environment of changing contingencies. The nucleus accumbens may play an important role in behavioral flexibility, representing learned stimulus-reward associations in neural activity during response selection and learning from results. To investigate the role of nucleus accumbens neural activity…

  20. Economic benefits of subsea flexible flowlines

    International Nuclear Information System (INIS)

    Hill, R.T.; Measamer, J.C.

    1993-01-01

    The development of marginal off-shore hydrocarbon deposits has resulted in production of increasingly corrosive fluids, thus furthering the need for pipelines capable of operating at elevated temperatures in the presence of high concentrations of H 2 S and CO 2 gases. Conventional pipelines require the use of stainless steels or other corrosion resistant alloys which drives up the cost of materials and fabrication/installation of the system. The use of flexible pipe is assuming an important role in these applications where the selection of compatible metallic and non-metallic components have resulted in cost effective alternatives. As development of marginal and aggressive hydrocarbon reservoirs increases operators are faced with providing systems which minimize the cost of field production. This paper describes the results of economic analyses of actual field developments in order to provide a methodology for selection of an appropriate pipeline technology to minimize life cycle costs of the flowline system