WorldWideScience

Sample records for flavivirus ns3 protein

  1. Hepatitis C virus NS3 protein polynucleotide-stimulated nucleoside triphosphatase and comparison with the related pestivirus and flavivirus enzymes.

    Science.gov (United States)

    Suzich, J A; Tamura, J K; Palmer-Hill, F; Warrener, P; Grakoui, A; Rice, C M; Feinstone, S M; Collett, M S

    1993-01-01

    Sequence motifs within the nonstructural protein NS3 of members of the Flaviviridae family suggest that this protein possesses nucleoside triphosphatase (NTPase) and RNA helicase activity. The RNA-stimulated NTPase activity of this protein from prototypic members of the Pestivirus and Flavivirus genera has recently been established and enzymologically characterized. Here, we experimentally demonstrate that the NS3 protein from a member of the third genus of Flaviviridae, human hepatitis C virus (HCV), also possesses a polynucleotide-stimulated NTPase activity. Characterization of the purified HCV NTPase activity showed that it exhibited reaction condition optima with respect to pH, MgCl2, and salt identical to those of the representative pestivirus and flavivirus enzymes. However, each NTPase also possessed several unique properties when compared with one another. Notably, the profile of polynucleotide stimulation of the NTPase activity was distinct for the three enzymes. The HCV NTPase was the only one whose activity was significantly enhanced by a deoxyribopolynucleotide. Additional distinguishing features among the three enzymes relating to the kinetic properties of their NTPase activities are discussed. These studies provide a foundation for investigation of the putative RNA helicase activity of these proteins and for further study of the role of the NS3 proteins of members of the Flaviviridae in the replication cycle of these viruses. Images PMID:8396675

  2. Flavivirus-cross-reactive, HLA-DR15-restricted epitope on NS3 recognized by human CD4+ CD8- cytotoxic T lymphocyte clones.

    Science.gov (United States)

    Kurane, I; Okamoto, Y; Dai, L C; Zeng, L L; Brinton, M A; Ennis, F A

    1995-09-01

    The role of flavivirus-cross-reactive T lymphocytes in recovery from and pathogenesis of flavivirus infections is not known. In the present paper, we have defined a flavivirus-cross-reactive epitope recognized by two CD4+ CD8- cytotoxic T lymphocyte (CTL) clones, JK4 and JK43. The T cell clones were established from the peripheral blood T lymphocytes of a dengue-4-immune donor, using a limiting-dilution method with dengue-4 antigen. These two T cell clones were cross-reactive for dengue virus types 1, 2, 3 and 4, yellow fever virus and West Nile virus, and recognized NS3 protein. The smallest synthetic peptide recognized by these T cell clones was an identical 9 amino acid peptide which contains amino acids 146 to 154 (VIGLYGNGV) of dengue-4 NS3. HLA-DR15 was the restriction allele for recognition of this epitope by JK4 and JK43. JK4 and JK43 both used T cell receptor V alpha 8, but JK4 used V beta 8 and JK43 used V beta 2. This result indicates that this epitope is recognized by two flavivirus-cross-reactive CD4+ T cell clones which originated from different T cells in vivo.

  3. Induction of a protective response in mice by the dengue virus NS3 protein using DNA vaccines.

    Science.gov (United States)

    Costa, Simone M; Yorio, Anna Paula; Gonçalves, Antônio J S; Vidale, Mariana M; Costa, Emmerson C B; Mohana-Borges, Ronaldo; Motta, Marcia A; Freire, Marcos S; Alves, Ada M B

    2011-01-01

    The dengue non-structural 3 (NS3) is a multifunctional protein, containing a serino-protease domain, located at the N-terminal portion, and helicase, NTPase and RTPase domains present in the C-terminal region. This protein is considered the main target for CD4+ and CD8+ T cell responses during dengue infection, which may be involved in protection. However, few studies have been undertaken evaluating the use of this protein as a protective antigen against dengue, as well as other flavivirus. In the present work, we investigate the protective efficacy of DNA vaccines based on the NS3 protein from DENV2. Different recombinant plasmids were constructed, encoding either the full-length NS3 protein or only its functional domains (protease and helicase), fused or not to a signal peptide (t-PA). The recombinant proteins were successfully expressed in transfected BHK-21 cells, and only plasmids encoding the t-PA signal sequence mediated protein secretion. Balb/c mice were immunized with the different DNA vaccines and challenged with a lethal dose of DENV2. Most animals immunized with plasmids encoding the full-length NS3 or the helicase domain survived challenge, regardless of the presence of the t-PA. However, some mice presented clinical signs of infection with high morbidity (hind leg paralysis and hunched posture), mainly in animal groups immunized with the DNA vaccines based on the helicase domain. On the other hand, inoculation with plasmids encoding the protease domain did not induce any protection, since mortality and morbidity rates in these mouse groups were similar to those detected in the control animals. The cellular immune response was analyzed by ELISPOT with a specific-CD8+ T cell NS3 peptide. Results revealed that the DNA vaccines based on the full-length protein induced the production of INF-γ, thus suggesting the involvement of this branch of the immune system in the protection.

  4. Translation of the flavivirus kunjin NS3 gene in cis but not its RNA sequence or secondary structure is essential for efficient RNA packaging.

    Science.gov (United States)

    Pijlman, Gorben P; Kondratieva, Natasha; Khromykh, Alexander A

    2006-11-01

    Our previous studies using trans-complementation analysis of Kunjin virus (KUN) full-length cDNA clones harboring in-frame deletions in the NS3 gene demonstrated the inability of these defective complemented RNAs to be packaged into virus particles (W. J. Liu, P. L. Sedlak, N. Kondratieva, and A. A. Khromykh, J. Virol. 76:10766-10775). In this study we aimed to establish whether this requirement for NS3 in RNA packaging is determined by the secondary RNA structure of the NS3 gene or by the essential role of the translated NS3 gene product. Multiple silent mutations of three computer-predicted stable RNA structures in the NS3 coding region of KUN replicon RNA aimed at disrupting RNA secondary structure without affecting amino acid sequence did not affect RNA replication and packaging into virus-like particles in the packaging cell line, thus demonstrating that the predicted conserved RNA structures in the NS3 gene do not play a role in RNA replication and/or packaging. In contrast, double frameshift mutations in the NS3 coding region of full-length KUN RNA, producing scrambled NS3 protein but retaining secondary RNA structure, resulted in the loss of ability of these defective RNAs to be packaged into virus particles in complementation experiments in KUN replicon-expressing cells. Furthermore, the more robust complementation-packaging system based on established stable cell lines producing large amounts of complemented replicating NS3-deficient replicon RNAs and infection with KUN virus to provide structural proteins also failed to detect any secreted virus-like particles containing packaged NS3-deficient replicon RNAs. These results have now firmly established the requirement of KUN NS3 protein translated in cis for genome packaging into virus particles.

  5. Differential humoral and cellular immunity induced by vaccination using plasmid DNA and protein recombinant expressing the NS3 protein of dengue virus type 3.

    Science.gov (United States)

    Hurtado-Melgoza, M L; Ramos-Ligonio, A; Álvarez-Rodríguez, L M; Meza-Menchaca, T; López-Monteon, A

    2016-12-01

    The dengue non-structural 3 (NS3) is a multifunctional protein, containing a serine-protease domain, located at the N-terminal portion, and helicase, NTPase and RTPase domains present in the C-terminal region. This protein is considered the main target for CD4+ and CD8+ T cell responses during dengue infection, which may be involved in protection. However, few studies have been undertaken evaluating the use of this protein as a protective antigen against dengue, as well as other flavivirus. In the present work we evaluated the potential of the NS3 (protease domain) as a protective antigen by comparing the administration of a recombinant protein versus a DNA vaccine in the mouse model. BALB/c mice were immunized with the recombinant protein NS3-DEN3 via intraperitoneal and with plasmid pcDNA3/NS3-DEN3 intramuscularly and the immune response was evaluated. The activity of T lymphocytes was analyzed by the MTT assay, and cells of mice immunized with the recombinant protein showed no activity when stimulated with the homologous protein. However, cells from mice immunized with DNA, responded to stimulation with the recombinant protein. When the expression (RT-PCR) and cytokine production (ELISA) was evaluated in the splenocytes, different behavior depending on the type of immunization was observed, splenocytes of mice immunized with the recombinant protein expressed cytokines such as IL-4, IL-10 and produced high concentrations of IL-1, IL-6 and TNFα. Splenocytes from mice immunized with DNA expressed IL-2 and IFNγ and did not produce IL-6. In addition, immunization with the recombinant protein induced the production of antibodies that are detected up to a dilution 1:3200 by ELISA and Western blot assays, however, the serum of mice immunized with DNA presented no detectable antibody titers. The results obtained in this study show that administration of pcDNA3/NS3-DEN3 induces a favorable response in the activation of T lymphocytes with low production of specific

  6. A Novel Adeno-Associated Virus-Based Genetic Vaccine Encoding the Hepatitis C Virus NS3/4 Protein Exhibits Immunogenic Properties in Mice Superior to Those of an NS3-Protein-Based Vaccine.

    Directory of Open Access Journals (Sweden)

    Fengqin Zhu

    Full Text Available More than 170 million individuals worldwide are infected with hepatitis C virus (HCV, and up to an estimated 30% of chronically infected individuals will go on to develop progressive liver disease. Despite the recent advances in antiviral treatment of HCV infection, it remains a major public health problem. Thus, development of an effective vaccine is urgently required. In this study, we constructed novel adeno-associated virus (AAV vectors expressing the full-length NS3 or NS3/4 protein of HCV genotype 1b. The expression of the NS3 or NS3/4 protein in HepG2 cells was confirmed by western blotting. C57BL/6 mice were intramuscularly immunised with a single injection of AAV vectors, and the resultant immune response was investigated. The AAV2/rh32.33.NS3/4 vaccine induced stronger humoral and cellular responses than did the AAV2/rh32.33.NS3 vaccine. Our results demonstrate that AAV-based vaccines exhibit considerable potential for the development of an effective anti-HCV vaccine.

  7. Translation of the flavivirus kunjin NS3 gene in cis but not its RNA sequence or secondary structure is essential for efficient RNA packaging

    NARCIS (Netherlands)

    Pijlman, G.P.; Kondratieva, N.; Khromykh, A.A.

    2006-01-01

    Our previous studies using trans-complementation analysis of Kunjin virus (KUN) full-length cDNA clones harboring in-frame deletions in the NS3 gene demonstrated the inability of these defective complemented RNAs to be packaged into virus particles (W. J. Liu, P. L. Sedlak, N. Kondratieva, and A. A.

  8. A DIVA system based on the detection of antibodies to non-structural protein 3 (NS3) of Bluetongue virus

    OpenAIRE

    2009-01-01

    Abstract Vaccination programs for the control of bluetongue (BT) in ruminants have limitations due to difficulties in differentiating between vaccinated and virus infected animals (DIVA). To overcome this problem a DIVA test that looks at a differential immune response to bluetongue virus (BTV) non-structural protein 3 (NS3) was developed. The NS3 encoding gene of strain BTV4/22045/PT04 was inserted into expression vector pET-28a and expressed in Escherichia coli strain JM109. Reco...

  9. Definition of the region on NS3 which contains multiple epitopes recognized by dengue virus serotype-cross-reactive and flavivirus-cross-reactive, HLA-DPw2-restricted CD4+ T cell clones.

    Science.gov (United States)

    Okamoto, Y; Kurane, I; Leporati, A M; Ennis, F A

    1998-04-01

    The epitopes recognized by six CD4+ CD8- cytotoxic T lymphocyte (CTL) clones established from a dengue-3 virus-immune donor were defined. (i) Three CTL clones, JK10, JK34 and JK39, were cross-reactive for dengue virus types 1-4. (ii) One clone, JK28, was cross-reactive for dengue virus types 1-4 and West Nile virus. (iii) Two clones, JK26 and JK49, were cross-reactive for dengue virus types 1-4, West Nile virus and yellow fever virus. The clones, except for JK49, recognized the same epitope on NS3 in an HLA-DPw2-restricted fashion. The smallest synthetic peptide recognized by the five CTL clones was a 10 aa peptide which comprises aa 255-264 on dengue virus NS3. JK49 recognized the overlapping epitope which comprises aa 257-266 in an HLA-DPw2-restricted fashion. Analysis of T cell receptor (TCR) usage by these T cell clones revealed that (i) JK10 and JK34 use V alpha11, and JK34 and JK28 use V beta23, and (ii) the amino acid sequences of the V(D)J junctional region of the TCR were different among these five CTL clones. There were, however, single amino acid conservations among TCRs of some of these T cell clones. These results indicate that the region on NS3 which comprises aa 255-266 contains multiple epitopes recognized by dengue serotype-cross-reactive and flavivirus-cross-reactive CD4+ CTL in an HLA-DPw2-restricted fashion and that a single epitope can be recognized by T cells which have heterogeneous virus specificities.

  10. Synergistic interactions between the NS3(hel and E proteins contribute to the virulence of dengue virus type 1.

    Directory of Open Access Journals (Sweden)

    Luana de Borba

    Full Text Available BACKGROUND: Dengue includes a broad range of symptoms, ranging from fever to hemorrhagic fever and may occasionally have alternative clinical presentations. Many possible viral genetic determinants of the intrinsic virulence of dengue virus (DENV in the host have been identified, but no conclusive evidence of a correlation between viral genotype and virus transmissibility and pathogenicity has been obtained. METHODOLOGY/PRINCIPAL FINDINGS: We used reverse genetics techniques to engineer DENV-1 viruses with subsets of mutations found in two different neuroadapted derivatives. The mutations were inserted into an infectious clone of DENV-1 not adapted to mice. The replication and viral production capacity of the recombinant viruses were assessed in vitro and in vivo. The results demonstrated that paired mutations in the envelope protein (E and in the helicase domain of the NS3 (NS3(hel protein had a synergistic effect enhancing viral fitness in human and mosquito derived cell lines. E mutations alone generated no detectable virulence in the mouse model; however, the combination of these mutations with NS3(hel mutations, which were mildly virulent on their own, resulted in a highly neurovirulent phenotype. CONCLUSIONS/SIGNIFICANCE: The generation of recombinant viruses carrying specific E and NS3(hel proteins mutations increased viral fitness both in vitro and in vivo by increasing RNA synthesis and viral load (these changes being positively correlated with central nervous system damage, the strength of the immune response and animal mortality. The introduction of only pairs of amino acid substitutions into the genome of a non-mouse adapted DENV-1 strain was sufficient to alter viral fitness substantially. Given current limitations to our understanding of the molecular basis of dengue neuropathogenesis, these results could contribute to the development of attenuated strains for use in vaccinations and provide insights into virus/host interactions

  11. Computational study on the inhibitor binding mode and allosteric regulation mechanism in hepatitis C virus NS3/4A protein.

    Directory of Open Access Journals (Sweden)

    Weiwei Xue

    Full Text Available HCV NS3/4A protein is an attractive therapeutic target responsible for harboring serine protease and RNA helicase activities during the viral replication. Small molecules binding at the interface between the protease and helicase domains can stabilize the closed conformation of the protein and thus block the catalytic function of HCV NS3/4A protein via an allosteric regulation mechanism. But the detailed mechanism remains elusive. Here, we aimed to provide some insight into the inhibitor binding mode and allosteric regulation mechanism of HCV NS3/4A protein by using computational methods. Four simulation systems were investigated. They include: apo state of HCV NS3/4A protein, HCV NS3/4A protein in complex with an allosteric inhibitor and the truncated form of the above two systems. The molecular dynamics simulation results indicate HCV NS3/4A protein in complex with the allosteric inhibitor 4VA adopts a closed conformation (inactive state, while the truncated apo protein adopts an open conformation (active state. Further residue interaction network analysis suggests the communication of the domain-domain interface play an important role in the transition from closed to open conformation of HCV NS3/4A protein. However, the inhibitor stabilizes the closed conformation through interaction with several key residues from both the protease and helicase domains, including His57, Asp79, Asp81, Asp168, Met485, Cys525 and Asp527, which blocks the information communication between the functional domains interface. Finally, a dynamic model about the allosteric regulation and conformational changes of HCV NS3/4A protein was proposed and could provide fundamental insights into the allosteric mechanism of HCV NS3/4A protein function regulation and design of new potent inhibitors.

  12. Role of nonstructural protein NS2A in flavivirus assembly

    NARCIS (Netherlands)

    Leung, J.Y.; Pijlman, G.P.; Kondratieva, N.; Hyde, J.; Mackenzie, J.M.; Khromykh, A.A.

    2008-01-01

    Flavivirus nonstructural (NS) proteins are involved in RNA replication and modulation of the host antiviral response; however, evidence is mounting that some NS proteins also have essential roles in virus assembly. Kunjin virus (KUN) NS2A is a small, hydrophobic, transmembrane protein that is part

  13. Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression

    Directory of Open Access Journals (Sweden)

    Hiscott John

    2006-09-01

    Full Text Available Abstract Background Hepatitis C virus (HCV encodes several proteins that interfere with the host cell antiviral response. Previously, the serine protease NS3/4A was shown to inhibit IFN-β gene expression by blocking dsRNA-activated retinoic acid-inducible gene I (RIG-I and Toll-like receptor 3 (TLR3-mediated signaling pathways. Results In the present work, we systematically studied the effect of all HCV proteins on IFN gene expression. NS2 and NS3/4A inhibited IFN gene activation. NS3/4A inhibited the Sendai virus-induced expression of multiple IFN (IFN-α, IFN-β and IFN-λ1/IL-29 and chemokine (CCL5, CXCL8 and CXCL10 gene promoters. NS2 and NS3/4A, but not its proteolytically inactive form NS3/4A-S139A, were found to inhibit promoter activity induced by RIG-I or its adaptor protein Cardif (or IPS-1/MAVS/VISA. Both endogenous and transfected Cardif were proteolytically cleaved by NS3/4A but not by NS2 indicating different mechanisms of inhibition of host cell cytokine production by these HCV encoded proteases. Cardif also strongly colocalized with NS3/4A at the mitochondrial membrane, implicating the mitochondrial membrane as the site for proteolytic cleavage. In many experimental systems, IFN priming dramatically enhances RNA virus-induced IFN gene expression; pretreatment of HEK293 cells with IFN-α strongly enhanced RIG-I expression, but failed to protect Cardif from NS3/4A-mediated cleavage and failed to restore Sendai virus-induced IFN-β gene expression. Conclusion HCV NS2 and NS3/4A proteins were identified as potent inhibitors of cytokine gene expression suggesting an important role for HCV proteases in counteracting host cell antiviral response.

  14. African horse sickness virus (AHSV) with a deletion of 77 amino acids in NS3/NS3a protein is not virulent and a safe promising AHS Disabled Infectious Single Animal (DISA) vaccine platform.

    Science.gov (United States)

    van Rijn, Piet A; Maris-Veldhuis, Mieke A; Potgieter, Christiaan A; van Gennip, René G P

    2018-04-05

    African horse sickness virus (AHSV) is a virus species in the genus Orbivirus of the family Reoviridae. Currently, nine serotypes have been defined showing limited cross neutralization. AHSV is transmitted by species of Culicoides biting midges and causes African Horse Sickness (AHS) in equids with a mortality up to 95% in naïve domestic horses. AHS has become a serious threat for countries outside Africa, since endemic Culicoides species in moderate climates are competent vectors of closely related bluetongue virus. AHS outbreaks cause huge economic losses in developing countries. In the developed world, outbreaks will result in losses in the equestrian industry and will have an enormous emotional impact on owners of pet horses. Live-attenuated vaccine viruses (LAVs) have been developed, however, safety of these LAVs are questionable due to residual virulence, reversion to virulence, and risk on virulent variants by reassortment between LAVs or with field AHSV. Research aims vaccines with improved profiles. Reverse genetics has recently being developed for AHSV and has opened endless possibilities including development of AHS vaccine candidates, such as Disabled Infectious Single Animal (DISA) vaccine. Here, virulent AHSV5 was recovered and its high virulence was confirmed by experimental infection of ponies. 'Synthetically derived' virulent AHSV5 with an in-frame deletion of 77 amino acids codons in genome segment 10 encoding NS3/NS3a protein resulted in similar in vitro characteristics as published NS3/NS3a knockout mutants of LAV strain AHSV4LP. In contrast to its highly virulent ancestor virus, this deletion AHSV5 mutant (DISA5) was completely safe for ponies. Two vaccinations with DISA5 as well as two vaccinations with DISA vaccine based on LAV strain AHSV4LP showed protection against lethal homologous AHSV. More research is needed to further improve efficacy, to explore the AHS DISA vaccine platform for all nine serotypes, and to study the vaccine profile

  15. X-ray structure of the pestivirus NS3 helicase and its conformation in solution.

    Science.gov (United States)

    Tortorici, M Alejandra; Duquerroy, Stéphane; Kwok, Jane; Vonrhein, Clemens; Perez, Javier; Lamp, Benjamin; Bricogne, Gerard; Rümenapf, Till; Vachette, Patrice; Rey, Félix A

    2015-04-01

    Pestiviruses form a genus in the Flaviviridae family of small enveloped viruses with a positive-sense single-stranded RNA genome. Viral replication in this family requires the activity of a superfamily 2 RNA helicase contained in the C-terminal domain of nonstructural protein 3 (NS3). NS3 features two conserved RecA-like domains (D1 and D2) with ATPase activity, plus a third domain (D3) that is important for unwinding nucleic acid duplexes. We report here the X-ray structure of the pestivirus NS3 helicase domain (pNS3h) at a 2.5-Å resolution. The structure deviates significantly from that of NS3 of other genera in the Flaviviridae family in D3, as it contains two important insertions that result in a narrower nucleic acid binding groove. We also show that mutations in pNS3h that rescue viruses from which the core protein is deleted map to D3, suggesting that this domain may be involved in interactions that facilitate particle assembly. Finally, structural comparisons of the enzyme in different crystalline environments, together with the findings of small-angle X-ray-scattering studies in solution, show that D2 is mobile with respect to the rest of the enzyme, oscillating between closed and open conformations. Binding of a nonhydrolyzable ATP analog locks pNS3h in a conformation that is more compact than the closest apo-form in our crystals. Together, our results provide new insight and bring up new questions about pNS3h function during pestivirus replication. Although pestivirus infections impose an important toll on the livestock industry worldwide, little information is available about the nonstructural proteins essential for viral replication, such as the NS3 helicase. We provide here a comparative structural and functional analysis of pNS3h with respect to its orthologs in other viruses of the same family, the flaviviruses and hepatitis C virus. Our studies reveal differences in the nucleic acid binding groove that could have implications for understanding the

  16. Expression of NS3/NS4A Proteins of Hepatitis C Virus in Huh7 Cells Following Engineering Its Eukaryotic Expression Vector.

    Science.gov (United States)

    Behzadi, Mohammad Amin; Alborzi, Abdolvahab; Pouladfar, Gholamreza; Dianatpour, Mehdi; Ziyaeyan, Mazyar

    2015-11-01

    Although the development of novel therapeutic regimens to combat hepatitis C virus (HCV) infection have been speeded up with successful results, no efficient vaccines exist yet. This study aimed to construct a eukaryotic expression vector encoding nonstructural proteins, NS3/NS4A, of HCV genotype 3a, and evaluate its expression on Huh7 cell surface. The NS3/NS4A sequence was isolated from a patient with HCV-3a chronic infection, cloned into intermediate vector pTZ57R/T, and then used for engineering a mammalian expression vector, pDisplay, to direct the respective protein to the secretory pathway and anchor it to the plasma membrane. The expression of the protein in Huh7 cell, which was transiently transfected with the vector using Lipofectamine, was determined by immunocytochemical staining assay with fluorescein isothiocyanate (FITC)-conjugated antibodies to the HA/myc tags located besides the fusion fragment. The results showed that the fragment was successfully amplified and cloned into a eukaryotic expression vector. Sequencing and enzyme digestion analysis confirmed the cloned gene completion and its correct position in the pDisply-NS3/NS4A plasmid. Immunocytochemical staining revealed that the target protein was expressed as a membrane-anchored protein in the Huh7 cells. This study can serve as a fundamental experiment for the construction of a NS3/NS4A eukaryotic expression vector and its expression in mammalian cells. Further research is underway to evaluate the fragment immunogenicity in lab animal models.

  17. Detection of dengue NS1 and NS3 proteins in placenta and umbilical cord in fetal and maternal death.

    Science.gov (United States)

    Nunes, Priscila Conrado Guerra; Paes, Marciano Viana; de Oliveira, Carlos Alberto Basilio; Soares, Ana Carla Gomes; de Filippis, Ana Maria Bispo; Lima, Monique da Rocha Queiroz; de Barcelos Alves, Ada Maria; da Silva, Juliana Fernandes Amorim; de Oliveira Coelho, Janice Mery Chicarino; de Carvalho Rodrigues, Francisco das Chagas; Nogueira, Rita Maria Ribeiro; Dos Santos, Flávia Barreto

    2016-08-01

    In Brazil, dengue is a public health problem with the occurrence of explosive epidemics. This study reports maternal and fetal deaths due to dengue and which tissues of placenta and umbilical cord were analyzed by molecular methods and immunohistochemistry. The dengue NS3 and NS1 detection revealed the viral presence in different cells from placenta and umbilical cord. In the latter, DENV-2 was detected at a viral titer of 1,02 × 10(4) amounts of viral RNA. It was shown that the DENV markers analyzed here may be an alternative approach for dengue fatal cases investigation, especially involving maternal and fetal death. J. Med. Virol. 88:1448-1452, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Organization of the Flavivirus RNA replicase complex.

    Science.gov (United States)

    Brand, Carolin; Bisaillon, Martin; Geiss, Brian J

    2017-11-01

    Flaviviruses, such as dengue, Japanese encephalitis, West Nile, yellow fever, and Zika viruses, are serious human pathogens that cause significant morbidity and mortality globally each year. Flaviviruses are single-stranded, positive-sense RNA viruses, and encode two multidomain proteins, NS3 and NS5, that possess all enzymatic activities required for genome replication and capping. NS3 and NS5 interact within virus-induced replication compartments to form the RNA genome replicase complex. Although the individual enzymatic activities of both proteins have been extensively studied and are well characterized, there are still gaps in our understanding of how they interact to efficiently coordinate their respective activities during positive-strand RNA synthesis and capping. Here, we discuss what is known about the structures and functions of the NS3 and NS5 proteins and propose a preliminary NS3:NS5:RNA interaction model based on a large body of literature about how the viral enzymes function, physical restraints between NS3 and NS5, as well as critical steps in the replication process. WIREs RNA 2017, 8:e1437. doi: 10.1002/wrna.1437 For further resources related to this article, please visit the WIREs website. © 2017 Wiley Periodicals, Inc.

  19. Novel nucleotide and amino acid covariation between the 5'UTR and the NS2/NS3 proteins of hepatitis C virus: bioinformatic and functional analyses.

    Directory of Open Access Journals (Sweden)

    Hung-Yu Sun

    Full Text Available Molecular covariation of highly polymorphic viruses is thought to have crucial effects on viral replication and fitness. This study employs association rule data mining of hepatitis C virus (HCV sequences to search for specific evolutionary covariation and then tests functional relevance on HCV replication. Data mining is performed between nucleotides in the untranslated regions 5' and 3'UTR, and the amino acid residues in the non-structural proteins NS2, NS3 and NS5B. Results indicate covariance of the 243(rd nucleotide of the 5'UTR with the 14(th, 41(st, 76(th, 110(th, 211(th and 212(th residues of NS2 and with the 71(st, 175(th and 621(st residues of NS3. Real-time experiments using an HCV subgenomic system to quantify viral replication confirm replication regulation for each covariant pair between 5'UTR₂₄₃ and NS2-41, -76, -110, -211, and NS3-71, -175. The HCV subgenomic system with/without the NS2 region shows that regulatory effects vanish without NS2, so replicative modulation mediated by HCV 5'UTR₂₄₃ depends on NS2. Strong binding of the NS2 variants to HCV RNA correlates with reduced HCV replication whereas weak binding correlates with restoration of HCV replication efficiency, as determined by RNA-protein immunoprecipitation assay band intensity. The dominant haplotype 5'UTR₂₄₃-NS2-41-76-110-211-NS3-71-175 differs according to the HCV genotype: G-Ile-Ile-Ile-Gly-Ile-Met for genotype 1b and A-Leu-Val-Leu-Ser-Val-Leu for genotypes 1a, 2a and 2b. In conclusion, 5'UTR₂₄₃ co-varies with specific NS2/3 protein amino acid residues, which may have significant structural and functional consequences for HCV replication. This unreported mechanism involving HCV replication possibly can be exploited in the development of advanced anti-HCV medication.

  20. Production of recombinant non-structural protein-3 hydrophobic domain deletion (NS3ΔHD) protein of bluetongue virus from prokaryotic expression system as an efficient diagnostic reagent.

    Science.gov (United States)

    Mohanty, Nihar Nalini; Chacko, Nirmal; Biswas, Sanchay Kumar; Chand, Karam; Pandey, Awadh Bihari; Mondal, Bimalendu; Hemadri, Divakar; Shivachandra, Sathish Bhadravati

    2016-09-01

    Serological diagnostics for bluetongue (BT), which is an infectious, non-contagious and arthropod-borne virus disease of ruminants, are primarily dependent on availability of high quality native or recombinant antigen(s) based on either structural/non-structural proteins in sufficient quantity. Non-structural proteins (NS1-NS4) of BT virus are presumed candidate antigens in development of DIVA diagnostics. In the present study, NS3 fusion gene encoding for NS3 protein containing the N- and C-termini with a deletion of two hydrophobic domains (118A to S141 aa and 162S to A182 aa) and intervening variable central domain (142D to K161 aa) of bluetongue virus 23 was constructed, cloned and over-expressed using prokaryotic expression system. The recombinant NS3ΔHD fusion protein (∼38 kDa) including hexa-histidine tag on its both termini was found to be non-cytotoxic to recombinant Escherichia coli cells and purified by affinity chromatography. The purified rNS3ΔHD fusion protein was found to efficiently detect BTV-NS3 specific antibodies in indirect-ELISA format with diagnostic sensitivity (DSn = 94.4%) and specificity (DSp = 93.9%). The study indicated the potential utility of rNS3ΔHD fusion protein as candidate diagnostic reagent in developing an indirect-ELISA for sero-surveillance of animals for BTV antibodies under DIVA strategy, wherever monovalent/polyvalent killed BT vaccine formulations devoid of NS proteins are being practiced for immunization. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  1. Recombinant Nonstructural 3 Protein, rNS3, of Hepatitis C Virus Along With Recombinant GP96 Induce IL-12, TNFα and α5integrin Expression in Antigen Presenting Cells

    Science.gov (United States)

    Hajizadeh, Mohammad Reza; Mokarram, Pooneh; Kamali sarvestani, Eskandar; Bolhassani, Azam; Mostafavi Pour, Zohreh

    2013-01-01

    Background Hepatitis C virus (HCV) infection is the main cause of chronic liver disease and to date there has been no vaccine development to prevent this infection. Among non-structural HCV proteins, NS3 protein is an excellent goal for a therapeutic vaccine, due to its large size and less variation in conserved regions. The immunogenic properties of heat shock proteins (HSPs) for instance GP96 have prompted investigations into their function as strong adjuvant to improve innate and adaptive immunity. Objectives The aim of this study was to examine additive effects of recombinant GP96 (rGP96) fragments accompanied by rNS3 on expression levels of α5integrin and pro-inflammatory cytokines, IL-12 and TNFα, in Antigen Presenting Cells (APCs). Materials and Methods Recombinant viral proteins (rNS3 and rRGD-NS3), N-terminal and C-terminal fragments of GP96 were produced and purified from E. coli in order to treat the cells; mouse spleen Dendritic Cells (DCs) and THP-1 macrophages. Results Our results showed that rNT-GP96 alone significantly increases the expression level of IL-12, TNFα and α5integrin in THP-1 macrophages and DCs, while IL-12 and TNFα expression levels were unaffected by either rNS3 or rRGD-NS3. Interestingly, the co-addition of these recombinant proteins with rNT-GP96 increased IL-12, TNFα and α5integrin expression. Pearson Correlation showed a direct association between α5integrin with IL-12 and TNF-α expression. Conclusions we have highlighted the role of rNS3 plus rNT-GP96 mediated by α5integrin in producing IL-12 and TNFα. It can be suggested that rNT-GP96 could enhance immunity characteristic of rNS3 protein via production of pro-inflammatory cytokines. PMID:24032046

  2. A Proline-Rich N-Terminal Region of the Dengue Virus NS3 Is Crucial for Infectious Particle Production.

    Science.gov (United States)

    Gebhard, Leopoldo G; Iglesias, Néstor G; Byk, Laura A; Filomatori, Claudia V; De Maio, Federico A; Gamarnik, Andrea V

    2016-06-01

    Dengue virus is currently the most important insect-borne viral human pathogen. Viral nonstructural protein 3 (NS3) is a key component of the viral replication machinery that performs multiple functions during viral replication and participates in antiviral evasion. Using dengue virus infectious clones and reporter systems to dissect each step of the viral life cycle, we examined the requirements of different domains of NS3 on viral particle assembly. A thorough site-directed mutagenesis study based on solvent-accessible surface areas of NS3 revealed that, in addition to being essential for RNA replication, different domains of dengue virus NS3 are critically required for production of infectious viral particles. Unexpectedly, point mutations in the protease, interdomain linker, or helicase domain were sufficient to abolish infectious particle formation without affecting translation, polyprotein processing, or RNA replication. In particular, we identified a novel proline-rich N-terminal unstructured region of NS3 that contains several amino acid residues involved in infectious particle formation. We also showed a new role for the interdomain linker of NS3 in virion assembly. In conclusion, we present a comprehensive genetic map of novel NS3 determinants for viral particle assembly. Importantly, our results provide evidence of a central role of NS3 in the coordination of both dengue virus RNA replication and particle formation. Dengue virus is an important human pathogen, and its prominence is expanding globally; however, basic aspects of its biology are still unclear, hindering the development of effective therapeutic and prophylactic treatments. Little is known about the initial steps of dengue and other flavivirus particle assembly. This process involves a complex interplay between viral and cellular components, making it an attractive antiviral target. Unpredictably, we identified spatially separated regions of the large NS3 viral protein as determinants for

  3. Sustained Specific and Cross-Reactive T Cell Responses to Zika and Dengue Virus NS3 in West Africa.

    Science.gov (United States)

    Herrera, Bobby Brooke; Tsai, Wen-Yang; Chang, Charlotte A; Hamel, Donald J; Wang, Wei-Kung; Lu, Yichen; Mboup, Souleymane; Kanki, Phyllis J

    2018-04-01

    Recent studies on the role of T cells in Zika virus (ZIKV) infection have shown that T cell responses to Asian ZIKV infection are important for protection, and that previous dengue virus (DENV) exposure amplifies the protective T cell response to Asian ZIKV. Human T cell responses to African ZIKV infection, however, remain unexplored. Here, we utilized the modified anthrax toxin delivery system to develop a flavivirus enzyme-linked immunosorbent spot (ELISPOT) assay. Using human ZIKV and DENV samples from Senegal, West Africa, our results demonstrate specific and cross-reactive T cell responses to nonstructural protein 3 (NS3). Specifically, we found that T cell responses to NS3 protease are ZIKV and DENV specific, but responses to NS3 helicase are cross-reactive. Sequential sample analyses revealed immune responses sustained many years after infection. These results have important implications for African ZIKV/DENV vaccine development, as well as for potential flavivirus diagnostics based on T cell responses. IMPORTANCE The recent Zika virus (ZIKV) epidemic in Latin America and the associated congenital microcephaly and Guillain-Barré syndrome have raised questions as to why we have not recognized these distinct clinical diseases in Africa. The human immunologic response to ZIKV and related flaviviruses in Africa represents a research gap that may shed light on the mechanisms contributing to protection. The goal of our study was to develop an inexpensive assay to detect and characterize the T cell response to African ZIKV and DENV. Our data show long-term specific and cross-reactive human immune responses against African ZIKV and DENV, suggesting the usefulness of a diagnostic based on the T cell response. Additionally, we show that prior flavivirus exposure influences the magnitude of the T cell response. The identification of immune responses to African ZIKV and DENV is of relevance to vaccine development. Copyright © 2018 American Society for Microbiology.

  4. Stress responses in flavivirus-infected cells: activation of unfolded protein response and autophagy

    Directory of Open Access Journals (Sweden)

    Ana-Belén eBlázquez

    2014-06-01

    Full Text Available The Flavivirus is a genus of RNA viruses that includes multiple long known human, animal and zoonotic pathogens such as Dengue virus, yellow fever virus, West Nile virus or Japanese encephalitis virus, as well as other less known viruses that represent potential threats for human and animal health such as Usutu or Zika viruses. Flavivirus replication is based on endoplasmic reticulum-derived structures. Membrane remodeling and accumulation of viral factors induce endoplasmic reticulum stress that results in activation of a cellular signaling response termed unfolded protein response (UPR, which can be modulated by the viruses for their own benefit. Concomitant with the activation of the UPR, an upregulation of the autophagic pathway in cells infected with different flaviviruses has also been described. This review addresses the current knowledge of the relationship between endoplasmic reticulum stress, UPR and autophagy in flavivirus-infected cells and the growing evidences for an involvement of these cellular pathways in the replication and pathogenesis of these viruses.

  5. Use of envelope domain III protein for detection and differentiation of flaviviruses in the Free State Province, South Africa.

    Science.gov (United States)

    Mathengtheng, Lehlohonolo; Burt, Felicity J

    2014-04-01

    The presence of the mosquito-borne flavivirus species West Nile virus (WNV) and Wesselsbron virus (WESSV) in southern Africa is well established; however, their true prevalence remains unknown. To date, the presence of tick-borne flaviviruses has not been confirmed in this region. Serological assays using reagents that can be handled in a biosafety level 2 or lower facility were developed and evaluated for the detection and differentiation of tick- and mosquito-borne flaviviruses in the Free State province of South Africa. A total of 2393 serum samples from a variety of species including humans, cattle, and sheep were tested using Kunjin virus (KUNV) cell lysate antigen for the detection of anti-flavivirus antibodies in an indirect immunoglobulin G (IgG) enzyme-linked immonosorbent assay (ELISA). To further differentiate positive reactors on the KUNV assay for antibodies against tick- or mosquito-borne flaviviruses, recombinant envelope domain III (r-EDIII) proteins of Langat virus (LGTV), WNV, and WESSV were expressed in a bacterial expression system and used in ELISA. A total of 722 samples were positive using the KUNV assay, of which 71, 457, and 431 were positive using the r-LGTVEDIII, r-WNVEDIII, and r-WESSVEDIII assays, respectively. A total of 70 samples were reactive using the KUNV assay but not using any of the other assays, suggesting that there are possibly other flaviviruses circulating in the Free State province for which specific r-EDIII assays were not available. Collectively, the results suggest a strong presence of flaviviruses co-circulating in the Free State province with an abundance of mosquito-borne flaviviruses. There is evidence suggesting the presence of tick-borne flaviviruses, but it has yet to be confirmed. The EDIII protein is a useful tool that can be used in the detection and differentiation of flaviviruses in resource-limited laboratories, but virus neutralization assays are suggested for accurate confirmation of results.

  6. Nonstructural Proteins Are Preferential Positive Selection Targets in Zika Virus and Related Flaviviruses.

    Science.gov (United States)

    Sironi, Manuela; Forni, Diego; Clerici, Mario; Cagliani, Rachele

    2016-09-01

    The Flavivirus genus comprises several human pathogens such as dengue virus (DENV), Japanese encephalitis virus (JEV), and Zika virus (ZIKV). Although ZIKV usually causes mild symptoms, growing evidence is linking it to congenital birth defects and to increased risk of Guillain-Barré syndrome. ZIKV encodes a polyprotein that is processed to produce three structural and seven nonstructural (NS) proteins. We investigated the evolution of the viral polyprotein in ZIKV and in related flaviviruses (DENV, Spondweni virus, and Kedougou virus). After accounting for saturation issues, alignment uncertainties, and recombination, we found evidence of episodic positive selection on the branch that separates DENV from the other flaviviruses. NS1 emerged as the major selection target, and selected sites were located in immune epitopes or in functionally important protein regions. Three of these sites are located in an NS1 region that interacts with structural proteins and is essential for virion biogenesis. Analysis of the more recent evolutionary history of ZIKV lineages indicated that positive selection acted on NS5 and NS4B, this latter representing the preferential target. All selected sites were located in the N-terminal portion of NS4B, which inhibits interferon response. One of the positively selected sites (26M/I/T/V) in ZIKV also represents a selection target in sylvatic DENV2 isolates, and a nearby residue evolves adaptively in JEV. Two additional positively selected sites are within a protein region that interacts with host (e.g. STING) and viral (i.e. NS1, NS4A) proteins. Notably, mutations in the NS4B region of other flaviviruses modulate neurovirulence and/or neuroinvasiveness. These results suggest that the positively selected sites we identified modulate viral replication and contribute to immune evasion. These sites should be prioritized in future experimental studies. However, analyses herein detected no selective events associated to the spread of the Asian

  7. Nonstructural Proteins Are Preferential Positive Selection Targets in Zika Virus and Related Flaviviruses.

    Directory of Open Access Journals (Sweden)

    Manuela Sironi

    2016-09-01

    Full Text Available The Flavivirus genus comprises several human pathogens such as dengue virus (DENV, Japanese encephalitis virus (JEV, and Zika virus (ZIKV. Although ZIKV usually causes mild symptoms, growing evidence is linking it to congenital birth defects and to increased risk of Guillain-Barré syndrome. ZIKV encodes a polyprotein that is processed to produce three structural and seven nonstructural (NS proteins. We investigated the evolution of the viral polyprotein in ZIKV and in related flaviviruses (DENV, Spondweni virus, and Kedougou virus. After accounting for saturation issues, alignment uncertainties, and recombination, we found evidence of episodic positive selection on the branch that separates DENV from the other flaviviruses. NS1 emerged as the major selection target, and selected sites were located in immune epitopes or in functionally important protein regions. Three of these sites are located in an NS1 region that interacts with structural proteins and is essential for virion biogenesis. Analysis of the more recent evolutionary history of ZIKV lineages indicated that positive selection acted on NS5 and NS4B, this latter representing the preferential target. All selected sites were located in the N-terminal portion of NS4B, which inhibits interferon response. One of the positively selected sites (26M/I/T/V in ZIKV also represents a selection target in sylvatic DENV2 isolates, and a nearby residue evolves adaptively in JEV. Two additional positively selected sites are within a protein region that interacts with host (e.g. STING and viral (i.e. NS1, NS4A proteins. Notably, mutations in the NS4B region of other flaviviruses modulate neurovirulence and/or neuroinvasiveness. These results suggest that the positively selected sites we identified modulate viral replication and contribute to immune evasion. These sites should be prioritized in future experimental studies. However, analyses herein detected no selective events associated to the spread of

  8. Enhanced and sustained CD8+ T cell responses with an adenoviral vector-based hepatitis C virus vaccine encoding NS3 linked to the MHC class II chaperone protein invariant chain

    DEFF Research Database (Denmark)

    Mikkelsen, Marianne; Holst, Peter Johannes; Bukh, Jens

    2011-01-01

    memory. Functionally, the AdIiNS3-vaccinated mice had a significantly increased cytotoxic capacity compared with the AdNS3 group. The AdIiNS3-induced CD8(+) T cells protected mice from infection with recombinant vaccinia virus expressing HCV NS3 of heterologous 1b strains, and studies in knockout mice...

  9. Single point mutations in the helicase domain of the NS3 protein enhance dengue virus replicative capacity in human monocyte-derived dendritic cells and circumvent the type I interferon response.

    Science.gov (United States)

    Silveira, G F; Strottmann, D M; de Borba, L; Mansur, D S; Zanchin, N I T; Bordignon, J; dos Santos, C N Duarte

    2016-01-01

    Dengue is the most prevalent arboviral disease worldwide. The outcome of the infection is determined by the interplay of viral and host factors. In the present study, we evaluated the cellular response of human monocyte-derived DCs (mdDCs) infected with recombinant dengue virus type 1 (DV1) strains carrying a single point mutation in the NS3hel protein (L435S or L480S). Both mutated viruses infect and replicate more efficiently and produce more viral progeny in infected mdDCs compared with the parental, non-mutated virus (vBACDV1). Additionally, global gene expression analysis using cDNA microarrays revealed that the mutated DVs induce the up-regulation of the interferon (IFN) signalling and pattern recognition receptor (PRR) canonical pathways in mdDCs. Pronounced production of type I IFN were detected specifically in mdDCs infected with DV1-NS3hel-mutated virus compared with mdDCs infected with the parental virus. In addition, we showed that the type I IFN produced by mdDCs is able to reduce DV1 infection rates, suggesting that cytokine function is effective but not sufficient to mediate viral clearance of DV1-NS3hel-mutated strains. Our results demonstrate that single point mutations in subdomain 2 have important implications for adenosine triphosphatase (ATPase) activity of DV1-NS3hel. Although a direct functional connection between the increased ATPase activity and viral replication still requires further studies, these mutations speed up viral RNA replication and are sufficient to enhance viral replicative capacity in human primary cell infection and circumvent type I IFN activity. This information may have particular relevance for attenuated vaccine protocols designed for DV. © 2015 British Society for Immunology.

  10. NS3 from Hepatitis C Virus Strain JFH-1 Is an Unusually Robust Helicase That Is Primed To Bind and Unwind Viral RNA

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Ting; Ren, Xiaoming; Adams, Rebecca L.; Pyle, Anna Marie; Ou, J. -H. James

    2017-10-25

    Hepatitis C viruses (HCV) encode a helicase enzyme that is essential for viral replication and assembly (nonstructural protein 3 [NS3]). This helicase has become the focus of extensive basic research on the general helicase mechanism, and it is also of interest as a novel drug target. Despite the importance of this protein, mechanistic work on NS3 has been conducted almost exclusively on variants from HCV genotype 1. Our understanding of NS3 from the highly active HCV strains that are used to study HCV genetics and mechanism in cell culture (such as JFH-1) is lacking. We therefore set out to determine whether NS3 from the replicatively efficient genotype 2a strain JFH-1 displays novel functional or structural properties. Using biochemical assays for RNA binding and duplex unwinding, we show that JFH-1 NS3 binds RNA much more rapidly than the previously studied NS3 variants from genotype 1b. Unlike NS3 variants from other genotypes, JFH-1 NS3 binds RNA with high affinity in a functionally active form that is capable of immediately unwinding RNA duplexes without undergoing rate-limiting conformational changes that precede activation. Unlike other superfamily 2 (SF2) helicases, JFH-1 NS3 does not require long 3' overhangs, and it unwinds duplexes that are flanked by only a few nucleotides, as in the folded HCV genome. To understand the physical basis for this, we solved the crystal structure of JFH-1 NS3, revealing a novel conformation that contains an open, positively charged RNA binding cleft that is primed for productive interaction with RNA targets, potentially explaining robust replication by HCV JFH-1.

    IMPORTANCEGenotypes of HCV are as divergent as different types of flavivirus, and yet mechanistic features of HCV variants are presumed to be held in common. One of the most well-studied components of the HCV replication complex is a helicase known as nonstructural protein 3 (NS3). We set out to determine whether this important

  11. Identification and characterization of the host protein DNAJC14 as a broadly active flavivirus replication modulator.

    Directory of Open Access Journals (Sweden)

    Zhigang Yi

    2011-01-01

    Full Text Available Viruses in the Flavivirus genus of the Flaviviridae family are arthropod-transmitted and contribute to staggering numbers of human infections and significant deaths annually across the globe. To identify cellular factors with antiviral activity against flaviviruses, we screened a cDNA library using an iterative approach. We identified a mammalian Hsp40 chaperone protein (DNAJC14 that when overexpressed was able to mediate protection from yellow fever virus (YFV-induced cell death. Further studies revealed that DNAJC14 inhibits YFV at the step of viral RNA replication. Since replication of bovine viral diarrhea virus (BVDV, a member of the related Pestivirus genus, is also known to be modulated by DNAJC14, we tested the effect of this host factor on diverse Flaviviridae family members. Flaviviruses, including the pathogenic Asibi strain of YFV, Kunjin, and tick-borne Langat virus, as well as a Hepacivirus, hepatitis C virus (HCV, all were inhibited by overexpression of DNAJC14. Mutagenesis showed that both the J-domain and the C-terminal domain, which mediates self-interaction, are required for anti-YFV activity. We found that DNAJC14 does not block YFV nor HCV NS2-3 cleavage, and using non-inhibitory mutants demonstrate that DNAJC14 is recruited to YFV replication complexes. Immunofluorescence analysis demonstrated that endogenous DNAJC14 rearranges during infection and is found in replication complexes identified by dsRNA staining. Interestingly, silencing of endogenous DNAJC14 results in impaired YFV replication suggesting a requirement for DNAJC14 in YFV replication complex assembly. Finally, the antiviral activity of overexpressed DNAJC14 occurs in a time- and dose-dependent manner. DNAJC14 overexpression may disrupt the proper stoichiometry resulting in inhibition, which can be overcome upon restoration of the optimal ratios due to the accumulation of viral nonstructural proteins. Our findings, together with previously published work

  12. Identification of amino acids involved in recognition by dengue virus NS3-specific, HLA-DR15-restricted cytotoxic CD4+ T-cell clones.

    Science.gov (United States)

    Zeng, L; Kurane, I; Okamoto, Y; Ennis, F A; Brinton, M A

    1996-05-01

    The majority of T-cell clones derived from a donor who experienced dengue illness following receipt of a live experimental dengue virus type 3 (DEN3) vaccine cross-reacted with all four serotypes of dengue virus, but some were serotype specific or only partially cross-reactive. The nonstructural protein, NS3, was immuno-dominant in the CD4+ T-cell response of this donor. The epitopes of four NS3-specific T-cell clones were analyzed. JK15 and JK13 recognized only DEN3 NS3, while JK44 recognized DEN1, DEN2, and DEN3 NS3 and JK5 recognized DEN1, DEN3, and West Nile virus NS3. The epitopes recognized by these clones on the DEN3 NS3 protein were localized with recombinant vaccinia viruses expressing truncated regions of the NS3 gene, and then the minimal recognition sequence was mapped with synthetic peptides. Amino acids critical for T-cell recognition were assessed by using peptides with amino acid substitutions. One of the serotype-specific clones (JK13) and the subcomplex- and flavivirus-cross-reactive clone (JK5) recognized the same core epitope, WITDFVGKTVW. The amino acid at the sixth position of this epitope is critical for recognition by both clones. Sequence analysis of the T-cell receptors of these two clones showed that they utilize different VP chains. The core epitopes for the four HLA-DR15-restricted CD4+ CTL clones studied do not contain motifs similar to those proposed by previous studies on endogenous peptides eluted from HLA-DR15 molecules. However, the majority of these dengue virus NS3 core epitopes have a positive amino acid (K or R) at position 8 or 9. Our results indicate that a single epitope can induce T cells with different virus specificities despite the restriction of these T cells by the same HLA-DR15 allele. This finding suggests a previously unappreciated level of complexity for interactions between human T-cell receptors and viral epitopes with very similar sequences on infected cells.

  13. Host cell killing by the West Nile Virus NS2B-NS3 proteolytic complex: NS3 alone is sufficient to recruit caspase-8-based apoptotic pathway

    International Nuclear Information System (INIS)

    Ramanathan, Mathura P.; Chambers, Jerome A.; Pankhong, Panyupa; Chattergoon, Michael; Attatippaholkun, Watcharee; Dang, Kesen; Shah, Neelima; Weiner, David B.

    2006-01-01

    The West Nile Virus (WNV) non-structural proteins 2B and 3 (NS2B-NS3) constitute the proteolytic complex that mediates the cleavage and processing of the viral polyprotein. NS3 recruits NS2B and NS5 proteins to direct protease and replication activities. In an effort to investigate the biology of the viral protease, we cloned cDNA encoding the NS2B-NS3 proteolytic complex from brain tissue of a WNV-infected dead crow, collected from the Lower Merion area (Merion strain). Expression of the NS2B-NS3 gene cassette induced apoptosis within 48 h of transfection. Electron microscopic analysis of NS2B-NS3-transfected cells revealed ultra-structural changes that are typical of apoptotic cells including membrane blebbing, nuclear disintegration and cytoplasmic vacuolations. The role of NS3 or NS2B in contributing to host cell apoptosis was examined. NS3 alone triggers the apoptotic pathways involving caspases-8 and -3. Experimental results from the use of caspase-specific inhibitors and caspase-8 siRNA demonstrated that the activation of caspase-8 was essential to initiate apoptotic signaling in NS3-expressing cells. Downstream of caspase-3 activation, we observed nuclear membrane ruptures and cleavage of the DNA-repair enzyme, PARP in NS3-expressing cells. Nuclear herniations due to NS3 expression were absent in the cells treated with a caspase-3 inhibitor. Expression of protease and helicase domains themselves was sufficient to trigger apoptosis generating insight into the apoptotic pathways triggered by NS3 from WNV

  14. Primuline Derivatives That Mimic RNA to Stimulate Hepatitis C Virus NS3 Helicase-catalyzed ATP Hydrolysis*

    Science.gov (United States)

    Sweeney, Noreena L.; Shadrick, William R.; Mukherjee, Sourav; Li, Kelin; Frankowski, Kevin J.; Schoenen, Frank J.; Frick, David N.

    2013-01-01

    ATP hydrolysis fuels the ability of helicases and related proteins to translocate on nucleic acids and separate base pairs. As a consequence, nucleic acid binding stimulates the rate at which a helicase catalyzes ATP hydrolysis. In this study, we searched a library of small molecule helicase inhibitors for compounds that stimulate ATP hydrolysis catalyzed by the hepatitis C virus (HCV) NS3 helicase, which is an important antiviral drug target. Two compounds were found that stimulate HCV helicase-catalyzed ATP hydrolysis, both of which are amide derivatives synthesized from the main component of the yellow dye primuline. Both compounds possess a terminal pyridine moiety, which was critical for stimulation. Analogs lacking a terminal pyridine inhibited HCV helicase catalyzed ATP hydrolysis. Unlike other HCV helicase inhibitors, the stimulatory compounds differentiate between helicases isolated from various HCV genotypes and related viruses. The compounds only stimulated ATP hydrolysis catalyzed by NS3 purified from HCV genotype 1b. They inhibited helicases from other HCV genotypes (e.g. 1a and 2a) or related flaviviruses (e.g. Dengue virus). The stimulatory compounds interacted with HCV helicase in the absence of ATP with dissociation constants of about 2 μm. Molecular modeling and site-directed mutagenesis studies suggest that the stimulatory compounds bind in the HCV helicase RNA-binding cleft near key residues Arg-393, Glu-493, and Ser-231. PMID:23703611

  15. Sequence, structure and function relationships in flaviviruses as assessed by evolutive aspects of its conserved non-structural protein domains.

    Science.gov (United States)

    da Fonseca, Néli José; Lima Afonso, Marcelo Querino; Pedersolli, Natan Gonçalves; de Oliveira, Lucas Carrijo; Andrade, Dhiego Souto; Bleicher, Lucas

    2017-10-28

    Flaviviruses are responsible for serious diseases such as dengue, yellow fever, and zika fever. Their genomes encode a polyprotein which, after cleavage, results in three structural and seven non-structural proteins. Homologous proteins can be studied by conservation and coevolution analysis as detected in multiple sequence alignments, usually reporting positions which are strictly necessary for the structure and/or function of all members in a protein family or which are involved in a specific sub-class feature requiring the coevolution of residue sets. This study provides a complete conservation and coevolution analysis on all flaviviruses non-structural proteins, with results mapped on all well-annotated available sequences. A literature review on the residues found in the analysis enabled us to compile available information on their roles and distribution among different flaviviruses. Also, we provide the mapping of conserved and coevolved residues for all sequences currently in SwissProt as a supplementary material, so that particularities in different viruses can be easily analyzed. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. New insights into flavivirus biology: the influence of pH over interactions between prM and E proteins

    Science.gov (United States)

    Oliveira, Edson R. A.; de Alencastro, Ricardo B.; Horta, Bruno A. C.

    2017-11-01

    Diseases caused by flaviviruses, such as dengue and zika, are globally recognized as major threats. During infection, a critical point in their replicative cycle is the maturation step, which occurs throughout the cellular exocytic pathway. This step is a pH-dependent process that involves the modification of the viral envelope by converting prM (pre-membrane) into M (membrane) proteins with the release of a "pr peptide". After this reaction, the pr peptides remain bound to the viral envelope while the virions cross the acidic trans-Golgi network, and are released only at neutral pH after secretion of the virus particles. Despite this current knowledge, the molecular basis of the flavivirus maturation step is largely unknown. Here, based on the crystal structure of the dengue pr-E complex ("pr peptide" bound to virus envelope protein) and using molecular dynamics simulations, we found that the pH shift from acidic to neutral yields considerable structural changes in the system. Dynamic cross correlation maps and root mean square deviation analyses revealed that the pr-E junction is clearly unstable under neutral pH. Secondary structure analysis also revealed that the fusion loop region, present in the E protein, is sensitive to pH and tends to unstructure at a neutral environment. Moreover, we found that five residues present in the E protein, Gly102, His244, Thr70, Thr68 and Asn67 are critical to confer stability to the pr-E complex while inside the Golgi apparatus. This work brings details about the dynamical behavior of the pr-E system, helps to better understand the flavivirus biology and may also be of use in the development of novel antiviral strategies.

  17. STD-NMR experiments identify a structural motif with novel second-site activity against West Nile virus NS2B-NS3 protease.

    Science.gov (United States)

    Schöne, Tobias; Grimm, Lena Lisbeth; Sakai, Naoki; Zhang, Linlin; Hilgenfeld, Rolf; Peters, Thomas

    2017-10-01

    West Nile virus (WNV) belongs to the genus Flavivirus of the family Flaviviridae. This mosquito-borne virus that is highly pathogenic to humans has been evolving into a global threat during the past two decades. Despite many efforts, neither antiviral drugs nor vaccines are available. The viral protease NS2B-NS3 pro is essential for viral replication, and therefore it is considered a prime drug target. However, success in the development of specific NS2B-NS3 pro inhibitors had been moderate so far. In the search for new structural motifs with binding affinity for NS2B-NS3 pro , we have screened a fragment library, the Maybridge Ro5 library, employing saturation transfer difference (STD) NMR experiments as readout. About 30% of 429 fragments showed binding to NS2B-NS3 pro . Subsequent STD-NMR competition experiments using the known active site fragment A as reporter ligand yielded 14 competitively binding fragments, and 22 fragments not competing with A. In a fluorophore-based protease assay, all of these fragments showed inhibition in the micromolar range. Interestingly, 10 of these 22 fragments showed a notable increase of STD intensities in the presence of compound A suggesting cooperative binding. The most promising non-competitive inhibitors 1 and 2 (IC 50 ∼ 500 μM) share a structural motif that may guide the development of novel second-site (potentially allosteric) inhibitors of NS2B-NS3 pro . To identify the matching protein binding site, chemical shift perturbation studies employing 1 H, 15 N-TROSY-HSQC experiments with uniformly 2 H, 15 N-labeled protease were performed in the presence of 1, and in the concomitant absence or presence of A. The data suggest that 1 interacts with Met 52* of NS2B, identifying a secondary site adjacent to the binding site of A. Therefore, our study paves the way for the synthesis of novel bidentate NS2B-NS3 pro inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Membrane and envelope virus proteins co-expressed as lysosome associated membrane protein (LAMP fused antigens: a potential tool to develop DNA vaccines against flaviviruses

    Directory of Open Access Journals (Sweden)

    Rafael Dhalia

    2009-12-01

    Full Text Available Vaccination is the most practical and cost-effective strategy to prevent the majority of the flavivirus infection to which there is an available vaccine. However, vaccines based on attenuated virus can potentially promote collateral side effects and even rare fatal reactions. Given this scenario, the developent of alternative vaccination strategies such as DNA-based vaccines encoding specific flavivirus sequences are being considered. Endogenous cytoplasmic antigens, characteristically plasmid DNA-vaccine encoded, are mainly presented to the immune system through Major Histocompatibility Complex class I - MHC I molecules. The MHC I presentation via is mostly associated with a cellular cytotoxic response and often do not elicit a satisfactory humoral response. One of the main strategies to target DNA-encoded antigens to the MHC II compartment is expressing the antigen within the Lysosome-Associated Membrane Protein (LAMP. The flavivirus envelope protein is recognized as the major virus surface protein and the main target for neutralizing antibodies. Different groups have demonstrated that co-expression of flavivirus membrane and envelope proteins in mammalian cells, fused with the carboxyl-terminal of LAMP, is able to induce satisfactory levels of neutralizing antibodies. Here we reviewed the use of the envelope flavivirus protein co-expression strategy as LAMP chimeras with the aim of developing DNA vaccines for dengue, West Nile and yellow fever viruses.A vacinação é a estratégia mais prática e o melhor custo-benefício para prevenir a maioria das infecções dos flavivirus, para os quais existe vacina disponível. Entretanto, as vacinas baseadas em vírus atenuados podem potencialmente promover efeitos colaterais e, mais raramente, reações fatais. Diante deste cenário, o desenvolvimento de estratégias alternativas de vacinação, como vacinas baseadas em DNA codificando seqüências específicas dos flavivirus, está sendo considerado

  19. Molecular Dynamics of the ZIKA Virus NS3 Helicase

    Science.gov (United States)

    Raubenolt, Bryan; Rick, Steven; The Rick Group Team

    The recent outbreaks of the ZIKA virus (ZIKV) and its connection to microcephaly in newborns has raised its awareness as a global threat and many scientific research efforts are currently underway in attempt to create a vaccine. Molecular Dynamics is a powerful method of investigating the physical behavior of protein complexes. ZIKV is comprised of 3 structural and 7 nonstructural proteins. The NS3 helicase protein appears to play a significant role in the replication complex and its inhibition could be a crucial source of antiviral drug design. This research primarily focuses on studying the structural dynamics, over the course of few hundred nanoseconds, of NS3 helicase in the free state, as well as in complex form with human ssRNA, ATP, and an analogue of GTP. RMSD and RMSF plots of each simulation will provide details on the forces involved in the overall stability of the active and inactive states. Furthermore, free energy calculations on a per residue level will reveal the most interactive residues between states and ultimately the primary driving force behind these interactions. Together these analyses will provide highly relevant information on the binding surface chemistry and thus serve as the basis for potential drug design.

  20. Analysis of Naturally Occurring Resistance-Associated Variants to NS3/4A Protein Inhibitors, NS5A Protein Inhibitors, and NS5B Polymerase Inhibitors in Patients With Chronic Hepatitis C.

    Science.gov (United States)

    Sun, Danhui; Dai, Mingjia; Shen, Shanshan; Li, Chunyang; Yan, Xuebing

    2018-03-21

    The first NS3/4A hepatitis C virus (HCV) protease inhibitors telaprevir and boceprevir were approved in 2011, and both NS5A and NS5B polymerase inhibitors were launched. Recently, direct-acting antivirals (DAAs) have had a major impact on patients infected with HCV. HCV DAAs are highly effective antivirals with fewer side effects. DAAs have been developed for the treatment of HCV infection in combination with PEG-IFN-α/RBV as well as in IFN-free regimens. However, some drug resistance mutations occur when a single oral DAA is used for treatment, which indicates that there is a low-frequency drug resistance mutation in HCV patients before the application of antiviral drugs. Our research showed that natural resistance to HCV DAAs was found in treatment-naive CHC patients and that the drug resistance mutation rates differ in various HCV genotypes. Many challenges posed by natural resistance should be considered in the context of DAA therapies.

  1. Identification of novel small molecule inhibitors against NS2B/NS3 serine protease from Zika virus

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun; Ren, Jinhong; Nocadello, Salvatore; Rice, Amy J.; Ojeda, Isabel; Light, Samuel; Minasov, George; Vargas, Jason; Nagarathnam, Dhanapalan; Anderson, Wayne F.; Johnson, Michael E. (UIC); (NWU); (Novalex); (DNSK)

    2016-12-26

    Zika flavivirus infection during pregnancy appears to produce higher risk of microcephaly, and also causes multiple neurological problems such as Guillain–Barré syndrome. The Zika virus is now widespread in Central and South America, and is anticipated to become an increasing risk in the southern United States. With continuing global travel and the spread of the mosquito vector, the exposure is expected to accelerate, but there are no currently approved treatments against the Zika virus. The Zika NS2B/NS3 protease is an attractive drug target due to its essential role in viral replication. Our studies have identified several compounds with inhibitory activity (IC50) and binding affinity (KD) of ~5–10 μM against the Zika NS2B-NS3 protease from testing 71 HCV NS3/NS4A inhibitors that were initially discovered by high-throughput screening of 40,967 compounds. Competition surface plasmon resonance studies and mechanism of inhibition analyses by enzyme kinetics subsequently determined the best compound to be a competitive inhibitor with a Ki value of 9.5 μM. We also determined the X-ray structure of the Zika NS2B-NS3 protease in a “pre-open conformation”, a conformation never observed before for any flavivirus proteases. This provides the foundation for new structure-based inhibitor design.

  2. Bluetongue virus nonstructural protein NS3/NS3a is not essential for virus replication

    NARCIS (Netherlands)

    Gennip, van H.G.P.; Water, van de S.G.P.; Rijn, van P.A.

    2014-01-01

    Orbiviruses form the largest genus of the family Reoviridae consisting of at least 23 different virus species. One of these is the bluetongue virus (BTV) and causes severe hemorrhagic disease in ruminants, and is transmitted by bites of Culicoides midges. BTV is a non-enveloped virus which is

  3. New binding site conformations of the dengue virus NS3 protease accessed by molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    Hugo de Almeida

    Full Text Available Dengue fever is caused by four distinct serotypes of the dengue virus (DENV1-4, and is estimated to affect over 500 million people every year. Presently, there are no vaccines or antiviral treatments for this disease. Among the possible targets to fight dengue fever is the viral NS3 protease (NS3PRO, which is in part responsible for viral processing and replication. It is now widely recognized that virtual screening campaigns should consider the flexibility of target protein by using multiple active conformational states. The flexibility of the DENV NS3PRO could explain the relatively low success of previous virtual screening studies. In this first work, we explore the DENV NS3PRO conformational states obtained from molecular dynamics (MD simulations to take into account protease flexibility during the virtual screening/docking process. To do so, we built a full NS3PRO model by multiple template homology modeling. The model comprised the NS2B cofactor (essential to the NS3PRO activation, a glycine flexible link and the proteolytic domain. MD simulations had the purpose to sample, as closely as possible, the ligand binding site conformational landscape prior to inhibitor binding. The obtained conformational MD sample was clustered into four families that, together with principal component analysis of the trajectory, demonstrated protein flexibility. These results allowed the description of multiple binding modes for the Bz-Nle-Lys-Arg-Arg-H inhibitor, as verified by binding plots and pair interaction analysis. This study allowed us to tackle protein flexibility in our virtual screening campaign against the dengue virus NS3 protease.

  4. Uncoupling of Protease trans-Cleavage and Helicase Activities in Pestivirus NS3.

    Science.gov (United States)

    Zheng, Fengwei; Lu, Guoliang; Li, Ling; Gong, Peng; Pan, Zishu

    2017-11-01

    The nonstructural protein NS3 from the Flaviviridae family is a multifunctional protein that contains an N-terminal protease and a C-terminal helicase, playing essential roles in viral polyprotein processing and genome replication. Here we report a full-length crystal structure of the classical swine fever virus (CSFV) NS3 in complex with its NS4A protease cofactor segment (PCS) at a 2.35-Å resolution. The structure reveals a previously unidentified ∼2,200-Å 2 intramolecular protease-helicase interface comprising three clusters of interactions, representing a "closed" global conformation related to the NS3-NS4A cis -cleavage event. Although this conformation is incompatible with protease trans -cleavage, it appears to be functionally important and beneficial to the helicase activity, as the mutations designed to perturb this conformation impaired both the helicase activities in vitro and virus production in vivo Our work reveals important features of protease-helicase coordination in pestivirus NS3 and provides a key basis for how different conformational states may explicitly contribute to certain functions of this natural protease-helicase fusion protein. IMPORTANCE Many RNA viruses encode helicases to aid their RNA genome replication and transcription by unwinding structured RNA. Being naturally fused to a protease participating in viral polyprotein processing, the NS3 helicases encoded by the Flaviviridae family viruses are unique. Therefore, how these two enzyme modules coordinate in a single polypeptide is of particular interest. Here we report a previously unidentified conformation of pestivirus NS3 in complex with its NS4A protease cofactor segment (PCS). This conformational state is related to the protease cis -cleavage event and is optimal for the function of helicase. This work provides an important basis to understand how different enzymatic activities of NS3 may be achieved by the coordination between the protease and helicase through different

  5. Hepatitis C virus NS3/4A protease inhibits complement activation by cleaving complement component 4.

    Directory of Open Access Journals (Sweden)

    Seiichi Mawatari

    Full Text Available BACKGROUND: It has been hypothesized that persistent hepatitis C virus (HCV infection is mediated in part by viral proteins that abrogate the host immune response, including the complement system, but the precise mechanisms are not well understood. We investigated whether HCV proteins are involved in the fragmentation of complement component 4 (C4, composed of subunits C4α, C4β, and C4γ, and the role of HCV proteins in complement activation. METHODS: Human C4 was incubated with HCV nonstructural (NS 3/4A protease, core, or NS5. Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then subjected to peptide sequencing. The activity of the classical complement pathway was examined using an erythrocyte hemolysis assay. The cleavage pattern of C4 in NS3/4A-expressing and HCV-infected cells, respectively, was also examined. RESULTS: HCV NS3/4A protease cleaved C4γ in a concentration-dependent manner, but viral core and NS5 did not. A specific inhibitor of NS3/4A protease reduced C4γ cleavage. NS3/4A protease-mediated cleavage of C4 inhibited classical pathway activation, which was abrogated by a NS3/4A protease inhibitor. In addition, co-transfection of cells with C4 and wild-type NS3/4A, but not a catalytic-site mutant of NS3/4A, produced cleaved C4γ fragments. Such C4 processing, with a concomitant reduction in levels of full-length C4γ, was also observed in HCV-infected cells expressing C4. CONCLUSIONS: C4 is a novel cellular substrate of the HCV NS3/4A protease. Understanding disturbances in the complement system mediated by NS3/4A protease may provide new insights into the mechanisms underlying persistent HCV infection.

  6. Protective vaccination with hepatitis C virus NS3 but not core antigen in a novel mouse challenge model.

    Science.gov (United States)

    El-Gogo, Susanne; Staib, Caroline; Lasarte, Juan José; Sutter, Gerd; Adler, Heiko

    2008-02-01

    Efficient vaccines against hepatitis C virus (HCV) infection are urgently needed. Vaccine development has been hampered by the lack of suitable small animal models to reliably test the protective capacity of immmunization. We used recombinant murine gammaherpesvirus 68 (MHV-68) as a novel challenge virus in mice and tested the efficacy of heterologous candidate human vaccines based on modified vaccinia virus Ankara or adenovirus, both delivering HCV non-structural NS3 or core proteins. Recombinant MHV-68 expressing NS3 (MHV-68-NS3) or core (MHV-68-core) were constructed and characterized in vitro and in vivo. Mice immunized with NS3-specific vector vaccines and challenged with MHV-68-NS3 were infected but showed significantly reduced viral loads in the acute and latent phase of infection. NS3-specific CD8+ T cells were amplified in immunized mice after challenge with MHV-68-NS3. By contrast, we did neither detect a reduction of viral load nor an induction of core-specific CD8+ T cells after core-specific immunization. Our data suggest that the challenge system using recombinant MHV-68 is a highly suitable model to test the immunogenicity and protective capacity of HCV candidate vaccine antigens. Using this system, we demonstrated the usefulness of NS3-specific immunization. By contrast, our analysis rather discarded core as a vaccine antigen.

  7. Neuroinvasive flavivirus infections

    NARCIS (Netherlands)

    Sips, Gregorius J.; Wilschut, Jan; Smit, Jolanda M.

    Flaviviruses, including Dengue, West Nile, Japanese encephalitis, and Tick-borne encephalitis virus, are major emerging human pathogens, affecting millions of individuals worldwide. Many clinically important flaviviruses elicit CNS diseases in infected hosts, including traditional "hemorrhagic"

  8. Engineered exosomes boost the HCV NS3-specific CD8+ T lymphocyte immunity in humans

    Directory of Open Access Journals (Sweden)

    Simona Anticoli

    2016-01-01

    Full Text Available At the present, no anti-Hepatitis C virus (HCV HCV vaccine is available, and many patients failed the treatment with new class of HCV inhibitors. In HCV infection, both experimental and clinic evidences indicate that a strong CTL-immune response could have significant therapeutic effects. We developed an innovative anti-HCV CD8+ T immunogen based on the uploading in engineered exosomes of full-length HCV-NS3 protein. HCV NS3 exosomes appeared immunogenic when injected in mice, as proven by the detection of a memory CD8+ T lymphocyte pool two weeks after the last of three immunizations. On the other hand, dendritic cells isolated from PBMCs of HCV infected patients activate autologous HCV NS3-specific CD8+ T lymphocytes upon challenge with HCV NS3 exosomes. These results provide the proof-of-principle that engineered exosomes can boost the CD8+ T cell immunity in HCV-infected patients, thus representing a suitable option for patients resisting the therapies with recently discovered HCV inhibitors.

  9. Identifying Candidate Targets of Immune Responses in Zika Virus Based on Homology to Epitopes in Other Flavivirus Species.

    Science.gov (United States)

    Xu, Xiaojun; Vaughan, Kerrie; Weiskopf, Daniela; Grifoni, Alba; Diamond, Michael S; Sette, Alessandro; Peters, Bjoern

    2016-11-15

    The current outbreak of Zika virus has resulted in a massive effort to accelerate the development of ZIKV-specific diagnostics and vaccines. These efforts would benefit greatly from the definition of the specific epitope targets of immune responses in ZIKV, but given the relatively recent emergence of ZIKV as a pandemic threat, few such data are available. We used a large body of epitope data for other Flaviviruses that was available from the IEDB for a comparative analysis against the ZIKV proteome in order to project targets of immune responses in ZIKV. We found a significant level of overlap between known antigenic sites from other Flavivirus proteins with residues on the ZIKV polyprotein. The E and NS1 proteins shared functional antibody epitope sites, whereas regions of T cell reactivity were conserved within NS3 and NS5 for ZIKV.  Discussion: Our epitope based analysis provides guidance for which regions of the ZIKV polyprotein are most likely unique targets of ZIKV-specific antibodies, and which targets in ZIKV are most likely to be cross-reactive with other Flavivirus species. These data may therefore provide insights for the development of antibody- and T cell-based ZIKV-specific diagnostics, therapeutics and prophylaxis.

  10. Complement-related proteins control the flavivirus infection of Aedes aegypti by inducing antimicrobial peptides.

    Directory of Open Access Journals (Sweden)

    Xiaoping Xiao

    2014-04-01

    Full Text Available The complement system functions during the early phase of infection and directly mediates pathogen elimination. The recent identification of complement-like factors in arthropods indicates that this system shares common ancestry in vertebrates and invertebrates as an immune defense mechanism. Thioester (TE-containing proteins (TEPs, which show high similarity to mammalian complement C3, are thought to play a key role in innate immunity in arthropods. Herein, we report that a viral recognition cascade composed of two complement-related proteins limits the flaviviral infection of Aedes aegypti. An A. aegypti macroglobulin complement-related factor (AaMCR, belonging to the insect TEP family, is a crucial effector in opposing the flaviviral infection of A. aegypti. However, AaMCR does not directly interact with DENV, and its antiviral effect requires an A. aegypti homologue of scavenger receptor-C (AaSR-C, which interacts with DENV and AaMCR simultaneously in vitro and in vivo. Furthermore, recognition of DENV by the AaSR-C/AaMCR axis regulates the expression of antimicrobial peptides (AMPs, which exerts potent anti-DENV activity. Our results both demonstrate the existence of a viral recognition pathway that controls the flaviviral infection by inducing AMPs and offer insights into a previously unappreciated antiviral function of the complement-like system in arthropods.

  11. Molecular models of NS3 protease variants of the Hepatitis C virus

    Directory of Open Access Journals (Sweden)

    Mello Isabel MVGC

    2005-01-01

    -based drug design of a new generation of NS3 protease variants inhibitors. All models in the database are publicly accessible via our interactive website, providing us with large amount of structural models for use in protein-ligand docking analysis.

  12. Microscopy techniques in flavivirus research.

    Science.gov (United States)

    Chong, Mun Keat; Chua, Anthony Jin Shun; Tan, Terence Tze Tong; Tan, Suat Hoon; Ng, Mah Lee

    2014-04-01

    The Flavivirus genus is composed of many medically important viruses that cause high morbidity and mortality, which include Dengue and West Nile viruses. Various molecular and biochemical techniques have been developed in the endeavour to study flaviviruses. However, microscopy techniques still have irreplaceable roles in the identification of novel virus pathogens and characterization of morphological changes in virus-infected cells. Fluorescence microscopy contributes greatly in understanding the fundamental viral protein localizations and virus-host protein interactions during infection. Electron microscopy remains the gold standard for visualizing ultra-structural features of virus particles and infected cells. New imaging techniques and combinatory applications are continuously being developed to push the limit of resolution and extract more quantitative data. Currently, correlative live cell imaging and high resolution three-dimensional imaging have already been achieved through the tandem use of optical and electron microscopy in analyzing biological specimens. Microscopy techniques are also used to measure protein binding affinities and determine the mobility pattern of proteins in cells. This chapter will consolidate on the applications of various well-established microscopy techniques in flavivirus research, and discuss how recently developed microscopy techniques can potentially help advance our understanding in these membrane viruses. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Data center network performance evaluation in ns3

    DEFF Research Database (Denmark)

    Andrus, Bogdan-Mihai; Vegas Olmos, Juan José

    2015-01-01

    In the following paper we present the analysis of highly interconnected topologies like hypercube and torus and how they can be implemented in data centers in order to cope with the rapid increase and demands for performance of the internal traffic. By replicating the topologies in NS3 and subjec......In the following paper we present the analysis of highly interconnected topologies like hypercube and torus and how they can be implemented in data centers in order to cope with the rapid increase and demands for performance of the internal traffic. By replicating the topologies in NS3...... we scale the network from 16 to 512 switches. The performance measurements are supported by abstract metrics that that also give a cost and complexity indication in choosing the right topology for the required application....

  14. Data center network performance evaluation in ns3

    DEFF Research Database (Denmark)

    Andrus, Bogdan-Mihai; Vegas Olmos, Juan José

    2015-01-01

    In the following paper we present the analysis of highly interconnected topologies like hypercube and torus and how they can be implemented in data centers in order to cope with the rapid increase and demands for performance of the internal traffic. By replicating the topologies in NS3...... we scale the network from 16 to 512 switches. The performance measurements are supported by abstract metrics that that also give a cost and complexity indication in choosing the right topology for the required application....

  15. A Serological Protein Microarray for Detection of Multiple Cross-Reactive Flavivirus Infections in Horses for Veterinary and Public Health Surveillance.

    Science.gov (United States)

    Cleton, N B; van Maanen, K; Bergervoet, S A; Bon, N; Beck, C; Godeke, G-J; Lecollinet, S; Bowen, R; Lelli, D; Nowotny, N; Koopmans, M P G; Reusken, C B E M

    2017-12-01

    The genus Flavivirus in the family Flaviviridae includes some of the most important examples of emerging zoonotic arboviruses that are rapidly spreading across the globe. Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV) and Usutu virus (USUV) are mosquito-borne members of the JEV serological group. Although most infections in humans are asymptomatic or present with mild flu-like symptoms, clinical manifestations of JEV, WNV, SLEV, USUV and tick-borne encephalitis virus (TBEV) can include severe neurological disease and death. In horses, infection with WNV and JEV can lead to severe neurological disease and death, while USUV, SLEV and TBEV infections are mainly asymptomatic, however, and induce antibody responses. Horses often serve as sentinels to monitor active virus circulation in serological surveillance programmes specifically for WNV, USUV and JEV. Here, we developed and validated a NS1-antigen protein microarray for the serological differential diagnosis of flavivirus infections in horses using sera of experimentally and naturally infected symptomatic as well as asymptomatic horses. Using samples from experimentally infected horses, an IgG and IgM specificity of 100% and a sensitivity of 95% for WNV and 100% for JEV was achieved with a cut-off titre of 1 : 20 based on ROC calculation. In field settings, the microarray identified 93-100% of IgG-positive horses with recent WNV infections and 87% of TBEV IgG-positive horses. WNV IgM sensitivity was 80%. Differentiation between closely related flaviviruses by the NS1-antigen protein microarray is possible, even though we identified some instances of cross-reactivity among antibodies. However, the assay is not able to differentiate between naturally infected horses and animals vaccinated with an inactivated WNV whole-virus vaccine. We showed that the NS1-microarray can potentially be used for diagnosing and distinguishing flavivirus infections in horses and for public

  16. Flavivirus-Mosquito Interactions

    Directory of Open Access Journals (Sweden)

    Yan-Jang S. Huang

    2014-11-01

    Full Text Available The Flavivirus genus is in the family Flaviviridae and is comprised of more than 70 viruses. These viruses have a broad geographic range, circulating on every continent except Antarctica. Mosquito-borne flaviviruses, such as yellow fever virus, dengue virus serotypes 1–4, Japanese encephalitis virus, and West Nile virus are responsible for significant human morbidity and mortality in affected regions. This review focuses on what is known about flavivirus-mosquito interactions and presents key data collected from the field and laboratory-based molecular and ultrastructural evaluations.

  17. Analysis of the Enzymatic Activity of an NS3 Helicase Genotype 3a Variant Sequence Obtained from a Relapse Patient.

    Directory of Open Access Journals (Sweden)

    Paola J S Provazzi

    Full Text Available The hepatitis C virus (HCV is a species of diverse genotypes that infect over 170 million people worldwide, causing chronic inflammation, cirrhosis and hepatocellular carcinoma. HCV genotype 3a is common in Brazil, and it is associated with a relatively poor response to current direct-acting antiviral therapies. The HCV NS3 protein cleaves part of the HCV polyprotein, and cellular antiviral proteins. It is therefore the target of several HCV drugs. In addition to its protease activity, NS3 is also an RNA helicase. Previously, HCV present in a relapse patient was found to harbor a mutation known to be lethal to HCV genotype 1b. The point mutation encodes the amino acid substitution W501R in the helicase RNA binding site. To examine how the W501R substitution affects NS3 helicase activity in a genotype 3a background, wild type and W501R genotype 3a NS3 alleles were sub-cloned, expressed in E. coli, and the recombinant proteins were purified and characterized. The impact of the W501R allele on genotype 2a and 3a subgenomic replicons was also analyzed. Assays monitoring helicase-catalyzed DNA and RNA unwinding revealed that the catalytic efficiency of wild type genotype 3a NS3 helicase was more than 600 times greater than the W501R protein. Other assays revealed that the W501R protein bound DNA less than 2 times weaker than wild type, and both proteins hydrolyzed ATP at similar rates. In Huh7.5 cells, both genotype 2a and 3a subgenomic HCV replicons harboring the W501R allele showed a severe defect in replication. Since the W501R allele is carried as a minor variant, its replication would therefore need to be attributed to the trans-complementation by other wild type quasispecies.

  18. Spot the Difference-Development of a Syndrome Based Protein Microarray for Specific Serological Detection of Multiple Flavivirus Infections in Travelers

    NARCIS (Netherlands)

    Cleton, Natalie B.; Godeke, Gert-Jan; Reimerink, Johan; Beersma, Mathias F.; van Doorn, H. Rogier; Franco, Leticia; Goeijenbier, Marco; Jimenez-Clavero, Miguel A.; Johnson, Barbara W.; Niedrig, Matthias; Papa, Anna; Sambri, Vittorio; Tami, Adriana; Velasco-Salas, Zoraida L.; Koopmans, Marion P. G.; Reusken, Chantal B. E. M.

    Background The family Flaviviridae, genus Flavivirus, holds many of the world's most prevalent arboviral diseases that are also considered the most important travel related arboviral infections. In most cases, flavivirus diagnosis in travelers is primarily based on serology as viremia is often low

  19. Variability and resistance mutations in the hepatitis C virus NS3 protease in patients not treated with protease inhibitors

    Directory of Open Access Journals (Sweden)

    Luciana Bonome Zeminian

    2013-02-01

    Full Text Available The goal of treatment of chronic hepatitis C is to achieve a sustained virological response, which is defined as exhibiting undetectable hepatitis C virus (HCV RNA levels in serum following therapy for at least six months. However, the current treatment is only effective in 50% of patients infected with HCV genotype 1, the most prevalent genotype in Brazil. Inhibitors of the serine protease non-structural protein 3 (NS3 have therefore been developed to improve the responses of HCV-infected patients. However, the emergence of drug-resistant variants has been the major obstacle to therapeutic success. The goal of this study was to evaluate the presence of resistance mutations and genetic polymorphisms in the NS3 genomic region of HCV from 37 patients infected with HCV genotype 1 had not been treated with protease inhibitors. Plasma viral RNA was used to amplify and sequence the HCV NS3 gene. The results indicate that the catalytic triad is conserved. A large number of substitutions were observed in codons 153, 40 and 91; the resistant variants T54A, T54S, V55A, R155K and A156T were also detected. This study shows that resistance mutations and genetic polymorphisms are present in the NS3 region of HCV in patients who have not been treated with protease inhibitors, data that are important in determining the efficiency of this new class of drugs in Brazil.

  20. Immune evasion strategies of flaviviruses.

    Science.gov (United States)

    Ye, Jing; Zhu, Bibo; Fu, Zhen F; Chen, Huanchun; Cao, Shengbo

    2013-01-07

    Flavivirus is a genus of the family Flaviviridae. It includes West Nile virus (WNV), dengue virus (DENV), yellow fever virus (YFV), Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), and several other viruses which lead to extensive morbidity and mortality in humans. To establish infection and replication in the hosts, flaviviruses have evolved a variety of strategies to modulate the host's immune responses. In this review, the strategies employed by flaviviruses to evade the innate and adaptive immunity of host are summarized based on current studies, with a major focus on the inhibition of interferon, complement, natural killer (NK) cell, B cell, and T cell responses. This review aims to provide an overview of the current understanding for the mechanisms used by flaviviruses to escape the host's immune response, which will facilitate the future studies on flavivirus pathogenesis and the development of anti-flavivirus therapeutics. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  1. Exosomes serve as novel modes of tick-borne flavivirus transmission from arthropod to human cells and facilitates dissemination of viral RNA and proteins to the vertebrate neuronal cells.

    Directory of Open Access Journals (Sweden)

    Wenshuo Zhou

    2018-01-01

    Full Text Available Molecular determinants and mechanisms of arthropod-borne flavivirus transmission to the vertebrate host are poorly understood. In this study, we show for the first time that a cell line from medically important arthropods, such as ticks, secretes extracellular vesicles (EVs including exosomes that mediate transmission of flavivirus RNA and proteins to the human cells. Our study shows that tick-borne Langat virus (LGTV, a model pathogen closely related to tick-borne encephalitis virus (TBEV, profusely uses arthropod exosomes for transmission of viral RNA and proteins to the human- skin keratinocytes and blood endothelial cells. Cryo-electron microscopy showed the presence of purified arthropod/neuronal exosomes with the size range of 30 to 200 nm in diameter. Both positive and negative strands of LGTV RNA and viral envelope-protein were detected inside exosomes derived from arthropod, murine and human cells. Detection of Nonstructural 1 (NS1 protein in arthropod and neuronal exosomes further suggested that exosomes contain viral proteins. Viral RNA and proteins in exosomes derived from tick and mammalian cells were secured, highly infectious and replicative in all tested evaluations. Treatment with GW4869, a selective inhibitor that blocks exosome release affected LGTV loads in both arthropod and mammalian cell-derived exosomes. Transwell-migration assays showed that exosomes derived from infected-brain-microvascular endothelial cells (that constitute the blood-brain barrier facilitated LGTV RNA and protein transmission, crossing of the barriers and infection of neuronal cells. Neuronal infection showed abundant loads of both tick-borne LGTV and mosquito-borne West Nile virus RNA in exosomes. Our data also suggest that exosome-mediated LGTV viral transmission is clathrin-dependent. Collectively, our results suggest that flaviviruses uses arthropod-derived exosomes as a novel means for viral RNA and protein transmission from the vector, and the

  2. Steady-state NTPase activity of Dengue virus NS3: number of catalytic sites, nucleotide specificity and activation by ssRNA.

    Directory of Open Access Journals (Sweden)

    J Jeremías Incicco

    Full Text Available Dengue virus nonstructural protein 3 (NS3 unwinds double stranded RNA driven by the free energy derived from the hydrolysis of nucleoside triphosphates. This paper presents the first systematic and quantitative characterization of the steady-state NTPase activity of DENV NS3 and their interaction with ssRNA. Substrate curves for ATP, GTP, CTP and UTP were obtained, and the specificity order for these nucleotides - evaluated as the ratio (kcat /KM - was GTP[Formula: see text]ATP[Formula: see text]CTP [Formula: see text] UTP, which showed that NS3 have poor ability to discriminate between different NTPs. Competition experiments between the four substrates indicated that all of them are hydrolyzed in one and the same catalytic site of the enzyme. The effect of ssRNA on the ATPase activity of NS3 was studied using poly(A and poly(C. Both RNA molecules produced a 10 fold increase in the turnover rate constant (kcat and a 100 fold decrease in the apparent affinity (KM for ATP. When the ratio [RNA bases]/[NS3] was between 0 and [Formula: see text]20 the ATPase activity was inhibited by increasing both poly(A and poly(C. Using the theory of binding of large ligands (NS3 to a one-dimensional homogeneous lattice of infinite length (RNA we tested the hypothesis that inhibition is the result of crowding of NS3 molecules along the RNA lattices. Finally, we discuss why this hypothesis is consistent with the idea that the ATPase catalytic cycle is tightly coupled to the movement of NS3 helicase along the RNA.

  3. Structural features of NS3 of Dengue virus serotypes 2 and 4 in solution and insight into RNA binding and the inhibitory role of quercetin.

    Science.gov (United States)

    Pan, Ankita; Saw, Wuan Geok; Subramanian Manimekalai, Malathy Sony; Grüber, Ardina; Joon, Shin; Matsui, Tsutomu; Weiss, Thomas M; Grüber, Gerhard

    2017-05-01

    Dengue virus (DENV), which has four serotypes (DENV-1 to DENV-4), is the causative agent of the viral infection dengue. DENV nonstructural protein 3 (NS3) comprises a serine protease domain and an RNA helicase domain which has nucleotide triphosphatase activities that are essential for RNA replication and viral assembly. Here, solution X-ray scattering was used to provide insight into the overall structure and flexibility of the entire NS3 and its recombinant helicase and protease domains for Dengue virus serotypes 2 and 4 in solution. The DENV-2 and DENV-4 NS3 forms are elongated and flexible in solution. The importance of the linker residues in flexibility and domain-domain arrangement was shown by the compactness of the individual protease and helicase domains. Swapping of the 174 PPAVP 179 linker stretch of the related Hepatitis C virus (HCV) NS3 into DENV-2 NS3 did not alter the elongated shape of the engineered mutant. Conformational alterations owing to RNA binding are described in the protease domain, which undergoes substantial conformational alterations that are required for the optimal catalysis of bound RNA. Finally, the effects of ATPase inhibitors on the enzymatically active DENV-2 and DENV-4 NS3 and the individual helicases are presented, and insight into the allosteric effect of the inhibitor quercetin is provided.

  4. Discovery of novel phosphonate derivatives as hepatitis C virus NS3 protease inhibitors.

    Science.gov (United States)

    Sheng, X Christopher; Pyun, Hyung-Jung; Chaudhary, Kleem; Wang, Jianying; Doerffler, Edward; Fleury, Melissa; McMurtrie, Darren; Chen, Xiaowu; Delaney, William E; Kim, Choung U

    2009-07-01

    A novel class of phosphonate derivatives was designed to mimic the interaction of product-like carboxylate based inhibitors of HCV NS3 protease. A phosphonic acid (compound 2) was demonstrated to be a potent HCV NS3 protease inhibitor, and a potential candidate for treating HCV infection. The syntheses and preliminary biological evaluation of this phosphonate class of inhibitor are described.

  5. Dengue Virus NS2B/NS3 Protease Inhibitors Exploiting the Prime Side.

    Science.gov (United States)

    Lin, Kuan-Hung; Ali, Akbar; Rusere, Linah; Soumana, Djade I; Kurt Yilmaz, Nese; Schiffer, Celia A

    2017-05-15

    The mosquito-transmitted dengue virus (DENV) infects millions of people in tropical and subtropical regions. Maturation of DENV particles requires proper cleavage of the viral polyprotein, including processing of 8 of the 13 substrate cleavage sites by dengue virus NS2B/NS3 protease. With no available direct-acting antiviral targeting DENV, NS2/NS3 protease is a promising target for inhibitor design. Current design efforts focus on the nonprime side of the DENV protease active site, resulting in highly hydrophilic and nonspecific scaffolds. However, the prime side also significantly modulates DENV protease binding affinity, as revealed by engineering the binding loop of aprotinin, a small protein with high affinity for DENV protease. In this study, we designed a series of cyclic peptides interacting with both sides of the active site as inhibitors of dengue virus protease. The design was based on two aprotinin loops and aimed to leverage both key specific interactions of substrate sequences and the entropic advantage driving aprotinin's high affinity. By optimizing the cyclization linker, length, and amino acid sequence, the tightest cyclic peptide achieved a K i value of 2.9 μM against DENV3 wild-type (WT) protease. These inhibitors provide proof of concept that both sides of DENV protease active site can be exploited to potentially achieve specificity and lower hydrophilicity in the design of inhibitors targeting DENV. IMPORTANCE Viruses of the flaviviral family, including DENV and Zika virus transmitted by Aedes aegypti , continue to be a threat to global health by causing major outbreaks in tropical and subtropical regions, with no available direct-acting antivirals for treatment. A better understanding of the molecular requirements for the design of potent and specific inhibitors against flaviviral proteins will contribute to the development of targeted therapies for infections by these viruses. The cyclic peptides reported here as DENV protease inhibitors

  6. In vitro inhibitory analysis of consensus siRNAs against NS3 gene of hepatitis C virus 1a genotype.

    Science.gov (United States)

    Shahid, Imran; AlMalki, Waleed Hassan; AlRabia, Mohammed Wanees; Mukhtar, Mohammed Hasan; Almalki, Shaia Saleh R; Alkahtani, Saad Ahmed; Ashgar, Sami S; Faidah, Hani S; Hafeez, Muhammad Hassan

    2017-07-01

    To explore inhibitory effects of genome-specific, chemically synthesized siRNAs (small interference RNA) against NS3 gene of hepatitis C virus (HCV) 1a genotype in stable Huh-7 (human hepatoma) cells as well as against viral replication in serum-inoculated Huh-7 cells. Stable Huh-7 cells persistently expressing NS3 gene were produced under antibiotic gentamycin (G418) selection. The cell clones resistant to 1000 μg antibiotic concentration (G418) were picked as stable cell clones. The NS3 gene expression in stable cell clone was confirmed by RT-PCR and Western blotting. siRNA cell cytotoxicity was determined by MTT cell proliferation assay. Stable cell lines were transfected with sequence specific siRNAs and their inhibitory effects were determined by RT-PCR, real-time PCR and Western blotting. The viral replication inhibition by siRNAs in serum inoculated Huh-7 cells was determined by real-time PCR. RT-PCR and Western blot analysis confirmed NS3 gene and protein expression in stable cell lines on day 10, 20 and 30 post transfection. MTT cell proliferation assay revealed that at most concentrated dose tested (50 nmol/L), siRNA had no cytotoxic effects on Huh-7 cells and cell proliferation remained unaffected. As demonstrated by the siRNA time-dependent inhibitory analysis, siRNA NS3-is44 showed maximum inhibition of NS3 gene in stable Huh-7 cell clones at 24 (80%, P = 0.013) and 48 h (75%, P = 0.002) post transfection. The impact of siRNAs on virus replication in serum inoculated Huh-7 cells also demonstrated significant decrease in viral copy number, where siRNA NS3-is44 exhibited 70% (P siRNA synergism (NS3-is33 + NS3-is44) decreased viral load by 84% (P siRNA (i.e., 64%-70% (P siRNAs mixture (NS5B-is88 + NS3-is33) targeting different region of HCV genome (NS5B and NS3) also decreased HCV viral load by 85% (P siRNA inhibitory effects alone (70% and 64% respectively, P siRNAs directed against NS3 gene significantly decreased mRNA and protein

  7. Flavivirus Entry Receptors: An Update

    Directory of Open Access Journals (Sweden)

    Manuel Perera-Lecoin

    2013-12-01

    Full Text Available Flaviviruses enter host cells by endocytosis initiated when the virus particles interact with cell surface receptors. The current model suggests that flaviviruses use at least two different sets of molecules for infectious entry: attachment factors that concentrate and/or recruit viruses on the cell surface and primary receptor(s that bind to virions and direct them to the endocytic pathway. Here, we present the currently available knowledge regarding the flavivirus receptors described so far with specific attention to C-type lectin receptors and the phosphatidylserine receptors, T-cell immunoglobulin and mucin domain (TIM and TYRO3, AXL and MER (TAM. Their role in flavivirus attachment and entry as well as their implication in the virus biology will be discussed in depth.

  8. The yellow fever 17D vaccine virus as a vector for the expression of foreign proteins: development of new live flavivirus vaccines

    Directory of Open Access Journals (Sweden)

    Myrna C Bonaldo

    2000-01-01

    Full Text Available The Flaviviridae is a family of about 70 mostly arthropod-borne viruses many of which are major public health problems with members being present in most continents. Among the most important are yellow fever (YF, dengue with its four serotypes and Japanese encephalitis virus. A live attenuated virus is used as a cost effective, safe and efficacious vaccine against YF but no other live flavivirus vaccines have been licensed. The rise of recombinant DNA technology and its application to study flavivirus genome structure and expression has opened new possibilities for flavivirus vaccine development. One new approach is the use of cDNAs encopassing the whole viral genome to generate infectious RNA after in vitro transcription. This methodology allows the genetic mapping of specific viral functions and the design of viral mutants with considerable potential as new live attenuated viruses. The use of infectious cDNA as a carrier for heterologous antigens is gaining importance as chimeric viruses are shown to be viable, immunogenic and less virulent as compared to the parental viruses. The use of DNA to overcome mutation rates intrinsic of RNA virus populations in conjunction with vaccine production in cell culture should improve the reliability and lower the cost for production of live attenuated vaccines. The YF virus despite a long period ignored by researchers probably due to the effectiveness of the vaccine has made a come back, both in nature as human populations grow and reach endemic areas as well as in the laboratory being a suitable model to understand the biology of flaviviruses in general and providing new alternatives for vaccine development through the use of the 17D vaccine strain.

  9. Cloning and expression of NS3 helicase fragment of hepatitis C virus and the study of its immunoreactivity in HCV infected patients

    Directory of Open Access Journals (Sweden)

    Mahrou Sadri

    2015-02-01

    Full Text Available Objective(s: Hepatitis C is a major cause of liver failure worldwide. Current therapies applied for this disease are not fully effective and produce side effects in most cases. Non-structural protein 3 helicase (NS3 of HCV is one of the key enzymes in viral replication and infection. Therefore, this region is a promising target to design new drugs and therapies against HCV infection. The aim of this study was cloning and expression of HCV NS3 helicase fragment in Escherichia coli BL21 (DE3 using pET102/D-TOPO expression vector and studying immunoreactivity of the expressed antigen in Iranian infected with hepatitis C. Materials and Methods: The viral RNA was extracted from the serum of HCV infected patient. The NS3 helicase region was amplified by RT-PCR. The PCR product was directionally cloned into the expression vector pET102/D-TOPO and transformed into the BL21 strain of E. coli (DE3. The transformed bacteria were then induced by adding 1mM isopropyl-β-D-thiogalactopyranoside (IPTG into the culture medium to enhance the protein expression. SDS-PAGE and western blotting were carried out to identify the protein under investigation, and finally purified recombinant fusion protein was used as the antigen for ELISA method. Results: Theinsertion of theDNA fragment of the NS3 regioninto the expression vectorwas further confirmed by PCR and sequencing. SDS-PAGE analysis showed the successful expression of the recombinant protein of interest. Furthermore, immunoreactivity of fusion NS3 helicase was confirmed by ELISA and western blotting. Conclusion: It seems that this recombinant protein could be a useful source of antigen for future studies on HCV diagnosis and therapy.

  10. Development and evaluation of a truncated recombinant NS3 antigen-based indirect ELISA for detection of pestivirus antibodies in sheep and goats.

    Science.gov (United States)

    Kalaiyarasu, Semmannan; Mishra, Niranjan; Rajukumar, Katherukamem; Nema, Ram Kumar; Behera, Sthita Pragnya

    2015-01-01

    The aim of this study was to develop an indirect ELISA using the helicase domain of bovine viral diarrhoea virus (BVDV) NS3 protein instead of full-length NS3 protein for detection of BVDV and BDV antibodies in sheep and goats and its validation by comparing its sensitivity and specificity with virus neutralization test (VNT) as the reference test. The purified 50 kDa recombinant NS3 protein was used as the coating antigen in the ELISA. The optimal concentration of antigen was 320 ng/well at a serum dilution of 1:20 and the optimal positive cut-off optical density value was 0.40 based on test results of 418 VNT negative sheep and goat sera samples. When 569 serum samples from sheep (463) and goats (106) were tested, the ELISA showed a sensitivity of 91.71% and specificity of 94.59% with BVDV VNT. A good correlation (93.67%) was observed between the two tests. It showed a sensitivity of 85% and specificity of 86.6% with VNT in detecting BDV antibody positive or negative samples. This study demonstrates the efficacy of truncated recombinant NS3 antigen based ELISA for seroepidemiological study of pestivirus infection in sheep and goats.

  11. Design, structure-based focusing and in silico screening of combinatorial library of peptidomimetic inhibitors of Dengue virus NS2B-NS3 protease

    Science.gov (United States)

    Frecer, Vladimir; Miertus, Stanislav

    2010-03-01

    Serine protease activity of the NS3 protein of Dengue virus is an important target of antiviral agents that interfere with the viral polyprotein precursor processing catalyzed by the NS3 protease (NS3pro), which is important for the viral replication and maturation. Recent studies showed that substrate-based peptidomimetics carrying an electrophilic warhead inhibit the NS2B-NS3pro cofactor-protease complex with inhibition constants in the low micromolar concentration range when basic amino acid residues occupy P1 and P2 positions of the inhibitor, and an aldehyde warhead is attached to the P1. We have used computer-assisted combinatorial techniques to design, focus using the NS2B-NS3pro receptor 3D structure, and in silico screen a virtual library of more than 9,200 peptidomimetic analogs targeted around the template inhibitor Bz-Nle-Lys-Arg-Arg- H (Bz—benzoyl) that are composed mainly of unusual amino acid residues in all positions P1-P4. The most promising virtual hits were analyzed in terms of computed enzyme-inhibitor interactions and Adsorption, Distribution, Metabolism and Excretion (ADME) related physico-chemical properties. Our study can direct the interest of medicinal chemists working on a next generation of antiviral chemotherapeutics against the Dengue Fever towards the explored subset of the chemical space that is predicted to contain peptide aldehydes with NS3pro inhibition potencies in nanomolar range which display ADME-related properties comparable to the training set inhibitors.

  12. Discovering key residues of dengue virus NS2b-NS3-protease: New binding sites for antiviral inhibitors design.

    Science.gov (United States)

    Aguilera-Pesantes, D; Robayo, L E; Méndez, P E; Mollocana, D; Marrero-Ponce, Y; Torres, F J; Méndez, M A

    2017-10-28

    The NS2B-NS3 protease is essential for the Dengue Virus (DENV) replication process. This complex constitutes a target for efficient antiviral discovery because a drug could inhibit the viral polyprotein processing. Furthermore, since the protease is highly conserved between the four Dengue virus serotypes, it is probable that a drug would be equally effective against all of them. In this article, a strategy is reported that allowed us to identify influential residues on the function of the Dengue NS2b-NS3 Protease. Moreover, this is a strategy that could be applied to virtually any protein for the search of alternative influential residues, and for non-competitive inhibitor development. First, we incorporated several features derived from computational alanine scanning mutagenesis, sequence, structure conservation, and other structure-based characteristics. Second, these features were used as variables to obtain a multilayer perceptron model to identify defined groups (clusters) of key residues as possible candidate pockets for binding sites of new leads on the DENV protease. The identified residues included: i) amino acids close to the beta sheet-loop-beta sheet known to be important in its closed conformation for NS2b ii) residues close to the active site, iii) several residues evenly spread on the NS2b-NS3 contact surface, and iv) some inner residues most likely related to the overall stability of the protease. In addition, we found concordance on our list of residues with previously identified amino acids part of a highly conserved peptide studied for vaccine development. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Hepacivirus NS3/4A Proteases Interfere with MAVS Signaling in both Their Cognate Animal Hosts and Humans: Implications for Zoonotic Transmission.

    Science.gov (United States)

    Anggakusuma; Brown, Richard J P; Banda, Dominic H; Todt, Daniel; Vieyres, Gabrielle; Steinmann, Eike; Pietschmann, Thomas

    2016-12-01

    Multiple novel members of the genus Hepacivirus have recently been discovered in diverse mammalian species. However, to date, their replication mechanisms and zoonotic potential have not been explored in detail. The NS3/4A serine protease of hepatitis C virus (HCV) is critical for cleavage of the viral polyprotein. It also cleaves the cellular innate immune adaptor MAVS, thus decreasing interferon (IFN) production and contributing to HCV persistence in the human host. To investigate the conservation of fundamental aspects of the hepaciviral life cycle, we explored if MAVS cleavage and suppression of innate immune signaling represent a common mechanism employed across different clades of the genus Hepacivirus to enhance viral replication. To estimate the zoonotic potential of these nonhuman hepaciviruses, we assessed if their NS3/4A proteases were capable of cleaving human MAVS. NS3/4A proteases of viruses infecting colobus monkeys, rodents, horses, and cows cleaved the MAVS proteins of their cognate hosts and interfered with the ability of MAVS to induce the IFN-β promoter. All NS3/4A proteases from nonhuman viruses readily cleaved human MAVS. Thus, NS3/4A-dependent cleavage of MAVS is a conserved replication strategy across multiple clades within the genus Hepacivirus Human MAVS is susceptible to cleavage by these nonhuman viral proteases, indicating that it does not pose a barrier for zoonotic transmission of these viruses to humans. Virus infection is recognized by cellular sensor proteins triggering innate immune signaling and antiviral defenses. While viruses have evolved strategies to thwart these antiviral programs in their cognate host species, these evasion mechanisms are often ineffective in a novel host, thus limiting viral transmission across species. HCV, the best-characterized member of the genus Hepacivirus within the family Flaviviridae, uses its NS3/4A protease to disrupt innate immune signaling by cleaving the cellular adaptor protein MAVS

  14. Identification and Analysis of Novel Inhibitors against NS3 Helicase and NS5B RNA-Dependent RNA Polymerase from Hepatitis C Virus 1b (Con1

    Directory of Open Access Journals (Sweden)

    Na Yang

    2017-11-01

    Full Text Available Hepatitis C virus (HCV leads to severe liver diseases, including liver fibrosis, cirrhosis and hepatocellular carcinoma. Non-structural protein 3 helicase (NS3h and non-structural protein 5B RNA-dependent RNA polymerase (NS5B are involved in the replication of HCV RNA genome, and have been proved to be excellent targets for discovery of direct-acting antivirals. In this study, two high-throughput screening systems, fluorescence polarization (FP-based ssDNA binding assay and fluorescence intensity (FI-based dsRNA formation assay, were constructed to identify candidate NS3h and NS5B inhibitors, respectively. A library of approximately 800 small molecules and crude extracts, derived from marine microorganisms or purchased from the National Compound Resource Center, China, were screened, with three hits selected for further study. Natural compound No.3A5, isolated from marine fungi, inhibited NS3h activity with an IC50 value of 2.8 μM. We further demonstrated that compound No.3A5 inhibited the abilities of NS3h to bind ssDNA in electrophoretic mobility shift assay and to hydrolyze ATP. The NS3h-inhibitory activity of compound No.3A5 was reversible in our dilution assay, which indicated there was no stable NS3h-No.3A5 complex formed. Additionally, compound No.3A5 exhibited no binding selectivity on NS3h or single strand binding protein of Escherichia coli. In NS5B assays, commercial compounds No.39 and No.94 previously reported as kinase inhibitors were found to disrupt dsRNA formation, and their IC50 values were 62.9 and 18.8 μM, respectively. These results highlight how identifying new uses for existing drugs is an effective method for discovering novel HCV inhibitors. To our knowledge, all inhibitors reported in this study were originally discovered with HCV anti-non-structural protein activities in vitro.

  15. Anticuerpos policlonales contra la proteína recombinante NS3 del virus del dengue

    Directory of Open Access Journals (Sweden)

    Liliana Morales

    2017-01-01

    Resultados. Los anticuerpos producidos fueron útiles en ensayos de Western blot e inmunofluorescencia y se reportó por primera vez un anticuerpo policlonal anti-NS3 que permitió la inmunoprecipitación de la proteína viral y la detecta con Western blot sin necesidad de inducir sobreexpresión de NS3 o de usar extractos de células marcados metabólicamente con radioisótopos. Conclusión. Las proteínas recombinantes expresadas y los anticuerpos producidos constituyen herramientas valiosas para estudiar procesos infecciosos del DENV que involucren a la proteína NS3 y evaluar pruebas dirigidas a interferir las funciones de esta proteína.

  16. How Flaviviruses Activate and Suppress the Interferon Response

    Directory of Open Access Journals (Sweden)

    Brenda L. Fredericksen

    2010-02-01

    Full Text Available The flavivirus genus includes viruses with a remarkable ability to produce disease on a large scale. The expansion and increased endemicity of dengue and West Nile viruses in the Americas exemplifies their medical and epidemiological importance. The rapid detection of viral infection and induction of the innate antiviral response are crucial to determining the outcome of infection. The intracellular pathogen receptors RIG-I and MDA5 play a central role in detecting flavivirus infections and initiating a robust antiviral response. Yet, these viruses are still capable of producing acute illness in humans. It is now clear that flaviviruses utilize a variety of mechanisms to modulate the interferon response. The non-structural proteins of the various flaviviruses reduce expression of interferon dependent genes by blocking phosphorylation, enhancing degradation or down-regulating expression of major components of the JAK/STAT pathway. Recent studies indicate that interferon modulation is an important factor in the development of severe flaviviral illness. This suggests that an increased understanding of viral-host interactions will facilitate the development of novel therapeutics to treat these viral infections and improved biological models to study flavivirus pathogenesis.

  17. Molecular dynamic simulation of complex NS2B-NS3 DENV2 ...

    African Journals Online (AJOL)

    Nissia

    2013-07-10

    Jul 10, 2013 ... Molecular dynamic simulation of complex NS2B-NS3. DENV2 protease with potential ... results provide conformational changes of enzyme-inhibitor complex that is shown by root-mean- square deviation (RMSD) values. ..... utilized MMFF94x and NVT (N=constant number,. V=volume, and T=temperature) ...

  18. Portulaca oleracea L. as a Prospective Candidate Inhibitor of Hepatitis C Virus NS3 Serine Protease.

    Science.gov (United States)

    Noreen, Sobia; Hussain, Ishtiaq; Tariq, Muhammad Ilyas; Ijaz, Bushra; Iqbal, Shahid; Qamar-ul-Zaman; Ashfaq, Usman Ali; Husnain, Tayyab

    2015-06-01

    Hepatitis C virus (HCV) infection is a worldwide health problem affecting about 300 million individuals. HCV causes chronic liver disease, liver cirrhosis, hepatocellular carcinoma, and death. Many side effects are associated with the current treatment options. Natural products that can be used as anti-HCV drugs are thus of considerable potential significance. NS3 serine protease (NS3-SP) is a target for the screening of antiviral activity against HCV. The present work explores plants with anti-HCV potential, isolating possible lead compounds. Ten plants, used for medicinal purposes against different infections in rural areas of Pakistan, were collected. The cellular toxicity effects of methanolic extracts of the plants on the viability of Huh-7 cells were studied through the Trypan blue dye exclusion method. Following this, the anti-HCV potential of phytoextracts was assessed by infecting liver cells with HCV-3a-infected serum inoculum. Only the methanolic extract of Portulaca oleracea L. (PO) exhibited more than 70% inhibition. Four fractions were obtained through bioassay-guided extraction of PO. Subsequent inhibition of all organic extract fractions against NS3 serine protease was checked to track the specific target in the virus. The results showed that the PO methanolic crude and ethyl acetate extract specifically abridged the HCV NS3 protease expression in a dose-dependent fashion. Hence, PO extract and its constituents either alone or with interferon could offer a future option to treat chronic HCV.

  19. High affinity human antibody fragments to dengue virus non-structural protein 3.

    Directory of Open Access Journals (Sweden)

    Nicole J Moreland

    Full Text Available BACKGROUND: The enzyme activities catalysed by flavivirus non-structural protein 3 (NS3 are essential for virus replication. They are distributed between the N-terminal protease domain in the first one-third and the C-terminal ATPase/helicase and nucleoside 5' triphosphatase domain which forms the remainder of the 618-aa long protein. METHODOLOGY/PRINCIPAL FINDINGS: In this study, dengue full-length NS3 protein with residues 49 to 66 of NS2B covalently attached via a flexible linker, was used as bait in biopanning with a naïve human Fab phage-display library. Using a range of truncated constructs spanning the NS2B cofactor region and the full-length NS3, 10 unique Fab were identified and characterized. Of these, monoclonal Fab 3F8 was shown to bind α3″ (residues 526 through 531 within subdomain III of the helicase domain. The antibody inhibits the ATPase and helicase activites of NS3 in biochemical assays and reduces DENV replication in HEK293 cells that were previously transfected with Fab 3F8 compared with mock transfected cells. CONCLUSIONS/SIGNIFICANCE: Antibodies such as 3F8 are valuable tools for studying the molecular mechanisms of flaviviral replication and for the monospecific detection of replicating dengue virus in vivo.

  20. Lyso-myristoyl phosphatidylcholine micelles sustain the activity of Dengue non-structural (NS) protein 3 protease domain fused with the full-length NS2B.

    Science.gov (United States)

    Huang, Qiwei; Li, Qingxin; Joy, Joma; Chen, Angela Shuyi; Ruiz-Carrillo, David; Hill, Jeffrey; Lescar, Julien; Kang, Congbao

    2013-12-01

    Dengue virus (DENV), a member of the flavivirus genus, affects 50-100 million people in tropical and sub-tropical regions. The DENV protease domain is located at the N-terminus of the NS3 protease and requires for its enzymatic activity a hydrophilic segment of the NS2B that acts as a cofactor. The protease is an important antiviral drug target because it plays a crucial role in virus replication by cleaving the genome-coded polypeptide into mature functional proteins. Currently, there are no drugs to inhibit DENV protease activity. Most structural and functional studies have been conducted using protein constructs containing the NS3 protease domain connected to a soluble segment of the NS2B membrane protein via a nine-residue linker. For in vitro structural and functional studies, it would be useful to produce a natural form of the DENV protease containing the NS3 protease domain and the full-length NS2B protein. Herein, we describe the expression and purification of a natural form of DENV protease (NS2BFL-NS3pro) containing the full-length NS2B protein and the protease domain of NS3 (NS3pro). The protease was expressed and purified in detergent micelles necessary for its folding. Our results show that this purified protein was active in detergent micelles such as lyso-myristoyl phosphatidylcholine (LMPC). These findings should facilitate further structural and functional studies of the protease and will facilitate drug discovery targeting DENV. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Anthracene-based Inhibitors of Dengue Virus NS2B-NS3 Protease†

    OpenAIRE

    Tomlinson, Suzanne M.; Watowich, Stanley J.

    2010-01-01

    Dengue virus (DENV) is a mosquito-borne flavivirus that has strained global healthcare systems throughout tropical and subtropical regions of the world. In addition to plaguing developing nations, it has re-emerged in several developed countries with recent outbreaks in the USA (CDC, 2010), Australia (Hanna et al., 2009), Taiwan (Kuan et al., 2010) and France (La Ruche et al., 2010). DENV infection can cause significant disease, including dengue fever, dengue hemorrhagic fever, dengue shock s...

  2. Multiple Sensing Application on Wireless Sensor Network Simulation using NS3

    Science.gov (United States)

    Kurniawan, I. F.; Bisma, R.

    2018-01-01

    Hardware enhancement provides opportunity to install various sensor device on single monitoring node which then enables users to acquire multiple data simultaneously. Constructing multiple sensing application in NS3 is a challenging task since numbers of aspects such as wireless communication, packet transmission pattern, and energy model must be taken into account. Despite of numerous types of monitoring data available, this study only considers two types such as periodic, and event-based data. Periodical data will generate monitoring data follows configured interval, while event-based transmit data when certain determined condition is met. Therefore, this study attempts to cover mentioned aspects in NS3. Several simulations are performed with different number of nodes on arbitrary communication scheme.

  3. Automatic Traffic-Based Internet Control Message Protocol (ICMP) Model Generation for ns-3

    Science.gov (United States)

    2015-12-01

    more protocols (especially at different layers of the OSI model ), implementing an inference engine to extract inter- and intrapacket dependencies, and...ARL-TR-7543 ● DEC 2015 US Army Research Laboratory Automatic Traffic-Based Internet Control Message Protocol (ICMP) Model ...ICMP) Model Generation for ns-3 by Jaime C Acosta and Felipe Jovel Survivability/Lethality Analysis Directorate, ARL Felipe Sotelo and Caesar

  4. The role of viral persistence in flavivirus biology

    Science.gov (United States)

    Mlera, Luwanika; Melik, Wessam; Bloom, Marshall E.

    2014-01-01

    In nature, vector-borne flaviviruses are persistently cycled between either the tick or mosquito vector and small mammals such as rodents, skunks, and swine. These viruses account for considerable human morbidity and mortality worldwide. Increasing and substantial evidence of viral persistence in humans, which includes the isolation of RNA by RT-PCR and infectious virus by culture, continues to be reported. Viral persistence can also be established in vitro in various human, animal, arachnid and insect cell lines in culture. Although some research has focused on the potential roles of defective virus particles, evasion of the immune response through the manipulation of autophagy and/or apoptosis, the precise mechanism of flavivirus persistence is still not well understood. We propose additional research for further understanding of how viral persistence is established in different systems. Avenues for additional studies include determining if the multifunctional flavivirus protein NS5 has a role in viral persistence, the development of relevant animal models of viral persistence as well as investigating the host responses that allow vector borne flavivirus replication without detrimental effects on infected cells. Such studies might shed more light on the viral-host relationships, and could be used to unravel the mechanisms for establishment of persistence. PMID:24737600

  5. Zika Vaccine Development: Flavivirus Foils

    Science.gov (United States)

    2016-09-01

    Martins, Bavari, Zika Vaccine Development 1 Zika Vaccine Development: Flavivirus Foils Martins KAO, Bavari S. The current Zika virus...contrast, work had been underway for decades on the development of an Ebola virus vaccine , laying the groundwork for a rapid response in 2014. The...broader community’s extensive experience with Dengue virus vaccine development and with the pros and cons of different vaccine platforms has led to

  6. Detection of a new insect flavivirus and isolation of Aedes flavivirus in Northern Italy

    Directory of Open Access Journals (Sweden)

    Roiz David

    2012-10-01

    Full Text Available Abstract Background During recent years, numerous novel ‘insect flaviviruses’ have been discovered in natural mosquito populations. In a previous study we described the presence of flavivirus DNA sequences integrated in Aedes albopictus (Asian tiger mosquito populations from Northern Italy in 2007. Methods During 2008 we collected and tested Aedes females for flavivirus presence and developed phylogenetic analysis, virus isolation, electron microscopy studies and RNAse treatments. Results We detected a high prevalence of flavivirus in Ae. albopictus (77.5%. The phylogenetic analysis identified the insect flavivirus sequences as Aedes flavivirus (AEFV recently described in Japan, and that may have been introduced in Italy travelling with the tiger mosquito. Some of these pools grew in C6/36 cells, producing cytopathic effects, and the RNase treatment results showed the presence of the detected sequences in RNA forms. Furthermore, we detected a new insect flavivirus in one pool of Aedes cinereus/geminus mosquitoes. Phylogenetic analysis of this virus shows that it forms a distinct cluster within the clade of insect flavivirus. Conclusions This is the first study to report a high prevalence, to describe the seasonal activity and an isolation of the insect flavivirus Aedes flavivirus in Europe. Moreover we describe the detection of a new insect flavivirus detected from Ae. cinereus mosquitoes from Italy. These flavivirus may be common, ubiquitous and diverse in nature and we discuss the implications of the insect flavivirus group in virus evolution and transmission.

  7. Purification and crystallization of dengue and West Nile virus NS2B–NS3 complexes

    International Nuclear Information System (INIS)

    D’Arcy, Allan; Chaillet, Maxime; Schiering, Nikolaus; Villard, Frederic; Lim, Siew Pheng; Lefeuvre, Peggy; Erbel, Paul

    2006-01-01

    Crystals of dengue serotype 2 and West Nile virus NS2B–NS3 protease complexes have been obtained and the crystals of both diffract to useful resolution. Sample homogeneity was essential for obtaining X-ray-quality crystals of the dengue protease. Controlled proteolysis produced a crystallizable fragment of the apo West Nile virus NS2B–NS3 and crystals were also obtained in the presence of a peptidic inhibitor. Both dengue and West Nile virus infections are an increasing risk to humans, not only in tropical and subtropical areas, but also in North America and parts of Europe. These viral infections are generally transmitted by mosquitoes, but may also be tick-borne. Infection usually results in mild flu-like symptoms, but can also cause encephalitis and fatalities. Approximately 2799 severe West Nile virus cases were reported this year in the United States, resulting in 102 fatalities. With this alarming increase in the number of West Nile virus infections in western countries and the fact that dengue virus already affects millions of people per year in tropical and subtropical climates, there is a real need for effective medicines. A possible therapeutic target to combat these viruses is the protease, which is essential for virus replication. In order to provide structural information to help to guide a lead identification and optimization program, crystallizations of the NS2B–NS3 protease complexes from both dengue and West Nile viruses have been initiated. Crystals that diffract to high resolution, suitable for three-dimensional structure determinations, have been obtained

  8. Simulación de redes móviles ad hoc mediante ns-3

    OpenAIRE

    Yuste Delgado, Antonio

    2014-01-01

    Introducción a la herramienta de simulación de redes network simulator 3 (ns-3). Este simulador es una de los programas más utilizados en la actualidad para la simulación de redes de diversos tipos, desde las redes ad hoc a redes móviles. El profesor Antonio Yuste especialista en protocolos de enrutamiento en redes móviles ad hoc utiliza este software en sus simulaciones. El objetivo de la charla es una dar una visión general del simulador y explicarnos cómo simular redes ad hoc móviles. U...

  9. Virtual screening of commercial cyclic peptides as NS2B-NS3 protease inhibitor of dengue virus serotype 2 through molecular docking simulation

    Science.gov (United States)

    Nasution, M. A. F.; Aini, R. N.; Tambunan, U. S. F.

    2017-04-01

    A disease caused by dengue virus infection has become one of the major health problems in the world, particularly in Asia, Africa, and South America. This disease has become endemic in more than 100 countries, and approximately 100 million cases occur each year with 2.5 billion people or 40% of the world population at risk of having this virus infection. Therefore, we need an antiviral drug that can inhibit the activity of the enzymes that involved in the virus replication in the body. Lately, the peptide-based drug design has been developed and proved to have interesting pharmacological properties. This study uses commercially cyclic peptides that have already marketed. The purpose of this study is to screen the commercial cyclic peptides that can be used as an inhibitor of the NS2B-NS3 protease of dengue virus serotype 2 (DENV-2) through molecular docking simulations. Inhibition of NS3 protease enzyme can lead to enzymatic inhibition activity so the formed polyprotein from the translation of RNA cannot be cut into pieces and remain in the long strand form. Consequently, proteins that are vital for the sustainability of dengue virus replication cannot be formed. This research resulted in [alpha]-ANF (1-28), rat, Brain Natriuretic Peptide, porcine, Atrial Natriuretic Factor (3-28) (human) and Atrial Natriuretic Peptide (126-150) (rat) as the best drug candidate for inhibiting the NS2B-NS3 protease of DENV-2.

  10. Development of Antibody Therapeutics against Flaviviruses

    Science.gov (United States)

    Sun, Haiyan; Chen, Qiang; Lai, Huafang

    2017-01-01

    Recent outbreaks of Zika virus (ZIKV) highlight the urgent need to develop efficacious interventions against flaviviruses, many of which cause devastating epidemics around the world. Monoclonal antibodies (mAb) have been at the forefront of treatment for cancer and a wide array of other diseases due to their specificity and potency. While mammalian cell-produced mAbs have shown promise as therapeutic candidates against several flaviviruses, their eventual approval for human application still faces several challenges including their potential risk of predisposing treated patients to more severe secondary infection by a heterologous flavivirus through antibody-dependent enhancement (ADE). The high cost associated with mAb production in mammalian cell cultures also poses a challenge for the feasible application of these drugs to the developing world where the majority of flavivirus infection occurs. Here, we review the current therapeutic mAb candidates against various flaviviruses including West Nile (WNV), Dengue virus (DENV), and ZIKV. The progress of using plants for developing safer and more economical mAb therapeutics against flaviviruses is discussed within the context of their expression, characterization, downstream processing, neutralization, and in vivo efficacy. The progress of using plant glycoengineering to address ADE, the major impediment of flavivirus therapeutic development, is highlighted. These advancements suggest that plant-based systems are excellent alternatives for addressing the remaining challenges of mAb therapeutic development against flavivirus and may facilitate the eventual commercialization of these drug candidates. PMID:29295568

  11. The development of flavivirus vaccines | Pulmanausahakul | African ...

    African Journals Online (AJOL)

    Mosquito and tick-borne flaviviruses are the causative agents of some of the world's most important diseases, including dengue fever, yellow fever, Japanese ... to vaccine development against a wide range of flaviviruses, but the application of modern techniques to the problem is opening up new avenues of approach.

  12. Novel benzoxazole inhibitor of dengue virus replication that targets the NS3 helicase.

    Science.gov (United States)

    Byrd, Chelsea M; Grosenbach, Douglas W; Berhanu, Aklile; Dai, Dongcheng; Jones, Kevin F; Cardwell, Kara B; Schneider, Christine; Yang, Guang; Tyavanagimatt, Shanthakumar; Harver, Chris; Wineinger, Kristin A; Page, Jessica; Stavale, Eric; Stone, Melialani A; Fuller, Kathleen P; Lovejoy, Candace; Leeds, Janet M; Hruby, Dennis E; Jordan, Robert

    2013-04-01

    Dengue virus (DENV) is the predominant mosquito-borne viral pathogen that infects humans with an estimated 50 to 100 million infections per year worldwide. Over the past 50 years, the incidence of dengue disease has increased dramatically and the virus is now endemic in more than 100 countries. Moreover, multiple serotypes of DENV are now found in the same geographic region, increasing the likelihood of more severe forms of disease. Despite extensive research, there are still no approved vaccines or therapeutics commercially available to treat DENV infection. Here we report the results of a high-throughput screen of a chemical compound library using a whole-virus assay that identified a novel small-molecule inhibitor of DENV, ST-610, that potently and selectively inhibits all four serotypes of DENV replication in vitro. Sequence analysis of drug-resistant virus isolates has identified a single point mutation, A263T, in the NS3 helicase domain that confers resistance to this compound. ST-610 inhibits DENV NS3 helicase RNA unwinding activity in a molecular-beacon-based helicase assay but does not inhibit nucleoside triphosphatase activity based on a malachite green ATPase assay. ST-610 is nonmutagenic, is well tolerated (nontoxic) in mice, and has shown efficacy in a sublethal murine model of DENV infection with the ability to significantly reduce viremia and viral load compared to vehicle controls.

  13. In Silico Screening, Alanine Mutation, and DFT Approaches for Identification of NS2B/NS3 Protease Inhibitors

    Directory of Open Access Journals (Sweden)

    R. Balajee

    2016-01-01

    Full Text Available To identify the ligand that binds to a target protein with high affinity is a nontrivial task in computer-assisted approaches. Antiviral drugs have been identified for NS2B/NS3 protease enzyme on the mechanism to cleave the viral protein using the computational tools. The consequence of the molecular docking, free energy calculations, and simulation protocols explores the better ligand. It provides in-depth structural insights with the catalytic triad of His51, Asp75, Ser135, and Gly133. The MD simulation was employed here to predict the stability of the complex. The alanine mutation has been performed and its stability was monitored by using the molecular dynamics simulation. The minimal RMSD value suggests that the derived complexes are close to equilibrium. The DFT outcome reveals that the HOMO-LUMO gap of Ligand19 is 2.86 kcal/mol. Among the considered ligands, Ligand19 shows the lowest gap and it is suggested that the HOMO of Ligand19 may transfer the electrons to the LUMO in the active regions. The calculated binding energy of Ligand19 using the DFT method is in good agreement with the docking studies. The pharmacological activity of ligand was performed and satisfies Lipinski rule of 5. Moreover, the computational results are compared with the available IC50 values of experimental results.

  14. Discovery of novel cyclic peptide inhibitors of dengue virus NS2B-NS3 protease with antiviral activity.

    Science.gov (United States)

    Takagi, Youhei; Matsui, Kouhei; Nobori, Haruaki; Maeda, Haruka; Sato, Akihiko; Kurosu, Takeshi; Orba, Yasuko; Sawa, Hirofumi; Hattori, Kazunari; Higashino, Kenichi; Numata, Yoshito; Yoshida, Yutaka

    2017-08-01

    NS2B-NS3 protease is an essential enzyme for the replication of dengue virus (DENV), which continues to be a serious threat to worldwide public health. We designed and synthesized a series of cyclic peptides mimicking the substrates of this enzyme, and assayed their activity against the DENV-2 NS2B-NS3 protease. The introduction of aromatic residues at the appropriate positions and conformational restriction generated the most promising cyclic peptide with an IC 50 of 0.95μM against NS2B-NS3 protease. Cyclic peptides with proper positioning of additional arginines and aromatic residues exhibited antiviral activity against DENV. Furthermore, replacing the C-terminal amide bond of the polybasic amino acid sequence with an amino methylene moiety stabilized the cyclic peptides against hydrolysis by NS2B-NS3 protease, while maintaining their enzyme inhibitory activity and antiviral activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Intracytoplasmic stable expression of IgG1 antibody targeting NS3 helicase inhibits replication of highly efficient hepatitis C Virus 2a clone

    Directory of Open Access Journals (Sweden)

    Clementi Massimo

    2010-06-01

    Full Text Available Abstract Background Hepatitis C virus (HCV infection is a major public health problem with more than 170 million cases of chronic infections worldwide. There is no protective vaccine currently available for HCV, therefore the development of novel strategy to prevent chronic infection is important. We reported earlier that a recombinant human antibody clone blocks viral NS3 helicase activity and inhibits replication of HCV 1b virus. This study was performed further to explore the mechanism of action of this recombinant antibody and to determine whether or not this antibody inhibits replication and infectivity of a highly efficient JFH1 HCV 2a virus clone. Results The antiviral effect of intracellular expressed antibody against the HCV 2a virus strain was examined using a full-length green fluorescence protein (GFP labeled infectious cell culture system. For this purpose, a Huh-7.5 cell line stably expressing the NS3 helicase gene specific IgG1 antibody was prepared. Replication of full-length HCV-GFP chimera RNA and negative-strand RNA was strongly inhibited in Huh-7.5 cells stably expressing NS3 antibody but not in the cells expressing an unrelated control antibody. Huh-7.5 cells stably expressing NS3 helicase antibody effectively suppressed infectious virus production after natural infection and the level of HCV in the cell free supernatant remained undetectable after first passage. In contrast, Huh-7.5 cells stably expressing an control antibody against influenza virus had no effect on virus production and high-levels of infectious HCV were detected in culture supernatants over four rounds of infectivity assay. A recombinant adenovirus based expression system was used to demonstrate that Huh-7.5 replicon cell line expressing the intracellular antibody strongly inhibited the replication of HCV-GFP RNA. Conclusion Recombinant human anti-HCV NS3 antibody clone inhibits replication of HCV 2a virus and infectious virus production. Intracellular

  16. Evaluation of the immunogenicity of liposome encapsulated HVR1 and NS3 regions of genotype 3 HCV, either singly or in combination

    Directory of Open Access Journals (Sweden)

    Gupte Gouri M

    2012-03-01

    Full Text Available Abstract Background Hepatitis C virus displays a high rate of mutation and exists as a quasispecies in infected patients. In the absence of an effective universal vaccine, genotype-specific vaccine development represents an alternative. We have attempted to develop a genotype 3 based, liposome encapsulated HCV vaccine with hypervariable region-1 (HVR1 and non-structural region-3 (NS3 components. Results HCV RNA extracted from serum samples of 49 chronically infected patients was PCR amplified to obtain HVR1 region. These amplified products were cloned to obtain 20 clones per sample in order to identify the quasispecies pattern. The HVR1 consensus sequence, along with three variants was reverse transcribed to obtain peptides. The peptides were checked for immunoreactivity individually, as a pool or as a single peptide tetramer interspersed with four glycine residues. Anti-HCV positivity varied from 42.6% (tetramer to 92.2% (variant-4 when 115 anti-HCV positive sera representing genotypes 1, 3, 4 and 6 were screened. All the 95 anti-HCV negatives were scored negative by all antigens. Mice were immunized with different liposome encapsulated or Al(OH3 adjuvanted formulations of HVR1 variants and recombinant NS3 protein, and monitored for anti-HVR1 and anti-NS3 antibody titres, IgG isotypes and antigen specific cytokine levels. A balanced Th1/Th2 isotyping response with high antibody titres was observed in most of the liposome encapsulated antigen groups. The effect of liposomes and aluminium hydroxide on the expression of immune response genes was studied using Taqman Low Density Array. Both Th1 (IFN-gamma, Il18 and Th2 (Il4 genes were up regulated in the liposome encapsulated HVR1 variant pool-NS3 combination group. In-vitro binding of the virus to anti-HVR1 antibodies was demonstrated. Conclusion The optimum immunogen was identified to be combination of peptides of HVR1 consensus sequence and its variants along with pNS3 encapsulated in liposomes

  17. Evaluation of the immunogenicity of liposome encapsulated HVR1 and NS3 regions of genotype 3 HCV, either singly or in combination.

    Science.gov (United States)

    Gupte, Gouri M; Arankalle, Vidya A

    2012-03-27

    Hepatitis C virus displays a high rate of mutation and exists as a quasispecies in infected patients. In the absence of an effective universal vaccine, genotype-specific vaccine development represents an alternative. We have attempted to develop a genotype 3 based, liposome encapsulated HCV vaccine with hypervariable region-1 (HVR1) and non-structural region-3 (NS3) components. HCV RNA extracted from serum samples of 49 chronically infected patients was PCR amplified to obtain HVR1 region. These amplified products were cloned to obtain 20 clones per sample in order to identify the quasispecies pattern. The HVR1 consensus sequence, along with three variants was reverse transcribed to obtain peptides. The peptides were checked for immunoreactivity individually, as a pool or as a single peptide tetramer interspersed with four glycine residues. Anti-HCV positivity varied from 42.6% (tetramer) to 92.2% (variant-4) when 115 anti-HCV positive sera representing genotypes 1, 3, 4 and 6 were screened. All the 95 anti-HCV negatives were scored negative by all antigens. Mice were immunized with different liposome encapsulated or Al(OH)3 adjuvanted formulations of HVR1 variants and recombinant NS3 protein, and monitored for anti-HVR1 and anti-NS3 antibody titres, IgG isotypes and antigen specific cytokine levels. A balanced Th1/Th2 isotyping response with high antibody titres was observed in most of the liposome encapsulated antigen groups. The effect of liposomes and aluminium hydroxide on the expression of immune response genes was studied using Taqman Low Density Array. Both Th1 (IFN-gamma, Il18) and Th2 (Il4) genes were up regulated in the liposome encapsulated HVR1 variant pool-NS3 combination group. In-vitro binding of the virus to anti-HVR1 antibodies was demonstrated. The optimum immunogen was identified to be combination of peptides of HVR1 consensus sequence and its variants along with pNS3 encapsulated in liposomes, which could generate both cellular and humoral

  18. Flaviviruses

    Science.gov (United States)

    1990-01-01

    adults or larvae pro- underlying the increasing susceptibility with age are vides the most sensitive system for assay of mosquito- not known, but they may...Japanese encephalitis, herpesvirus, Trichinella, most important are age, sex, genetic susceptibility, and and visceral larva migrans; a similar...disease was recognized in Asia in 1954 (see section and Toxorhynchites spp. mosquitoes inoculated intra- entitled "Dengue Hemorrhagic Fever," below

  19. Evaluating Andrographolide as a Potent Inhibitor of NS3-4A Protease and Its Drug-Resistant Mutants Using In Silico Approaches

    Directory of Open Access Journals (Sweden)

    Vivek Chandramohan

    2015-01-01

    Full Text Available Current combination therapy of PEG-INF and ribavirin against the Hepatitis C Virus (HCV genotype-1 infections is ineffective in maintaining sustained viral response in 50% of the infection cases. New compounds in the form of protease inhibitors can complement the combination therapy. Asunaprevir is new to the drug regiment as the NS3-4A protease inhibitor, but it is susceptible to two mutations, namely, R155K and D168A in the protein. Thus, in our study, we sought to evaluate Andrographolide, a labdane-diterpenoid from the Andrographis paniculata plant as an effective compound for inhibiting the NS3-4A protease as well as its concomitant drug-resistant mutants by using molecular docking and dynamic simulations. Our study shows that Andrographolide has best docking scores of −15.0862, −15.2322, and −13.9072 compared to those of Asunaprevir −3.7159, −2.6431, and −5.4149 with wild-type R155K and D168A mutants, respectively. Also, as shown in the MD simulations, the compound was good in binding the target proteins and maintains strong bonds causing very less to negligible perturbation in the protein backbone structures. Our results validate the susceptibility of Asunaprevir to protein variants as seen from our docking studies and trajectory period analysis. Therefore, from our study, we hope to add one more option in the drug regiment to tackle drug resistance in HCV infections.

  20. Structure and Function of Flavivirus NS5 Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Zhou,Y.; Ray, D.; Zhao, Y.; Dong, H.; Ren, S.; Li, Z.; Guo, Y.; Bernard, K.; Shi, P.; Li, H.

    2007-01-01

    The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m{sup 7}GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA {yields} m{sup 7}GpppA {yields} m{sup 7}GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m{sup 7}GpppA-RNA can be readily methylated to m{sup 7}GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 {angstrom} resolution showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K{sub 61}-D{sub 146}-K{sub 182}-E{sub 218} motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.

  1. Research of G3-PLC net self-organization processes in the NS-3 modeling framework

    Science.gov (United States)

    Pospelova, Irina; Chebotayev, Pavel; Klimenko, Aleksey; Myakochin, Yuri; Polyakov, Igor; Shelupanov, Alexander; Zykov, Dmitriy

    2017-11-01

    When modern infocommunication networks are designed, the combination of several data transfer channels is widely used. It is necessary for the purposes of improvement in quality and robustness of communication. Communication systems based on more than one data transfer channel are named heterogeneous communication systems. For the design of a heterogeneous network, the most optimal solution is the use of mesh technology. Mesh technology ensures message delivery to the destination under conditions of unpredictable interference environment situation in each of two channels. Therewith, one of the high-priority problems is the choice of a routing protocol when the mesh networks are designed. An important design stage for any computer network is modeling. Modeling allows us to design a few different variants of design solutions and also to compute all necessary functional specifications for each of these solutions. As a result, it allows us to reduce costs for the physical realization of a network. In this article the research of dynamic routing in the NS3 simulation modeling framework is presented. The article contains an evaluation of simulation modeling applicability in solving the problem of heterogeneous networks design. Results of modeling may be afterwards used for physical realization of this kind of networks.

  2. Rapid and sharp decline in HCV upon monotherapy with NS3 protease inhibitor, ACH-1625.

    Science.gov (United States)

    Agarwal, Atul; Zhang, Bao; Olek, Elizabeth; Robison, Heather; Robarge, Lisa; Deshpande, Milind

    2012-01-01

    ACH-1625 is a linear peptidomimetic inhibitor that non-covalently binds to HCV NS3 protease with high potency and specificity. Short-term monotherapy of HCV genotype-1 infection with ACH-1625 was found to be safe and resulted in ≥3.3 log(10) IU/ml mean viral load reduction. These viral load decay data were analysed to compare HCV dynamics with prior reports and estimate the antiviral efficiency of ACH-1625. Drug efficiency was estimated by analysing the viral decay following initiation of up to 5 days of monotherapy with ACH-1625 in 36 chronically infected HCV genotype-1 patients. During this monotherapy study, ACH-1625 was administered either twice-a-day for 4.5 days or once daily for 5 days at 5 different dose levels in 36 patients. A sharp viral decay during the first 48 h following the initiation of ACH-1625 treatment afforded high drug efficiency estimates (≥0.9934). In addition, an increase in the estimated drug efficiency was observed with increasing ACH-1625 dose. The observed anti-HCV response was fairly uniform in this proof-of-concept study across the population of 36 patients. Estimates of the treatment-independent viral kinetics parameters were consistent with prior reports and the estimated drug efficiency of ACH-1625 monotherapy was very high (≥0.9934) in fasted and fed states.

  3. Implementation and Evaluation of WLAN 802.11ac for Residential Networks in NS-3

    Directory of Open Access Journals (Sweden)

    Andy Bubune Amewuda

    2018-01-01

    Full Text Available Wi-Fi has been an amazingly successful technology. Its success may be attributed to the fact that, despite the significant advances made in technology over the last decade, it has remained backward compatible. 802.11ac is the latest version of the wireless LAN (WLAN standard that is currently being adopted, and it promises to deliver very high throughput (VHT, operating at the 5 GHz band. In this paper, we report on an implementation of 802.11ac wireless LAN for residential scenario based on the 802.11ax task group scenario document. We evaluate the 802.11ac protocol performance under different operating conditions. Key features such as modulation coding set (MCS, frame aggregation, and multiple-input multiple-output (MIMO were investigated. We also evaluate the average throughput, delay, jitter, optimum range for goodput, and effect of station (STA density per access point (AP in a network. ns-3, an open source network simulator with features supporting 802.11ac, was used to perform the simulation. Results obtained indicate that very high data rates are achievable. The highest data rate, the best mean delay, and mean jitter are possible under combined features of 802.11ac (MIMO and A-MPDU.

  4. Implementation of quantum key distribution network simulation module in the network simulator NS-3

    Science.gov (United States)

    Mehic, Miralem; Maurhart, Oliver; Rass, Stefan; Voznak, Miroslav

    2017-10-01

    As the research in quantum key distribution (QKD) technology grows larger and becomes more complex, the need for highly accurate and scalable simulation technologies becomes important to assess the practical feasibility and foresee difficulties in the practical implementation of theoretical achievements. Due to the specificity of the QKD link which requires optical and Internet connection between the network nodes, to deploy a complete testbed containing multiple network hosts and links to validate and verify a certain network algorithm or protocol would be very costly. Network simulators in these circumstances save vast amounts of money and time in accomplishing such a task. The simulation environment offers the creation of complex network topologies, a high degree of control and repeatable experiments, which in turn allows researchers to conduct experiments and confirm their results. In this paper, we described the design of the QKD network simulation module which was developed in the network simulator of version 3 (NS-3). The module supports simulation of the QKD network in an overlay mode or in a single TCP/IP mode. Therefore, it can be used to simulate other network technologies regardless of QKD.

  5. Production and characterization of vaccines based on flaviviruses defective in replication

    International Nuclear Information System (INIS)

    Mason, Peter W.; Shustov, Alexandr V.; Frolov, Ilya

    2006-01-01

    To develop new vaccine candidates for flavivirus infections, we have engineered two flaviviruses, yellow fever virus (YFV) and West Nile virus (WNV), that are deficient in replication. These defective pseudoinfectious viruses (PIVs) lack a functional copy of the capsid (C) gene in their genomes and are incapable of causing spreading infection upon infection of cells both in vivo and in vitro. However, they produce extracellular E protein in form of secreted subviral particles (SVPs) that are known to be an effective immunogen. PIVs can be efficiently propagated in trans-complementing cell lines making high levels of C or all three viral structural proteins. PIVs derived from YFV and WNV, demonstrated very high safety and immunization produced high levels of neutralizing antibodies and protective immune response. Such defective flaviviruses can be produced in large scale under low biocontainment conditions and should be useful for diagnostic or vaccine applications

  6. Definition of an epitope on NS3 recognized by human CD4+ cytotoxic T lymphocyte clones cross-reactive for dengue virus types 2, 3, and 4.

    Science.gov (United States)

    Kurane, I; Zeng, L; Brinton, M A; Ennis, F A

    1998-01-20

    The role of dengue virus-specific serotype-cross-reactive T lymphocytes in recovery from and pathogenesis of dengue virus infections is not known. In the present paper, we have defined a dengue serotype-cross-reactive epitope recognized by two CD4+ CD8- cytotoxic T lymphocyte (CTL) clones, JK36 and JK46. These T cell clones were established from the peripheral blood T lymphocytes of a dengue-3-immune donor, using a limiting dilution method. JK36 and JK46 were cross-reactive for dengue virus types 2, 3, and 4, but not for type 1, and recognized the NS3 protein. The smallest synthetic peptide recognized by JK36 was an 8-amino acid peptide that contains amino acids (aa) 226 to 233 (VVAAEMEE) of NS3. The smallest peptide recognized by JK46 was an 11-amino acid peptide that contains aa 224 to 234 (TRVVAAEMEEA). HLA-DR15 was the restriction allele for recognition of these peptides by both JK36 and JK46. This is the first epitope to be defined that is recognized by human CD4+ CTL cross-reactive for dengue virus types 2, 3, and 4.

  7. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus.

    Directory of Open Access Journals (Sweden)

    Jingliang Su

    Full Text Available Since April 2010, a severe outbreak of duck viral infection, with egg drop, feed uptake decline and ovary-oviduct disease, has spread around the major duck-producing regions in China. A new virus, named BYD virus, was isolated in different areas, and a similar disease was reproduced in healthy egg-producing ducks, infecting with the isolated virus. The virus was re-isolated from the affected ducks and replicated well in primary duck embryo fibroblasts and Vero cells, causing the cytopathic effect. The virus was identified as an enveloped positive-stranded RNA virus with a size of approximately 55 nm in diameter. Genomic sequencing of the isolated virus revealed that it is closely related to Tembusu virus (a mosquito-borne Ntaya group flavivirus, with 87-91% nucleotide identity of the partial E (envelope proteins to that of Tembusu virus and 72% of the entire genome coding sequence with Bagaza virus, the most closely related flavivirus with an entirely sequenced genome. Collectively our systematic studies fulfill Koch's postulates, and therefore, the causative agent of the duck egg drop syndrome occurring in China is a new flavivirus. Flavivirus is an emerging and re-emerging zoonotic pathogen and BYD virus that causes severe egg-drop, could be disastrous for the duck industry. More importantly its public health concerns should also be evaluated, and its epidemiology should be closely watched due to the zoonotic nature of flaviviruses.

  8. Flavonoids as noncompetitive inhibitors of Dengue virus NS2B-NS3 protease: inhibition kinetics and docking studies.

    Science.gov (United States)

    de Sousa, Lorena Ramos Freitas; Wu, Hongmei; Nebo, Liliane; Fernandes, João Batista; da Silva, Maria Fátima das Graças Fernandes; Kiefer, Werner; Kanitz, Manuel; Bodem, Jochen; Diederich, Wibke E; Schirmeister, Tanja; Vieira, Paulo Cezar

    2015-02-01

    NS2B-NS3 is a serine protease of the Dengue virus considered a key target in the search for new antiviral drugs. In this study flavonoids were found to be inhibitors of NS2B-NS3 proteases of the Dengue virus serotypes 2 and 3 with IC50 values ranging from 15 to 44 μM. Agathisflavone (1) and myricetin (4) turned out to be noncompetitive inhibitors of dengue virus serotype 2 NS2B-NS3 protease with Ki values of 11 and 4.7 μM, respectively. Docking studies propose a binding mode of the flavonoids in a specific allosteric binding site of the enzyme. Analysis of biomolecular interactions of quercetin (5) with NT647-NHS-labeled Dengue virus serotype 3 NS2B-NS3 protease by microscale thermophoresis experiments, yielded a dissociation constant KD of 20 μM. Our results help to understand the mechanism of inhibition of the Dengue virus serine protease by flavonoids, which is essential for the development of improved inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Structure-based drug design of novel peptidomimetic cellulose derivatives as HCV-NS3 protease inhibitors.

    Science.gov (United States)

    Saleh, Noha A; Elshemey, Wael M

    2017-10-15

    Hepatitis C Virus (HCV) represents a global health threat not only due to the large number of reported worldwide HCV infections, but also due to the absence of a reliable vaccine for its prevention. HCV NS3 protease is one of the most important targets for drug design aiming at the deactivation of HCV. In the present work, molecular docking simulations are carried out for suggested novel NS3 protease inhibitors applied to the Egyptian genotype 4. These inhibitors are modifications of dimer cellulose by adding a hexa-peptide to the cellulose at one of the positions 2, 3, 6, 2', 3' or 6'. Results show that the inhibitor compound with the hexa-peptide at position 6 shows significantly higher simulation docking score with HCV NS3 protease active site. This is supported by low total energy value of docking system, formation of two H-bonds with HCV NS3 protease active site residues, high binding affinity and increased stability in the interaction system. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. T cell immunity to Zika virus targets immunodominant epitopes that show cross-reactivity with other Flaviviruses.

    Science.gov (United States)

    Reynolds, C J; Suleyman, O M; Ortega-Prieto, A M; Skelton, J K; Bonnesoeur, P; Blohm, A; Carregaro, V; Silva, J S; James, E A; Maillère, B; Dorner, M; Boyton, R J; Altmann, D M

    2018-01-12

    Zika virus (ZIKV) Infection has several outcomes from asymptomatic exposure to rash, conjunctivitis, Guillain-Barré syndrome or congenital Zika syndrome. Analysis of ZIKV immunity is confounded by the fact that several related Flaviviruses infect humans, including Dengue virus 1-4, West Nile virus and Yellow Fever virus. HLA class II restricted T cell cross-reactivity between ZIKV and other Flaviviruses infection(s) or vaccination may contribute to protection or to enhanced immunopathology. We mapped immunodominant, HLA class II restricted, CD4 epitopes from ZIKV Envelope (Env), and Non-structural (NS) NS1, NS3 and NS5 antigens in HLA class II transgenic mice. In several cases, ZIKV primed CD4 cells responded to homologous sequences from other viruses, including DENV1-4, WNV or YFV. However, cross-reactive responses could confer immune deviation - the response to the Env DENV4 p1 epitope in HLA-DR1 resulted in IL-17A immunity, often associated with exacerbated immunopathogenesis. This conservation of recognition across Flaviviruses, may encompass protective and/or pathogenic components and poses challenges to characterization of ZIKV protective immunity.

  11. Flavivirus internalization is regulated by a size-dependent endocytic pathway.

    Science.gov (United States)

    Hackett, Brent A; Cherry, Sara

    2018-04-02

    Flaviviruses enter host cells through the process of clathrin-mediated endocytosis, and the spectrum of host factors required for this process are incompletely understood. Here we found that lymphocyte antigen 6 locus E (LY6E) promotes the internalization of multiple flaviviruses, including West Nile virus, Zika virus, and dengue virus. Perhaps surprisingly, LY6E is dispensable for the internalization of the endogenous cargo transferrin, which is also dependent on clathrin-mediated endocytosis for uptake. Since viruses are substantially larger than transferrin, we reasoned that LY6E may be required for uptake of larger cargoes and tested this using transferrin-coated beads of similar size as flaviviruses. LY6E was indeed required for the internalization of transferrin-coated beads, suggesting that LY6E is selectively required for large cargo. Cell biological studies found that LY6E forms tubules upon viral infection and bead internalization, and we found that tubule formation was dependent on RNASEK, which is also required for flavivirus internalization, but not transferrin uptake. Indeed, we found that RNASEK is also required for the internalization of transferrin-coated beads, suggesting it functions upstream of LY6E. These LY6E tubules resembled microtubules, and we found that microtubule assembly was required for their formation and flavivirus uptake. Since microtubule end-binding proteins link microtubules to downstream activities, we screened the three end-binding proteins and found that EB3 promotes virus uptake and LY6E tubularization. Taken together, these results highlight a specialized pathway required for the uptake of large clathrin-dependent endocytosis cargoes, including flaviviruses. Copyright © 2018 the Author(s). Published by PNAS.

  12. Molecular evolution of the insect-specific flaviviruses.

    Science.gov (United States)

    Cook, Shelley; Moureau, Gregory; Kitchen, Andrew; Gould, Ernest A; de Lamballerie, Xavier; Holmes, Edward C; Harbach, Ralph E

    2012-02-01

    There has been an explosion in the discovery of 'insect-specific' flaviviruses and/or their related sequences in natural mosquito populations. Herein we review all 'insect-specific' flavivirus sequences currently available and conduct phylogenetic analyses of both the 'insect-specific' flaviviruses and available sequences of the entire genus Flavivirus. We show that there is no statistical support for virus-mosquito co-divergence, suggesting that the 'insect-specific' flaviviruses may have undergone multiple introductions with frequent host switching. We discuss potential implications for the evolution of vectoring within the family Flaviviridae. We also provide preliminary evidence for potential recombination events in the history of cell fusing agent virus. Finally, we consider priorities and guidelines for future research on 'insect-specific' flaviviruses, including the vast potential that exists for the study of biodiversity within a range of potential hosts and vectors, and its effect on the emergence and maintenance of the flaviviruses.

  13. Identification of a Flavivirus Sequence in a Marine Arthropod.

    Directory of Open Access Journals (Sweden)

    Michael J Conway

    Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

  14. Flavivirus methyltransferase as target for virus treatment

    Czech Academy of Sciences Publication Activity Database

    Krafčíková, Petra; Chalupská, Dominika; Hercík, Kamil; Nencka, Radim; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 216-217 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : flavivirus methyltransferase * antivirals Subject RIV: CE - Biochemistry

  15. The development of flavivirus vaccines | Pulmanausahakul | African ...

    African Journals Online (AJOL)

    Mosquito and tick-borne flaviviruses are the causative agents of some of the world's most important diseases, including dengue fever, yellow fever, Japanese encephalitis, tick-borne encephalitis and West Nile fever. Cumulatively, these viruses cause many millions of infections each year and impose a significant burden on ...

  16. Identification of diagnostic peptide regions that distinguish Zika virus from related mosquito-borne Flaviviruses.

    Directory of Open Access Journals (Sweden)

    Alexandra J Lee

    Full Text Available Zika virus (ZIKV is a member of the Flavivirus genus of positive-sense single-stranded RNA viruses, which includes Dengue, West Nile, Yellow Fever, and other mosquito-borne arboviruses. Infection by ZIKV can be difficult to distinguish from infection by other mosquito-borne Flaviviruses due to high sequence similarity, serum antibody cross-reactivity, and virus co-circulation in endemic areas. Indeed, existing serological methods are not able to consistently differentiate ZIKV from other Flaviviruses, which makes it extremely difficult to accurately calculate the incidence rate of Zika-associated Guillain-Barre in adults, microcephaly in newborns, or asymptomatic infections within a geographical area. In order to identify Zika-specific peptide regions that could be used as serology reagents, we have applied comparative genomics and protein structure analyses to identify amino acid residues that distinguish each of 10 Flavivirus species and subtypes from each other by calculating the specificity, sensitivity, and surface exposure of each residue in relevant target proteins. For ZIKV we identified 104 and 116 15-mer peptides in the E glycoprotein and NS1 non-structural protein, respectively, that contain multiple diagnostic sites and are located in surface-exposed regions in the tertiary protein structure. These sensitive, specific, and surface-exposed peptide regions should serve as useful reagents for seroprevalence studies to better distinguish between prior infections with any of these mosquito-borne Flaviviruses. The development of better detection methods and diagnostic tools will enable clinicians and public health workers to more accurately estimate the true incidence rate of asymptomatic infections, neurological syndromes, and birth defects associated with ZIKV infection.

  17. Flavivirus structural heterogeneity: implications for cell entry.

    Science.gov (United States)

    Rey, Félix A; Stiasny, Karin; Heinz, Franz X

    2017-06-01

    The explosive spread of Zika virus is the most recent example of the threat imposed to human health by flaviviruses. High-resolution structures are available for several of these arthropod-borne viruses, revealing alternative icosahedral organizations of immature and mature virions. Incomplete proteolytic maturation, however, results in a cloud of highly heterogeneous mosaic particles. This heterogeneity is further expanded by a dynamic behavior of the viral envelope glycoproteins. The ensemble of heterogeneous and dynamic infectious particles circulating in infected hosts offers a range of alternative possible receptor interaction sites at their surfaces, potentially contributing to the broad flavivirus host-range and variation in tissue tropism. The potential synergy between heterogeneous particles in the circulating cloud thus provides an additional dimension to understand the unanticipated properties of Zika virus in its recent outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Evaluating co-channel interference in long term evolution-advanced (LTE-Advanced) networks on NS-3 simulator

    CSIR Research Space (South Africa)

    Dzivhani, Mulalo

    2016-09-01

    Full Text Available for a particular noise level and bandwidth. The following equation demonstrates how the theoretical maximum user throughput (C) that can be experienced by a UE is converted from the calculated SINR of that UE [16] as shown in equation (3); C= 𝐵... will need to invest in the equipment and deploy a test-bed. However, this will require a lot of money, which can be a constrain for R&D. Network simulations such as NS-3 becomes a vital tool to setup large-scale networks and test Quality of Service...

  19. FLAVIdB: A data mining system for knowledge discovery in flaviviruses with direct applications in immunology and vaccinology

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Zhang, Guang Lan; Reinherz, Ellis L.

    2011-01-01

    and vaccinology. FLAVIdB contains 12,858 entries of flavivirus antigen sequences, 184 verified T-cell epitopes, 201 verified B-cell epitopes, and 4 representative molecular structures of the dengue virus envelope protein. FLAVIdB was assembled by collection, annotation, and integration of data from GenBank, Gen...... was incorporated into a web-accessible data mining system, combining specialized data analysis tools for integrated analysis of relevant data categories (protein sequences, macromolecular structures, and immune epitopes). The data mining system includes tools for variability and conservation analysis, T...... have been studied extensively, safe and efficient vaccines lack for the majority of the flaviviruses.  Results: We have assembled a database that combines antigenic data of flaviviruses, specialized analysis tools, and workflows for automated complex analyses focusing on applications in immunology...

  20. Effects of NS2B-NS3 protease and furin inhibition on West Nile and Dengue virus replication.

    Science.gov (United States)

    Kouretova, Jenny; Hammamy, M Zouhir; Epp, Anton; Hardes, Kornelia; Kallis, Stephanie; Zhang, Linlin; Hilgenfeld, Rolf; Bartenschlager, Ralf; Steinmetzer, Torsten

    2017-12-01

    West Nile virus (WNV) and Dengue virus (DENV) replication depends on the viral NS2B-NS3 protease and the host enzyme furin, which emerged as potential drug targets. Modification of our previously described WNV protease inhibitors by basic phenylalanine analogs provided compounds with reduced potency against the WNV and DENV protease. In a second series, their decarboxylated P1-trans-(4-guanidino)cyclohexylamide was replaced by an arginyl-amide moiety. Compound 4-(guanidinomethyl)-phenylacetyl-Lys-Lys-Arg-NH 2 inhibits the NS2B-NS3 protease of WNV with an inhibition constant of 0.11 µM. Due to the similarity in substrate specificity, we have also tested the potency of our previously described multibasic furin inhibitors. Their further modification provided chimeric inhibitors with additional potency against the WNV and DENV proteases. A strong inhibition of WNV and DENV replication in cell culture was observed for the specific furin inhibitors, which reduced virus titers up to 10,000-fold. These studies reveal that potent inhibitors of furin can block the replication of DENV and WNV.

  1. Discovery of novel potent and selective dipeptide hepatitis C virus NS3/4A serine protease inhibitors.

    Science.gov (United States)

    Raboisson, Pierre; Lin, Tse-I; Kock, Herman de; Vendeville, Sandrine; Vreken, Wim Van de; McGowan, David; Tahri, Abdellah; Hu, Lili; Lenz, Oliver; Delouvroy, Frederic; Surleraux, Dominique; Wigerinck, Piet; Nilsson, Magnus; Rosenquist, Sa; Samuelsson, Bertil; Simmen, Kenneth

    2008-09-15

    Starting from the previously reported HCV NS3/4A protease inhibitor BILN 2061, we have used a fast-follower approach to identify a novel series of HCV NS3/4A protease inhibitors in which (i) the P3 amino moiety and its capping group have been truncated, (ii) a sulfonamide is introduced in the P1 cyclopropyl amino acid, (iii) the position 8 of the quinoline is substituted with a methyl or halo group, and (iv) the ring size of the macrocycle has been reduced to 14 atoms. SAR analysis performed with a limited set of compounds led to the identification of N-{17-[8-chloro-2-(4-isopropylthiazol-2-yl)-7-methoxyquinolin-4-yloxy]-2,14-dioxo-3,15-diazatricyclo [13.3.0.0 [Bartenschlager, R.; Lohmann, V. J. Gen. Virol. 2000, 81, 1631; Vincent Soriano, Antonio Madejon, Eugenia Vispo, Pablo Labarga, Javier Garcia-Samaniego, Luz Martin-Carbonero, Julie Sheldon, Marcelle Bottecchia, Paula Tuma, Pablo Barreiro Expert Opin. Emerg. Drugs, 2008, 13, 1-19

  2. Interferon signaling in Peromyscus leucopus confers a potent and specific restriction to vector-borne flaviviruses.

    Directory of Open Access Journals (Sweden)

    Adaeze O Izuogu

    Full Text Available Tick-borne flaviviruses (TBFVs, including Powassan virus and tick-borne encephalitis virus cause encephalitis or hemorrhagic fevers in humans with case-fatality rates ranging from 1-30%. Despite severe disease in humans, TBFV infection of natural rodent hosts has little noticeable effect. Currently, the basis for resistance to disease is not known. We hypothesize that the coevolution of flaviviruses with their respective hosts has shaped the evolution of potent antiviral factors that suppress virus replication and protect the host from lethal infection. In the current study, we compared virus infection between reservoir host cells and related susceptible species. Infection of primary fibroblasts from the white-footed mouse (Peromyscus leucopus, a representative host with a panel of vector-borne flaviviruses showed up to a 10,000-fold reduction in virus titer compared to control Mus musculus cells. Replication of vesicular stomatitis virus was equivalent in P. leucopus and M. musculus cells suggesting that restriction was flavivirus-specific. Step-wise comparison of the virus infection cycle revealed a significant block to viral RNA replication, but not virus entry, in P. leucopus cells. To understand the role of the type I interferon (IFN response in virus restriction, we knocked down signal transducer and activator of transcription 1 (STAT1 or the type I IFN receptor (IFNAR1 by RNA interference. Loss of IFNAR1 or STAT1 significantly relieved the block in virus replication in P. leucopus cells. The major IFN antagonist encoded by TBFV, nonstructural protein 5, was functional in P. leucopus cells, thus ruling out ineffective viral antagonism of the host IFN response. Collectively, this work demonstrates that the IFN response of P. leucopus imparts a strong and virus-specific barrier to flavivirus replication. Future identification of the IFN-stimulated genes responsible for virus restriction specifically in P. leucopus will yield mechanistic

  3. Construction and biological characterization of artificial recombinants between a wild type flavivirus (Kunjin) and a live chimeric flavivirus vaccine (ChimeriVax-JE).

    Science.gov (United States)

    Pugachev, Konstantin V; Schwaiger, Julia; Brown, Nathan; Zhang, Zhen-xi; Catalan, John; Mitchell, Frederick S; Ocran, Simeon W; Rumyantsev, Alexander A; Khromykh, Alexander A; Monath, Thomas P; Guirakhoo, Farshad

    2007-09-17

    Although the theoretical concern of genetic recombination has been raised related to the use of live attenuated flavivirus vaccines [Seligman, Gould, Lancet 2004;363:2073-5], it has little foundation [e.g., Monath TP, Kanesa-Thasan N, Guirakhoo F, Pugachev K, Almond J, Lang J, et al. Vaccine 2005;23:2956-8]. To investigate biological effects of recombination between a chimeric yellow fever (YF) 17D/Japanese encephalitis (JE) vaccine virus (ChimeriVax-JE) and a wild-type flavivirus Kunjin (KUN-cDNA), the prM-E envelope protein genes were swapped between the two viruses, resulting in new YF 17D/KUN(prM-E) and KUN/JE(prM-E) chimeras. The prM-E genes are easily exchangeable between flavivirues, and thus the exchange was expected to yield the most replication-competent chimeras, while other rationally designed recombinants would be more likely to be crippled or non-viable. The new chimeras proved highly attenuated in comparison with the KUN-cDNA parent, as judged by plaque size and growth kinetics in cell culture, low viremia in hamsters, and reduced neurovirulence/neuroinvasiveness in mice. These data provide strong experimental evidence that the potential of recombinants, should they ever emerge, to cause disease or spread (compete in nature with wild-type flaviviruses) would be indeed extremely low.

  4. Resistance Analyses of HCV NS3/4A Protease and NS5B Polymerase from Clinical Studies of Deleobuvir and Faldaprevir.

    Directory of Open Access Journals (Sweden)

    Kristi L Berger

    Full Text Available The resistance profile of anti-hepatitis C virus (HCV agents used in combination is important to guide optimal treatment regimens. We evaluated baseline and treatment-emergent NS3/4A and NS5B amino-acid variants among HCV genotype (GT-1a and -1b-infected patients treated with faldaprevir (HCV protease inhibitor, deleobuvir (HCV polymerase non-nucleoside inhibitor, and ribavirin in multiple clinical studies.HCV NS3/4A and NS5B population sequencing (Sanger method was performed on all baseline plasma samples (n = 1425 NS3; n = 1556 NS5B and on post-baseline plasma samples from patients with virologic failure (n = 113 GT-1a; n = 221 GT-1b. Persistence and time to loss of resistance-associated variants (RAVs was estimated using Kaplan-Meier analysis.Faldaprevir RAVs (NS3 R155 and D168 and deleobuvir RAVs (NS5B 495 and 496 were rare (90%. Virologic relapse was associated with RAVs in both NS3 and NS5B (53% GT-1b; 52% GT-1b; some virologic relapses had NS3 RAVs only (47% GT-1a; 17% GT-1b. Median time to loss of GT-1b NS5B P495 RAVs post-treatment (5 months was less than that of GT-1b NS3 D168 (8.5 months and GT-1a R155 RAVs (11.5 months.Faldaprevir and deleobuvir RAVs are more prevalent among virologic failures than at baseline. Treatment response was not compromised by common NS3 polymorphisms; however, alanine at NS5B amino acid 499 at baseline (wild-type in GT-1a, polymorphism in GT-1b may reduce response to this deleobuvir-based regimen.

  5. Construction characterization and application of Flavivirus infectious clones

    NARCIS (Netherlands)

    Jiang, Xiaohong

    2013-01-01

    The topics in this thesis revolve around a group of plus-strand RNA viruses that belong to the Flavivirus genus, a general introduction of which is presented in Chapter 1. The experimental chapters in this thesis mainly focus on the construction and characterization of flavivirus infectious clones

  6. In Vitro Evaluation of Novel Inhibitors against the NS2B-NS3 Protease of Dengue Fever Virus Type 4

    Directory of Open Access Journals (Sweden)

    Thi Thanh Hanh Nguyen

    2013-12-01

    Full Text Available The discovery of potent therapeutic compounds against dengue virus is urgently needed. The NS2B-NS3 protease (NS2B-NS3pro of dengue fever virus carries out all enzymatic activities needed for polyprotein processing and is considered to be amenable to antiviral inhibition by analogy. Virtual screening of 300,000 compounds using Autodock 3 on the GVSS platform was conducted to identify novel inhibitors against the NS2B-NS3pro. Thirty-six compounds were selected for in vitro assay against NS2B-NS3pro expressed in Pichia pastoris. Seven novel compounds were identified as inhibitors with IC50 values of 3.9 ± 0.6–86.7 ± 3.6 μM. Three strong NS2B-NS3pro inhibitors were further confirmed as competitive inhibitors with Ki values of 4.0 ± 0.4, 4.9 ± 0.3, and 3.4 ± 0.1 μM, respectively. Hydrophobic and hydrogen bond interactions between amino acid residues in the NS3pro active site with inhibition compounds were also identified.

  7. Further theoretical insight into the reaction mechanism of the hepatitis C NS3/NS4A serine protease

    Science.gov (United States)

    Martínez-González, José Ángel; Rodríguez, Alex; Puyuelo, María Pilar; González, Miguel; Martínez, Rodrigo

    2015-01-01

    The main reactions of the hepatitis C virus NS3/NS4A serine protease are studied using the second-order Møller-Plesset ab initio method and rather large basis sets to correct the previously reported AM1/CHARMM22 potential energy surfaces. The reaction efficiencies measured for the different substrates are explained in terms of the tetrahedral intermediate formation step (the rate-limiting process). The energies of the barrier and the corresponding intermediate are so close that the possibility of a concerted mechanism is open (especially for the NS5A/5B substrate). This is in contrast to the suggested general reaction mechanism of serine proteases, where a two-step mechanism is postulated.

  8. The NS3 protein of rice hoja blanca virus complements the RNAi suppressor function of HIV-1 Tat

    NARCIS (Netherlands)

    Schnettler, E.; Vries, de W.; Hemmes, J.C.; Haasnoot, J.; Kormelink, R.J.M.; Goldbach, R.W.; Berkhout, B.

    2009-01-01

    The question of whether RNA interference (RNAi) acts as an antiviral mechanism in mammalian cells remains controversial. The antiviral interferon (IFN) response cannot easily be distinguished from a possible antiviral RNAi pathway owing to the involvement of double-stranded RNA (dsRNA) as a common

  9. Dengue Virus Non-Structural Protein 5

    Science.gov (United States)

    El Sahili, Abbas; Lescar, Julien

    2017-01-01

    The World Health Organization estimates that the yearly number of dengue cases averages 390 million. This mosquito-borne virus disease is endemic in over 100 countries and will probably continue spreading, given the observed trend in global warming. So far, there is no antiviral drug available against dengue, but a vaccine has been recently marketed. Dengue virus also serves as a prototype for the study of other pathogenic flaviviruses that are emerging, like West Nile virus and Zika virus. Upon viral entry into the host cell and fusion of the viral lipid membrane with the endosomal membrane, the viral RNA is released and expressed as a polyprotein, that is then matured into three structural and seven non-structural (NS) proteins. The envelope, membrane and capsid proteins form the viral particle while NS1-NS2A-NS2B-NS3-NS4A-NS4B and NS5 assemble inside a cellular replication complex, which is embedded in endoplasmic reticulum (ER)-derived vesicles. In addition to their roles in RNA replication within the infected cell, NS proteins help the virus escape the host innate immunity and reshape the host-cell inner structure. This review focuses on recent progress in characterizing the structure and functions of NS5, a protein responsible for the replication and capping of viral RNA that represents a promising drug target. PMID:28441781

  10. Immunization with a Recombinant Expression Vector Encoding NS3/NS4A of Hepatitis C Virus Genotype 3a Elicits Cell-Mediated Immune Responses in C57BL/6 Mice.

    Science.gov (United States)

    Behzadi, Mohammad Amin; Alborzi, Abdolvahab; Kalani, Mehdi; Pouladfar, Gholamreza; Dianatpour, Mehdi; Ziyaeyan, Mazyar

    2016-04-01

    Today, hepatitis C virus (HCV) infection is considered as one of the most significant international health concerns. Although novel therapeutic regimens against the infection have shown satisfactory results, no approved vaccine exists yet. This study aimed to evaluate the immunogenicity of a DNA vaccine candidate for HCV-3a, based on nonstructural proteins NS3/NS4A, in C57BL/6 mice. Immunogenicity effect of pDisplay-NS3/NS4A was analyzed through immunization with 100 and 200 μg concentrations of the construct with complete Freund's adjuvant, monophosphoryl lipid A (MPL), or without adjuvant. The frequencies of different splenic mononuclear cells were measured using the Mouse Th1/Th2/Th17 Phenotyping Kit. Moreover, the number of T-CD8(+) cells was determined using conjugated anti-CD8a and anti-CD3e antibodies by flow cytometry. As observed, the frequencies of Th1, T-CD8(+), and Th2 cells increased in all the experimental groups, compared with the controls. The highest levels of the respective cells were seen in the group immunized with 200 μg of the construct with MPL. Also, there were positive correlations between the frequency of Th1 cells and those of Th2 and T-CD8(+) cells in all the immunized groups, but were significant in those receiving adjuvants. The frequency of Th17 cells did not statistically change among the groups. Taken together, our findings revealed that the constructed DNA vaccine encoding HCV-3a NS3/NS4A gene induces the cell-mediated immune responses significantly. However, its coadministration with adjuvants exhibits more efficient results than the recombinant plasmid alone. Further study is currently underway to evaluate the specific immune responses and recognize the responsible antigenic epitopes.

  11. Flaviviruses are neurotropic, but how do they invade the CNS?

    Science.gov (United States)

    Neal, J W

    2014-09-01

    Flaviruses (FV) are RNA viruses carried by mosquitoes. Neurological signs including acute encephalitis, meningitis and acute flaccid paralysis develop in a small percentage of infected individuals; long term sequlae are, Parkinsonism, dystonias and cognitive changes. FV neuroinfection is neurotropic involving subcortical nuclei (substantia nigra and thalamus) anterior horn neurons and neocortex. Glycosylation of the FV E envelope protein is one determinant of neuroinvasion, increasing both axonal and trans-epithelial transportation. Neutralizing antibodies against the E and NS proteins prevents FV uptake into several cell types, including axons. CD8+ T cells are vital for clearance of WNF infected cells from the CNS, whereas TLR-3 and TLR-7 mediated anti-virus response through increased serum inflammatory cytokines to disrupt the BBB providing infected leucocytes and free virus access to the CNS (so called Trojan horse) Cellular virus attachment factors, promoting FV cell entry are widely distributed and include DC-SIGN (that detects complex carbohydrate molecules); Glycosamino glycans (GAG), Heparan sulphate(HSPG) Semaphorin 7A, Low Density Lipid receptors (LDLR); these are not FV specific virus entry receptors. The FV also crosses epithelial and endothelial barriers by disrupting Tight Junction complexes to increase BBB permeability. This review describes the multiple pathways responsible for the neuroinvasive properties of the Flaviviruses. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  12. Antibody-based assay discriminates Zika virus infection from other flaviviruses.

    Science.gov (United States)

    Balmaseda, Angel; Stettler, Karin; Medialdea-Carrera, Raquel; Collado, Damaris; Jin, Xia; Zambrana, José Victor; Jaconi, Stefano; Cameroni, Elisabetta; Saborio, Saira; Rovida, Francesca; Percivalle, Elena; Ijaz, Samreen; Dicks, Steve; Ushiro-Lumb, Ines; Barzon, Luisa; Siqueira, Patricia; Brown, David W G; Baldanti, Fausto; Tedder, Richard; Zambon, Maria; de Filippis, A M Bispo; Harris, Eva; Corti, Davide

    2017-08-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus that emerged recently as a global health threat, causing a pandemic in the Americas. ZIKV infection mostly causes mild disease, but is linked to devastating congenital birth defects and Guillain-Barré syndrome in adults. The high level of cross-reactivity among flaviviruses and their cocirculation has complicated serological approaches to differentially detect ZIKV and dengue virus (DENV) infections, accentuating the urgent need for a specific and sensitive serological test. We previously generated a ZIKV nonstructural protein 1 (NS1)-specific human monoclonal antibody, which we used to develop an NS1-based competition ELISA. Well-characterized samples from RT-PCR-confirmed patients with Zika and individuals exposed to other flavivirus infections or vaccination were used in a comprehensive analysis to determine the sensitivity and specificity of the NS1 blockade-of-binding (BOB) assay, which was established in laboratories in five countries (Nicaragua, Brazil, Italy, United Kingdom, and Switzerland). Of 158 sera/plasma from RT-PCR-confirmed ZIKV infections, 145 (91.8%) yielded greater than 50% inhibition. Of 171 patients with primary or secondary DENV infections, 152 (88.9%) scored negative. When the control group was extended to patients infected by other flaviviruses, other viruses, or healthy donors ( n = 540), the specificity was 95.9%. We also analyzed longitudinal samples from DENV-immune and DENV-naive ZIKV infections and found inhibition was achieved within 10 d postonset of illness and maintained over time. Thus, the Zika NS1 BOB assay is sensitive, specific, robust, simple, low-cost, and accessible, and can detect recent and past ZIKV infections for surveillance, seroprevalence studies, and intervention trials.

  13. Potent Inhibitors of the Hepatitis C Virus NS3 Protease: Design and Synthesis of Macrocyclic Substrate-Based [beta]-Strand Mimics

    Energy Technology Data Exchange (ETDEWEB)

    Goudreau, Nathalie; Brochu, Christian; Cameron, Dale R.; Duceppe, Jean-Simon; Faucher, Anne-Marie; Ferland, Jean-Marie; Grand-Maître, Chantal; Poirier, Martin; Simoneau, Bruno; Tsantrizos, Youla S. (Boehringer)

    2008-06-30

    The virally encoded NS3 protease is essential to the life cycle of the hepatitis C virus (HCV), an important human pathogen causing chronic hepatitis, cirrhosis of the liver, and hepatocellular carcinoma. The design and synthesis of 15-membered ring {beta}-strand mimics which are capable of inhibiting the interactions between the HCV NS3 protease enzyme and its polyprotein substrate will be described. The binding interactions between a macrocyclic ligand and the enzyme were explored by NMR and molecular dynamics, and a model of the ligand/enzyme complex was developed.

  14. Prevalence of antibodies to phleboviruses and flaviviruses in Peja, Kosovo.

    Science.gov (United States)

    Venturi, G; Marchi, A; Fiorentini, C; Ramadani, N; Quaglio, G; Kalaveshi, A; Bertinato, L; Putoto, G; Benedetti, E; Rezza, G; Ciufolini, M G

    2011-08-01

    In order to investigate the current and past activity of phlebovirus and flavivirus in Kosovo, a seroprevalence study among 200 blood donors was performed. Positive results were obtained for the phleboviruses TOSV and SFNV, and for a flavivirus of the Japanese Encephalitis group. No positive results for TBEV were observed. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  15. Design of New Competitive Dengue Ns2b/Ns3 Protease Inhibitors—A Computational Approach

    Directory of Open Access Journals (Sweden)

    Noorsaadah Abd. Rahman

    2011-02-01

    Full Text Available Dengue is a serious disease which has become a global health burden in the last decade. Currently, there are no approved vaccines or antiviral therapies to combat the disease. The increasing spread and severity of the dengue virus infection emphasizes the importance of drug discovery strategies that could efficiently and cost-effectively identify antiviral drug leads for development into potent drugs. To this effect, several computational approaches were applied in this work. Initially molecular docking studies of reference ligands to the DEN2 NS2B/NS3 serine protease were carried out. These reference ligands consist of reported competitive inhibitors extracted from Boesenbergia rotunda (i.e., 4-hydroxypanduratin A and panduratin A and three other synthesized panduratin A derivative compounds (i.e., 246DA, 2446DA and 20H46DA. The design of new lead inhibitors was carried out in two stages. In the first stage, the enzyme complexed to the reference ligands was minimized and their complexation energies (i.e., sum of interaction energy and binding energy were computed. New compounds as potential dengue inhibitors were then designed by putting various substituents successively on the benzyl ring A of the reference molecule. These substituted benzyl compounds were then computed for their enzyme-ligand complexation energies. New enzyme-ligand complexes, exhibiting the lowest complexation energies and closest to the computed energy for the reference compounds, were then chosen for the next stage manipulation and design, which involved substituting positions 4 and 5 of the benzyl ring A (positions 3 and 4 for 2446DA with various substituents.

  16. Thermodynamic Mechanism for the Evasion of Antibody Neutralization in Flaviviruses

    Science.gov (United States)

    2015-01-01

    Mutations in the epitopes of antigenic proteins can confer viral resistance to antibody-mediated neutralization. However, the fundamental properties that characterize epitope residues and how mutations affect antibody binding to alter virus susceptibility to neutralization remain largely unknown. To address these questions, we used an ensemble-based algorithm to characterize the effects of mutations on the thermodynamics of protein conformational fluctuations. We applied this method to the envelope protein domain III (ED3) of two medically important flaviviruses: West Nile and dengue 2. We determined an intimate relationship between the susceptibility of a residue to thermodynamic perturbations and epitope location. This relationship allows the successful identification of the primary epitopes in each ED3, despite their high sequence and structural similarity. Mutations that allow the ED3 to evade detection by the antibody either increase or decrease conformational fluctuations of the epitopes through local effects or long-range interactions. Spatially distant interactions originate in the redistribution of conformations of the ED3 ensembles, not through a mechanically connected array of contiguous amino acids. These results reconcile previous observations of evasion of neutralization by mutations at a distance from the epitopes. Finally, we established a quantitative correlation between subtle changes in the conformational fluctuations of the epitope and large defects in antibody binding affinity. This correlation suggests that mutations that allow viral growth, while reducing neutralization, do not generate significant structural changes and underscores the importance of protein fluctuations and long-range interactions in the mechanism of antibody-mediated neutralization resistance. PMID:24950171

  17. Molecular archaeology of Flaviviridae untranslated regions: duplicated RNA structures in the replication enhancer of flaviviruses and pestiviruses emerged via convergent evolution.

    Science.gov (United States)

    Gritsun, Dmitri J; Jones, Ian M; Gould, Ernest A; Gritsun, Tamara S

    2014-01-01

    RNA secondary structures in the 3'untranslated regions (3'UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.

  18. Molecular archaeology of Flaviviridae untranslated regions: duplicated RNA structures in the replication enhancer of flaviviruses and pestiviruses emerged via convergent evolution.

    Directory of Open Access Journals (Sweden)

    Dmitri J Gritsun

    Full Text Available RNA secondary structures in the 3'untranslated regions (3'UTR of the viruses of the family Flaviviridae, previously identified as essential (promoters or beneficial (enhancers for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV. RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.

  19. Molecular Archaeology of Flaviviridae Untranslated Regions: Duplicated RNA Structures in the Replication Enhancer of Flaviviruses and Pestiviruses Emerged via Convergent Evolution

    Science.gov (United States)

    Gritsun, Dmitri J.; Jones, Ian M.; Gould, Ernest A.; Gritsun, Tamara S.

    2014-01-01

    RNA secondary structures in the 3′untranslated regions (3′UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3′UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3′UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3′UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3′UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3′UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs. PMID:24647143

  20. Broadening CD4(+) and CD8(+) T Cell Responses against Hepatitis C Virus by Vaccination with NS3 Overlapping Peptide Panels in Cross-Priming Liposomes

    DEFF Research Database (Denmark)

    Filskov, Jonathan; Mikkelsen, Marianne; Hansen, Paul R.

    2017-01-01

    and was as potent a CD8+ T cell inducer as an adenovirus-vectored vaccine expressing NS3. Importantly, the cellular responses are dominated by multifunctional T cells, such as gamma interferon-positive (IFN-γ+) tumor necrosis factor alpha-positive (TNF-α+) coproducers, and displayed cytotoxic capacity in mice...

  1. The bright and the dark side of human antibody responses to flaviviruses: lessons for vaccine design

    OpenAIRE

    Rey, Félix A; Stiasny, Karin; Vaney, Marie‐Christine; Dellarole, Mariano; Heinz, Franz X

    2017-01-01

    Abstract Zika and dengue viruses belong to the Flavivirus genus, a close group of antigenically related viruses that cause significant arthropod‐transmitted diseases throughout the globe. Although infection by a given flavivirus is thought to confer lifelong protection, some of the patient's antibodies cross‐react with other flaviviruses without cross‐neutralizing. The original antigenic sin phenomenon may amplify such antibodies upon subsequent heterologous flavivirus infection, potentially ...

  2. Arthropod-borne flaviviruses and RNA interference : seeking new approaches for antiviral therapy

    NARCIS (Netherlands)

    Diosa-Toro, Mayra; Urcuqui-Inchima, Silvio; Smit, Jolanda M

    2013-01-01

    Flaviviruses are the most prevalent arthropod-borne viruses worldwide, and nearly half of the 70 Flavivirus members identified are human pathogens. Despite the huge clinical impact of flaviviruses, there is no specific human antiviral therapy available to treat infection with any of the

  3. No correspondence between resistance mutations in the HCV-NS3 protease at baseline and early telaprevir-based triple therapy

    Directory of Open Access Journals (Sweden)

    Luísa Hoffmann

    2015-06-01

    Full Text Available Direct-acting antiviral (DAA-based therapy is the new standard treatment for chronic hepatitis C virus (HCV infection. However, protease inhibitor (PI-resistant viral variants have been often described. This study aimed to examine HCV-NS3 protease variants at baseline and at 4 weeks under triple therapy. To this end, we analyzed the presence of variants in HCV-NS3 protease region from peripheral blood samples of 16 patients infected with HCV-1 at baseline and at 4 weeks of combined therapy with telaprevir, pegylated interferon, and ribavirin, using next-generation sequencing. Several variants with synonymous and non-synonymous amino acid substitutions were detected at both time points. Variants detected at low frequency corresponded to 74% (HCV-1a and 35% (HCV-1b of non-synonymous substitutions. We found nine PI-resistance-associated variants (V36A, T54S, V55I, Q80K, Q80R, V107I, I132V, D168E, M175L in HCV-NS3 of 10 patients. There was no correspondence of resistance-associated variant profile between baseline and at 4 weeks. Moreover, these resistance variants at baseline and short-term treatment are not good predictors of outcome under triple therapy. Our study also shows a large number of others minor and major non-synonymous variants in HCV-NS3 early in telaprevir-based therapy that can be important for further drug resistance association studies with newly developed PI agents.

  4. Dealing with low pH: entry and exit of alphaviruses and flaviviruses.

    Science.gov (United States)

    Sánchez-San Martín, Claudia; Liu, Catherine Y; Kielian, Margaret

    2009-11-01

    The alphaviruses and flaviviruses include many important human pathogens, such as the dengue, West Nile, and Chikungunya viruses. These enveloped viruses infect cells by a membrane fusion reaction triggered by the low pH in endosomes. Fusion is mediated by viral membrane proteins through their acid-dependent conversion from a dimer on the virus surface to a homotrimer inserted into the host cell membrane. Here we review recent studies on the regulatory mechanisms that silence these fusion proteins during virus exit and that sense low pH and mediate protein refolding during virus entry. We discuss results using truncated proteins to dissect the fusion reaction, and future research directions including the development of antiviral therapies against these medically important viruses.

  5. QSAR studies of the bioactivity of hepatitis C virus (HCV) NS3/4A protease inhibitors by multiple linear regression (MLR) and support vector machine (SVM).

    Science.gov (United States)

    Qin, Zijian; Wang, Maolin; Yan, Aixia

    2017-07-01

    In this study, quantitative structure-activity relationship (QSAR) models using various descriptor sets and training/test set selection methods were explored to predict the bioactivity of hepatitis C virus (HCV) NS3/4A protease inhibitors by using a multiple linear regression (MLR) and a support vector machine (SVM) method. 512 HCV NS3/4A protease inhibitors and their IC 50 values which were determined by the same FRET assay were collected from the reported literature to build a dataset. All the inhibitors were represented with selected nine global and 12 2D property-weighted autocorrelation descriptors calculated from the program CORINA Symphony. The dataset was divided into a training set and a test set by a random and a Kohonen's self-organizing map (SOM) method. The correlation coefficients (r 2 ) of training sets and test sets were 0.75 and 0.72 for the best MLR model, 0.87 and 0.85 for the best SVM model, respectively. In addition, a series of sub-dataset models were also developed. The performances of all the best sub-dataset models were better than those of the whole dataset models. We believe that the combination of the best sub- and whole dataset SVM models can be used as reliable lead designing tools for new NS3/4A protease inhibitors scaffolds in a drug discovery pipeline. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Zika Virus Is Not Uniquely Stable at Physiological Temperatures Compared to Other Flaviviruses

    Directory of Open Access Journals (Sweden)

    Leslie Goo

    2016-09-01

    Full Text Available Zika virus (ZIKV is a flavivirus that has emerged as a global health threat due in part to its association with congenital abnormalities. Other globally relevant flaviviruses include dengue virus (DENV and West Nile virus (WNV. High-resolution structures of ZIKV reveal many similarities to DENV and suggest some differences, including an extended glycan loop (D. Sirohi, Z. Chen, L. Sun, T. Klose, T. C. Pierson, et al., 352:467–470, 2016, http://dx.doi.org/10.1126/science.aaf5316 and unique interactions among envelope (E protein residues that were proposed to confer increased virion stability and contribute mechanistically to the distinctive pathobiology of ZIKV (V. A. Kostyuchenko, E. X. Lim, S. Zhang, G. Fibriansah, T. S. Ng, et al., Nature 533:425–428, 2016, http://dx.doi.org/10.1038/nature17994. However, in the latter study, virus stability was inferred by measuring the loss of infectivity following a short incubation period. Here, we rigorously assessed the relative stability of ZIKV, DENV, and WNV by measuring changes in infectivity following prolonged incubation at physiological temperatures. At 37°C, the half-life of ZIKV was approximately twice as long as the half-life of DENV (11.8 and 5.2 h, respectively but shorter than that of WNV (17.7 h. Incubation at 40°C accelerated the loss of ZIKV infectivity. Increasing virion maturation efficiency modestly increased ZIKV stability, as observed previously with WNV and DENV. Finally, mutations at E residues predicted to confer increased stability to ZIKV did not affect virion half-life. Our results demonstrate that ZIKV is not uniquely stable relative to other flaviviruses, suggesting that its unique pathobiology is explained by an alternative mechanism.

  7. [Detection of flavivirus in mosquitoes (Diptera: Culicidae) from Easter Island-Chile].

    Science.gov (United States)

    Collao, Ximena; Prado, Lorena; González, Christian; Vásquez, Ana; Araki, Romina; Henríquez, Tuki; Peña, Cindy M

    2015-02-01

    Flaviviruses are arthropod-borne viruses, mainly by mosquitoes of the genera Aedes and Culex (Culicidae) that are detected in tropical and subtropical areas. Main flaviviruses of public health importance are: dengue, West Nile virus, yellow fever, among others. In continental Chile, flaviviruses has not been detected. However, there are indigenous cases of dengue detected in Easter Island since 2002, as the presence of its vector Aedes aegypti. The aim of this study was: To determine diversity of flavivirus mosquitoes present in Easter Island. Thirty pools of mosquitoes collected in Hanga Roa were analyzed; a RT-PCR nested flavivirus was performed. Thirteen positive samples were detected and the amplification products were sequenced, identifying two specific flavivirus Insect, the Cell fusing agent virus and other related viruses Kamiti River. This is the first study in Chile showed the presence of flavivirus in vectors in Easter Island.

  8. Complement receptor mediates enhanced flavivirus replication in macrophages

    OpenAIRE

    1983-01-01

    Evidence is presented that M phi complement receptors (CR3) mediate IgM- dependent enhancement of flavivirus replication in the presence of complement. Enhancement is blocked by pretreatment of macrophages with monoclonal antibody Ml/70, which inhibits CR3 binding, but not by pretreatment with monoclonal antibody 2.4G2, which inhibits FcR binding.

  9. A three-dimensional comparison of tick-borne flavivirus infection in mammalian and tick cell lines.

    Directory of Open Access Journals (Sweden)

    Danielle K Offerdahl

    Full Text Available Tick-borne flaviviruses (TBFV are sustained in nature through cycling between mammalian and tick hosts. In this study, we used African green monkey kidney cells (Vero and Ixodes scapularis tick cells (ISE6 to compare virus-induced changes in mammalian and arthropod cells. Using confocal microscopy, transmission electron microscopy (TEM, and electron tomography (ET, we examined viral protein distribution and the ultrastructural changes that occur during TBFV infection. Within host cells, flaviviruses cause complex rearrangement of cellular membranes for the purpose of virus replication. Virus infection was accompanied by a marked expansion in endoplasmic reticulum (ER staining and markers for TBFV replication were localized mainly to the ER in both cell lines. TEM of Vero cells showed membrane-bound vesicles enclosed in a network of dilated, anastomosing ER cisternae. Virions were seen within the ER and were sometimes in paracrystalline arrays. Tubular structures or elongated vesicles were occasionally noted. In acutely and persistently infected ISE6 cells, membrane proliferation and vesicles were also noted; however, the extent of membrane expansion and the abundance of vesicles were lower and no viral particles were observed. Tubular profiles were far more prevalent in persistently infected ISE6 cells than in acutely infected cells. By ET, tubular profiles, in persistently infected tick cells, had a cross-sectional diameter of 60-100 nm, reached up to 800 nm in length, were closed at the ends, and were often arranged in fascicle-like bundles, shrouded with ER membrane. Our experiments provide analysis of viral protein localization within the context of both mammalian and arthropod cell lines as well as both acute and persistent arthropod cell infection. Additionally, we show for the first time 3D flavivirus infection in a vector cell line and the first ET of persistent flavivirus infection.

  10. Some epitopes conservation in non structural 3 protein dengue virus serotype 4

    Directory of Open Access Journals (Sweden)

    Tegar A. P. Siregar

    2016-03-01

    Full Text Available AbstrakLatar belakang: Protein Non Struktural 3 (NS3 virus dengue menginduksi respon antibodi netralisasidan respon sel T CD4+ dan CD8+, serta berperan dalam replikasi virus. Protein NS3 memiliki epitopepitopsel T dan B yang terdapat perbedaan kelestarian pada berbagai strain virus dengue serotipe 4(DENV-4. Penelitian ini bertujuan untuk mengetahui kelestarian epitop sel T dan B pada protein NS3DENV-4 strain-strain dunia dan keempat serotipe virus dengue strain Indonesia.Metode: Penelitian ini dilakukan di Departemen Mikrobiologi Fakultas Kedokteran UI sejak Juni 2013 - April2014. Sekuens asam amino NS3 DENV-4 strain 081 didapatkan setelah produk PCR gen NS3 DENV-4 081disekuensing. Epitop-epitop sel T dan sel B protein NS3 DENV-4 081 dianalisis dan dibandingkan dengansekuens asam amino protein NS3 dari 124 strain DENV-4 di dunia dan keempat serotipe DENV strain Indonesia.Strain-strain dunia merupakan strain yang ada di benua Amerika (Venezuela, Colombia, dll dan Asia (Cina,Singapura, dll. Referensi posisi epitop sel T dan B protein NS3 diperoleh dari laporan penelitian terdahulu.Hasil: Delapan epitop sel T dan 2 epitop sel B dari protein NS3 DENV-4 081 ternyata identik dan lestaripada protein NS3 dari 124 strain DENV-4 dunia. Epitop sel B di posisi asam amino 537-544 pada proteinNS3 DENV-4 081 ternyata identik dan lestari dengan epitop sel B protein NS3 dari keempat serotipeDENV strain Indonesia.Kesimpulan: Kelestarian yang luas dari epitop sel T dan B pada hampir seluruh strain DENV-4 dunia danserotipe-serotipe DENV strain Indonesia. (Health Science Journal of Indonesia 2015;6:126-31Kata kunci: virus dengue, protein NS3, epitop sel T, epitop sel B AbstractBackground: Non Structural 3 (NS3 protein of dengue virus (DENV is known to induce antibody, CD4+and CD8+ T cell responses, and playing role in viral replication. NS3 protein has T and B cell epitopes,which has conservation difference between DENV-4 strains. This study aimed to identify

  11. Expectoration of Flaviviruses during sugar feeding by mosquitoes (Diptera: Culicidae).

    Science.gov (United States)

    van den Hurk, Andrew F; Johnson, Petrina H; Hall-Mendelin, Sonja; Northill, Judy A; Simmons, Russell J; Jansen, Cassie C; Frances, Stephen P; Smith, Greg A; Ritchie, Scott A

    2007-09-01

    Biological transmission of arboviruses to a vertebrate host occurs when virions are expelled along with saliva during blood feeding by a hematophagous arthropod. We undertook experiments to determine whether mosquitoes expectorate flaviviruses in their saliva while sugar feeding. Batches of Culex annulirostris Skuse and Culex gelidus Theobald (Diptera: Culicidae) were orally infected with Japanese encephalitis (family Flaviviridae, genus Flavivirus, JEV), Kunjin (family Flaviviridae, genus Flavivirus, KUNV; a subtype of West Nile virus), and Murray Valley encephalitis (family Flaviviridae, genus Flavivirus, MVEV) viruses. After a 7-d extrinsic incubation, these mosquitoes were offered sucrose meals via cotton pledgets, which were removed daily and processed for viral RNA by using real-time TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) assays. JEV, MVEV, and KUNV RNA was detected in all pledgets removed from batches of Cx. gelidus on days 7-14 postexposure. In contrast, detection rates were variable for Cx. annulirostris, with KUNV detected in 0.3 M sucrose pledgets on all days postexposure, and JEV and MVEV detected on 57 and 50% of days postexposure, respectively. Higher concentrations of sucrose in the pledget did not increase virus detection rates. When individual JEV-infected Cx. gelidus were exposed to the sucrose pledget, 73% of mosquitoes expectorated virus with titers that were detectable by TaqMan RT-PCR. These results clearly show that flaviviruses are expectorated by infected mosquitoes during the process of sugar feeding on artificial pledgets. Potential applications of the method for arboviral bioassays and field surveillance are discussed.

  12. Ecuador Paraiso Escondido Virus, a New Flavivirus Isolated from New World Sand Flies in Ecuador, Is the First Representative of a Novel Clade in the Genus Flavivirus.

    Science.gov (United States)

    Alkan, Cigdem; Zapata, Sonia; Bichaud, Laurence; Moureau, Grégory; Lemey, Philippe; Firth, Andrew E; Gritsun, Tamara S; Gould, Ernest A; de Lamballerie, Xavier; Depaquit, Jérôme; Charrel, Rémi N

    2015-12-01

    A new flavivirus, Ecuador Paraiso Escondido virus (EPEV), named after the village where it was discovered, was isolated from sand flies (Psathyromyia abonnenci, formerly Lutzomyia abonnenci) that are unique to the New World. This represents the first sand fly-borne flavivirus identified in the New World. EPEV exhibited a typical flavivirus genome organization. Nevertheless, the maximum pairwise amino acid sequence identity with currently recognized flaviviruses was 52.8%. Phylogenetic analysis of the complete coding sequence showed that EPEV represents a distinct clade which diverged from a lineage that was ancestral to the nonvectored flaviviruses Entebbe bat virus, Yokose virus, and Sokoluk virus and also the Aedes-associated mosquito-borne flaviviruses, which include yellow fever virus, Sepik virus, Saboya virus, and others. EPEV replicated in C6/36 mosquito cells, yielding high infectious titers, but failed to reproduce either in vertebrate cell lines (Vero, BHK, SW13, and XTC cells) or in suckling mouse brains. This surprising result, which appears to eliminate an association with vertebrate hosts in the life cycle of EPEV, is discussed in the context of the evolutionary origins of EPEV in the New World. The flaviviruses are rarely (if ever) vectored by sand fly species, at least in the Old World. We have identified the first representative of a sand fly-associated flavivirus, Ecuador Paraiso Escondido virus (EPEV), in the New World. EPEV constitutes a novel clade according to current knowledge of the flaviviruses. Phylogenetic analysis of the virus genome showed that EPEV roots the Aedes-associated mosquito-borne flaviviruses, including yellow fever virus. In light of this new discovery, the New World origin of EPEV is discussed together with that of the other flaviviruses. Copyright © 2015 Alkan et al.

  13. PCA criterion for SVM (MLP) classifier for flavivirus biomarker from salivary SERS spectra at febrile stage.

    Science.gov (United States)

    Radzol, A R M; Lee, Khuan Y; Mansor, W; Omar, I S

    2016-08-01

    Non-structural protein (NS1) has been conceded as one of the biomarkers for flavivirus that causes diseases with life threatening consequences. NS1 is an antigen that allows detection of the illness at febrile stage, mostly from blood samples currently. Our work here intends to define an optimum model for PCA-SVM with MLP kernel for classification of flavivirus biomarker, NS1 molecule, from SERS spectra of saliva, which to the best of our knowledge has never been explored. Since performance of the model depends on the PCA criterion and MLP parameters, both are examined in tandem. Input vector to classifier determined by each PCA criterion is subjected to brute force tuning of MLP parameters for entirety. Its performance is also compared to our previous works where a Linear and RBF kernel are used. It is found that the best PCA-SVM (MLP) model can be defined by 5 PCs from Cattel's Scree test for PCA, together with P1 and P2 values of 0.1 and -0.2 respectively, with a classification performance of [96.9%, 93.8%, 100.0%].

  14. Cacipacore virus as an emergent mosquito-borne Flavivirus

    Directory of Open Access Journals (Sweden)

    Mario Luis Garcia de Figueiredo

    Full Text Available Abstract INTRODUCTION: Cacipacore virus (CPCV, a possible bird-associated flavivirus, has yet to be detected in mosquitoes. Our purpose is examining CPCV in mosquitoes from the Amazon region of Brazil. METHODS: Approximately 3,253 Culicidae (grouped into 264 pools were collected from the Amazon region during 2002-2006 and analyzed using a Flavivirus genus-specific reverse transcription- polymerase chain reaction followed by nested polymerase chain reaction assay and by nucleotide sequencing of amplicons. RESULTS: Nucleotide sequences from five mosquito samples showed high similarity to the those of CPCV originally isolated in the Amazon region. CONCLUSIONS: This is the first report of CPCV-infected mosquitoes which has implications on the arbovirus maintenance in nature and transmission to man.

  15. Detection of mosquito-only flaviviruses in Europe

    Czech Academy of Sciences Publication Activity Database

    Calzolari, M.; Zé-Zé, L.; Růžek, Daniel; Vazquez, A.; Jeffries, C.; Defilippo, F.; Osório, H.C.; Kilian, Patrik; Ruíz, S.; Fooks, A. R.; Maioli, G.; Amaro, F.; Tlustý, M.; Figuerola, J.; Medlock, J. M.; Bonilauri, P.; Alves, M. J.; Šebesta, Oldřich; Tenorio, A.; Vaux, A. G. C.; Bellini, R.; Gelbič, Ivan; Sánchez-Seco, M. P.; Johnson, N.; Dottori, M.

    2012-01-01

    Roč. 93, č. 6 (2012), s. 1215-1225 ISSN 0022-1317 R&D Projects: GA MŠk 2B08003; GA MŠk(CZ) LC06009; GA ČR GD206/09/H026 Institutional research plan: CEZ:AV0Z60220518; CEZ:AV0Z50070508; CEZ:AV0Z60930519 Keywords : WEST-NILE-VIRUS * INSECT-SPECIFIC FLAVIVIRUSES * POLYMERASE CHAIN-REACTION * FUSING AGENT VIRUS * AEDES-ALBOPICTUS * CULEX FLAVIVIRUS * DIPTERA-CULICIDAE * PHYLOGENETIC ANALYSIS * SURVEILLANCE * TRANSMISSION Subject RIV: EC - Immunology Impact factor: 3.127, year: 2012 http://link.springer.com/article/10.1007%2Fs00436-012-2928-4

  16. Nhumirim virus, a novel flavivirus isolated from mosquitoes from the Pantanal, Brazil

    Science.gov (United States)

    Solberg, Owen; Couto-Lima, Dinair; Kenney, Joan; Serra-Freire, Nicolau; Brault, Aaron; Nogueira, Rita; Langevin, Stanley; Komar, Nicholas

    2016-01-01

    We describe the isolation of a novel flavivirus, isolated from a pool of mosquitoes identified as Culex (Culex) chidesteri collected in 2010 in the Pantanal region of west-central Brazil. The virus is herein designated Nhumirim virus (NHUV) after the name of the ranch from which the mosquito pool was collected. Flavivirus RNA was detected by real-time RT-PCR of homogenized mosquitoes and from the corresponding C6/36 culture supernatant. Based on full-genome sequencing, the virus isolate was genetically distinct from but most closely related to Barkedji virus (BJV), a newly described flavivirus from Senegal. Phylogenetic analysis demonstrated that NHUV grouped with mosquito-borne flaviviruses forming a clade with BJV. This clade may be genetically intermediate between the Culex-borne flaviviruses amplified by birds and the insect-only flaviviruses. PMID:25252815

  17. Mechanism for maturation-related reorganization of flavivirus glycoproteins.

    Science.gov (United States)

    Plevka, Pavel; Battisti, Anthony J; Sheng, Ju; Rossmann, Michael G

    2014-01-01

    Flaviviruses, such as dengue, West Nile, and yellow fever viruses, assemble as fusion-incompetent particles and subsequently undergo a large reorganization of their glycoprotein envelope resulting in formation of mature infectious virions. Here we used a combination of three-dimensional cryo-electron tomography and two-dimensional image analysis to study pleomorphic maturation intermediates of dengue virus 2. Icosahedral symmetries of immature and mature regions within one particle were mismatched relative to each other. Furthermore, the orientation of the two regions relative to each other differed among particles. Therefore, there cannot be a specific pathway determining the maturation of all particles. Instead, the region with mature structure expands when glycoproteins on its boundary acquire suitable orientation and conformation to allow them to become a stable part of the mature region. This type of maturation is possible because the envelope glycoproteins are anchored to the phospholipid bilayer that is a part of flavivirus virions and are thus restricted to movement on the two-dimensional surface of the particle. Therefore, compounds that limit movement of the glycoproteins within the virus membrane might be used as inhibitors of flavivirus maturation. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Genetic characterization of tick-borne flaviviruses : New insights into evolution, pathogenetic determinants and taxonomy

    OpenAIRE

    Grard, G.; Moureau, G.; Charrel, R. N.; Lemasson, Jean-Jacques; Gonzalez, Jean-Paul; Gallian, P.; Gritsun, T. S.; Holmes, E. C.; Gould, E. A.; Lamballerie, X. de

    2007-01-01

    Here, we analyze the complete coding sequences of all recognized tick-borne flavivirus species, including Gadgets Gully Royal Farm and Karshi virus, seabird-associated flaviviruses, Kadant virus and previously uncharacterized isolates of Kyasanur Forest disease virus and Omsk hemorrhagic fever virus. Significant taxonomic improvements are proposed, e.g. the identification of three major groups (mammalian, seabird and Kadam tick-borne flavivirus groups), the creation of a new species (Karshi v...

  19. Analysis of Mosquito-Borne Flavivirus Superinfection in Culex tritaeniorhynchus (Diptera: Culicidae) Cells Persistently Infected with Culex Flavivirus (Flaviviridae).

    Science.gov (United States)

    Kuwata, Ryusei; Isawa, Haruhiko; Hoshino, Keita; Sasaki, Toshinori; Kobayashi, Mutsuo; Maeda, Ken; Sawabe, Kyoko

    2015-03-01

    Superinfection exclusion is generally defined as a phenomenon in which a pre-existing viral infection prevents a secondary viral infection; this has also been observed in infections with mosquito-borne viruses. In this study, we examined the superinfection exclusion of the vertebrate-infecting flaviviruses, Japanese encephalitis virus (JEV) and dengue virus (DENV), by stable and persistent infection with an insect-specific flavivirus, Culex flavivirus (CxFV), in a Culex tritaeniorhynchus Giles cell line (CTR cells). Our experimental system was designed based on the premise that wild Cx. tritaeniorhynchus mosquitoes naturally infected with CxFV are superinfected with JEV by feeding on JEV-infected animals. As a result, we found no evidence of the superinfection exclusion of both JEV and DENV by pre-existing CxFV infection at the cellular level. However, JEV superinfection induced severe cytopathic effects on persistently CxFV-infected CTR cells. These observations imply the possibility that JEV superinfection in CxFV-infected Cx. tritaeniorhynchus mosquitoes has an adverse effect on their fitness. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Discovery and Early Clinical Evaluation of BMS-605339, a Potent and Orally Efficacious Tripeptidic Acylsulfonamide NS3 Protease Inhibitor for the Treatment of Hepatitis C Virus Infection

    Energy Technology Data Exchange (ETDEWEB)

    Scola, Paul M.; Wang, Alan Xiangdong; Good, Andrew C.; Sun, Li-Qiang; Combrink, Keith D.; Campbell, Jeffrey A.; Chen, Jie; Tu, Yong; Sin, Ny; Venables, Brian L.; Sit, Sing-Yuen; Chen, Yan; Cocuzza, Anthony; Bilder, Donna M.; D’Andrea, Stanley; Zheng, Barbara; Hewawasam, Piyasena; Ding, Min; Thuring, Jan; Li, Jianqing; Hernandez, Dennis; Yu, Fei; Falk, Paul; Zhai, Guangzhi; Sheaffer, Amy K.; Chen, Chaoqun; Lee, Min S.; Barry, Diana; Knipe, Jay O.; Li, Wenying; Han, Yong-Hae; Jenkins, Susan; Gesenberg, Christoph; Gao, Qi; Sinz, Michael W.; Santone, Kenneth S.; Zvyaga, Tatyana; Rajamani, Ramkumar; Klei, Herbert E.; Colonno, Richard J.; Grasela, Dennis M.; Hughes, Eric; Chien, Caly; Adams, Stephen; Levesque, Paul C.; Li, Danshi; Zhu, Jialong; Meanwell, Nicholas A.; McPhee, Fiona

    2014-03-13

    The discovery of BMS-605339 (35), a tripeptidic inhibitor of the NS3/4A enzyme, is described. This compound incorporates a cyclopropylacylsulfonamide moiety that was designed to improve the potency of carboxylic acid prototypes through the introduction of favorable nonbonding interactions within the S1' site of the protease. The identification of 35 was enabled through the optimization and balance of critical properties including potency and pharmacokinetics (PK). This was achieved through modulation of the P2* subsite of the inhibitor which identified the isoquinoline ring system as a key template for improving PK properties with further optimization achieved through functionalization. A methoxy moiety at the C6 position of this isoquinoline ring system proved to be optimal with respect to potency and PK, thus providing the clinical compound 35 which demonstrated antiviral activity in HCV-infected patients.

  1. Structure-guided Discovery of a Novel Non-peptide Inhibitor of Dengue Virus NS2B-NS3 Protease.

    Science.gov (United States)

    Li, Linfeng; Basavannacharya, Chandrakala; Chan, Kitti Wing Ki; Shang, Luqing; Vasudevan, Subhash G; Yin, Zheng

    2015-09-01

    Dengue fever is a fast emerging epidemic-prone viral disease caused by dengue virus serotypes 1-4. NS2B-NS3 protease of dengue virus is a validated target to develop antiviral agents. A major limitation in developing dengue virus protease inhibitors has been the lack of or poor cellular activity. In this work, we extracted and refined a pharmacophore model based on X-ray crystal structure and predicted binding patterns, followed by a three-dimensional flexible database filtration. These output molecules were screened according to a docking-based protocol, leading to the discovery of a compound with novel scaffold and good cell-based bioactivity that has potential to be further optimized. The discovery of this novel scaffold by combination of in silico methods suggests that structure-guided drug discovery can lead to the development of potent dengue virus protease inhibitors. © 2014 John Wiley & Sons A/S.

  2. The Structural Dynamics of the Flavivirus Fusion Peptide–Membrane Interaction

    Science.gov (United States)

    Souza, Theo L. F.; Sousa, Ivanildo P.; Bianconi, M. Lucia; Bernardi, Rafael C.; Pascutti, Pedro G.; Silva, Jerson L.; Gomes, Andre M. O.; Oliveira, Andréa C.

    2012-01-01

    Membrane fusion is a crucial step in flavivirus infections and a potential target for antiviral strategies. Lipids and proteins play cooperative roles in the fusion process, which is triggered by the acidic pH inside the endosome. This acidic environment induces many changes in glycoprotein conformation and allows the action of a highly conserved hydrophobic sequence, the fusion peptide (FP). Despite the large volume of information available on the virus-triggered fusion process, little is known regarding the mechanisms behind flavivirus–cell membrane fusion. Here, we evaluated the contribution of a natural single amino acid difference on two flavivirus FPs, FLAG (98DRGWGNGCGLFGK110) and FLAH (98DRGWGNHCGLFGK110), and investigated the role of the charge of the target membrane on the fusion process. We used an in silico approach to simulate the interaction of the FPs with a lipid bilayer in a complementary way and used spectroscopic approaches to collect conformation information. We found that both peptides interact with neutral and anionic micelles, and molecular dynamics (MD) simulations showed the interaction of the FPs with the lipid bilayer. The participation of the indole ring of Trp appeared to be important for the anchoring of both peptides in the membrane model, as indicated by MD simulations and spectroscopic analyses. Mild differences between FLAG and FLAH were observed according to the pH and the charge of the target membrane model. The MD simulations of the membrane showed that both peptides adopted a bend structure, and an interaction between the aromatic residues was strongly suggested, which was also observed by circular dichroism in the presence of micelles. As the FPs of viral fusion proteins play a key role in the mechanism of viral fusion, understanding the interactions between peptides and membranes is crucial for medical science and biology and may contribute to the design of new antiviral drugs. PMID:23094066

  3. Functions and requirements of conserved RNA structures in the 3’ untranslated region of Flaviviruses

    NARCIS (Netherlands)

    Agostinho Gonçalves Costa da Silva, Patrícia

    2011-01-01

    The Flavivirus genus contains nearly 80 viruses, including many important human pathogens such as dengue virus, yellow fever virus, West Nile virus and tick-borne encephalitis virus. To reduce and prevent the impact of flavivirus infection on society, vaccines and effective therapies are required.

  4. NMR analysis of the dynamic exchange of the NS2B cofactor between open and closed conformations of the West Nile virus NS2B-NS3 protease.

    Directory of Open Access Journals (Sweden)

    Xun-Cheng Su

    Full Text Available BACKGROUND: The two-component NS2B-NS3 proteases of West Nile and dengue viruses are essential for viral replication and established targets for drug development. In all crystal structures of the proteases to date, the NS2B cofactor is located far from the substrate binding site (open conformation in the absence of inhibitor and lining the substrate binding site (closed conformation in the presence of an inhibitor. METHODS: In this work, nuclear magnetic resonance (NMR spectroscopy of isotope and spin-labeled samples of the West Nile virus protease was used to investigate the occurrence of equilibria between open and closed conformations in solution. FINDINGS: In solution, the closed form of the West Nile virus protease is the predominant conformation irrespective of the presence or absence of inhibitors. Nonetheless, dissociation of the C-terminal part of the NS2B cofactor from the NS3 protease (open conformation occurs in both the presence and the absence of inhibitors. Low-molecular-weight inhibitors can shift the conformational exchange equilibria so that over 90% of the West Nile virus protease molecules assume the closed conformation. The West Nile virus protease differs from the dengue virus protease, where the open conformation is the predominant form in the absence of inhibitors. CONCLUSION: Partial dissociation of NS2B from NS3 has implications for the way in which the NS3 protease can be positioned with respect to the host cell membrane when NS2B is membrane associated via N- and C-terminal segments present in the polyprotein. In the case of the West Nile virus protease, discovery of low-molecular-weight inhibitors that act by breaking the association of the NS2B cofactor with the NS3 protease is impeded by the natural affinity of the cofactor to the NS3 protease. The same strategy can be more successful in the case of the dengue virus NS2B-NS3 protease.

  5. Rapid Identification of Vector-Borne Flaviviruses by Mass Spectrometry

    Science.gov (United States)

    2010-02-01

    not been well- studied [16]. Important mosquito-borne flaviviruses include dengue viruses serotypes 1e4 (DENV 1e4), yellow fever virus (YFV),West...West Nile virus WNV NY99 Crow/New York/1999 NC_009942 Yellow fever virus YFV Tick-borne viruses Central European subtype TBEVa TBEV-CE Hypr Human...Guirakhoo F, Monath TP, et al. Growth characteristics of ChimeriVax-DEN2 vaccine virus in Aedes aegypti and Aedes albopictus mosquitoes. Am J Trop Med

  6. Rational Design of a Flavivirus Vaccine by Abolishing Viral RNA 2′-O Methylation

    Science.gov (United States)

    Li, Shi-Hua; Dong, Hongping; Li, Xiao-Feng; Xie, Xuping; Zhao, Hui; Deng, Yong-Qiang; Wang, Xiao-Yu; Ye, Qing; Zhu, Shun-Ya; Wang, Hong-Jiang; Zhang, Bo; Leng, Qi-Bin; Zuest, Roland; Qin, E-De

    2013-01-01

    Viruses that replicate in the cytoplasm cannot access the host nuclear capping machinery. These viruses have evolved viral methyltransferase(s) to methylate N-7 and 2′-O cap of their RNA; alternatively, they “snatch” host mRNA cap to form the 5′ end of viral RNA. The function of 2′-O methylation of viral RNA cap is to mimic cellular mRNA and to evade host innate immune restriction. A cytoplasmic virus defective in 2′-O methylation is replicative, but its viral RNA lacks 2′-O methylation and is recognized and eliminated by the host immune response. Such a mutant virus could be rationally designed as a live attenuated vaccine. Here, we use Japanese encephalitis virus (JEV), an important mosquito-borne flavivirus, to prove this novel vaccine concept. We show that JEV methyltransferase is responsible for both N-7 and 2′-O cap methylations as well as evasion of host innate immune response. Recombinant virus completely defective in 2′-O methylation was stable in cell culture after being passaged for >30 days. The mutant virus was attenuated in mice, elicited robust humoral and cellular immune responses, and retained the engineered mutation in vivo. A single dose of immunization induced full protection against lethal challenge with JEV strains in mice. Mechanistically, the attenuation phenotype was attributed to the enhanced sensitivity of the mutant virus to the antiviral effects of interferon and IFIT proteins. Collectively, the results demonstrate the feasibility of using 2′-O methylation-defective virus as a vaccine approach; this vaccine approach should be applicable to other flaviviruses and nonflaviviruses that encode their own viral 2′-O methyltransferases. PMID:23487465

  7. Low density lipopolyprotein inhibits flavivirus acquisition in Aedes aegypti.

    Science.gov (United States)

    Wagar, Z L; Tree, M O; Mpoy, M C; Conway, M J

    2017-12-01

    Aedes aegypti is the primary vector of a number of human pathogens including dengue virus (DENV) and Zika virus (ZIKV). Ae. aegypti acquires these viruses during the processing of bloodmeals obtained from an infected vertebrate host. Vertebrate blood contains a number of factors that have the potential to modify virus acquisition in the mosquito. Interestingly, low density lipopolyprotein (LDL) levels are decreased during severe DENV infection. Accordingly, we hypothesized that LDL is a modifiable factor that can influence flavivirus acquisition in the mosquito. We found that LDL is endocytosed by Ae. aegypti cells in a dynamin-dependent manner. LDL is also endocytosed by midgut epithelial cells and accumulates at the luminal midgut epithelium during bloodmeal digestion. Importantly, pretreatment with LDL, but not high density lipopolyprotein (HDL), significantly inhibited both DENV and ZIKV infection in vitro, and LDL inhibited ZIKV infection in vivo. This study identifies human LDL or 'bad cholesterol' as a modifiable factor that can inhibit flavivirus acquisition in Ae. aegypti. Identification of modifiable blood factors and critical cellular interactions that mediate pathogen acquisition may lead to novel strategies to disrupt the transmission cycle of vector-borne diseases. © 2017 The Royal Entomological Society.

  8. Detection of Culex flavivirus and Aedes flavivirus nucleotide sequences in mosquitoes from parks in the city of São Paulo, Brazil.

    Science.gov (United States)

    Fernandes, Licia Natal; de Paula, Marcia Bicudo; Araújo, Alessandra Bergamo; Gonçalves, Elisabeth Fernandes Bertoletti; Romano, Camila Malta; Natal, Delsio; Malafronte, Rosely dos Santos; Marrelli, Mauro Toledo; Levi, José Eduardo

    2016-05-01

    The dengue viruses are widespread in Brazil and are a major public health concern. Other flaviviruses also cause diseases in humans, although on a smaller scale. The city of São Paulo is in a highly urbanized area with few green spaces apart from its parks, which are used for recreation and where potential vertebrate hosts and mosquito vectors of pathogenic Flavivirus species can be found. Although this scenario can contribute to the transmission of Flavivirus to humans, little is known about the circulation of members of this genus in these areas. In light of this, the present study sought to identify Flavivirus infection in mosquitoes (Diptera: Culicidae) collected in parks in the city of São Paulo. Seven parks in different sectors of the city were selected. Monthly mosquito collections were carried out in each park from March 2011 to February 2012 using aspiration and traps (Shannon and CD C-CO2). Nucleic acids were extracted from the mosquitoes collected and used for reverse-transcriptase and real-time polymerase chain reactions with genus-specific primers targeting a 200-nucleotide region in the Flavivirus NS5 gene. Positive samples were sequenced, and phylogenetic analyses were performed. Culex and Aedes were the most frequent genera of Culicidae collected. Culex flavivirus (CxFV)-related and Aedes flavivirus (AEFV)- related nucleotide sequences were detected in 17 pools of Culex and two pools of Aedes mosquitoes, respectively, among the 818 pools of non-engorged females analyzed. To the best of our knowledge, this is the first report of CxFV and AEFV in the city of São Paulo and Latin America, respectively. Both viruses are insect- specific flaviviruses, a group known to replicate only in mosquito cells and induce a cytopathic effect in some situations. Hence, our data suggests that CxFV and AEFV are present in Culex and Aedes mosquitoes, respectively, in parks in the city of São Paulo. Even though Flavivirus species of medical importance were not

  9. Genetic diversity of NS3 protease from Brazilian HCV isolates and possible implications for therapy with direct-acting antiviral drugs

    Directory of Open Access Journals (Sweden)

    Allan Peres-da-Silva

    2012-03-01

    Full Text Available The hepatitis C virus (HCV NS3 protease has been one of the molecular targets of new therapeutic approaches. Its genomic sequence variability in Brazilian HCV isolates is poorly documented. To obtain more information on the magnitude of its genetic diversity, 114 Brazilian HCV samples were sequenced and analysed together with global reference sequences. Genetic distance (d analyses revealed that subtype 1b had a higher degree of heterogeneity (d = 0.098 than subtypes 1a (d = 0.060 and 3a (d = 0.062. Brazilian isolates of subtype 1b were distributed in the phylogenetic tree among sequences from other countries, whereas most subtype 1a and 3a sequences clustered into a single branch. Additional characterisation of subtype 1a in clades 1 and 2 revealed that all but two Brazilian subtype 1a sequences formed a distinct and strongly supported (approximate likelihood-ratio test = 93 group of sequences inside clade 1. Moreover, this subcluster inside clade 1 presented an unusual phenotypic characteristic in relation to the presence of resistance mutations for macrocyclic inhibitors. In particular, the mutation Q80K was found in the majority of clade 1 sequences, but not in the Brazilian isolates. These data demonstrate that Brazilian HCV subtypes display a distinct pattern of genetic diversity and reinforce the importance of sequence information in future therapeutic approaches.

  10. New insights into flavivirus evolution, taxonomy and biogeographic history, extended by analysis of canonical and alternative coding sequences.

    Directory of Open Access Journals (Sweden)

    Gregory Moureau

    Full Text Available To generate the most diverse phylogenetic dataset for the flaviviruses to date, we determined the genomic sequences and phylogenetic relationships of 14 flaviviruses, of which 10 are primarily associated with Culex spp. mosquitoes. We analyze these data, in conjunction with a comprehensive collection of flavivirus genomes, to characterize flavivirus evolutionary and biogeographic history in unprecedented detail and breadth. Based on the presumed introduction of yellow fever virus into the Americas via the transatlantic slave trade, we extrapolated a timescale for a relevant subset of flaviviruses whose evolutionary history, shows that different Culex-spp. associated flaviviruses have been introduced from the Old World to the New World on at least five separate occasions, with 2 different sets of factors likely to have contributed to the dispersal of the different viruses. We also discuss the significance of programmed ribosomal frameshifting in a central region of the polyprotein open reading frame in some mosquito-associated flaviviruses.

  11. A MicroRNA Screen Identifies the Wnt Signaling Pathway as a Regulator of the Interferon Response during Flavivirus Infection.

    Science.gov (United States)

    Smith, Jessica L; Jeng, Sophia; McWeeney, Shannon K; Hirsch, Alec J

    2017-04-15

    the point of glycogen synthase kinase 3β (GSK3β)-TANK-binding kinase 1 (TBK1) binding, inducing TBK1 to phosphorylate IRF3 and initiate downstream IFN signaling. In this way, we have identified a novel cellular signaling network with a critical role in regulating the replication of multiple virus families. These findings highlight the opportunities for using miRNAs as tools to discover and characterize unique cellular factors involved in supporting or limiting virus replication, opening up new avenues for antiviral research. IMPORTANCE MicroRNAs are a class of small regulatory RNAs that modulate cellular processes through the posttranscriptional repression of multiple transcripts. We hypothesized that individual miRNAs may be capable of inhibiting viral replication through their effects on host proteins or pathways. To test this, we performed a high-content screen for miRNAs that inhibit the replication of three medically relevant members of the flavivirus family: West Nile virus, Japanese encephalitis virus, and dengue virus 2. The results of this screen identify multiple miRNAs that inhibit one or more of these viruses. Extensive follow-up on members of the miR-34 family of miRNAs, which are active against all three viruses as well as the closely related Zika virus, demonstrated that miR-34 functions through increasing the infected cell's ability to respond to infection through the interferon-based innate immune pathway. Our results not only add to the knowledge of how viruses interact with cellular pathways but also provide a basis for more extensive data mining by providing a comprehensive list of miRNAs capable of inhibiting flavivirus replication. Finally, the miRNAs themselves or cellular pathways identified as modulating virus infection may prove to be novel candidates for the development of therapeutic interventions. Copyright © 2017 American Society for Microbiology.

  12. Dating the origin of the genus Flavivirus in the light of Beringian biogeography.

    Science.gov (United States)

    Pettersson, John H-O; Fiz-Palacios, Omar

    2014-09-01

    The genus Flavivirus includes some of the most important human viral pathogens, and its members are found in all parts of the populated world. The temporal origin of diversification of the genus has long been debated due to the inherent problems with dating deep RNA virus evolution. A generally accepted hypothesis suggests that Flavivirus emerged within the last 10 000 years. However, it has been argued that the tick-borne Powassan flavivirus was introduced into North America some time between the opening and closing of the Beringian land bridge that connected Asia and North America 15 000-11 000 years ago, indicating an even older origin for Flavivirus. To determine the temporal origin of Flavivirus, we performed Bayesian relaxed molecular clock dating on a dataset with high coverage of the presently available Flavivirus diversity by combining tip date calibrations and internal node calibration, based on the Powassan virus and Beringian land bridge biogeographical event. Our analysis suggested that Flavivirus originated ~85 000 (64 000-110 000) or 120 000 (87 000-159 000) years ago, depending on the circumscription of the genus. This is significantly older than estimated previously. In light of our results, we propose that it is likely that modern humans came in contact with several members of the genus Flavivirus much earlier than suggested previously, and that it is possible that the spread of several flaviviruses coincided with, and was facilitated by, the migration and population expansion of modern humans out of Africa. © 2014 The Authors.

  13. Co-circulation of West Nile virus and distinct insect-specific flaviviruses in Turkey.

    Science.gov (United States)

    Ergünay, Koray; Litzba, Nadine; Brinkmann, Annika; Günay, Filiz; Sarıkaya, Yasemen; Kar, Sırrı; Örsten, Serra; Öter, Kerem; Domingo, Cristina; Erisoz Kasap, Özge; Özkul, Aykut; Mitchell, Luke; Nitsche, Andreas; Alten, Bülent; Linton, Yvonne-Marie

    2017-03-20

    Active vector surveillance provides an efficient tool for monitoring the presence or spread of emerging or re-emerging vector-borne viruses. This study was undertaken to investigate the circulation of flaviviruses. Mosquitoes were collected from 58 locations in 10 provinces across the Aegean, Thrace and Mediterranean Anatolian regions of Turkey in 2014 and 2015. Following morphological identification, mosquitoes were pooled and screened by nested and real-time PCR assays. Detected viruses were further characterised by sequencing. Positive pools were inoculated onto cell lines for virus isolation. Next generation sequencing was employed for genomic characterisation of the isolates. A total of 12,711 mosquito specimens representing 15 species were screened in 594 pools. Eleven pools (2%) were reactive in the virus screening assays. Sequencing revealed West Nile virus (WNV) in one Culex pipiens (s.l.) pool from Thrace. WNV sequence corresponded to lineage one clade 1a but clustered distinctly from the Turkish prototype isolate. In 10 pools, insect-specific flaviviruses were characterised as Culex theileri flavivirus in 5 pools of Culex theileri and one pool of Cx. pipiens (s.l.), Ochlerotatus caspius flavivirus in two pools of Aedes (Ochlerotatus) caspius, Flavivirus AV-2011 in one pool of Culiseta annulata, and an undetermined flavivirus in one pool of Uranotaenia unguiculata from the Aegean and Thrace regions. DNA forms or integration of the detected insect-specific flaviviruses were not observed. A virus strain, tentatively named as "Ochlerotatus caspius flavivirus Turkey", was isolated from an Ae. caspius pool in C6/36 cells. The viral genome comprised 10,370 nucleotides with a putative polyprotein of 3,385 amino acids that follows the canonical flavivirus polyprotein organisation. Sequence comparisons and phylogenetic analyses revealed the close relationship of this strain with Ochlerotatus caspius flavivirus from Portugal and Hanko virus from Finland. Several

  14. Selection of replicon variants resistant to ACH-806, a novel hepatitis C virus inhibitor with no cross-resistance to NS3 protease and NS5B polymerase inhibitors.

    Science.gov (United States)

    Yang, Wengang; Zhao, Yongsen; Fabrycki, Joanne; Hou, Xiaohong; Nie, Xingtie; Sanchez, Amy; Phadke, Avinash; Deshpande, Milind; Agarwal, Atul; Huang, Mingjun

    2008-06-01

    We have discovered a novel class of compounds active against hepatitis C virus (HCV), using a surrogate cellular system, HCV replicon cells. The leading compound in the series, ACH-806 (GS-9132), is a potent and specific inhibitor of HCV. The selection of resistance replicon variants against ACH-806 was performed to map the mutations conferring resistance to ACH-806 and to determine cross-resistance profiles with other classes of HCV inhibitors. Several clones emerged after the addition of ACH-806 to HCV replicon cells at frequencies and durations similar to that observed with NS3 protease inhibitors and NS5B polymerase inhibitors. Phenotypic analyses of these clones revealed that they are resistant to ACH-806 but remain sensitive to other classes of HCV inhibitors. Moreover, no significant change in the susceptibility to ACH-806 was found when the replicon cellular clones resistant to NS3 protease inhibitors and NS5B polymerase inhibitors were examined. Sequencing of the entire coding region of ACH-806-resistant replicon variants yielded several consensus mutations. Reverse genetics identified two single mutations in NS3, a cysteine-to-serine mutation at amino acid 16 and an alanine-to-valine mutation at amino acid 39, that are responsible for the resistance of the replicon variants to ACH-806. Both mutations are located at the N terminus of NS3 where extensive interactions with the central hydrophobic region of NS4A exist. These data provide evidence that ACH-806 inhibits HCV replication by a novel mechanism.

  15. An Envelope-Modified Tetravalent Dengue Virus-Like-Particle Vaccine Has Implications for Flavivirus Vaccine Design.

    Science.gov (United States)

    Urakami, Akane; Ngwe Tun, Mya Myat; Moi, Meng Ling; Sakurai, Atsuko; Ishikawa, Momoko; Kuno, Sachiko; Ueno, Ryuji; Morita, Kouichi; Akahata, Wataru

    2017-12-01

    Dengue viruses (DENV) infect 50 to 100 million people each year. The spread of DENV-associated infections is one of the most serious public health problems worldwide, as there is no widely available vaccine or specific therapeutic for DENV infections. To address this, we developed a novel tetravalent dengue vaccine by utilizing virus-like particles (VLPs). We created recombinant DENV1 to -4 (DENV1-4) VLPs by coexpressing precursor membrane (prM) and envelope (E) proteins, with an F108A mutation in the fusion loop structure of E to increase the production of VLPs in mammalian cells. Immunization with DENV1-4 VLPs as individual, monovalent vaccines elicited strong neutralization activity against each DENV serotype in mice. For use as a tetravalent vaccine, DENV1-4 VLPs elicited high levels of neutralization activity against all four serotypes simultaneously. The neutralization antibody responses induced by the VLPs were significantly higher than those with DNA or recombinant E protein immunization. Moreover, antibody-dependent enhancement (ADE) was not observed against any serotype at a 1:10 serum dilution. We also demonstrated that the Zika virus (ZIKV) VLP production level was enhanced by introducing the same F108A mutation into the ZIKV envelope protein. Taken together, these results suggest that our strategy for DENV VLP production is applicable to other flavivirus VLP vaccine development, due to the similarity in viral structures, and they describe the promising development of an effective tetravalent vaccine against the prevalent flavivirus. IMPORTANCE Dengue virus poses one of the most serious public health problems worldwide, and the incidence of diseases caused by the virus has increased dramatically. Despite decades of effort, there is no effective treatment against dengue. A safe and potent vaccine against dengue is still needed. We developed a novel tetravalent dengue vaccine by using virus-like particles (VLPs), which are noninfectious because they lack

  16. The Influence of Urbanization Modes on the Spatial Circulation of Flaviviruses within Ouagadougou (Burkina Faso)

    OpenAIRE

    Fournet, Florence; Rican, St?phane; Vaillant, Zo?; Roudot, Anna; Meunier-Nikiema, Aude; Kassi?, Daouda; Dabir?, Roch K.; Salem, G?rard

    2016-01-01

    Dengue is an emerging infectious disease of global significance. Although this virus has been reported for a long time, its significance within the burden of diseases in West Africa is not obvious, especially in Burkina Faso. Our objective was to evaluate flavivirus presence in Ouagadougou (Burkina Faso) and the link between anti-flavivirus antibody seroprevalence and urbanization modes. A population-based cross-sectional survey was conducted and 3015 children were enrolled from Ouagadougou d...

  17. Insect-Specific Flaviviruses from Culex Mosquitoes in Colorado, with Evidence of Vertical Transmission

    Science.gov (United States)

    Bolling, Bethany G.; Eisen, Lars; Moore, Chester G.; Blair, Carol D.

    2011-01-01

    Mosquitoes were collected in Colorado during 2006 and 2007 to examine spatial and seasonal patterns of risk for exposure to Culex vectors and West Nile virus. We used universal flavivirus primers to test pools of Culex mosquitoes for viral RNA. This led to the detection and subsequent isolation of two insect-specific flaviviruses: Culex flavivirus (CxFV), which was first described from Japan, and a novel insect flavivirus, designated Calbertado virus (CLBOV), which has also been detected in California and Canada. We recorded both viruses in Cx. tarsalis and Cx. pipiens from Colorado. Furthermore, quantitative reverse transcription polymerase chain reaction (RT-PCR) revealed the presence of CxFV RNA in Cx. pipiens eggs and larvae from a laboratory colony established in 2005 and naturally infected with CxFV, suggesting vertical transmission as a means of viral maintenance in natural Culex populations. Finally, we present phylogenetic analyses of the relationships between insect-specific flaviviruses and other selected flaviviruses. PMID:21734144

  18. Serological evidence for the circulation of flaviviruses in seabird populations of the western Indian Ocean.

    Science.gov (United States)

    Jaeger, A; Lecollinet, S; Beck, C; Bastien, M; Le Corre, M; Dellagi, K; Pascalis, H; Boulinier, T; Lebarbenchon, C

    2016-02-01

    Birds play a central role in the epidemiology of several flaviviruses of concern for public and veterinary health. Seabirds represent the most abundant and widespread avifauna in the western Indian Ocean and may play an important role as host reservoirs and spreaders of arthropod-borne pathogens such as flaviviruses. We report the results of a serological investigation based on blood samples collected from nine seabird species from seven islands in the Indian Ocean. Using a commercial competitive enzyme-linked immunosorbent assay directed against the prototypic West Nile flavivirus, antibodies against flaviviruses were detected in the serum of 47 of the 855 seabirds tested. They were detected in bird samples from three islands and from four bird species. Seroneutralization tests on adults and chicks suggested that great frigatebirds (Fregata minor) from Europa were infected by West Nile virus during their non-breeding period, and that Usutu virus probably circulated within bird colonies on Tromelin and on Juan de Nova. Real-time polymerase chain reactions performed on bird blood samples did not yield positive results precluding the genetic characterization of flavivirus using RNA sequencing. Our findings stress the need to further investigate flavivirus infections in arthropod vectors present in seabird colonies.

  19. Stability of a tick-borne flavivirus in milk

    Directory of Open Access Journals (Sweden)

    Danielle K Offerdahl

    2016-05-01

    Full Text Available The tick-borne flaviviruses (TBFV occur worldwide and the tick-borne encephalitis virus members of the group (TBEV often cause severe, debilitating neurological disease in humans. Although the primary route of infection is through the bite of an infected tick, alimentary infection through the consumption of TBEV-contaminated dairy products is also well-documented and is responsible for some disease in endemic areas. Experimental infection of goats, cattle, and sheep with TBEV shows that virus can be excreted in the milk of infected animals. Additionally, the virus remains infectious after exposure to low pH levels, similar to those found in the stomach. To evaluate survival of virus in milk, we studied the stability of the BSL-2 TBFV, Langat virus, in unpasteurized goat milk over time and after different thermal treatments. Virus was stable in milk maintained under refrigeration conditions; however, there was a marked reduction in virus titer after incubation at room temperature. High temperature, short time pasteurization protocols completely inactivated the virus. Interestingly, simulation of a typical thermal regime utilized for cheese did not completely inactivate the virus in milk. These findings stress the importance of proper milk handling and pasteurization processes in areas endemic for TBEV.

  20. Stability of a Tick-Borne Flavivirus in Milk.

    Science.gov (United States)

    Offerdahl, Danielle K; Clancy, Niall G; Bloom, Marshall E

    2016-01-01

    The tick-borne flaviviruses (TBFV) occur worldwide and the tick-borne encephalitis virus (TBEV) members of the group often cause severe, debilitating neurological disease in humans. Although the primary route of infection is through the bite of an infected tick, alimentary infection through the consumption of TBEV-contaminated dairy products is also well-documented and is responsible for some disease in endemic areas. Experimental infection of goats, cattle, and sheep with TBEV shows that the virus can be excreted in the milk of infected animals. Additionally, the virus remains infectious after exposure to low pH levels, similar to those found in the stomach. To evaluate the survival of virus in milk, we studied the stability of the BSL-2 TBFV, Langat virus, in unpasteurized goat milk over time and after different thermal treatments. Virus was stable in milk maintained under refrigeration conditions; however, there was a marked reduction in virus titer after incubation at room temperature. High temperature, short time pasteurization protocols completely inactivated the virus. Interestingly, simulation of a typical thermal regime utilized for cheese did not completely inactivate the virus in milk. These findings stress the importance of proper milk handling and pasteurization processes in areas endemic for TBEV.

  1. A Roadmap for Tick-Borne Flavivirus Research in the “Omics” Era

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Grabowski

    2017-12-01

    Full Text Available Tick-borne flaviviruses (TBFs affect human health globally. Human vaccines provide protection against some TBFs, and antivirals are available, yet TBF-specific control strategies are limited. Advances in genomics offer hope to understand the viral complement transmitted by ticks, and to develop disruptive, data-driven technologies for virus detection, treatment, and control. The genome assemblies of Ixodes scapularis, the North American tick vector of the TBF, Powassan virus, and other tick vectors, are providing insights into tick biology and pathogen transmission and serve as nucleation points for expanded genomic research. Systems biology has yielded insights to the response of tick cells to viral infection at the transcript and protein level, and new protein targets for vaccines to limit virus transmission. Reverse vaccinology approaches have moved candidate tick antigenic epitopes into vaccine development pipelines. Traditional drug and in silico screening have identified candidate antivirals, and target-based approaches have been developed to identify novel acaricides. Yet, additional genomic resources are required to expand TBF research. Priorities include genome assemblies for tick vectors, “omic” studies involving high consequence pathogens and vectors, and emphasizing viral metagenomics, tick-virus metabolomics, and structural genomics of TBF and tick proteins. Also required are resources for forward genetics, including the development of tick strains with quantifiable traits, genetic markers and linkage maps. Here we review the current state of genomic research on ticks and tick-borne viruses with an emphasis on TBFs. We outline an ambitious 10-year roadmap for research in the “omics era,” and explore key milestones needed to accomplish the goal of delivering three new vaccines, antivirals and acaricides for TBF control by 2030.

  2. Hepatitis C virus non-structural protein 3 interacts with cytosolic 5'(3'-deoxyribonucleotidase and partially inhibits its activity.

    Directory of Open Access Journals (Sweden)

    Chiu-Ping Fang

    Full Text Available Infection with hepatitis C virus (HCV is etiologically involved in liver cirrhosis, hepatocellular carcinoma and B-cell lymphomas. It has been demonstrated previously that HCV non-structural protein 3 (NS3 is involved in cell transformation. In this study, a yeast two-hybrid screening experiment was conducted to identify cellular proteins interacting with HCV NS3 protein. Cytosolic 5'(3'-deoxyribonucleotidase (cdN, dNT-1 was found to interact with HCV NS3 protein. Binding domains of HCV NS3 and cellular cdN proteins were also determined using the yeast two-hybrid system. Interactions between HCV NS3 and cdN proteins were further demonstrated by co-immunoprecipitation and confocal analysis in cultured cells. The cellular cdN activity was partially repressed by NS3 protein in both the transiently-transfected and the stably-transfected systems. Furthermore, HCV partially repressed the cdN activity while had no effect on its protein expression in the systems of HCV sub-genomic replicons and infectious HCV virions. Deoxyribonucleotidases are present in most mammalian cells and involve in the regulation of intracellular deoxyribonucleotides pools by substrate cycles. Control of DNA precursor concentration is essential for the maintenance of genetic stability. Reduction of cdN activity would result in the imbalance of DNA precursor concentrations. Thus, our results suggested that HCV partially reduced the cdN activity via its NS3 protein and this may in turn cause diseases.

  3. The bright and the dark side of human antibody responses to flaviviruses: lessons for vaccine design.

    Science.gov (United States)

    Rey, Félix A; Stiasny, Karin; Vaney, Marie-Christine; Dellarole, Mariano; Heinz, Franz X

    2018-02-01

    Zika and dengue viruses belong to the Flavivirus genus, a close group of antigenically related viruses that cause significant arthropod-transmitted diseases throughout the globe. Although infection by a given flavivirus is thought to confer lifelong protection, some of the patient's antibodies cross-react with other flaviviruses without cross-neutralizing. The original antigenic sin phenomenon may amplify such antibodies upon subsequent heterologous flavivirus infection, potentially aggravating disease by antibody-dependent enhancement (ADE). The most striking example is provided by the four different dengue viruses, where infection by one serotype appears to predispose to more severe disease upon infection by a second one. A similar effect was postulated for sequential infections with Zika and dengue viruses. In this review, we analyze the molecular determinants of the dual antibody response to flavivirus infection or vaccination in humans. We highlight the role of conserved partially cryptic epitopes giving rise to cross-reacting and poorly neutralizing, ADE-prone antibodies. We end by proposing a strategy for developing an epitope-focused vaccine approach to avoid eliciting undesirable antibodies while focusing the immune system on producing protective antibodies only. © 2017 Institut Pasteur. Published under the terms of the CC BY NC ND 4.0 license.

  4. Flaviviruses, an expanding threat in public health: focus on Dengue, West Nile, and Japanese encephalitis virus

    Science.gov (United States)

    Daep, Carlo Amorin; Muñoz-Jordán, Jorge L.; Eugenin, Eliseo Alberto

    2014-01-01

    The flaviviruses Dengue, West Nile, and Japanese encephalitis represent three major mosquito-borne viruses worldwide. These pathogens impact the lives of millions of individuals and potentially could affect non-endemic areas already colonized by mosquito vectors. Unintentional transport of infected vectors (Aedes and Culex sp), traveling within endemic areas, rapid adaptation of the insects into new geographic locations, climate change, and lack of medical surveillance have greatly contributed to the increase in flaviviral infections worldwide. The mechanisms by which flaviviruses alter the immune and the central nervous system have only recently been examined despite the alarming number of infections, related deaths, and increasing global distribution. In this review, we will discuss the expansion of the geographic areas affected by flaviviruses, the potential threats to previously unaffected countries, the mechanisms of pathogenesis, and the potential therapeutic interventions to limit the devastating consequences of these viruses. PMID:25287260

  5. Flaviviruses, an expanding threat in public health: focus on dengue, West Nile, and Japanese encephalitis virus.

    Science.gov (United States)

    Daep, Carlo Amorin; Muñoz-Jordán, Jorge L; Eugenin, Eliseo Alberto

    2014-12-01

    The flaviviruses dengue, West Nile, and Japanese encephalitis represent three major mosquito-borne viruses worldwide. These pathogens impact the lives of millions of individuals and potentially could affect non-endemic areas already colonized by mosquito vectors. Unintentional transport of infected vectors (Aedes and Culex spp.), traveling within endemic areas, rapid adaptation of the insects into new geographic locations, climate change, and lack of medical surveillance have greatly contributed to the increase in flaviviral infections worldwide. The mechanisms by which flaviviruses alter the immune and the central nervous system have only recently been examined despite the alarming number of infections, related deaths, and increasing global distribution. In this review, we will discuss the expansion of the geographic areas affected by flaviviruses, the potential threats to previously unaffected countries, the mechanisms of pathogenesis, and the potential therapeutic interventions to limit the devastating consequences of these viruses.

  6. Inhibition of type I interferon induction and signalling by mosquito-borne flaviviruses.

    Science.gov (United States)

    Cumberworth, Stephanie L; Clark, Jordan J; Kohl, Alain; Donald, Claire L

    2017-05-01

    The Flavivirus genus (Flaviviridae family) contains a number of important human pathogens, including dengue and Zika viruses, which have the potential to cause severe disease. In order to efficiently establish a productive infection in mammalian cells, flaviviruses have developed key strategies to counteract host immune defences, including the type I interferon response. They employ different mechanisms to control interferon signal transduction and effector pathways, and key research generated over the past couple of decades has uncovered new insights into their abilities to actively decrease interferon antiviral activity. Given the lack of antivirals or prophylactic treatments for many flaviviral infections, it is important to fully understand how these viruses affect cellular processes to influence pathogenesis and disease outcome. This review will discuss the strategies mosquito-borne flaviviruses have evolved to antagonise type I interferon mediated immune responses. © 2017 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.

  7. Genetic characterization of tick-borne flaviviruses: new insights into evolution, pathogenetic determinants and taxonomy.

    Science.gov (United States)

    Grard, Gilda; Moureau, Grégory; Charrel, Rémi N; Lemasson, Jean-Jacques; Gonzalez, Jean-Paul; Gallian, Pierre; Gritsun, Tamara S; Holmes, Edward C; Gould, Ernest A; de Lamballerie, Xavier

    2007-04-25

    Here, we analyze the complete coding sequences of all recognized tick-borne flavivirus species, including Gadgets Gully, Royal Farm and Karshi virus, seabird-associated flaviviruses, Kadam virus and previously uncharacterized isolates of Kyasanur Forest disease virus and Omsk hemorrhagic fever virus. Significant taxonomic improvements are proposed, e.g. the identification of three major groups (mammalian, seabird and Kadam tick-borne flavivirus groups), the creation of a new species (Karshi virus) and the assignment of Tick-borne encephalitis and Louping ill viruses to a unique species (Tick-borne encephalitis virus) including four viral types (i.e. Western Tick-borne encephalitis virus, Eastern Tick-borne encephalitis virus, Turkish sheep Tick-borne encephalitis virus and Louping ill Tick-borne encephalitis virus). The analyses also suggest a complex relationship between viruses infecting birds and those infecting mammals. Ticks that feed on both categories of vertebrates may constitute the evolutionary bridge between the three distinct identified lineages.

  8. Isolation and genomic characterization of Culex theileri flaviviruses in field-collected mosquitoes from Turkey.

    Science.gov (United States)

    Ergünay, Koray; Litzba, Nadine; Brinkmann, Annika; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Örsten, Serra; Sarıkaya, Yasemen; Alten, Bülent; Nitsche, Andreas; Linton, Yvonne-Marie

    2016-12-01

    Vector surveillance for the arthropod-borne infections has resulted in the isolation of a growing number of novel viruses, including several flavivirus strains that exclusively replicate in insects. This report describes the isolation and genomic characterization of four insect-specific flaviviruses from mosquitoes, previously collected from various locations in Turkey. C6/36 Aedes albopictus and Vero cell lines were inoculated with mosquito pools. On C6/36 cells, mild cytopathic effects, characterized as rounding and detachment, were observed in four pools that comprised female Culex theileri mosquitoes. Complete (3 isolates, 10,697 nucleotides) or near-complete (1 isolate, 10,452 nucleotides) genomic characterization was performed in these culture supernatants via next generation sequencing. All strains demonstrated high genetic similarities, with over 99% identity match on nucleotide and amino acid alignments, revealing them to be different isolates of the same virus. Sequence comparisons identified the closest relative to be the Culex theileri flavivirus (CTFV) strains, originally characterized in Portugal. Phylogenetic analyses demonstrated that the isolates remained distinct as a cluster but formed a monophyletic group with CTFV strains, and shared a common ancestor with Quang Binh or related Culex flaviviruses. The organization of the viral genome was consistent with the universal flavivirus structure and stem-loops; conserved motifs and imperfect tandem repeats were identified in the non-coding ends of the viral genomes. A potential ribosomal shifting site, resulting in the translation of an additional reading frame, was detected. The deduced viral polyprotein comprised 3357 amino acids and was highly-conserved. Amino acid variations, presumably associated with adaptive environmental pressures, were identified. These isolates comprise the first fully characterized insect-specific flaviviruses in Turkey. Their impact on West Nile virus circulation, which is

  9. Dual miRNA Targeting Restricts Host Range and Attenuates Neurovirulence of Flaviviruses

    Science.gov (United States)

    Tsetsarkin, Konstantin A.; Liu, Guangping; Kenney, Heather; Bustos-Arriaga, Jose; Hanson, Christopher T.; Whitehead, Stephen S.; Pletnev, Alexander G.

    2015-01-01

    Mosquito-borne flaviviruses are among the most significant arboviral pathogens worldwide. Vaccinations and mosquito population control programs remain the most reliable means for flavivirus disease prevention, and live attenuated viruses remain one of the most attractive flavivirus vaccine platforms. Some live attenuated viruses are capable of infecting principle mosquito vectors, as demonstrated in the laboratory, which in combination with their intrinsic genetic instability could potentially lead to a vaccine virus reversion back to wild-type in nature, followed by introduction and dissemination of potentially dangerous viral strains into new geographic locations. To mitigate this risk we developed a microRNA-targeting approach that selectively restricts replication of flavivirus in the mosquito host. Introduction of sequences complementary to a mosquito-specific mir-184 and mir-275 miRNAs individually or in combination into the 3’NCR and/or ORF region resulted in selective restriction of dengue type 4 virus (DEN4) replication in mosquito cell lines and adult Aedes mosquitos. Moreover a combined targeting of DEN4 genome with mosquito-specific and vertebrate CNS-specific mir-124 miRNA can silence viral replication in two evolutionally distant biological systems: mosquitoes and mouse brains. Thus, this approach can reinforce the safety of newly developed or existing vaccines for use in humans and could provide an additional level of biosafety for laboratories using viruses with altered pathogenic or transmissibility characteristics. PMID:25906260

  10. Incidence of primary dengue virus infections in Southern Vietnamese children and reactivity against other flaviviruses

    NARCIS (Netherlands)

    Thai, Khoa T. D.; Nga, Tran Thi Thanh; van Nam, Nguyen; Phuong, Hoang Lan; Giao, Phan Trong; Hung, Le Quoc; Binh, Tran Quang; van Doornum, Gerard J. J.; de Vries, Peter J.

    2007-01-01

    OBJECTIVE: To study the incidence of asymptomatic primary dengue infections among children and reactivity against other flaviviruses. METHODS: A total of 216 children, who had no dengue-specific IgG antibodies during a serosurvey in 2003 were re-examined 23 months later to determine if

  11. Do wild ungulates allow improved monitoring of flavivirus circulation in Spain?

    Science.gov (United States)

    Boadella, Mariana; Díez-Delgado, Iratxe; Gutiérrez-Guzmán, Ana Valeria; Höfle, Ursula; Gortázar, Christian

    2012-06-01

    As a response to the need for improved and cost-efficient West Nile virus (WNV) and other flavivirus surveillance tools, we tested 887 juvenile free-living red deer, 742 free-living juvenile wild boar, and 327 farmed deer, to detect temporal variability in exposure to these viruses. Thirty of 742 wild boar samples (4%; 95% CI 2.8,5.7) yielded a positive ELISA result. Antibody-positive individuals had been sampled between 2003 and 2011 in localities from central and southern Spain. No wild boar from the northern half of Spain (n=120) tested positive. Regarding juvenile wild red deer, only two out of 887 samples yielded a positive ELISA result (0.2%; 95% CI 0.1,0.8). These two samples came from the same site and sampling year. The likelihood of detecting contact with WNV or cross-reacting flaviviruses was 18 times higher among juvenile wild boar than among juvenile red deer. ELISA positivity among farmed deer increased 10-fold after local flavivirus outbreaks recorded in the summer and autumn of 2010. This survey demonstrated the potential usefulness of juvenile wild ungulates, particularly wild boar, as suitable flavivirus sentinels in southwestern Europe, and that systematic serum banking of samples from hunter-harvested wildlife or from individual farmed ungulates provides valuable material for retrospective epidemiological surveys and future disease monitoring.

  12. Impact of prior flavivirus immunity on Zika virus infection in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Michael K McCracken

    2017-08-01

    Full Text Available Studies have demonstrated cross-reactivity of anti-dengue virus (DENV antibodies in human sera against Zika virus (ZIKV, promoting increased ZIKV infection in vitro. However, the correlation between in vitro and in vivo findings is not well characterized. Thus, we evaluated the impact of heterotypic flavivirus immunity on ZIKV titers in biofluids of rhesus macaques. Animals previously infected (≥420 days with DENV2, DENV4, or yellow fever virus were compared to flavivirus-naïve animals following infection with a Brazilian ZIKV strain. Sera from DENV-immune macaques demonstrated cross-reactivity with ZIKV by antibody-binding and neutralization assays prior to ZIKV infection, and promoted increased ZIKV infection in cell culture assays. Despite these findings, no significant differences between flavivirus-naïve and immune animals were observed in viral titers, neutralizing antibody levels, or immune cell kinetics following ZIKV infection. These results indicate that prior infection with heterologous flaviviruses neither conferred protection nor increased observed ZIKV titers in this non-human primate ZIKV infection model.

  13. Impact of prior flavivirus immunity on Zika virus infection in rhesus macaques.

    Science.gov (United States)

    McCracken, Michael K; Gromowski, Gregory D; Friberg, Heather L; Lin, Xiaoxu; Abbink, Peter; De La Barrera, Rafael; Eckles, Kenneth H; Garver, Lindsey S; Boyd, Michael; Jetton, David; Barouch, Dan H; Wise, Matthew C; Lewis, Bridget S; Currier, Jeffrey R; Modjarrad, Kayvon; Milazzo, Mark; Liu, Michelle; Mullins, Anna B; Putnak, J Robert; Michael, Nelson L; Jarman, Richard G; Thomas, Stephen J

    2017-08-01

    Studies have demonstrated cross-reactivity of anti-dengue virus (DENV) antibodies in human sera against Zika virus (ZIKV), promoting increased ZIKV infection in vitro. However, the correlation between in vitro and in vivo findings is not well characterized. Thus, we evaluated the impact of heterotypic flavivirus immunity on ZIKV titers in biofluids of rhesus macaques. Animals previously infected (≥420 days) with DENV2, DENV4, or yellow fever virus were compared to flavivirus-naïve animals following infection with a Brazilian ZIKV strain. Sera from DENV-immune macaques demonstrated cross-reactivity with ZIKV by antibody-binding and neutralization assays prior to ZIKV infection, and promoted increased ZIKV infection in cell culture assays. Despite these findings, no significant differences between flavivirus-naïve and immune animals were observed in viral titers, neutralizing antibody levels, or immune cell kinetics following ZIKV infection. These results indicate that prior infection with heterologous flaviviruses neither conferred protection nor increased observed ZIKV titers in this non-human primate ZIKV infection model.

  14. Dual miRNA targeting restricts host range and attenuates neurovirulence of flaviviruses.

    Directory of Open Access Journals (Sweden)

    Konstantin A Tsetsarkin

    2015-04-01

    Full Text Available Mosquito-borne flaviviruses are among the most significant arboviral pathogens worldwide. Vaccinations and mosquito population control programs remain the most reliable means for flavivirus disease prevention, and live attenuated viruses remain one of the most attractive flavivirus vaccine platforms. Some live attenuated viruses are capable of infecting principle mosquito vectors, as demonstrated in the laboratory, which in combination with their intrinsic genetic instability could potentially lead to a vaccine virus reversion back to wild-type in nature, followed by introduction and dissemination of potentially dangerous viral strains into new geographic locations. To mitigate this risk we developed a microRNA-targeting approach that selectively restricts replication of flavivirus in the mosquito host. Introduction of sequences complementary to a mosquito-specific mir-184 and mir-275 miRNAs individually or in combination into the 3'NCR and/or ORF region resulted in selective restriction of dengue type 4 virus (DEN4 replication in mosquito cell lines and adult Aedes mosquitos. Moreover a combined targeting of DEN4 genome with mosquito-specific and vertebrate CNS-specific mir-124 miRNA can silence viral replication in two evolutionally distant biological systems: mosquitoes and mouse brains. Thus, this approach can reinforce the safety of newly developed or existing vaccines for use in humans and could provide an additional level of biosafety for laboratories using viruses with altered pathogenic or transmissibility characteristics.

  15. A trans-Complementing Recombination Trap Demonstrates a Low Propensity of Flaviviruses for Intermolecular Recombination▿

    Science.gov (United States)

    Taucher, Christian; Berger, Angelika; Mandl, Christian W.

    2010-01-01

    Intermolecular recombination between the genomes of closely related RNA viruses can result in the emergence of novel strains with altered pathogenic potential and antigenicity. Although recombination between flavivirus genomes has never been demonstrated experimentally, the potential risk of generating undesirable recombinants has nevertheless been a matter of concern and controversy with respect to the development of live flavivirus vaccines. As an experimental system for investigating the ability of flavivirus genomes to recombine, we developed a “recombination trap,” which was designed to allow the products of rare recombination events to be selected and amplified. To do this, we established reciprocal packaging systems consisting of pairs of self-replicating subgenomic RNAs (replicons) derived from tick-borne encephalitis virus (TBEV), West Nile virus (WNV), and Japanese encephalitis virus (JEV) that could complement each other in trans and thus be propagated together in cell culture over multiple passages. Any infectious viruses with intact, full-length genomes that were generated by recombination of the two replicons would be selected and enriched by end point dilution passage, as was demonstrated in a spiking experiment in which a small amount of wild-type virus was mixed with the packaged replicons. Using the recombination trap and the JEV system, we detected two aberrant recombination events, both of which yielded unnatural genomes containing duplications. Infectious clones of both of these genomes yielded viruses with impaired growth properties. Despite the fact that the replicon pairs shared approximately 600 nucleotides of identical sequence where a precise homologous crossover event would have yielded a wild-type genome, this was not observed in any of these systems, and the TBEV and WNV systems did not yield any viable recombinant genomes at all. Our results show that intergenomic recombination can occur in the structural region of flaviviruses

  16. The Influence of Urbanization Modes on the Spatial Circulation of Flaviviruses within Ouagadougou (Burkina Faso

    Directory of Open Access Journals (Sweden)

    Florence Fournet

    2016-12-01

    Full Text Available Dengue is an emerging infectious disease of global significance. Although this virus has been reported for a long time, its significance within the burden of diseases in West Africa is not obvious, especially in Burkina Faso. Our objective was to evaluate flavivirus presence in Ouagadougou (Burkina Faso and the link between anti-flavivirus antibody seroprevalence and urbanization modes. A population-based cross-sectional survey was conducted and 3015 children were enrolled from Ouagadougou districts with different types and degrees of urbanization (with/without equipment and high/low building density. Flavivirus (FLAV IgM MAC-ELISA and FLAV indirect IgG ELISA were performed. Associations between FLAV IgG presence (sign of past infection and various independent variables were assessed using the chi-square test and a multivariate logistic regression analysis. The apparent prevalence of past flavivirus infections among the enrolled children was 22.7% (95% CI: 22.4–26.7 (n = 685. Eleven children (0.4%; 95% CI: 0.61–2.14 were positive for FLAV IgM, indicating active transmission. Factors associated with flavivirus infection were identified among the enrolled children (age, sex, householders (educational level, asset index and in the environment (building density, water access, waste management and house appearance; however, they showed great variability according to the city districts. The water access modality did not significantly influence FLAV IgG positivity. Conversely, apparently good practices of waste management had unexpected consequences (increased risk related to municipal dumpsters. Given the scale of ongoing urbanization and the spread of arboviral diseases, close collaboration between health and city stakeholders is needed.

  17. The Influence of Urbanization Modes on the Spatial Circulation of Flaviviruses within Ouagadougou (Burkina Faso).

    Science.gov (United States)

    Fournet, Florence; Rican, Stéphane; Vaillant, Zoé; Roudot, Anna; Meunier-Nikiema, Aude; Kassié, Daouda; Dabiré, Roch K; Salem, Gérard

    2016-12-10

    Dengue is an emerging infectious disease of global significance. Although this virus has been reported for a long time, its significance within the burden of diseases in West Africa is not obvious, especially in Burkina Faso. Our objective was to evaluate flavivirus presence in Ouagadougou (Burkina Faso) and the link between anti-flavivirus antibody seroprevalence and urbanization modes. A population-based cross-sectional survey was conducted and 3015 children were enrolled from Ouagadougou districts with different types and degrees of urbanization (with/without equipment and high/low building density). Flavivirus (FLAV) IgM MAC-ELISA and FLAV indirect IgG ELISA were performed. Associations between FLAV IgG presence (sign of past infection) and various independent variables were assessed using the chi-square test and a multivariate logistic regression analysis. The apparent prevalence of past flavivirus infections among the enrolled children was 22.7% (95% CI: 22.4-26.7) ( n = 685). Eleven children (0.4%; 95% CI: 0.61-2.14) were positive for FLAV IgM, indicating active transmission. Factors associated with flavivirus infection were identified among the enrolled children (age, sex), householders (educational level, asset index) and in the environment (building density, water access, waste management and house appearance); however, they showed great variability according to the city districts. The water access modality did not significantly influence FLAV IgG positivity. Conversely, apparently good practices of waste management had unexpected consequences (increased risk related to municipal dumpsters). Given the scale of ongoing urbanization and the spread of arboviral diseases, close collaboration between health and city stakeholders is needed.

  18. Hepatitis C Virus Nonstructural 3/4A Protein Dampens Inflammation and Contributes to Slow Fibrosis Progression during Chronic Fibrosis In Vivo.

    Directory of Open Access Journals (Sweden)

    Ruchi Bansal

    Full Text Available HCV infection typically induces liver injury and inflammation, which appears to be responsible for the associated fibrogenesis. To date, the mechanism underlying the different rates of disease progression remains unclear. The aim of the study is to understand the possible role of the HCV non-structural (NS 3/4A protein in the fibrosis progression. We used NS3/4A-expressing transgenic mice (NS3/4A-Tg to accomplish the goals of the study. Different stages of liver fibrosis were induced in wild-type and NS3/4A-Tg mice by single carbon tetrachloride (acute or multiple injections for 4 (intermediate or 8 (chronic weeks. Fibrotic parameters, inflammatory responses and hepatocyte turnover were extensively examined. Hepatic expression of HCV NS3/4A did not induce spontaneous liver damage. However, NS3/4A expression exerted contrasting effects during acute and chronic liver damage. During early fibrogenesis and intermediate fibrosis (4 weeks, NS3/4A-Tg mice exhibited enhanced liver damage whereas reduced fibrosis was observed in NS3/4A-Tg during chronic liver fibrosis (8 weeks. Furthermore, attenuated inflammation was observed in NS3/4A-Tg during chronic fibrosis with increase in M2 macrophages, hepatocyte proliferation, decreased hepatocyte apoptosis and decreased ductular reaction. In conclusion, during early fibrogenesis, HCV NS3/4A contributes to liver damage. While, during chronic liver fibrosis, NS3/4A dampens inflammation and induces hepatocyte regeneration thereby contributing to slow fibrosis progression to promote its survival or persistence.

  19. A novel flavivirus detected in two Aedes spp. collected near the demilitarized zone of the Republic of Korea.

    Science.gov (United States)

    Korkusol, Achareeya; Takhampunya, Ratree; Hang, Jun; Jarman, Richard G; Tippayachai, Bousaraporn; Kim, Heung-Chul; Chong, Sung-Tae; Davidson, Silas A; Klein, Terry A

    2017-05-01

    Flaviviruses comprise a large and diverse group of positive-stranded RNA viruses, including tick-, mosquito- and unknown-vector-borne flaviviruses. A novel flavivirus was detected in pools of Aedes vexans nipponii (n=1) and Aedes esoensis (n=3) collected in 2012 and 2013 near the demilitarized zone (DMZ), Republic of Korea (ROK). Phylogenetic analyses of the NS5, E gene and complete polyprotein coding sequence (CDS) showed that the novel virus fell within the Aedes-borne flaviviruses (ABFVs), with nucleotide identity ranging from 57.8-75.1 %, 46.1-74.2 % and 51.1-76.2 %, respectively. While the novel ABFV was distant from other flaviviruses within the group, it formed a clade with Ilomantsi virus (ILOV). Sequence alignments of the partial NS5 gene, full-length E gene and polyprotein CDS between the novel virus and ILOV showed approximately 76.2 % nucleotide identity and 90 % amino acid identity, respectively. The ABFV identified in Aedes mosquitoes from the ROK is a novel ABFV based on the sequence analyses and is designated as Panmunjeom flavivirus (PANFV).

  20. Decreased Flight Activity in Culex pipiens (Diptera: Culicidae) Naturally Infected With Culex flavivirus.

    Science.gov (United States)

    Newman, Christina M; Anderson, Tavis K; Goldberg, Tony L

    2016-01-01

    Insect-specific flaviviruses (ISFVs) commonly infect vectors of mosquito-borne arboviruses. To investigate whether infection with an ISFV might affect mosquito flight behavior, we quantified flight behavior in Culex pipiens L. naturally infected with Culex flavivirus (CxFV). We observed a significant reduction in the scotophase (dark hours) flight activity of CxFV-positive mosquitoes relative to CxFV-negative mosquitoes, but only a marginal reduction in photophase (light hours) flight activity, and no change in the circadian pattern of flight activity. These results suggest that CxFV infection alters the flight activity of naturally infected Cx. pipiens most dramatically when these vectors are likely to be host seeking and may therefore affect the transmission of medically important arboviruses. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Culex Flavivirus During West Nile Virus Epidemic and Interepidemic Years in Chicago, United States.

    Science.gov (United States)

    Newman, Christina M; Krebs, Bethany L; Anderson, Tavis K; Hamer, Gabriel L; Ruiz, Marilyn O; Brawn, Jeffrey D; Brown, William M; Kitron, Uriel D; Goldberg, Tony L

    2017-08-01

    Culex flavivirus (CxFV) is an insect-specific flavivirus infecting Culex mosquitoes, which are important vectors of West Nile virus (WNV). CxFV and WNV cocirculate in nature and coinfect Culex mosquitoes, including in a WNV "hotspot" in suburban Chicago. We previously identified a positive association between CxFV and WNV in mosquito pools collected from suburban Chicago in 2006. To further investigate this phenomenon, we compared the spatial and temporal distribution of CxFV during an interepidemic year (2011) and an epidemic year (2012) for WNV. Both viruses were more prevalent in mosquito pools in 2012 compared to 2011. During both years, the CxFV infection status of mosquito pools was associated with environmental factors such as habitat type and precipitation frequency rather than coinfection with WNV. These results support the idea that WNV and CxFV are ecologically associated, perhaps because both viruses respond to similar environmental drivers of mosquito populations.

  2. Flavivirus infection from mosquitoes in vitro reveals cell entry at the plasma membrane

    Energy Technology Data Exchange (ETDEWEB)

    Vancini, Ricardo [Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, NC (United States); Kramer, Laura D. [Wadsworth Center, New York State Department of Health, and School of Public Health, State University of New York at Albany, Albany, NY (United States); Ribeiro, Mariana; Hernandez, Raquel [Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, NC (United States); Brown, Dennis, E-mail: dennis_brown@ncsu.edu [Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, NC (United States)

    2013-01-20

    Dengue and West Nile viruses are enveloped RNA viruses that belong to genus Flavivirus (family Flaviviridae) and are considered important mosquito-borne viral pathogenic agents worldwide. A potential target for intervention strategies is the virus cell entry mechanism. Previous studies of flavivirus entry have focused on the effects of biochemical and molecular inhibitors on viral entry leading to controversial conclusions suggesting that the process is dependent upon endocytosis and low pH mediated membrane fusion. In this study we analyzed the early events in the infection process by means of electron microscopy and immuno-gold labeling of viral particles during cell entry, and used as a new approach for infecting cells with viruses obtained directly from mosquitoes. The results show that Dengue and West Nile viruses may infect cells by a mechanism that involves direct penetration of the host cell plasma membrane as proposed for alphaviruses.

  3. Flavivirus infection from mosquitoes in vitro reveals cell entry at the plasma membrane

    International Nuclear Information System (INIS)

    Vancini, Ricardo; Kramer, Laura D.; Ribeiro, Mariana; Hernandez, Raquel; Brown, Dennis

    2013-01-01

    Dengue and West Nile viruses are enveloped RNA viruses that belong to genus Flavivirus (family Flaviviridae) and are considered important mosquito-borne viral pathogenic agents worldwide. A potential target for intervention strategies is the virus cell entry mechanism. Previous studies of flavivirus entry have focused on the effects of biochemical and molecular inhibitors on viral entry leading to controversial conclusions suggesting that the process is dependent upon endocytosis and low pH mediated membrane fusion. In this study we analyzed the early events in the infection process by means of electron microscopy and immuno-gold labeling of viral particles during cell entry, and used as a new approach for infecting cells with viruses obtained directly from mosquitoes. The results show that Dengue and West Nile viruses may infect cells by a mechanism that involves direct penetration of the host cell plasma membrane as proposed for alphaviruses.

  4. Sustained Virologic Response at 24 Weeks after the End of Treatment Is a Better Predictor for Treatment Outcome in Real-World HCV-Infected Patients Treated by HCV NS3/4A Protease Inhibitors with Peginterferon plus Ribavirin.

    Science.gov (United States)

    Kanda, Tatsuo; Nakamoto, Shingo; Sasaki, Reina; Nakamura, Masato; Yasui, Shin; Haga, Yuki; Ogasawara, Sadahisa; Tawada, Akinobu; Arai, Makoto; Mikami, Shigeru; Imazeki, Fumio; Yokosuka, Osamu

    2016-01-01

    Direct-acting antiviral agents against HCV with or without peginterferon plus ribavirin result in higher eradication rates of HCV and shorter treatment duration. We examined which is better for predicting persistent virologic response, the assessment of serum HCV RNA at 12 or 24 weeks after the end of treatment for predicting sustained virologic response (SVR12 or SVR24, respectively) in patients treated by HCV NS3/4A protease inhibitors with peginterferon plus ribavirin. In all, 149 Japanese patients infected with HCV genotype 1b treated by peginterferon plus ribavirin with telaprevir or simeprevir were retrospectively analyzed: 59 and 90 patients were treated with telaprevir- and simeprevir-including regimens, respectively. HCV RNA was measured by TaqMan HCV Test, version 2.0, real-time PCR assay. SVR12 or SVR24, respectively, was defined as HCV RNA negativity at 12 or 24 weeks after ending treatment. Total SVR rates were 78.0% and 66.7% in the telaprevir and simeprevir groups, respectively. In the telaprevir group, all 46 patients with SVR12 finally achieved SVR24. In the simeprevir group, 60 (93.8%) of the total 64 patients with SVR12 achieved SVR24, with the other 4 patients all being previous-treatment relapsers. SVR12 was suitable for predicting persistent virologic response in almost all cases. In simeprevir-including regimens, SVR12 could not always predict persistent virologic response. Clinicians should use SVR24 for predicting treatment outcome in the use of HCV NS3/4A protease inhibitors with peginterferon plus ribavirin for any group of real-world patients chronically infected with HCV.

  5. Arbidol (Umifenovir): A broad-spectrum antiviral drug that inhibits medically important arthropod-borne flaviviruses

    Czech Academy of Sciences Publication Activity Database

    Haviernik, J.; Štefánik, M.; Fojtíková, M.; Kali, S.; Tordo, N.; Rudolf, Ivo; Hubálek, Zdeněk; Eyer, Luděk; Růžek, Daniel

    2018-01-01

    Roč. 10, č. 4 (2018), č. článku 184. ISSN 1999-4915 R&D Projects: GA ČR(CZ) GA16-20054S Institutional support: RVO:68081766 ; RVO:60077344 Keywords : Antiviral activity * Arbidol * Cell-type dependent antiviral effect * Cytotoxicity * Flavivirus * Umifenovir Subject RIV: EE - Microbiology, Virology OBOR OECD: Virology Impact factor: 3.465, year: 2016

  6. Serologic survey of humans for Flavivirus West Nile in southern Moravia (Czech Republic)

    Czech Academy of Sciences Publication Activity Database

    Hubálek, Zdeněk; Kříž, B.; Halouzka, Jiří

    2011-01-01

    Roč. 19, č. 3 (2011), s. 131-133 ISSN 1210-7778 R&D Projects: GA AV ČR IAA600930611 EU Projects: European Commission(XE) 10284 - EDEN Institutional research plan: CEZ:AV0Z60930519 Keywords : West Nile virus * Flavivirus * Moravia * serosurvey Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology http://www.szu.cz/svi/cejph/show_en.php?kat=archiv/2011-3-03

  7. Impact of prior flavivirus immunity on Zika virus infection in rhesus macaques

    OpenAIRE

    McCracken, Michael K.; Gromowski, Gregory D.; Friberg, Heather L.; Lin, Xiaoxu; Abbink, Peter; De La Barrera, Rafael; Eckles, Kenneth H.; Garver, Lindsey S.; Boyd, Michael; Jetton, David; Barouch, Dan H.; Wise, Matthew C.; Lewis, Bridget S.; Currier, Jeffrey R.; Modjarrad, Kayvon

    2017-01-01

    Author summary Zika virus (ZIKV) is a mosquito-borne, emerging flavivirus. In addition to asymptomatic or mild febrile manifestations, ZIKV infection in humans is associated with comparatively rare congenital and neurological abnormalities. Previous in vitro studies have demonstrated cross-reactivity of antibodies derived from dengue virus infections with ZIKV, as well as antibody-mediated enhancement of infection in cell culture. Therefore, there is concern among vaccinologists and the publi...

  8. A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis

    Science.gov (United States)

    Rey, Félix A.

    2017-01-01

    The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS) proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132), which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region) suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation. PMID:28151973

  9. A positive-strand RNA virus uses alternative protein-protein interactions within a viral protease/cofactor complex to switch between RNA replication and virion morphogenesis.

    Directory of Open Access Journals (Sweden)

    Danilo Dubrau

    2017-02-01

    Full Text Available The viruses of the family Flaviviridae possess a positive-strand RNA genome and express a single polyprotein which is processed into functional proteins. Initially, the nonstructural (NS proteins, which are not part of the virions, form complexes capable of genome replication. Later on, the NS proteins also play a critical role in virion formation. The molecular basis to understand how the same proteins form different complexes required in both processes is so far unknown. For pestiviruses, uncleaved NS2-3 is essential for virion morphogenesis while NS3 is required for RNA replication but is not functional in viral assembly. Recently, we identified two gain of function mutations, located in the C-terminal region of NS2 and in the serine protease domain of NS3 (NS3 residue 132, which allow NS2 and NS3 to substitute for uncleaved NS2-3 in particle assembly. We report here the crystal structure of pestivirus NS3-4A showing that the NS3 residue 132 maps to a surface patch interacting with the C-terminal region of NS4A (NS4A-kink region suggesting a critical role of this contact in virion morphogenesis. We show that destabilization of this interaction, either by alanine exchanges at this NS3/4A-kink interface, led to a gain of function of the NS3/4A complex in particle formation. In contrast, RNA replication and thus replicase assembly requires a stable association between NS3 and the NS4A-kink region. Thus, we propose that two variants of NS3/4A complexes exist in pestivirus infected cells each representing a basic building block required for either RNA replication or virion morphogenesis. This could be further corroborated by trans-complementation studies with a replication-defective NS3/4A double mutant that was still functional in viral assembly. Our observations illustrate the presence of alternative overlapping surfaces providing different contacts between the same proteins, allowing the switch from RNA replication to virion formation.

  10. Exploring Genomic, Geographic and Virulence Interactions among Epidemic and Non-Epidemic St. Louis Encephalitis Virus (Flavivirus Strains.

    Directory of Open Access Journals (Sweden)

    Luis A Diaz

    Full Text Available St. Louis encephalitis virus (SLEV is a re-emerging arbovirus in South America. In 2005, an encephalitis outbreak caused by SLEV was reported in Argentina. The reason for the outbreak remains unknown, but may have been related to virological factors, changes in vectors populations, avian amplifying hosts, and/or environmental conditions. The main goal of this study was to characterize the complete genome of epidemic and non-epidemic SLEV strains from Argentina. Seventeen amino acid changes were detected; ten were non-conservative and located in proteins E, NS1, NS3 and NS5. Phylogenetic analysis showed two major clades based on geography: the North America and northern Central America (NAnCA clade and the South America and southern Central America (SAsCA clade. Interestingly, the presence of SAsCA genotype V SLEV strains in the NAnCA clade was reported in California, Florida and Texas, overlapping with known bird migration flyways. This work represents the first step in understanding the molecular mechanisms underlying virulence and biological variation among SLEV strains.

  11. Flavivirus Infection of Ixodes scapularis (Black-Legged Tick Ex Vivo Organotypic Cultures and Applications for Disease Control

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Grabowski

    2017-08-01

    Full Text Available Ixodes scapularis ticks transmit many infectious agents that cause disease, including tick-borne flaviviruses (TBFVs. TBFV infections cause thousands of human encephalitis cases worldwide annually. In the United States, human TBFV infections with Powassan virus (POWV are increasing and have a fatality rate of 10 to 30%. Additionally, Langat virus (LGTV is a TBFV of low neurovirulence and is used as a model TBFV. TBFV replication and dissemination within I. scapularis organs are poorly characterized, and a deeper understanding of virus biology in this vector may inform effective countermeasures to reduce TBFV transmission. Here, we describe short-term, I. scapularis organ culture models of TBFV infection. Ex vivo organs were metabolically active for 9 to 10 days and were permissive to LGTV and POWV replication. Imaging and videography demonstrated replication and spread of green fluorescent protein-expressing LGTV in the organs. Immunohistochemical staining confirmed LGTV envelope and POWV protein synthesis within the infected organs. LGTV- and POWV-infected organs produced infectious LGTV and POWV; thus, the ex vivo cultures were suitable for study of virus replication in individual organs. LGTV- and POWV-infected midgut and salivary glands were subjected to double-stranded RNA (dsRNA transfection with dsRNA to the LGTV 3′ untranslated region (UTR, which reduced infectious LGTV and POWV replication, providing a proof-of-concept use of RNA interference in I. scapularis organ cultures to study the effects on TBFV replication. The results contribute important information on TBFV localization within ex vivo I. scapularis organs and provide a significant translational tool for evaluating recombinant, live vaccine candidates and potential tick transcripts and proteins for possible therapeutic use and vaccine development to reduce TBFV transmission.

  12. Mechanistic Studies of Flavivirus Inhibition and Nanoparticle-Catalyzed Decontamination

    Science.gov (United States)

    2016-06-01

    recyclable, ‘self-cleaning sensor’ useful for detecting hydrophobic toxins.   iii Table of Contents Abstract...qRT-PCR kit ( Basel , Switzerland), using primers Den_F (TTAGAGGAGACCCCTCCC) and Den_R (TCTCCTCTAACCTCTAGTCC) and the following cycling conditions: 1...recognizes E protein domain III 4.8A anti-dengue virus human monoclonal antibody, neutralizing 4G2 anti-dengue virus mouse monoclonal antibody

  13. Serological and spatial analysis of alphavirus and flavivirus prevalence and risk factors in a rural community in western Kenya.

    Directory of Open Access Journals (Sweden)

    Elysse N Grossi-Soyster

    2017-10-01

    Full Text Available Alphaviruses, such as chikungunya virus, and flaviviruses, such as dengue virus, are (re-emerging arboviruses that are endemic in tropical environments. In Africa, arbovirus infections are often undiagnosed and unreported, with febrile illnesses often assumed to be malaria. This cross-sectional study aimed to characterize the seroprevalence of alphaviruses and flaviviruses among children (ages 5-14, n = 250 and adults (ages 15 ≥ 75, n = 250 in western Kenya. Risk factors for seropositivity were explored using Lasso regression. Overall, 67% of participants showed alphavirus seropositivity (CI95 63%-70%, and 1.6% of participants showed flavivirus seropositivity (CI95 0.7%-3%. Children aged 10-14 were more likely to be seropositive to an alphavirus than adults (p < 0.001, suggesting a recent transmission period. Alphavirus and flavivirus seropositivity was detected in the youngest participants (age 5-9, providing evidence of inter-epidemic transmission. Demographic variables that were significantly different amongst those with previous infection versus those without infection included age, education level, and occupation. Behavioral and environmental variables significantly different amongst those in with previous infection to those without infection included taking animals for grazing, fishing, and recent village flooding. Experience of recent fever was also found to be a significant indicator of infection (p = 0.027. These results confirm alphavirus and flavivirus exposure in western Kenya, while illustrating significantly higher alphavirus transmission compared to previous studies.

  14. Impact of HCV kinetics on treatment outcome differs by the type of real-time HCV assay in NS3/4A protease inhibitor-based triple therapy.

    Science.gov (United States)

    Ogawa, Eiichi; Furusyo, Norihiro; Murata, Masayuki; Hayashi, Takeo; Shimizu, Motohiro; Mukae, Haru; Toyoda, Kazuhiro; Hotta, Taeko; Uchiumi, Takeshi; Hayashi, Jun

    2016-02-01

    Repeated measurement of the HCV RNA level is essential for properly monitoring treatment efficacy. The aim of this study was to determine the utility of two HCV real-time assays in the evaluation of the impact of hepatitis C virus (HCV) kinetics on the outcome of triple therapy with NS3/4A protease inhibitors (PIs), telaprevir or simeprevir. This study consisted of 171 Japanese patients infected with HCV genotype 1. All 3266 serum samples taken during and post treatment were tested with both the COBAS AmpliPrep/COBAS TaqMan (CAP/CTM) HCV Test v2.0 and the Abbott RealTime (ART) HCV Test. Of the 2597 samples undetectable (lower limit of detection [HCV RNA by the CAP/CTM assay from the on and post treatment, 400 (15.4%) (369 detectable/less than the lower limitation of quantification [HCV RNA HCV RNA being once HCV RNA (detectable/HCV RNA after 12 weeks (without PI-treatment period). The superior ability to detect low-level HCV RNA by ART could be useful for predicting SVR by difficult-to-treat patients in the early period and relapse in the late period. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. [The intracellular localization of the regulatory proteins of the densovirus of German cockroach, Blattella germanica].

    Science.gov (United States)

    Martynova, E U; Kapelinskaia, T V; Schal, C; Mukha, D V

    2014-01-01

    The intracellular localization of the regulatory proteins encoded by the genome of the densovirus of German cockroach was analyzed using western-blotting of nuclear and cytoplasmic extracts of the densovirus-infected passaging cells tissue culture BGE-2. Two of the three regulatory proteins, NS1 and NS3, were shown to possess mainly nuclear localization, while NS2 protein was distributed between the nucleus and cytoplasm. Data obtained provide new information necessary for prediction of the functions of densovirus regulatory proteins. Intracellular localization of NS3 protein was described for the densoviruses for the first time.

  16. Genes de susceptibilidad/ resistencia a Flavivirus, implicaciones en la severidad de la infección

    Directory of Open Access Journals (Sweden)

    Jeanette Prada-Arismendy

    2006-07-01

    Full Text Available Las infecciones transmitidas por Flavivirus se encuentran entre las enfermedades transmisibles con mayor incidencia en el mundo. La mayoría de ellas se manifiestan clínicamente como un síndrome febril que puede estar o no acompañado de diversos síntomas. La severidad de estas infecciones es variable con casos asintomáticos y otros que pueden llegar a ser letales, La razón de esta variabilidad en la presentación clínica, se desconoce en humanos. En ratones se han identificado cepas susceptibles y cepas resistentes a la infección por algunos Flavivirus. Por clonación posicional se mapeó el gen responsable de la resistencia a virus West Nile en el cromosoma 5 de ratón y se identificó como oligoadenilato sintetasa 1b (Oas1 b. Este gen codifica una proteína que sintetiza oligómeros de adenina que activan la RNasaL, que a su vez degrada los RNAs virales. Células provenientes de ratones resistentes a la infección por Flavivirus producen menor cantidad de virus que su contraparte susceptible, Recientemente en humanos, se identificó un polimorfismo asociado con susceptibilidad a infección por virus West Nile en el gen de OasL. Sin embargo, el mecanismo bioquímico y molecular exacto por el cual se produce la susceptibilidad no ha sido completamente dilucidado, Este conocimiento permitiría aclarar aspectos de la fisiopatología de estas enfermedades y enfocar la terapéutica desde un punto de vista más específico.

  17. An "All-In-One" Pharmacophoric Architecture for the Discovery of Potential Broad-Spectrum Anti-Flavivirus Drugs.

    Science.gov (United States)

    Ncube, Nomagugu B; Ramharack, Pritika; Soliman, Mahmoud E S

    2018-01-18

    A precipitous increase in the number of flaviviral infections has been noted over the last 5 years. Despite these outbreaks, treatment protocols for infected individuals remain ambiguous. Numerous studies have identified NITD008 as a potent flavivirus inhibitor; however, clinical testing was dismissed due to undesirable toxic effects. The binding landscape of NITD008 in complex with five detrimental flaviviruses at the RNA-dependent RNA polymerase active sites was explored. An "all-in-one" pharmacophore model was created for the design of small molecules that may inhibit a broad spectrum of flaviviruses. This pharmacophore model approach serves as a robust cornerstone, thus assisting medicinal experts in the composition of multifunctional inhibitors that will eliminate cross-resistance and toxicity and enhance patient adherence.

  18. ANTIGENIC RELATEDNESS OF SELECTED FLAVIVIRUSES: STUDY WITH HOMOLOGOUS AND HETEROLOGOUS IMMUNE MOUSE ASCITIC FLUIDS

    Directory of Open Access Journals (Sweden)

    S.S. BABA

    1998-11-01

    Full Text Available The antigenic relationship of 9 flaviviruses, Yellow fever (YF , Wesselsbron (WSL , Uganda S (UGS , Potiskum (POT, West Nile (WN , Banzi (BAN , Zika (ZK , Dengue type 1 (DEN-1 and Dengue type 2 (DEN-2, was assessed by cross-haemagglutination-inhibition (Cross-HI and cross-complement fixation (Cross-CF reactions between each of the viruses and their homologous immune mouse ascitic fluids. Titre ratios were calculated using the heterologous and homologous titres. Cross-CF reactions revealed wider antigenic variations among viruses than Cross-HI reactions. There was no significant antigenic variation between WSL, POT and YF viruses using either of those methods. However, definite differences in antigenicity were observed between them and UGS, BAN and ZK viruses. There were no significant differences between UGS, BAN and ZK or between DEN-1 and DEN-2. The serological relationship among flaviviruses is important in establishing diagnosis and epidemiology of these infections in Africa.A relação antigênica de 9 Flavivirus, Febre amarela (YF, Wesselsbron (WSL, Uganda S (UGS, Potiskum (POT, West Nile (WN, Banzi (BAN, Zika (ZK, Dengue tipo 1 (DEN-1 e Dengue tipo2 (DEN-2, foi avaliada por reação de inibição da hemaglutinação cruzada (cross-HI e reação de fixação do complemento cruzada (Cross-CF entre cada um dos virus e seu fluido ascítico homólogo em camundongos. Médias de títulos foram calculadas usando os títulos heterólogos e homólogos. Reações cruzadas CF revelaram maiores variações antigênicas entre virus do que reações cruzadas HI. Não houve variação antigênica significativa entre virus WSL, POT e YF usando cada um dos métodos. Todavia, diferenças definidas da antigenicidade foram observadas entre eles e os vírus UGS, BAN e ZK. Não existiram diferenças significativas entre UGS, BAN e ZK ou entre DEN-1 e DEN-2. A relação sorológica entre Flavivirus é importante para se estabelecer o diagnóstico e a

  19. GENES DE SUSCEPTIBILIDAD/RESISTENCIA A Flavivirus, IMPLICACIONES EN LA SEVERIDAD DE LA INFECCIÓN

    OpenAIRE

    JEANETTE PRADA-ARISMENDY; JAIME E. CASTELLANOS

    2006-01-01

    Las infecciones transmitidas por Flavivirus se encuentran entre las enfermedades transmisibles con mayor incidencia en el mundo. La mayoría de ellas se manifiestan clínicamente como un síndrome febril que puede estar o no acompañado de diversos síntomas. La severidad de estas infecciones es variable con casos asintomáticos y otros que pueden llegar a ser letales. La razón de esta variabilidad en la presentación clínica, se desconoce en humanos. En ratones se han identificado cepas susceptible...

  20. Molecular detection of flaviviruses and alphaviruses in mosquitoes (Diptera: Culicidae) from coastal ecosystems in the Colombian Caribbean.

    Science.gov (United States)

    Hoyos-López, Richard; Suaza-Vasco, Juan; Rúa-Uribe, Guillermo; Uribe, Sandra; Gallego-Gómez, Juan Carlos

    2016-10-01

    Arboviruses belonging to the genera Flavivirus and Alphavirus were detected in mosquitoes in a rural area of San Bernardo del Viento (Córdoba, Colombia). A total of 22,180 mosquitoes were collected, sorted into 2,102 pools, and tested by generic/nested reverse transcription-polymerase chain reaction. Venezuelan equine encephalitis virus, dengue virus, West Nile virus, St. Louis encephalitis virus, yellow fever virus, and Culex flavivirus were detected and identified by sequencing. The detection of arboviral pathogens in this zone represents possible circulation and indicates a human health risk, demonstrating the importance of virological surveillance activities.

  1. Does adaptation to vertebrate codon usage relate to flavivirus emergence potential?

    Science.gov (United States)

    Di Paola, Nicholas; Freire, Caio César de Melo; Zanotto, Paolo Marinho de Andrade

    2018-01-01

    Codon adaptation index (CAI) is a measure of synonymous codon usage biases given a usage reference. Through mutation, selection, and drift, viruses can optimize their replication efficiency and produce more offspring, which could increase the chance of secondary transmission. To evaluate how higher CAI towards the host has been associated with higher viral titers, we explored temporal trends of several historic and extensively sequenced zoonotic flaviviruses and relationships within the genus itself. To showcase evolutionary and epidemiological relationships associated with silent, adaptive synonymous changes of viruses, we used codon usage tables from human housekeeping and antiviral immune genes, as well as tables from arthropod vectors and vertebrate species involved in the flavivirus maintenance cycle. We argue that temporal trends of CAI changes could lead to a better understanding of zoonotic emergences, evolutionary dynamics, and host adaptation. CAI appears to help illustrate historically relevant trends of well-characterized viruses, in different viral species and genetic diversity within a single species. CAI can be a useful tool together with in vivo and in vitro kinetics, phylodynamics, and additional functional genomics studies to better understand species trafficking and viral emergence in a new host.

  2. Noncoding Subgenomic Flavivirus RNA: Multiple Functions in West Nile Virus Pathogenesis and Modulation of Host Responses

    Directory of Open Access Journals (Sweden)

    Justin A. Roby

    2014-01-01

    Full Text Available Flaviviruses are a large group of positive strand RNA viruses transmitted by arthropods that include many human pathogens such as West Nile virus (WNV, Japanese encephalitis virus (JEV, yellow fever virus, dengue virus, and tick-borne encephalitis virus. All members in this genus tested so far are shown to produce a unique subgenomic flavivirus RNA (sfRNA derived from the 3' untranslated region (UTR. sfRNA is a product of incomplete degradation of genomic RNA by the cell 5'–3' exoribonuclease XRN1 which stalls at highly ordered secondary RNA structures at the beginning of the 3'UTR. Generation of sfRNA results in inhibition of XRN1 activity leading to an increase in stability of many cellular mRNAs. Mutant WNV deficient in sfRNA generation was highly attenuated displaying a marked decrease in cytopathicity in cells and pathogenicity in mice. sfRNA has also been shown to inhibit the antiviral activity of IFN-α/β by yet unknown mechanism and of the RNAi pathway by likely serving as a decoy substrate for Dicer. Thus, sfRNA is involved in modulating multiple cellular pathways to facilitate viral pathogenicity; however the overlying mechanism linking all these multiple functions of sfRNA remains to be elucidated.

  3. The prevalence of the pre-existing hepatitis C viral variants and the evolution of drug resistance in patients treated with the NS3-4a serine protease inhibitor telaprevir

    Energy Technology Data Exchange (ETDEWEB)

    Rong, Libin [Los Alamos National Laboratory; Ribeiro, Ruy M [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory

    2008-01-01

    Telaprevir (VX-950), a novel hepatitis C virus (HCV) NS3-4A serine protease inhibitor, has demonstrated substantial antiviral activity in patients infected with HCV genotype 1. Some patients experience viral breakthrough, which has been shown to be associated with emergence of telaprevir-resistant HCV variants during treatment. The exact mechanisms underlying the rapid selection of drug resistant viral variants during dosing are not fully understood. In this paper, we develop a two-strain model to study the pre-treatment prevalence of the mutant virus and derive an analytical solution of the mutant frequency after administration of the protease inhibitor. Our analysis suggests that the rapid increase of the mutant frequency during therapy is not due to mutant growth but rather due to the rapid and profound loss of wild-type virus, which uncovers the pre-existing mutant variants. We examine the effects of backward mutation and hepatocyte proliferation on the pre-existence of the mutant virus and the competition between wild-type and drug resistant virus during therapy. We then extend the simple model to a general model with multiple viral strains. Mutations during therapy do not play a significant role in the dynamics of various viral strains, although they are capable of generating low levels of HCV variants that would otherwise be completely suppressed because of fitness disadvantages. Hepatocyte proliferation may not affect the pretreatment frequency of mutant variants, but is able to influence the quasispecies dynamics during therapy. It is the relative fitness of each mutant strain compared with wild-type that determines which strain(s) will dominate the virus population. The study provides a theoretical framework for exploring the prevalence of pre-existing mutant variants and the evolution of drug resistance during treatment with other protease inhibitors or HCV polymerase inhibitors.

  4. Characterization of Rabensburg virus, a flavivirus closely related to West Nile virus of the Japanese encephalitis antigenic group

    Czech Academy of Sciences Publication Activity Database

    Aliota, M. T.; Jones, S. A.; Dupuis, A. P.; Ciota, A. T.; Hubálek, Zdeněk; Kramer, L. D.

    2012-01-01

    Roč. 7, č. 6 (2012), e39387 E-ISSN 1932-6203 Institutional support: RVO:68081766 Keywords : Insect-specific flaviviruses * Northeastern United-States * Culex pipiens Subject RIV: EE - Microbiology, Virology Impact factor: 3.730, year: 2012

  5. Interaction of Flavivirus with their mosquito vectors and their impact on the human health in the Americas.

    Science.gov (United States)

    Valderrama, Anayansi; Díaz, Yamilka; López-Vergès, Sandra

    2017-10-28

    Some of the major arboviruses with public health importance, such as dengue, yellow fever, Zika and West Nile virus are mosquito-borne or mosquito-transmitted Flavivirus. Their principal vectors are from the family Culicidae, Aedes aegypti and Aedes albopictus being responsible of the urban cycles of dengue, Zika and yellow fever virus. These vectors are highly competent for transmission of many arboviruses. The genetic variability of the vectors, the environment and the viral diversity modulate the vector competence, in this context, it is important to determine which vector species is responsible of an outbreak in areas where many vectors coexist. As some vectors can transmit several flaviviruses and some flaviviruses can be transmitted by different species of vectors, through this review we expose importance of yellow fever, dengue and Zika virus in the world and the Americas, as well as the updated knowledge about these flaviviruses in their interaction with their mosquito vectors, guiding us on what is probably the beginning of a new stage in which the simultaneity of outbreaks will occur more frequently. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Recent advances in understanding the adaptive immune response to Zika virus and the effect of previous flavivirus exposure.

    Science.gov (United States)

    Andrade, Daniela V; Harris, Eva

    2017-06-26

    Zika virus (ZIKV) caused explosive epidemics across the Americas, starting in Brazil in 2015, and has been associated with severe manifestations such as microcephaly in babies born to infected mothers and Guillain-Barré syndrome in adults. As the underlying mechanisms of pathogenesis remain largely unknown, diverse investigations have focused on a potential role for flavivirus cross-reactive antibodies in enhancing ZIKV infection. Antibody-dependent enhancement is especially concerning due to structural similarities between ZIKV and other flaviviruses, especially dengue virus (DENV), that co-circulate in areas affected by ZIKV. Conversely, investigating cross-neutralizing antibodies is important for understanding protection among flaviviruses, including ZIKV. In this review, we discuss the latest findings regarding ZIKV-induced adaptive immunity, such as monoclonal and polyclonal antibody responses, structural immunology, and T cell-mediated responses. Much progress has been made in a short amount of time, but many questions remain. Fully understanding the specificity, magnitude, and kinetics of B cell/antibody and T cell responses in ZIKV-infected individuals with or without prior exposure to flaviviruses is of great relevance for diagnostics and vaccine development. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Antiviral activity of the adenosine analogue BCX4430 against West Nile virus and tick-borne flaviviruses.

    Science.gov (United States)

    Eyer, Luděk; Zouharová, Darina; Širmarová, Jana; Fojtíková, Martina; Štefánik, Michal; Haviernik, Jan; Nencka, Radim; de Clercq, Erik; Růžek, Daniel

    2017-06-01

    There are currently no approved antiviral therapies against medically important human flaviviruses. The imino-C-nucleoside BCX4430 shows broad-spectrum antiviral activity against a wide range of RNA viruses. Here, we demonstrate that BCX4430 inhibits tick-borne species of the genus Flavivirus; however, the antiviral effect varies against individual species. Micro-molar BCX4430 levels inhibited tick-borne encephalitis virus (TBEV); while, approximately 3-8-fold higher concentrations were needed to inhibit louping ill virus and Kyasanur Forest disease virus. Moreover, the compound strongly inhibited in vitro replication of West Nile virus, a typical mosquito-transmitted flavivirus. Two chemical forms of the compound, i.e. BCX4430 and BCX4430 hydrochloride, were compared and both exerted similar inhibitory profiles in our in vitro antiviral assay systems and no or negligible cytotoxicity in porcine kidney stable and Vero cells. The obtained data indicate that, in addition to mosquito-borne flaviviruses, the compound has strong antiviral activity against members of the TBEV serocomplex. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Serological evidence of widespread circulation of West Nile virus and other flaviviruses in equines of the Pantanal, Brazil.

    Science.gov (United States)

    Pauvolid-Corrêa, Alex; Campos, Zilca; Juliano, Raquel; Velez, Jason; Nogueira, Rita Maria Ribeiro; Komar, Nicholas

    2014-02-01

    A recent study reported neutralizing antibodies to West Nile virus (WNV) in horses from four ranches of southern Pantanal. To extend that study, a serosurvey for WNV and 11 Brazilian flaviviruses was conducted with 760 equines, 238 sheep and 61 caimans from 17 local cattle ranches. Among the tested equines, 32 were collected from a ranch where a neurologic disorder outbreak had been recently reported. The sera were initially screened by using a blocking ELISA and then titrated by 90% plaque-reduction neutralization test (PRNT90) for 12 flaviviruses. Employing the criterion of 4-fold greater titer, 78 (10.3%) equines were seropositive for Ilheus virus, 59 (7.8%) for Saint Louis encephalitis virus, 24 (3.2%) for WNV, two (0.3%) for Cacipacore virus and one (0.1%) for Rocio virus. No serological evidence was found linking the neurological disease that affected local equines to WNV. All caimans and sheep were negative by blocking ELISA for flaviviruses. There were no seropositive equines for Bussuquara, Iguape, Yellow fever and all four Dengue virus serotypes. The detection of WNV-seropositive equines in ten ranches and ILHV and SLEV-seropositive equines in fourteen ranches of two different sub-regions of Pantanal is strong evidence of widespread circulation of these flaviviruses in the region.

  9. Serological Survey of Hantavirus and Flavivirus Among Wild Rodents in Central Italy.

    Science.gov (United States)

    Cosseddu, Gian Mario; Sozio, Giulia; Valleriani, Fabrizia; Di Gennaro, Annapia; Pascucci, Ilaria; Gavaudan, Stefano; Marianneau, Philippe; Monaco, Federica

    2017-11-01

    Hantaviruses are a group of zoonotic viruses carried by rodents. Puumala virus (PUUV) and Dobrava virus (DOBV) are the causative agents of human hantavirus infections in Europe. Knowledge about hantavirus circulation in Italy is very scarce. West Nile virus (WNV) and Usutu virus (USUV) are emerging neuropathogenic flaviviruses, both endemic in most part of the Italian territories. To monitor the circulation of PUUV, DOBV, WNV, and USUV in natural environment in central Italy, we carried out serological surveillance in wild rodents. During this study, 90 animals were captured in forested areas of Abruzzo and Marche regions and tested with serological assays for the specific pathogens. Serological test provided no evidence of PUUV and DOBV circulation in the studied area. However, four rodents (Apodemus flavicollis) were found to be positive by WNV ELISA test. Two of them were confirmed as WNV by virus neutralization test.

  10. Hiding from intracellular pattern recognition receptors, a passive strategy of flavivirus immune evasion.

    Science.gov (United States)

    Overby, Anna K; Weber, Friedemann

    2011-01-01

    Tick-borne encephalitis virus (TBEV) is a medically important flavivirus in Europe and Asia, causing meningitis and encephalitis in thousands of people annually. Despite its relevance for public health, the interaction of TBEV with the type I interferon (IFN) system is poorly characterized. Induction of these antiviral cytokines is normally triggered by cytoplasmic recognition of viral signature molecules such as double-stranded (ds) RNA. In a recent paper, we showed that TBEV infection leads to formation of intracellular membrane vesicles which protect the viral dsRNA from cellular recognition. This delays the onset of antiviral IFN production sufficiently enough for an unhindered release of progeny viruses over 24 h. Thus, TBEV has evolved a stealth strategy to outrun the antiviral IFN response.

  11. Transmission of West Nile virus by Culex quinquefasciatus say infected with Culex Flavivirus Izabal.

    Directory of Open Access Journals (Sweden)

    Rebekah J Kent

    Full Text Available BACKGROUND: The natural history and potential impact of mosquito-specific flaviviruses on the transmission efficiency of West Nile virus (WNV is unknown. The objective of this study was to determine whether or not prior infection with Culex flavivirus (CxFV Izabal altered the vector competence of Cx. quinquefasciatus Say for transmission of a co-circulating strain of West Nile virus (WNV from Guatemala. METHODS AND FINDINGS: CxFV-negative Culex quinquefasciatus and those infected with CxFV Izabal by intrathoracic inoculation were administered WNV-infectious blood meals. Infection, dissemination, and transmission of WNV were measured by plaque titration on Vero cells of individual mosquito bodies, legs, or saliva, respectively, two weeks following WNV exposure. Additional groups of Cx. quinquefasciatus were intrathoracically inoculated with WNV alone or WNV+CxFV Izabal simultaneously, and saliva collected nine days post inoculation. Growth of WNV in Aedes albopictus C6/36 cells or Cx. quinquefasciatus was not inhibited by prior infection with CxFV Izabal. There was no significant difference in the vector competence of Cx. quinquefasciatus for WNV between mosquitoes uninfected or infected with CxFV Izabal across multiple WNV blood meal titers and two colonies of Cx. quinquefasciatus (p>0.05. However, significantly more Cx. quinquefasciatus from Honduras that were co-inoculated simultaneously with both viruses transmitted WNV than those inoculated with WNV alone (p = 0.0014. Co-inoculated mosquitoes that transmitted WNV also contained CxFV in their saliva, whereas mosquitoes inoculated with CxFV alone did not contain virus in their saliva. CONCLUSIONS: In the sequential infection experiments, prior infection with CxFV Izabal had no significant impact on WNV replication, infection, dissemination, or transmission by Cx. quinquefasciatus, however WNV transmission was enhanced in the Honduras colony when mosquitoes were inoculated simultaneously with

  12. Rapid detection of newly isolated Tembusu-related Flavivirus by reverse-transcription loop-mediated isothermal amplification assay

    Directory of Open Access Journals (Sweden)

    Wang Youling

    2011-12-01

    Full Text Available Abstract Background From April 2010 to January 2011, a severe new viral disease had devastated most duck-farming regions in China. This disease affected not only laying ducks but also meat ducks, causing huge economic losses for the poultry industry. The objective of this study is to develop a one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of the new virus related to Tembusu-related Flavivirus. Results The RT-LAMP assay is very simple and rapid, and the amplification can be completed within 50 min under isothermal conditions at 63°C by a set of 6 primers targeting the E gene based on the sequences analysis of the newly isolated viruses and other closely related Flavivirus.The monitoring of gene amplification can also be visualized by using SYBR green I fluorescent dye. In addition, the RT-LAMP assay for newly isolated Tembusu-related Flavivirus showed higher sensitivity with an RNA detection-limit of 2 copies/μL compared with 190 copies/μL of the conventional RT-PCR method. The specificity was identified without cross reaction to other common avian pathogens. By screening a panel of clinical samples this method was more feasible in clinical settings and there was higher positive coincidence rate than conventional RT-PCR and virus isolation. Conclusion The RT-LAMP assay for newly isolated Tembusu-related Flavivirus is a valuable tool for the rapid and real-time detection not only in well-equipped laboratories but also in general conditions.

  13. Antiviral activity of the adenosine analogue BCX4430 against West Nile virus and tick-borne flaviviruses

    Czech Academy of Sciences Publication Activity Database

    Eyer, Luděk; Zouharová, D.; Širmarová, J.; Fojtiková, M.; Štefánik, M.; Haviernik, J.; Nencka, Radim; De Clercq, E.; Růžek, Daniel

    2017-01-01

    Roč. 142, JUN (2017), s. 63-67 ISSN 0166-3542 R&D Projects: GA MZd(CZ) NV16-34238A; GA ČR(CZ) GA16-20054S Institutional support: RVO:60077344 ; RVO:61388963 Keywords : BCX4430 * Flavivirus * adenosine analogue * nucleoside inhibitor * antiviral activity * cytotoxicity Subject RIV: EE - Microbiology, Virology OBOR OECD: Virology Impact factor: 4.271, year: 2016

  14. Insect-Specific Flaviviruses: A Systematic Review of Their Discovery, Host Range, Mode of Transmission, Superinfection Exclusion Potential and Genomic Organization

    Directory of Open Access Journals (Sweden)

    Bradley J. Blitvich

    2015-04-01

    Full Text Available There has been a dramatic increase in the number of insect-specific flaviviruses (ISFs discovered in the last decade. Historically, these viruses have generated limited interest due to their inability to infect vertebrate cells. This viewpoint has changed in recent years because some ISFs have been shown to enhance or suppress the replication of medically important flaviviruses in co-infected mosquito cells. Additionally, comparative studies between ISFs and medically important flaviviruses can provide a unique perspective as to why some flaviviruses possess the ability to infect and cause devastating disease in humans while others do not. ISFs have been isolated exclusively from mosquitoes in nature but the detection of ISF-like sequences in sandflies and chironomids indicates that they may also infect other dipterans. ISFs can be divided into two distinct phylogenetic groups. The first group currently consists of approximately 12 viruses and includes cell fusing agent virus, Kamiti River virus and Culex flavivirus. These viruses are phylogenetically distinct from all other known flaviviruses. The second group, which is apparently not monophyletic, currently consists of nine viruses and includes Chaoyang virus, Nounané virus and Lammi virus. These viruses phylogenetically affiliate with mosquito/vertebrate flaviviruses despite their apparent insect-restricted phenotype. This article provides a review of the discovery, host range, mode of transmission, superinfection exclusion ability and genomic organization of ISFs. This article also attempts to clarify the ISF nomenclature because some of these viruses have been assigned more than one name due to their simultaneous discoveries by independent research groups.

  15. Patterns of Flavivirus Seroprevalence in the Human Population of Northern Laos.

    Science.gov (United States)

    Conlan, James V; Vongxay, Khamphouth; Khamlome, Boualam; Jarman, Richard G; Gibbons, Robert V; Fenwick, Stanley G; Thompson, R C A; Blacksell, Stuart D

    2015-11-01

    A total of 1,136 samples from 289 households in four provinces in northern Laos were subjected to Japanese encephalitis virus (JEV) and dengue virus hemagglutination inhibition (DENV HI). Overall, antibodies to JEV were detected by HI in 620 (54.6%) of 1,136 people; of which 217 (19.1%) had HI activity against JEV only. Antibodies to DENV4 were detected by HI in 526 (46.3%) of 1,136 people; of which 124 (10.9%) had HI activity against DENV4 only. Antibodies to DENV1-3 were detected by HI in 296 (26.1%), 274 (24.1%), and 283 (24.9) of 1,136 people, respectively; of which 7, 1, and 0, respectively, had HI activity against DENV1-3 only. JEV was the most prevalent Flavivirus in Oudomxay, Luangprabang, and Huaphan provinces and DENV4 was the most prevalent in Xiengkhouang province. Seroprevalence for JEV increased with increasing age and wealth and was higher in villages where rice was cultivated in paddy fields and highest for people of Lao-Tai ethnicity. © The American Society of Tropical Medicine and Hygiene.

  16. Screening test for neutralizing antibodies against yellow fever virus, based on a flavivirus pseudotype.

    Directory of Open Access Journals (Sweden)

    Séverine Mercier-Delarue

    Full Text Available Given the possibility of yellow fever virus reintroduction in epidemiologically receptive geographic areas, the risk of vaccine supply disruption is a serious issue. New strategies to reduce the doses of injected vaccines should be evaluated very carefully in terms of immunogenicity. The plaque reduction test for the determination of neutralizing antibodies (PRNT is particularly time-consuming and requires the use of a confinement laboratory. We have developed a new test based on the use of a non-infectious pseudovirus (WN/YF17D. The presence of a reporter gene allows sensitive determination of neutralizing antibodies by flow cytometry. This WN/YF17D test was as sensitive as PRNT for the follow-up of yellow fever vaccinees. Both tests lacked specificity with sera from patients hospitalized for acute Dengue virus infection. Conversely, both assays were strictly negative in adults never exposed to flavivirus infection or vaccination, and in patients sampled some time after acute Dengue infection. This WN/YF17D test will be particularly useful for large epidemiological studies and for screening for neutralizing antibodies against yellow fever virus.

  17. An Approach for a Synthetic CTL Vaccine Design against Zika Flavivirus Using Class I and Class II Epitopes Identified by Computer Modeling.

    Science.gov (United States)

    Cunha-Neto, Edecio; Rosa, Daniela S; Harris, Paul E; Olson, Tim; Morrow, Alex; Ciotlos, Serban; Herst, Charles V; Rubsamen, Reid Martin

    2017-01-01

    The threat posed by severe congenital abnormalities related to Zika virus (ZKV) infection during pregnancy has turned development of a ZKV vaccine into an emergency. Recent work suggests that the cytotoxic T lymphocyte (CTL) response to infection is an important defense mechanism in response to ZKV. Here, we develop the rationale and strategy for a new approach to developing cytotoxic T lymphocyte (CTL) vaccines for ZKV flavivirus infection. The proposed approach is based on recent studies using a protein structure computer model for HIV epitope selection designed to select epitopes for CTL attack optimized for viruses that exhibit antigenic drift. Because naturally processed and presented human ZKV T cell epitopes have not yet been described, we identified predicted class I peptide sequences on ZKV matching previously identified DNV (Dengue) class I epitopes and by using a Major Histocompatibility Complex (MHC) binding prediction tool. A subset of those met the criteria for optimal CD8+ attack based on physical chemistry parameters determined by analysis of the ZKV protein structure encoded in open source Protein Data File (PDB) format files. We also identified candidate ZKV epitopes predicted to bind promiscuously to multiple HLA class II molecules that could provide help to the CTL responses. This work suggests that a CTL vaccine for ZKV may be possible even if ZKV exhibits significant antigenic drift. We have previously described a microsphere-based CTL vaccine platform capable of eliciting an immune response for class I epitopes in mice and are currently working toward in vivo testing of class I and class II epitope delivery directed against ZKV epitopes using the same microsphere-based vaccine.

  18. An Approach for a Synthetic CTL Vaccine Design against Zika Flavivirus Using Class I and Class II Epitopes Identified by Computer Modeling

    Directory of Open Access Journals (Sweden)

    Edecio Cunha-Neto

    2017-06-01

    Full Text Available The threat posed by severe congenital abnormalities related to Zika virus (ZKV infection during pregnancy has turned development of a ZKV vaccine into an emergency. Recent work suggests that the cytotoxic T lymphocyte (CTL response to infection is an important defense mechanism in response to ZKV. Here, we develop the rationale and strategy for a new approach to developing cytotoxic T lymphocyte (CTL vaccines for ZKV flavivirus infection. The proposed approach is based on recent studies using a protein structure computer model for HIV epitope selection designed to select epitopes for CTL attack optimized for viruses that exhibit antigenic drift. Because naturally processed and presented human ZKV T cell epitopes have not yet been described, we identified predicted class I peptide sequences on ZKV matching previously identified DNV (Dengue class I epitopes and by using a Major Histocompatibility Complex (MHC binding prediction tool. A subset of those met the criteria for optimal CD8+ attack based on physical chemistry parameters determined by analysis of the ZKV protein structure encoded in open source Protein Data File (PDB format files. We also identified candidate ZKV epitopes predicted to bind promiscuously to multiple HLA class II molecules that could provide help to the CTL responses. This work suggests that a CTL vaccine for ZKV may be possible even if ZKV exhibits significant antigenic drift. We have previously described a microsphere-based CTL vaccine platform capable of eliciting an immune response for class I epitopes in mice and are currently working toward in vivo testing of class I and class II epitope delivery directed against ZKV epitopes using the same microsphere-based vaccine.

  19. Recombinant Envelope-Proteins with Mutations in the Conserved Fusion Loop Allow Specific Serological Diagnosis of Dengue-Infections.

    Directory of Open Access Journals (Sweden)

    Alexandra Rockstroh

    2015-11-01

    Full Text Available Dengue virus (DENV is a mosquito-borne flavivirus and a major international public health concern in many tropical and sub-tropical areas worldwide. DENV is divided into four major serotypes, and infection with one serotype leads to immunity against the same, but not the other serotypes. The specific diagnosis of DENV-infections via antibody-detection is problematic due to the high degree of cross-reactivity displayed by antibodies against related flaviviruses, such as West Nile virus (WNV, Yellow Fever virus (YFV or Tick-borne encephalitis virus (TBEV. Especially in areas where several flaviviruses co-circulate or in the context of vaccination e.g. against YFV or TBEV, this severely complicates diagnosis and surveillance. Most flavivirus cross-reactive antibodies are produced against the highly conserved fusion loop (FL domain in the viral envelope (E protein. We generated insect-cell derived recombinant E-proteins of the four DENV-serotypes which contain point mutations in the FL domain. By using specific mixtures of these mutant antigens, cross-reactivity against heterologous flaviviruses was strongly reduced, enabling sensitive and specific diagnosis of the DENV-infected serum samples in IgG and IgM-measurements. These results have indications for the development of serological DENV-tests with improved specificity.

  20. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  1. In a randomized trial, the live attenuated tetravalent dengue vaccine TV003 is well-tolerated and highly immunogenic in subjects with flavivirus exposure prior to vaccination.

    Science.gov (United States)

    Whitehead, Stephen S; Durbin, Anna P; Pierce, Kristen K; Elwood, Dan; McElvany, Benjamin D; Fraser, Ellen A; Carmolli, Marya P; Tibery, Cecilia M; Hynes, Noreen A; Jo, Matthew; Lovchik, Janece M; Larsson, Catherine J; Doty, Elena A; Dickson, Dorothy M; Luke, Catherine J; Subbarao, Kanta; Diehl, Sean A; Kirkpatrick, Beth D

    2017-05-01

    Infection caused by the four serotypes of dengue virus (DENV-1-4) is a leading cause of mosquito-borne disease. Clinically-severe dengue disease is more common when secondary dengue infection occurs following prior infection with a heterologous dengue serotype. Other flaviviruses such as yellow fever virus, Japanese encephalitis virus, and Zika virus, can also elicit antibodies which are cross-reactive to DENV. As candidate dengue vaccines become available in endemic settings and for individuals who have received other flavivirus vaccines, it is important to examine vaccine safety and immunogenicity in these flavivirus-experienced populations. We performed a randomized, controlled trial of the National Institutes of Health live attenuated tetravalent dengue vaccine candidate (TV003) in fifty-eight individuals with prior exposure to flavivirus infection or vaccine. As in prior studies of this vaccine in flavivirus-naive volunteers, flavivirus-experienced subjects received two doses of vaccine six months apart and were followed closely for clinical events, laboratory changes, viremia, and neutralizing antibody titers. TV003 was well tolerated with few adverse events other than rash, which was predominately mild. Following one dose, 87% of vaccinees had an antibody response to all four serotypes (tetravalent response), suggesting a robust immune response. In addition, 76% of vaccinees were viremic; mean peak titers ranged from 0.68–1.1 log10 PFU/mL and did not differ by serotype. The second dose of TV003 was not associated with viremia, rash, or a sustained boost in antibody titers indicating that a single dose of the vaccine is likely sufficient to prevent viral replication and thus protect against disease. In comparison to the viremia and neutralizing antibody response elicited by TV003 in flavivirus-naïve subjects from prior studies, we found that subjects who were flavivirus-exposed prior to vaccination exhibited slightly higher DENV-3 viremia, higher

  2. In a randomized trial, the live attenuated tetravalent dengue vaccine TV003 is well-tolerated and highly immunogenic in subjects with flavivirus exposure prior to vaccination.

    Directory of Open Access Journals (Sweden)

    Stephen S Whitehead

    2017-05-01

    Full Text Available Infection caused by the four serotypes of dengue virus (DENV-1-4 is a leading cause of mosquito-borne disease. Clinically-severe dengue disease is more common when secondary dengue infection occurs following prior infection with a heterologous dengue serotype. Other flaviviruses such as yellow fever virus, Japanese encephalitis virus, and Zika virus, can also elicit antibodies which are cross-reactive to DENV. As candidate dengue vaccines become available in endemic settings and for individuals who have received other flavivirus vaccines, it is important to examine vaccine safety and immunogenicity in these flavivirus-experienced populations. We performed a randomized, controlled trial of the National Institutes of Health live attenuated tetravalent dengue vaccine candidate (TV003 in fifty-eight individuals with prior exposure to flavivirus infection or vaccine. As in prior studies of this vaccine in flavivirus-naive volunteers, flavivirus-experienced subjects received two doses of vaccine six months apart and were followed closely for clinical events, laboratory changes, viremia, and neutralizing antibody titers. TV003 was well tolerated with few adverse events other than rash, which was predominately mild. Following one dose, 87% of vaccinees had an antibody response to all four serotypes (tetravalent response, suggesting a robust immune response. In addition, 76% of vaccinees were viremic; mean peak titers ranged from 0.68–1.1 log10 PFU/mL and did not differ by serotype. The second dose of TV003 was not associated with viremia, rash, or a sustained boost in antibody titers indicating that a single dose of the vaccine is likely sufficient to prevent viral replication and thus protect against disease. In comparison to the viremia and neutralizing antibody response elicited by TV003 in flavivirus-naïve subjects from prior studies, we found that subjects who were flavivirus-exposed prior to vaccination exhibited slightly higher DENV-3 viremia

  3. End-point disease investigation for virus strains of intermediate virulence as illustrated by flavivirus infections.

    Science.gov (United States)

    Suen, Willy W; Prow, Natalie A; Setoh, Yin X; Hall, Roy A; Bielefeldt-Ohmann, Helle

    2016-02-01

    Viruses of intermediate virulence are defined as isolates causing an intermediate morbidity/mortality rate in a specific animal model system, involving specific host and inoculation parameters (e.g. dose and route). Therefore, variable disease phenotype may exist between animals that develop severe disease or die and those that are asymptomatic or survive after infection with these isolates. There may also be variability amongst animals within each of these subsets. Such potential variability may confound the use of time-point sacrifice experiments to investigate pathogenesis of this subset of virus strains, as uniformity in disease outcome is a fundamental assumption for time-course sacrifice experiments. In the current study, we examined the disease phenotype, neuropathology, neural infection and glial cell activity in moribund/dead and surviving Swiss white (CD-1) mice after intraperitoneal infection with various Australian flaviviruses, including West Nile virus (WNV) strains of intermediate virulence (WNVNSW2011 and WNVNSW2012), and highly virulent Murray Valley encephalitis virus (MVEV) isolates. We identified notable intragroup variation in the end-point disease in mice infected with either WNVNSW strain, but to a lesser extent in mice infected with MVEV strains. The variable outcomes associated with WNVNSW infection suggest that pathogenesis investigations using time-point sacrifice of WNVNSW-infected mice may not be the best approach, as the assumption of uniformity in outcomes is violated. Our study has therefore highlighted a previously unacknowledged challenge to investigating pathogenesis of virus isolates of intermediate virulence. We have also set a precedent for routine examination of the disease phenotype in moribund/dead and surviving mice during survival challenge experiments.

  4. Limonoids from Melia azedarach Fruits as Inhibitors of Flaviviruses and Mycobacterium tubercolosis.

    Directory of Open Access Journals (Sweden)

    Giuseppina Sanna

    Full Text Available The biological diversity of nature is the source of a wide range of bioactive molecules. The natural products, either as pure compounds or as standardized plant extracts, have been a successful source of inspiration for the development of new drugs. The present work was carried out to investigate the cytotoxicity, antiviral and antimycobacterial activity of the methanol extract and of four identified limonoids from the fruits of Melia azedarach (Meliaceae. The extract and purified limonoids were tested in cell-based assays for antiviral activity against representatives of ssRNA, dsRNA and dsDNA viruses and against Mycobacterium tuberculosis. Very interestingly, 3-α-tigloyl-melianol and melianone showed a potent antiviral activity (EC50 in the range of 3-11μM against three important human pathogens, belonging to Flaviviridae family, West Nile virus, Dengue virus and Yellow Fever virus. Mode of action studies demonstrated that title compounds were inhibitors of West Nile virus only when added during the infection, acting as inhibitors of the entry or of a very early event of life cycle. Furthermore, 3-α-tigloyl-melianol and methyl kulonate showed interesting antimycobacterial activity (with MIC values of 29 and 70 μM respectively. The limonoids are typically lipophilic compounds present in the fruits of Melia azeradach. They are known as cytotoxic compounds against different cancer cell lines, while their potential as antiviral and antibacterial was poorly investigated. Our studies show that they may serve as a good starting point for the development of novel drugs for the treatment of infections by Flaviviruses and Mycobacterium tuberculosis, for which there is a continued need.

  5. Exploring of primate models of tick-borne flaviviruses infection for evaluation of vaccines and drugs efficacy.

    Directory of Open Access Journals (Sweden)

    Natalia S Pripuzova

    Full Text Available Tick-borne encephalitis virus (TBEV is one of the most prevalent and medically important tick-borne arboviruses in Eurasia. There are overlapping foci of two flaviviruses: TBEV and Omsk hemorrhagic fever virus (OHFV in Russia. Inactivated vaccines exist only against TBE. There are no antiviral drugs for treatment of both diseases. Optimal animal models are necessary to study efficacy of novel vaccines and treatment preparations against TBE and relative flaviviruses. The models for TBE and OHF using subcutaneous inoculation were tested in Cercopithecus aethiops and Macaca fascicularis monkeys with or without prior immunization with inactivated TBE vaccine. No visible clinical signs or severe pathomorphological lesions were observed in any monkey infected with TBEV or OHFV. C. aethiops challenged with OHFV showed massive hemolytic syndrome and thrombocytopenia. Infectious virus or viral RNA was revealed in visceral organs and CNS of C. aethiops infected with both viruses; however, viremia was low. Inactivated TBE vaccines induced high antibody titers against both viruses and expressed booster after challenge. The protective efficacy against TBE was shown by the absence of virus in spleen, lymph nodes and CNS of immunized animals after challenge. Despite the absence of expressed hemolytic syndrome in immunized C. aethiops TBE vaccine did not prevent the reproduction of OHFV in CNS and visceral organs. Subcutaneous inoculation of M. fascicularis with two TBEV strains led to a febrile disease with well expressed viremia, fever, and virus reproduction in spleen, lymph nodes and CNS. The optimal terms for estimation of the viral titers in CNS were defined as 8-16 days post infection. We characterized two animal models similar to humans in their susceptibility to tick-borne flaviviruses and found the most optimal scheme for evaluation of efficacy of preventive and therapeutic preparations. We also identified M. fascicularis to be more susceptible to

  6. [Taxonomy of the Sokuluk virus (SOKV) (Flaviviridae, Flavivirus, Entebbe bat virus group) isolated from bats (Vespertilio pipistrellus Schreber, 1774), ticks (Argasidae Koch, 1844), and birds in Kyrgyzstan].

    Science.gov (United States)

    L'vov, D K; Al'khovskiĭ, S V; Shchelkanov, M Iu; Shchetinin, A M; Deriabin, P G; Gitel'man, A K; Samokhvalov, E I; Botikov, A G

    2014-01-01

    Complete genome sequencing of the Sokuluk virus (SOKV) isolated in Kyrgyzstan from bats Vespertilio pipistrellus and their obligatory parasites--Argasidae Koch, 1844, ticks was carried out. SOKV was classified as attributed to the Flaviviridae family, Flavivirus genus. The maximum homology (71% for nucleotide and 79% for amino acid sequences) was detected with respect to the Entebbe bat virus (ENTV). ENTV and SOKV form a group joining to the yellow fever virus (YFV) within the limits of the mosquito flavivirus branch. Close relation of SOKV with bat covers and human housings permits to assume SOKV potentially patogenic to human health.

  7. Seroprevalence of selected flaviviruses in free-living and captive capuchin monkeys in the state of Pernambuco, Brazil.

    Science.gov (United States)

    de Oliveira-Filho, E F; Oliveira, R A S; Ferreira, D R A; Laroque, P O; Pena, L J; Valença-Montenegro, M M; Mota, R A; Gil, L H V G

    2018-02-08

    Mosquito-borne diseases such as dengue, yellow fever and, more recently, Chikungunya virus (CHIKV) and Zika virus (ZIKV) have a great impact in the public health. In addition, the presence of such viruses might have an impact on wild animal conservation as well as their possible role as animal reservoir. Here, we performed a serological survey searching for antibodies against a panel of flaviviruses [ZIKV, Dengue virus (DENV), Yellow Fever virus (YFV), West Nile virus (WNV), Saint Louis Encephalitis virus (SLEV), Ilheus virus (ILHV) and Rocio virus (ROCV)] using plaque reduction neutralization test (PRNT 90 ) in both free-ranging and captive capuchin monkeys (Sapajus flavius and Sapajus libidinosus). Captive and free-living monkeys were sampled between June 2015 and January 2016 in the state of Pernambuco, including in the border with State of Paraíba, the epicentre of the ZIKV epidemics in Brazil. We have found neutralizing antibodies for ZIKV, DENV-1, DENV-2, DENV-3, DENV-4, YFV, ILHV and SLEV in both S. flavius and S. libidinosus samples. No positives samples were found for ROCV and WNV. Our results suggest that these flaviviruses might be circulating in capuchin monkey in the studied region. The possible presence of these viruses represents a risk for public health, as well as for animal conservation, especially for S. flavius which is a critically endangered species, facing high risk of extinction. © 2018 Blackwell Verlag GmbH.

  8. Review: A neglected Flavivirus: an update on Zika virus in 2016 and the future direction of research.

    Science.gov (United States)

    Bharucha, Tehmina; Breuer, Judith

    2016-06-01

    The 2015-16 global emergence of Zika virus infection (ZIKV) and its link with Guillain-Barré Syndrome and microcephaly, at the tail-end of the Ebola epidemic, has provoked unease throughout the international community. The World Health Organisation declared ZIKV a public health emergency on 1st February 2016, but until the 31st March 2016 maintained that there was insufficient evidence that ZIKV was independently responsible for any serious complications. Our current understanding of this arthropod-borne flavivirus is still at an early stage. The first reported human infections were 60 years ago, and until the first outbreak in Micronesia in 2007, there were only 14 documented cases. Nonetheless, there are parallels that we can draw from our understanding of other related arbo-flaviviruses, such as dengue, Japanese encephalitis and West Nile viruses. This article provides a focussed review of the literature on ZIKV to date, with perspectives on the direction of future research. © 2016 British Neuropathological Society.

  9. The Antigenic Structure of Zika Virus and Its Relation to Other Flaviviruses: Implications for Infection and Immunoprophylaxis

    Science.gov (United States)

    Stiasny, Karin

    2017-01-01

    SUMMARY Zika virus was discovered ∼70 years ago in Uganda and maintained a low profile as a human disease agent in Africa and Asia. Only recently has it caused explosive outbreaks in previously unaffected regions, first in Oceania and then in the Americas since 2015. Of special concern is the newly identified link between congenital malformations (especially microcephaly) and Zika virus infections during pregnancy. At present, it is unclear whether Zika virus changed its pathogenicity or whether the huge number of infections allowed the recognition of a previously cryptic pathogenic property. The purpose of this review is to discuss recent data on the molecular antigenic structure of Zika virus in the context of antibody-mediated neutralization and antibody-dependent enhancement (ADE) of infection, a phenomenon that has been implicated in the development of severe disease caused by the related dengue viruses. Emphasis is given to epitopes of antibodies that potently neutralize Zika virus and also to epitopes that provide antigenic links to other important human-pathogenic flaviviruses such as dengue, yellow fever, West Nile, Japanese encephalitis, and tick-borne encephalitis viruses. The antigenic cross talk between Zika and dengue viruses appears to be of special importance, since they cocirculate in many regions of endemicity and sequential infections are likely to occur frequently. New insights into the molecular antigenic structure of Zika virus and flaviviruses in general have provided the foundation for great progress made in developing Zika virus vaccines and antibodies for passive immunization. PMID:28179396

  10. Innate Immune Evasion Mediated by Flaviviridae Non-Structural Proteins.

    Science.gov (United States)

    Chen, Shun; Wu, Zhen; Wang, Mingshu; Cheng, Anchun

    2017-10-07

    Flaviviridae-caused diseases are a critical, emerging public health problem worldwide. Flaviviridae infections usually cause severe, acute or chronic diseases, such as liver damage and liver cancer resulting from a hepatitis C virus (HCV) infection and high fever and shock caused by yellow fever. Many researchers worldwide are investigating the mechanisms by which Flaviviridae cause severe diseases. Flaviviridae can interfere with the host's innate immunity to achieve their purpose of proliferation. For instance, dengue virus (DENV) NS2A, NS2B3, NS4A, NS4B and NS5; HCV NS2, NS3, NS3/4A, NS4B and NS5A; and West Nile virus (WNV) NS1 and NS4B proteins are involved in immune evasion. This review discusses the interplay between viral non-structural Flaviviridae proteins and relevant host proteins, which leads to the suppression of the host's innate antiviral immunity.

  11. Hepatitis C virus infection protein network.

    Science.gov (United States)

    de Chassey, B; Navratil, V; Tafforeau, L; Hiet, M S; Aublin-Gex, A; Agaugué, S; Meiffren, G; Pradezynski, F; Faria, B F; Chantier, T; Le Breton, M; Pellet, J; Davoust, N; Mangeot, P E; Chaboud, A; Penin, F; Jacob, Y; Vidalain, P O; Vidal, M; André, P; Rabourdin-Combe, C; Lotteau, V

    2008-01-01

    A proteome-wide mapping of interactions between hepatitis C virus (HCV) and human proteins was performed to provide a comprehensive view of the cellular infection. A total of 314 protein-protein interactions between HCV and human proteins was identified by yeast two-hybrid and 170 by literature mining. Integration of this data set into a reconstructed human interactome showed that cellular proteins interacting with HCV are enriched in highly central and interconnected proteins. A global analysis on the basis of functional annotation highlighted the enrichment of cellular pathways targeted by HCV. A network of proteins associated with frequent clinical disorders of chronically infected patients was constructed by connecting the insulin, Jak/STAT and TGFbeta pathways with cellular proteins targeted by HCV. CORE protein appeared as a major perturbator of this network. Focal adhesion was identified as a new function affected by HCV, mainly by NS3 and NS5A proteins.

  12. Flavivirus cross-reactivity in serological tests and Guillain-Barré syndrome in a hematopoietic stem cell transplant patient: A case report.

    Science.gov (United States)

    Raboni, Sonia M; Bonfim, Carmem; Almeida, Bernardo M; Zanluca, Camila; Koishi, Andrea C; Rodrigues, Paula R V P; Kay, Claudia K; Ribeiro, Lisandro L; Scola, Rosana H; Duarte Dos Santos, Claudia N

    2017-08-01

    Serological diagnosis of flavivirus infection is a challenge, particularly in the context of a disease associated with immune response enhancement in a transplant patient, where aspects such as previous flavivirus infections may be involved with the outcome. We report a case of a pediatric patient who developed Guillain-Barré syndrome (GBS) after matched-unrelated hematopoietic stem cell transplantation (HSCT). The patient lives in a Brazilian region that is experiencing an epidemic of Zika virus (ZIKV) and dengue virus (DENV). Because an increasing number of cases of GBS, likely triggered by ZIKV infection, are being reported in Brazil, samples from the patient were tested for both ZIKV and DENV infection. Serological assays strongly suggested a recent ZIKV infection, although infection by DENV or co-infection with both viruses cannot be ruled out. The presence of anti-DENV immunoglobulin-G in donor serum led to the hypothesis that antibodies from the donor could have enhanced the severity of the ZIKV infection. This hypothesis is in agreement with the recent findings that DENV sero-cross-reactivity drives antibody-dependent enhancement of ZIKV infection. These findings highlight the need for discussion of the indication to perform previous flavivirus tests in HSCT donors, especially in areas where ZIKV and other flaviviruses co-circulate. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil.

    Science.gov (United States)

    Romeiro, Marilia Farignoli; Souza, William Marciel de; Tolardo, Aline Lavado; Vieira, Luiz Carlos; Colombo, Tatiana Elias; Aquino, Victor Hugo; Nogueira, Maurício Lacerda; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) method for the diagnosis of the Flavivirus genus. We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA) transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410) of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  14. Revisiting the clinal concept of evolution and dispersal for the tick-borne flaviviruses by using phylogenetic and biogeographic analyses.

    Science.gov (United States)

    Heinze, D M; Gould, E A; Forrester, N L

    2012-08-01

    Tick-borne flaviviruses (TBF) are widely dispersed across Africa, Europe, Asia, Oceania, and North America, and some present a significant threat to human health. Seminal studies on tick-borne encephalitis viruses (TBEV), based on partial envelope gene sequences, predicted a westward clinal pattern of evolution and dispersal across northern Eurasia, terminating in the British Isles. We tested this hypothesis using all available full-length open reading frame (ORF) TBF sequences. Phylogenetic analysis was consistent with current reports. However, linear and nonlinear regression analysis of genetic versus geographic distance combined with BEAST analysis identified two separate clines, suggesting that TBEV spread both east and west from a central point. In addition, BEAST analysis suggested that TBF emerged and dispersed more than 16,000 years ago, significantly earlier than previously predicted. Thus, climatic and ecological changes may have played a greater role in TBF dispersal than humans.

  15. Perturbation in the Conserved Methyltransferase-Polymerase Interface of Flavivirus NS5 Differentially Affects Polymerase Initiation and Elongation

    Science.gov (United States)

    Wu, Jiqin; Lu, Guoliang; Zhang, Bo

    2014-01-01

    ABSTRACT The flavivirus NS5 is a natural fusion of a methyltransferase (MTase) and an RNA-dependent RNA polymerase (RdRP). Analogous to DNA-dependent RNA polymerases, the NS5 polymerase initiates RNA synthesis through a de novo mechanism and then makes a transition to a processive elongation phase. However, whether and how the MTase affects polymerase activities through intramolecular interactions remain elusive. By solving the crystal structure of the Japanese encephalitis virus (JEV) NS5, we recently identified an MTase-RdRP interface containing a set of six hydrophobic residues highly conserved among flaviviruses. To dissect the functional relevance of this interface, we made a series of JEV NS5 constructs with mutations of these hydrophobic residues and/or with the N-terminal first 261 residues and other residues up to the first 303 residues deleted. Compared to the wild-type (WT) NS5, full-length NS5 variants exhibited consistent up- or downregulation of the initiation activities in two types of polymerase assays. Five representative full-length NS5 constructs were then tested in an elongation assay, from which the apparent single-nucleotide incorporation rate constant was estimated. Interestingly, two constructs exhibited different elongation kinetics from the WT NS5, with an effect rather opposite to what was observed at initiation. Moreover, constructs with MTase and/or the linker region (residues 266 to 275) removed still retained polymerase activities, albeit at overall lower levels. However, further removal of the N-terminal extension (residues 276 to 303) abolished regular template-directed synthesis. Together, our data showed that the MTase-RdRP interface is relevant in both polymerase initiation and elongation, likely with different regulation mechanisms in these two major phases of RNA synthesis. IMPORTANCE The flavivirus NS5 is very unique in having a methyltransferase (MTase) placed on the immediate N terminus of its RNA-dependent RNA polymerase

  16. Discovery of (1R,5S)-N-[3-Amino-1-(cyclobutylmethyl)-2,3-dioxopropyl]- 3-[2(S)-[[[(1,1-dimethylethyl)amino]carbonyl]amino]-3,3-dimethyl-1-oxobutyl]- 6,6-dimethyl-3-azabicyclo[3.1.0]hexan-2(S)-carboxamide (SCH 503034), a Selective, Potent, Orally Bioavailable Hepatitis C Virus NS3 Protease Inhibitor: A Potential Therapeutic Agent for the Treatment of Hepatitis C Infection

    Energy Technology Data Exchange (ETDEWEB)

    Venkatraman, Srikanth; Bogen, Stephane L.; Arasappan, Ashok; Bennett, Frank; Chen, Kevin; Jao, Edwin; Liu, Yi-Tsung; Lovey, Raymond; Hendrata, Siska; Huang, Yuhua; Pan, Weidong; Parekh, Tejal; Pinto, Patrick; Popov, Veljko; Pike, Russel; Ruan, Sumei; Santhanam, Bama; Vibulbhan, Bancha; Wu, Wanli; Yang, Weiying; Kong, Jianshe; Liang, Xiang; Wong, Jesse; Liu, Rong; Butkiewicz, Nancy; Chase, Robert; Hart, Andrea; Agrawal, Sony; Ingravallo, Paul; Pichardo, John; Kong, Rong; Baroudy, Bahige; Malcolm, Bruce; Guo, Zhuyan; Prongay, Andrew; Madison, Vincent; Broske, Lisa; Cui, Xiaoming; Cheng, Kuo-Chi; Hsieh, Yunsheng; Brisson, Jean-Marc; Prelusky, Danial; Korfmacher, Walter; White, Ronald; Bogdanowich-Knipp, Susan; Pavlovsky, Anastasia; Bradley, Prudence; Saksena, Anil K.; Ganguly, Ashit; Piwinski, John; Girijavallabhan, Viyyoor; Njoroge, F. George (SPRI)

    2008-06-30

    Hepatitis C virus (HCV) infection is the major cause of chronic liver disease, leading to cirrhosis and hepatocellular carcinoma, which affects more than 170 million people worldwide. Currently the only therapeutic regimens are subcutaneous interferon-{alpha} or polyethylene glycol (PEG)-interferon-{alpha} alone or in combination with oral ribavirin. Although combination therapy is reasonably successful with the majority of genotypes, its efficacy against the predominant genotype (genotype 1) is moderate at best, with only about 40% of the patients showing sustained virological response. Herein, the SAR leading to the discovery of 70 (SCH 503034), a novel, potent, selective, orally bioavailable NS3 protease inhibitor that has been advanced to clinical trials in human beings for the treatment of hepatitis C viral infections is described. X-ray structure of inhibitor 70 complexed with the NS3 protease and biological data are also discussed.

  17. Scaling NS-3 DCE Experiments on Multi-Core Servers

    Science.gov (United States)

    2016-06-15

    access data that is resident in another core’s cache , for example a variable that is shared between threads, a cache coherency protocol comes into...play to ensure a consistent view of the data across the cores. This is sometimes called a ccNUMA ( cache - coherent NUMA) architecture, though the cc...prefix is often omitted because nearly all modern NUMA architectures incorporate cache coherency . 4. DCE OBSERVATIONS This section describes our

  18. Significance of monoclonal antibodies against the conserved epitopes within non-structural protein 3 helicase of hepatitis C virus.

    Directory of Open Access Journals (Sweden)

    Yixin Bian

    Full Text Available Nonstructural protein 3 (NS3 of hepatitis C virus (HCV, codes for protease and helicase carrying NTPase enzymatic activities, plays a crucial role in viral replication and an ideal target for diagnosis, antiviral therapy and vaccine development. In this study, monoclonal antibodies (mAbs to NS3 helicase were characterized by epitope mapping and biological function test. A total of 29 monoclonal antibodies were produced to the truncated NS3 helicase of HCV-1b (T1b-rNS3, aa1192-1459. Six mAbs recognized 8/29 16mer peptides, which contributed to identify 5 linear and 1 discontinuous putative epitope sequences. Seven mAbs reacted with HCV-2a JFH-1 infected Huh-7.5.1 cells by immunofluorescent staining, of which 2E12 and 3E5 strongly bound to the exposed linear epitope (1231PTGSGKSTK(1239 (EP05 or core motif (1373IPFYGKAI(1380 (EP21, respectively. Five other mAbs recognized semi-conformational or conformational epitopes of HCV helicase. MAb 2E12 binds to epitope EP05 at the ATP binding site of motif I in domain 1, while mAb 3E5 reacts with epitope EP21 close to helicase nucleotide binding region of domain 2. Epitope EP05 is totally conserved and EP21 highly conserved across HCV genotypes. These two epitope peptides reacted strongly with 59-79% chronic and weakly with 30-58% resolved HCV infected blood donors, suggesting that these epitopes were dominant in HCV infection. MAb 2E12 inhibited 50% of unwinding activity of NS3 helicase in vitro. Novel monoclonal antibodies recognize highly conserved epitopes at crucial functional sites within NS3 helicase, which may become important antibodies for diagnosis and antiviral therapy in chronic HCV infection.

  19. The live attenuated chimeric vaccine rWN/DEN4Δ30 is well-tolerated and immunogenic in healthy flavivirus-naïve adult volunteers.

    Science.gov (United States)

    Durbin, Anna P; Wright, Peter F; Cox, Amber; Kagucia, Wangeci; Elwood, Daniel; Henderson, Susan; Wanionek, Kimberli; Speicher, Jim; Whitehead, Stephen S; Pletnev, Alexander G

    2013-11-19

    WNV has become the leading vector-borne cause of meningoencephalitis in the United States. Although the majority of WNV infections result in asymptomatic illness, approximately 20% of infections result in West Nile fever and 1% in West Nile neuroinvasive disease (WNND), which causes encephalitis, meningitis, or flaccid paralysis. The elderly are at particular risk for WNND, with more than half the cases occurring in persons older than sixty years of age. There is no licensed treatment for WNND, nor is there any licensed vaccine for humans for the prevention of WNV infection. The Laboratory of Infectious Diseases at the National Institutes of Health has developed a recombinant live attenuated WNV vaccine based on chimerization of the wild-type WNV NY99 genome with that of the live attenuated DENV-4 candidate vaccine rDEN4Δ30. The genes encoding the prM and envelope proteins of DENV-4 were replaced with those of WNV NY99 and the resultant virus was designated rWN/DEN4Δ30. The vaccine was evaluated in healthy flavivirus-naïve adult volunteers age 18-50 years in two separate studies, both of which are reported here. The first study evaluated 10³ or 10⁴ PFU of the vaccine given as a single dose; the second study evaluated 10⁵ PFU of the vaccine given as two doses 6 months apart. The vaccine was well-tolerated and immunogenic at all three doses, inducing seroconversion to WNV NY99 in 74% (10³ PFU), 75% (10⁴ PFU), and 55% (10⁵ PFU) of subjects after a single dose. A second 10⁵ PFU dose of rWN/DEN4Δ30 given 6 months after the first dose increased the seroconversion rate 89%. Based on the encouraging results from these studies, further evaluation of the candidate vaccine in adults older than 50 years of age is planned. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Crystal structure of the Japanese encephalitis virus envelope protein.

    Science.gov (United States)

    Luca, Vincent C; AbiMansour, Jad; Nelson, Christopher A; Fremont, Daved H

    2012-02-01

    Japanese encephalitis virus (JEV) is the leading global cause of viral encephalitis. The JEV envelope protein (E) facilitates cellular attachment and membrane fusion and is the primary target of neutralizing antibodies. We have determined the 2.1-Å resolution crystal structure of the JEV E ectodomain refolded from bacterial inclusion bodies. The E protein possesses the three domains characteristic of flavivirus envelopes and epitope mapping of neutralizing antibodies onto the structure reveals determinants that correspond to the domain I lateral ridge, fusion loop, domain III lateral ridge, and domain I-II hinge. While monomeric in solution, JEV E assembles as an antiparallel dimer in the crystal lattice organized in a highly similar fashion as seen in cryo-electron microscopy models of mature flavivirus virions. The dimer interface, however, is remarkably small and lacks many of the domain II contacts observed in other flavivirus E homodimers. In addition, uniquely conserved histidines within the JEV serocomplex suggest that pH-mediated structural transitions may be aided by lateral interactions outside the dimer interface in the icosahedral virion. Our results suggest that variation in dimer structure and stability may significantly influence the assembly, receptor interaction, and uncoating of virions.

  1. An Approach for a Synthetic CTL Vaccine Design against Zika Flavivirus Using Class I and Class II Epitopes Identified by Computer Modeling

    OpenAIRE

    Cunha-Neto, Edecio; Rosa, Daniela S.; Harris, Paul E.; Olson, Tim; Morrow, Alex; Ciotlos, Serban; Herst, Charles V.; Rubsamen, Reid Martin

    2017-01-01

    The threat posed by severe congenital abnormalities related to Zika virus (ZKV) infection during pregnancy has turned development of a ZKV vaccine into an emergency. Recent work suggests that the cytotoxic T lymphocyte (CTL) response to infection is an important defense mechanism in response to ZKV. Here, we develop the rationale and strategy for a new approach to developing cytotoxic T lymphocyte (CTL) vaccines for ZKV flavivirus infection. The proposed approach is based on recent studies us...

  2. Limited cross-reactivity of mouse monoclonal antibodies against Dengue virus capsid protein among four serotypes

    Directory of Open Access Journals (Sweden)

    Noda M

    2012-11-01

    Full Text Available Megumi Noda,1 Promsin Masrinoul,1 Chaweewan Punkum,1 Chonlatip Pipattanaboon,2,3 Pongrama Ramasoota,2,4 Chayanee Setthapramote,2,3 Tadahiro Sasaki,6 Mikiko Sasayama,1 Akifumi Yamashita,1,5 Takeshi Kurosu,6 Kazuyoshi Ikuta,6 Tamaki Okabayashi11Mahidol-Osaka Center for Infectious Diseases, 2Center of Excellence for Antibody Research, 3Department of Microbiology and Immunology, 4Department of Social and Environmental Medicine, Faculty of Tropical Medicine, Mahidol University, Ratchathewi, Bangkok, Thailand; 5Graduate School of Life Science, Tohoku University, Sendai, Miyagi, 6Department of Virology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, JapanBackground: Dengue illness is one of the important mosquito-borne viral diseases in tropical and subtropical regions. Four serotypes of dengue virus (DENV-1, DENV-2, DENV-3, and DENV-4 are classified in the Flavivirus genus of the family Flaviviridae. We prepared monoclonal antibodies against DENV capsid protein from mice immunized with DENV-2 and determined the cross-reactivity with each serotype of DENV and Japanese encephalitis virus.Methods and results: To clarify the relationship between the cross-reactivity of monoclonal antibodies and the diversity of these viruses, we examined the situations of flaviviruses by analyses of phylogenetic trees. Among a total of 60 prepared monoclonal antibodies specific for DENV, five monoclonal antibodies stained the nuclei of infected cells and were found to be specific to the capsid protein. Three were specific to DENV-2, while the other two were cross-reactive with DENV-2 and DENV-4. No monoclonal antibodies were cross-reactive with all four serotypes. Phylogenetic analysis of DENV amino acid sequences of the capsid protein revealed that DENV-2 and DENV-4 were clustered in the same branch, while DENV-1 and DENV-3 were clustered in the other branch. However, these classifications of the capsid protein were different from those of the

  3. First isolation of Aedes flavivirus in the Western Hemisphere and evidence of vertical transmission in the mosquito Aedes (Stegomyia) albopictus (Diptera: Culicidae)

    Energy Technology Data Exchange (ETDEWEB)

    Haddow, Andrew D., E-mail: adhaddow@gmail.com [Institute for Human Infections and Immunity, Center for Emerging Infectious Diseases and Biodefense, Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Guzman, Hilda; Popov, Vsevolod L. [Institute for Human Infections and Immunity, Center for Emerging Infectious Diseases and Biodefense, Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Wood, Thomas G.; Widen, Steven G. [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Haddow, Alastair D. [Mercy Clinic, 2115 S. Fremont, Springfield, MO 65804 (United States); Tesh, Robert B.; Weaver, Scott C. [Institute for Human Infections and Immunity, Center for Emerging Infectious Diseases and Biodefense, Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States)

    2013-06-05

    We report here the first evidence of vertical transmission of Aedes flavivirus (AEFV) and its first isolation in the Western Hemisphere. AEFV strain SPFLD-MO-2011-MP6 was isolated in C6/36 cells from a pool of male Aedes albopictus mosquitoes that were reared to adults from larvae collected in southwest Missouri, USA, in 2011. Electron micrographs of the virus showed virions of approximately 45 nm in diameter with morphological characteristics associated with flaviviruses. The genomic sequence demonstrated that AEFV-SPFLD-MO-2011-MP6 shares a high degree of nucleotide and amino acid sequence identity with the AEFV Narita-21 strain, isolated in Japan in 2003. Intracerebral inoculation of newborn mice with the virus failed to produce observable illness or death and the virus did not replicate in vertebrate cells, consistent with a lack of vertebrate host range. - Highlights: ► The first report of Aedes flavivirus (AEFV) in the Western Hemisphere. ► The first evidence of vertical transmission of AEFV in mosquitoes. ► The first electron micrograph of AEFV. ► The first attempt to infect animals with AEFV.

  4. Real-World Experiences with the Combination Treatment of Ledipasvir plus Sofosbuvir for 12 Weeks in HCV Genotype 1-Infected Japanese Patients: Achievement of a Sustained Virological Response in Previous Users of Peginterferon plus Ribavirin with HCV NS3/4A Inhibitors.

    Science.gov (United States)

    Kanda, Tatsuo; Yasui, Shin; Nakamura, Masato; Suzuki, Eiichiro; Arai, Makoto; Ooka, Yoshihiko; Ogasawara, Sadahisa; Chiba, Tetsuhiro; Saito, Tomoko; Haga, Yuki; Takahashi, Koji; Sasaki, Reina; Wu, Shuang; Nakamoto, Shingo; Tawada, Akinobu; Maruyama, Hitoshi; Imazeki, Fumio; Kato, Naoya; Yokosuka, Osamu

    2017-04-25

    The aim of this study was to characterize the treatment response and serious adverse events of ledipasvir plus sofosbuvir therapies in Japanese patients infected with hepatitis C virus (HCV) genotype 1 (GT1). This retrospective study analyzed 240 Japanese HCV GT1 patients treated for 12 weeks with 90 mg of ledipasvir plus 400 mg of sofosbuvir daily. Sustained virological response at 12 weeks post-treatment (SVR12) was achieved in 236 of 240 (98.3%) patients. Among treatment-naïve patients, SVR12 was achieved in 136 of 138 (98.6%) patients, and among treatment-experienced patients, SVR12 was achieved in 100 of 102 (98.0%) patients. In patients previously treated with peginterferon plus ribavirin with various HCV NS3/4A inhibitors, 100% SVR rates (25/25) were achieved. Two relapsers had HCV NS5A resistance-associated variants (RAVs), but no HCV NS5B-S282 was observed after they relapsed. We experienced two patients with cardiac events during treatment. In conclusion, combination of ledipasvir plus sofosbuvir for 12 weeks is a potential therapy for HCV GT1 patients. Caution is needed for HCV NS5A RAVs, which were selected by HCV NS5A inhibitors and cardiac adverse events.

  5. Preliminary findings on Bagaza virus (Flavivirus: Flaviviridae growth kinetics, transmission potential & transovarial transmission in three species of mosquitoes

    Directory of Open Access Journals (Sweden)

    A B Sudeep

    2013-01-01

    Full Text Available Background & objectives: Bagaza virus (BAGV, a flavivirus synonymous with Israel turkey meningoencephalitis virus, has been found to circulate in India. BAGV has recently been held responsible for inducing febrile illness in humans and causing unusually high mortality to wild birds in Spain. A study was therefore, undertaken to determine its replication kinetics in certain mosquitoes and to determine vector competence and potential of the mosquitoes to transmit BAGV experimentally. Methods: Aedes aegypti, Culex tritaeniorhynchus and Cx quinquefasciatus mosquitoes were inoculated with BAGV; samples were harvested every day and titrated in BHK-21 cell line. Vector competence and experimental transmission were determined by examining the saliva of infected mosquitoes for virus and induction of sickness in suckling mice, respectively. Results: Cx. tritaeniorhynchus and Ae. aegypti mosquitoes yielded 5 log 10 and 4.67 log 10 TCID 50 /ml of virus on day 3 post-infection (PI, respectively while Cx. quinquefasciatus yielded a titre of 4 log 10 TCID 50 /ml on day 4 PI. BAGV was detected in saliva of all the infected mosquitoes demonstrating their vector competence. Experimental transmission of BAGV to infant mice as well as transovarial transmission was demonstrated by Cx. tritaeniorhynchus but not by Ae. aegypti and Cx. quinquefasciatus mosquitoes. Interpretation & conclusions: Replication of BAGV to high titres and dissemination to saliva in three most prevalent mosquitoes in India is of immense public health importance. Though no major outbreak involving man has been reported yet, BAGV has a potential to cause outbreaks in future.

  6. Neuro-invasion by a ‘Trojan Horse’ strategy and vasculopathy during intrauterine flavivirus infection

    Science.gov (United States)

    Bielefeldt-Ohmann, Helle; Smirnova, Natalia P; Tolnay, Airn-Elizabeth; Webb, Brett T; Antoniazzi, Alfredo Q; van Campen, Hana; Hansen, Thomas R

    2012-01-01

    The central nervous system (CNS) is a major target of several important human and animal viral pathogens causing congenital infections. However, despite the importance of neuropathological outcomes, for humans in particular, the pathogenesis, including mode of neuro-invasion, remains unresolved for most congenital virus infections. Using a natural model of congenital infection with an RNA virus, bovine viral diarrhoea virus in pregnant cattle, we sought to delineate the timing and mode of virus neuro-invasion of and spread within the brain of foetuses following experimental respiratory tract infection of the dams at day 75 of pregnancy, a time of maximal risk of tissue pathology without foetal death. Virus antigen was first detected in the foetal brains 14 days postinfection of dams and was initially restricted to amoeboid microglial cells in the periventricular germinal layer. The appearance of these cells was preceded by or concurrent with vasculopathy in the same region. While the affected microvessels were negative for virus antigen, they expressed high levels of the type I interferon-stimulated protein ISG15 and eventually disappeared in parallel with the appearance of microcavitary lesions. Subsequently, the virus spread to neurons and other glial cells. Our findings suggest that the virus enters the CNS via infected microglial precursors, the amoeboid microglial cells, in a ‘Trojan horse’ mode of invasion and that the microcavitary lesions are associated with loss of periventricular microvasculature, perhaps as a consequence of high, unrestricted induction of interferon-regulated proteins. PMID:22264283

  7. In vitro and in vivo studies identify important features of dengue virus pr-E protein interactions.

    Directory of Open Access Journals (Sweden)

    Aihua Zheng

    2010-10-01

    Full Text Available Flaviviruses bud into the endoplasmic reticulum and are transported through the secretory pathway, where the mildly acidic environment triggers particle rearrangement and allows furin processing of the prM protein to pr and M. The peripheral pr peptide remains bound to virus at low pH and inhibits virus-membrane interaction. Upon exocytosis, the release of pr at neutral pH completes virus maturation to an infectious particle. Together this evidence suggests that pr may shield the flavivirus fusion protein E from the low pH environment of the exocytic pathway. Here we developed an in vitro system to reconstitute the interaction of dengue virus (DENV pr with soluble truncated E proteins. At low pH recombinant pr bound to both monomeric and dimeric forms of E and blocked their membrane insertion. Exogenous pr interacted with mature infectious DENV and specifically inhibited virus fusion and infection. Alanine substitution of E H244, a highly conserved histidine residue in the pr-E interface, blocked pr-E interaction and reduced release of DENV virus-like particles. Folding, membrane insertion and trimerization of the H244A mutant E protein were preserved, and particle release could be partially rescued by neutralization of the low pH of the secretory pathway. Thus, pr acts to silence flavivirus fusion activity during virus secretion, and this function can be separated from the chaperone activity of prM. The sequence conservation of key residues involved in the flavivirus pr-E interaction suggests that this protein-protein interface may be a useful target for broad-spectrum inhibitors.

  8. The West Nile virus assembly process evades the conserved antiviral mechanism of the interferon-induced MxA protein

    Energy Technology Data Exchange (ETDEWEB)

    Hoenen, Antje [School of Chemistry and Molecular Biosciences, University of Queensland, Brisbane (Australia); Gillespie, Leah [Department of Microbiology, La Trobe University, Melbourne (Australia); Department of Microbiology and Immunology, University of Melbourne, Melbourne (Australia); Morgan, Garry; Heide, Peter van der [Institute for Molecular Bioscience, University of Queensland, Brisbane (Australia); Khromykh, Alexander [School of Chemistry and Molecular Biosciences, University of Queensland, Brisbane (Australia); Australian Infectious Diseases Research Centre, University of Queensland, Brisbane (Australia); Mackenzie, Jason, E-mail: jason.mackenzie@unimelb.edu.au [Department of Microbiology, La Trobe University, Melbourne (Australia); Department of Microbiology and Immunology, University of Melbourne, Melbourne (Australia)

    2014-01-05

    Flaviviruses have evolved means to evade host innate immune responses. Recent evidence suggests this is due to prevention of interferon production and signaling in flavivirus-infected cells. Here we show that the interferon-induced MxA protein can sequester the West Nile virus strain Kunjin virus (WNV{sub KUN}) capsid protein in cytoplasmic tubular structures in an expression-replication system. This sequestering resulted in reduced titers of secreted WNV{sub KUN} particles. We show by electron microscopy, tomography and 3D modeling that these cytoplasmic tubular structures form organized bundles. Additionally we show that recombinant ER-targeted MxA can restrict production of infectious WNV{sub KUN} under conditions of virus infection. Our results indicate a co-ordinated and compartmentalized WNV{sub KUN} assembly process may prevent recognition of viral components by MxA, particularly the capsid protein. This recognition can be exploited if MxA is targeted to intracellular sites of WNV{sub KUN} assembly. This results in further understanding of the mechanisms of flavivirus evasion from the immune system. - Highlights: • We show that the ISG MxA can recognize the West Nile virus capsid protein. • Interaction between WNV C protein and MxA induces cytoplasmic fibrils. • MxA can be retargeted to the ER to restrict WNV particle release. • WNV assembly process is a strategy to avoid MxA recognition.

  9. The West Nile virus assembly process evades the conserved antiviral mechanism of the interferon-induced MxA protein

    International Nuclear Information System (INIS)

    Hoenen, Antje; Gillespie, Leah; Morgan, Garry; Heide, Peter van der; Khromykh, Alexander; Mackenzie, Jason

    2014-01-01

    Flaviviruses have evolved means to evade host innate immune responses. Recent evidence suggests this is due to prevention of interferon production and signaling in flavivirus-infected cells. Here we show that the interferon-induced MxA protein can sequester the West Nile virus strain Kunjin virus (WNV KUN ) capsid protein in cytoplasmic tubular structures in an expression-replication system. This sequestering resulted in reduced titers of secreted WNV KUN particles. We show by electron microscopy, tomography and 3D modeling that these cytoplasmic tubular structures form organized bundles. Additionally we show that recombinant ER-targeted MxA can restrict production of infectious WNV KUN under conditions of virus infection. Our results indicate a co-ordinated and compartmentalized WNV KUN assembly process may prevent recognition of viral components by MxA, particularly the capsid protein. This recognition can be exploited if MxA is targeted to intracellular sites of WNV KUN assembly. This results in further understanding of the mechanisms of flavivirus evasion from the immune system. - Highlights: • We show that the ISG MxA can recognize the West Nile virus capsid protein. • Interaction between WNV C protein and MxA induces cytoplasmic fibrils. • MxA can be retargeted to the ER to restrict WNV particle release. • WNV assembly process is a strategy to avoid MxA recognition

  10. Neuro-invasion by a 'Trojan Horse' strategy and vasculopathy during intrauterine flavivirus infection.

    Science.gov (United States)

    Bielefeldt-Ohmann, Helle; Smirnova, Natalia P; Tolnay, Airn-Elizabeth; Webb, Brett T; Antoniazzi, Alfredo Q; van Campen, Hana; Hansen, Thomas R

    2012-02-01

    The central nervous system (CNS) is a major target of several important human and animal viral pathogens causing congenital infections. However, despite the importance of neuropathological outcomes, for humans in particular, the pathogenesis, including mode of neuro-invasion, remains unresolved for most congenital virus infections. Using a natural model of congenital infection with an RNA virus, bovine viral diarrhoea virus in pregnant cattle, we sought to delineate the timing and mode of virus neuro-invasion of and spread within the brain of foetuses following experimental respiratory tract infection of the dams at day 75 of pregnancy, a time of maximal risk of tissue pathology without foetal death. Virus antigen was first detected in the foetal brains 14 days postinfection of dams and was initially restricted to amoeboid microglial cells in the periventricular germinal layer. The appearance of these cells was preceded by or concurrent with vasculopathy in the same region. While the affected microvessels were negative for virus antigen, they expressed high levels of the type I interferon-stimulated protein ISG15 and eventually disappeared in parallel with the appearance of microcavitary lesions. Subsequently, the virus spread to neurons and other glial cells. Our findings suggest that the virus enters the CNS via infected microglial precursors, the amoeboid microglial cells, in a 'Trojan horse' mode of invasion and that the microcavitary lesions are associated with loss of periventricular microvasculature, perhaps as a consequence of high, unrestricted induction of interferon-regulated proteins. © 2012 The Authors. International Journal of Experimental Pathology © 2012 International Journal of Experimental Pathology.

  11. Transmission dynamics of an insect-specific flavivirus in a naturally infected Culex pipiens laboratory colony and effects of co-infection on vector competence for West Nile virus

    Science.gov (United States)

    Bolling, Bethany G.; Olea-Popelka, Francisco J.; Eisen, Lars; Moore, Chester G.; Blair, Carol D.

    2012-01-01

    We established a laboratory colony of Culex pipiens mosquitoes from eggs collected in Colorado and discovered that mosquitoes in the colony are naturally infected with Culex flavivirus (CxFV), an insect-specific flavivirus. In this study we examined transmission dynamics of CxFV and effects of persistent CxFV infection on vector competence for West Nile virus (WNV). We found that vertical transmission is the primary mechanism for persistence of CxFV in Cx. pipiens, with venereal transmission potentially playing a minor role. Vector competence experiments indicated possible early suppression of WNV replication by persistent CxFV infection in Cx. pipiens. This is the first description of insect-specific flavivirus transmission dynamics in a naturally infected mosquito colony and the observation of delayed dissemination of superinfecting WNV suggests that the presence of CxFV may impact the intensity of enzootic transmission of WNV and the risk of human exposure to this important pathogen. PMID:22425062

  12. Computer analysis of antigenic domains and RGD-like sequences (RGWG) in the E glycoprotein of flaviviruses: an approach to vaccine development.

    Science.gov (United States)

    Becker, Y

    1990-09-01

    Antigenic domains and RGD-like sequences in the E glycoprotein of the flaviviruses Japanese encephalitis virus, yellow fever virus, West Nile virus, dengue type 4 virus, and tick-borne encephalitis virus were analyzed by computer programs that provide information on the physical properties of the polypeptides. The use of computer programs for the development of vaccines based on the synthesis of antigenic peptides is discussed. Synthetic viral peptides are proposed to be used for topical application so as to interfere with the virus-cell interaction. Viral peptides with antigenic epitopes to protect against dengue virus infection without enhancing pathogenesis may also be developed on the basis of the computer analysis.

  13. Dengue Virus Infection of Aedes aegypti Requires a Putative Cysteine Rich Venom Protein.

    Directory of Open Access Journals (Sweden)

    Berlin Londono-Renteria

    2015-10-01

    Full Text Available Dengue virus (DENV is a mosquito-borne flavivirus that causes serious human disease and mortality worldwide. There is no specific antiviral therapy or vaccine for DENV infection. Alterations in gene expression during DENV infection of the mosquito and the impact of these changes on virus infection are important events to investigate in hopes of creating new treatments and vaccines. We previously identified 203 genes that were ≥5-fold differentially upregulated during flavivirus infection of the mosquito. Here, we examined the impact of silencing 100 of the most highly upregulated gene targets on DENV infection in its mosquito vector. We identified 20 genes that reduced DENV infection by at least 60% when silenced. We focused on one gene, a putative cysteine rich venom protein (SeqID AAEL000379; CRVP379, whose silencing significantly reduced DENV infection in Aedes aegypti cells. Here, we examine the requirement for CRVP379 during DENV infection of the mosquito and investigate the mechanisms surrounding this phenomenon. We also show that blocking CRVP379 protein with either RNAi or specific antisera inhibits DENV infection in Aedes aegypti. This work identifies a novel mosquito gene target for controlling DENV infection in mosquitoes that may also be used to develop broad preventative and therapeutic measures for multiple flaviviruses.

  14. The dengue virus NS5 protein as a target for drug discovery.

    Science.gov (United States)

    Lim, Siew Pheng; Noble, Christian G; Shi, Pei-Yong

    2015-07-01

    The non-structural protein 5 (NS5) of flaviviruses is the most conserved amongst the viral proteins. It is about 900 kDa and bears enzymatic activities that play vital roles in virus replication. Its N-terminal domain encodes dual N7 and 2'-O methyltransferase activities (MTase), and possibly guanylyltransferase (GTase) involved in RNA cap formation. The C-terminal region comprises a RNA-dependent RNA polymerase (RdRp) required for viral RNA synthesis. Both MTase and RdRp activities of dengue virus NS5 are well characterized, structurally and functionally. Numerous crystal structures of the flavivirus MTase and RdRp domains have been solved. Inhibitors of both functions have been identified through screening activities using biochemical and cell-based assays, as well as via rational design approaches. This review summaries the current knowledge as well as prospective views on these aspects. This article forms part of a symposium on flavivirus drug discovery in Antiviral Research. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Characterization of the GXXXG motif in the first transmembrane segment of Japanese encephalitis virus precursor membrane (prM protein

    Directory of Open Access Journals (Sweden)

    Wu Suh-Chin

    2010-05-01

    Full Text Available Abstract The interaction between prM and E proteins in flavivirus-infected cells is a major driving force for the assembly of flavivirus particles. We used site-directed mutagenesis to study the potential role of the transmembrane domains of the prM proteins of Japanese encephalitis virus (JEV in prM-E heterodimerization as well as subviral particle formation. Alanine insertion scanning mutagenesis within the GXXXG motif in the first transmembrane segment of JEV prM protein affected the prM-E heterodimerization; its specificity was confirmed by replacing the two glycines of the GXXXG motif with alanine, leucine and valine. The GXXXG motif was found to be conserved in the JEV serocomplex viruses but not other flavivirus groups. These mutants with alanine inserted in the two prM transmembrane segments all impaired subviral particle formation in cell cultures. The prM transmembrane domains of JEV may play importation roles in prM-E heterodimerization and viral particle assembly.

  16. Dengue Virus Type 2: Protein Binding and Active Replication in Human Central Nervous System Cells

    Directory of Open Access Journals (Sweden)

    Ma Isabel Salazar

    2013-01-01

    Full Text Available An increased number of dengue cases with neurological complications have been reported in recent years. The lack of reliable animal models for dengue has hindered studies on dengue virus (DENV pathogenesis and cellular tropism in vivo. We further investigate the tropism of DENV for the human central nervous system (CNS, characterizing DENV interactions with cell surface proteins in human CNS cells by virus overlay protein binding assays (VOPBA and coimmunoprecipitations. In VOPBA, three membrane proteins (60, 70, and 130 kDa from the gray matter bound the entire virus particle, whereas only a 70 kDa protein bound in white matter. The coimmunoprecipitation assays revealed three proteins from gray matter consistently binding virus particles, one clearly distinguishable protein (~32 kDa and two less apparent proteins (100 and 130 kDa. Monoclonal anti-NS3 targeted the virus protein in primary cell cultures of human CNS treated with DENV-2, which also stained positive for NeuH, a neuron-specific marker. Thus, our results indicate (1 that DENV-2 exhibited a direct tropism for human neurons and (2 that human neurons sustain an active DENV replication as was demonstrated by the presence of the NS3 viral antigen in primary cultures of these cells treated with DENV-2.

  17. Potential for Co-Infection of a Mosquito-Specific Flavivirus, Nhumirim Virus, to Block West Nile Virus Transmission in Mosquitoes

    Science.gov (United States)

    Goenaga, Silvina; Kenney, Joan L.; Duggal, Nisha K.; Delorey, Mark; Ebel, Gregory D.; Zhang, Bo; Levis, Silvana C.; Enria, Delia A.; Brault, Aaron C.

    2015-01-01

    Nhumirim virus (NHUV) is an insect-specific virus that phylogenetically affiliates with dual-host mosquito-borne flaviviruses. Previous in vitro co-infection experiments demonstrated prior or concurrent infection of Aedes albopictus C6/36 mosquito cells with NHUV resulted in a 10,000-fold reduction in viral production of West Nile virus (WNV). This interference between WNV and NHUV was observed herein in an additional Ae. albopictus mosquito cell line, C7-10. A WNV 2K peptide (V9M) mutant capable of superinfection with a pre-established WNV infection demonstrated a comparable level of interference from NHUV as the parental WNV strain in C6/36 and C7-10 cells. Culex quinquefasciatus and Culex pipiens mosquitoes intrathoracically inoculated with NHUV and WNV, or solely with WNV as a control, were allowed to extrinsically incubate the viruses up to nine and 14 days, respectively, and transmissibility and replication of WNV was determined. The proportion of Cx. quinquefasciatus mosquitoes capable of transmitting WNV was significantly lower for the WNV/NHUV group than the WNV control at seven and nine days post inoculation (dpi), while no differences were observed in the Cx. pipiens inoculation group. By dpi nine, a 40% reduction in transmissibility in mosquitoes from the dual inoculation group was observed compared to the WNV-only control. These data indicate the potential that infection of some Culex spp. vectors with NHUV could serve as a barrier for efficient transmissibility of flaviviruses associated with human disease. PMID:26569286

  18. Antiviral Properties of the Natural Polyphenols Delphinidin and Epigallocatechin Gallate against the Flaviviruses West Nile Virus, Zika Virus, and Dengue Virus.

    Science.gov (United States)

    Vázquez-Calvo, Ángela; Jiménez de Oya, Nereida; Martín-Acebes, Miguel A; Garcia-Moruno, Emilia; Saiz, Juan-Carlos

    2017-01-01

    The Flavivirus genus contains important pathogens, such as West Nile virus (WNV), Zika virus (ZIKV), and Dengue virus (DENV), which are enveloped plus-strand RNA viruses transmitted by mosquitoes and constitute a worrisome threat to global human and animal health. Currently no licensed drugs against them are available, being, thus, still necessary the search for effective antiviral molecules. In this line, a novel antiviral approach (economical, simple to use, and environmental friendly) is the use of natural compounds. Consequently, we have tested the antiviral potential of different polyphenols present in plants and natural products, such as wine and tea, against WNV, ZIKV, and DENV. So that, we assayed the effect of a panel of structurally related polyphenols [delphinidin (D), cyanidin (Cy), catechin (C), epicatechin (EC), epigallocatechin (EGC), and epigallocatechin gallate (EGCG)] on WNV infection, and found that D and EGCG inhibited more effectively the virus production. Further analysis with both compounds indicated that they mainly affected the attachment and entry steps of the virus life cycle. Moreover, D and EGCG showed a direct effect on WNV particles exerting a virucidal effect. We showed a similar inhibition of viral production of these compounds on WNV variants that differed on acidic pH requirements for viral fusion, indicating that their antiviral activity against WNV is produced by a virucidal effect rather than by an inhibition of pH-dependent viral fusion. Both polyphenols also reduced the infectivity of ZIKV and DENV. Therefore, D and EGCG impair the infectivity in cell culture of these three medically relevant flaviviruses.

  19. Safety and Immunogenicity of a Live Attenuated Tetravalent Dengue Vaccine Candidate in Flavivirus-Naive Adults: A Randomized, Double-Blinded Phase 1 Clinical Trial.

    Science.gov (United States)

    George, Sarah L; Wong, Mimi A; Dube, Tina J T; Boroughs, Karen L; Stovall, Janae L; Luy, Betty E; Haller, Aurelia A; Osorio, Jorge E; Eggemeyer, Linda M; Irby-Moore, Sharon; Frey, Sharon E; Huang, Claire Y-H; Stinchcomb, Dan T

    2015-10-01

    Dengue viruses (DENVs) infect >300 million people annually, causing 96 million cases of dengue disease and 22 000 deaths [1]. A safe vaccine that protects against DENV disease is a global health priority [2]. We enrolled 72 flavivirus-naive healthy adults in a phase 1 double-blinded, randomized, placebo-controlled dose-escalation trial (low and high dose) of a live attenuated recombinant tetravalent dengue vaccine candidate (TDV) given in 2 doses 90 days apart. Volunteers were followed for safety, vaccine component viremia, and development of neutralizing antibodies to the 4 DENV serotypes. The majority of adverse events were mild, with no vaccine-related serious adverse events. Vaccinees reported injection site pain (52% vs 17%) and erythema (73% vs 25%) more frequently than placebo recipients. Low levels of TDV-serotype 2 (TDV-2), TDV-3, and TDV-4 viremia were observed after the first but not second administration of vaccine. Overall seroconversion rates and geometric mean neutralization titers after 2 doses were 84.2% and 54.1, respectively, for DENV serotype 1 (DENV-1); 92.1% and 292.8, respectively, for DENV-2; 86.8% and 32.3, respectively, for DENV-3; and 71.1% and 15.0, respectively, for DENV-4. More than 90.0% of high-dose recipients had trivalent or broader responses. TDV was generally well tolerated, induced trivalent or broader neutralizing antibodies to DENV in most flavivirus-naive vaccinees, and is undergoing further development. NCT01110551. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Antiviral Properties of the Natural Polyphenols Delphinidin and Epigallocatechin Gallate against the Flaviviruses West Nile Virus, Zika Virus, and Dengue Virus

    Directory of Open Access Journals (Sweden)

    Ángela Vázquez-Calvo

    2017-07-01

    Full Text Available The Flavivirus genus contains important pathogens, such as West Nile virus (WNV, Zika virus (ZIKV, and Dengue virus (DENV, which are enveloped plus-strand RNA viruses transmitted by mosquitoes and constitute a worrisome threat to global human and animal health. Currently no licensed drugs against them are available, being, thus, still necessary the search for effective antiviral molecules. In this line, a novel antiviral approach (economical, simple to use, and environmental friendly is the use of natural compounds. Consequently, we have tested the antiviral potential of different polyphenols present in plants and natural products, such as wine and tea, against WNV, ZIKV, and DENV. So that, we assayed the effect of a panel of structurally related polyphenols [delphinidin (D, cyanidin (Cy, catechin (C, epicatechin (EC, epigallocatechin (EGC, and epigallocatechin gallate (EGCG] on WNV infection, and found that D and EGCG inhibited more effectively the virus production. Further analysis with both compounds indicated that they mainly affected the attachment and entry steps of the virus life cycle. Moreover, D and EGCG showed a direct effect on WNV particles exerting a virucidal effect. We showed a similar inhibition of viral production of these compounds on WNV variants that differed on acidic pH requirements for viral fusion, indicating that their antiviral activity against WNV is produced by a virucidal effect rather than by an inhibition of pH-dependent viral fusion. Both polyphenols also reduced the infectivity of ZIKV and DENV. Therefore, D and EGCG impair the infectivity in cell culture of these three medically relevant flaviviruses.

  1. A crystal structure of the Dengue virus NS5 protein reveals a novel inter-domain interface essential for protein flexibility and virus replication.

    Directory of Open Access Journals (Sweden)

    Yongqian Zhao

    2015-03-01

    Full Text Available Flavivirus RNA replication occurs within a replication complex (RC that assembles on ER membranes and comprises both non-structural (NS viral proteins and host cofactors. As the largest protein component within the flavivirus RC, NS5 plays key enzymatic roles through its N-terminal methyltransferase (MTase and C-terminal RNA-dependent-RNA polymerase (RdRp domains, and constitutes a major target for antivirals. We determined a crystal structure of the full-length NS5 protein from Dengue virus serotype 3 (DENV3 at a resolution of 2.3 Å in the presence of bound SAH and GTP. Although the overall molecular shape of NS5 from DENV3 resembles that of NS5 from Japanese Encephalitis Virus (JEV, the relative orientation between the MTase and RdRp domains differs between the two structures, providing direct evidence for the existence of a set of discrete stable molecular conformations that may be required for its function. While the inter-domain region is mostly disordered in NS5 from JEV, the NS5 structure from DENV3 reveals a well-ordered linker region comprising a short 310 helix that may act as a swivel. Solution Hydrogen/Deuterium Exchange Mass Spectrometry (HDX-MS analysis reveals an increased mobility of the thumb subdomain of RdRp in the context of the full length NS5 protein which correlates well with the analysis of the crystallographic temperature factors. Site-directed mutagenesis targeting the mostly polar interface between the MTase and RdRp domains identified several evolutionarily conserved residues that are important for viral replication, suggesting that inter-domain cross-talk in NS5 regulates virus replication. Collectively, a picture for the molecular origin of NS5 flexibility is emerging with profound implications for flavivirus replication and for the development of therapeutics targeting NS5.

  2. The interactomes of influenza virus NS1 and NS2 proteins identify new host factors and provide insights for ADAR1 playing a supportive role in virus replication.

    Science.gov (United States)

    de Chassey, Benoît; Aublin-Gex, Anne; Ruggieri, Alessia; Meyniel-Schicklin, Laurène; Pradezynski, Fabrine; Davoust, Nathalie; Chantier, Thibault; Tafforeau, Lionel; Mangeot, Philippe-Emmanuel; Ciancia, Claire; Perrin-Cocon, Laure; Bartenschlager, Ralf; André, Patrice; Lotteau, Vincent

    2013-01-01

    Influenza A NS1 and NS2 proteins are encoded by the RNA segment 8 of the viral genome. NS1 is a multifunctional protein and a virulence factor while NS2 is involved in nuclear export of viral ribonucleoprotein complexes. A yeast two-hybrid screening strategy was used to identify host factors supporting NS1 and NS2 functions. More than 560 interactions between 79 cellular proteins and NS1 and NS2 proteins from 9 different influenza virus strains have been identified. These interacting proteins are potentially involved in each step of the infectious process and their contribution to viral replication was tested by RNA interference. Validation of the relevance of these host cell proteins for the viral replication cycle revealed that 7 of the 79 NS1 and/or NS2-interacting proteins positively or negatively controlled virus replication. One of the main factors targeted by NS1 of all virus strains was double-stranded RNA binding domain protein family. In particular, adenosine deaminase acting on RNA 1 (ADAR1) appeared as a pro-viral host factor whose expression is necessary for optimal viral protein synthesis and replication. Surprisingly, ADAR1 also appeared as a pro-viral host factor for dengue virus replication and directly interacted with the viral NS3 protein. ADAR1 editing activity was enhanced by both viruses through dengue virus NS3 and influenza virus NS1 proteins, suggesting a similar virus-host co-evolution.

  3. The interactomes of influenza virus NS1 and NS2 proteins identify new host factors and provide insights for ADAR1 playing a supportive role in virus replication.

    Directory of Open Access Journals (Sweden)

    Benoît de Chassey

    Full Text Available Influenza A NS1 and NS2 proteins are encoded by the RNA segment 8 of the viral genome. NS1 is a multifunctional protein and a virulence factor while NS2 is involved in nuclear export of viral ribonucleoprotein complexes. A yeast two-hybrid screening strategy was used to identify host factors supporting NS1 and NS2 functions. More than 560 interactions between 79 cellular proteins and NS1 and NS2 proteins from 9 different influenza virus strains have been identified. These interacting proteins are potentially involved in each step of the infectious process and their contribution to viral replication was tested by RNA interference. Validation of the relevance of these host cell proteins for the viral replication cycle revealed that 7 of the 79 NS1 and/or NS2-interacting proteins positively or negatively controlled virus replication. One of the main factors targeted by NS1 of all virus strains was double-stranded RNA binding domain protein family. In particular, adenosine deaminase acting on RNA 1 (ADAR1 appeared as a pro-viral host factor whose expression is necessary for optimal viral protein synthesis and replication. Surprisingly, ADAR1 also appeared as a pro-viral host factor for dengue virus replication and directly interacted with the viral NS3 protein. ADAR1 editing activity was enhanced by both viruses through dengue virus NS3 and influenza virus NS1 proteins, suggesting a similar virus-host co-evolution.

  4. Structural, antigenic, and evolutionary characterizations of the envelope protein of newly emerging Duck Tembusu Virus.

    Directory of Open Access Journals (Sweden)

    Kexiang Yu

    Full Text Available Since the first reported cases of ducks infected with a previously unknown flavivirus in eastern China in April 2010, the virus, provisionally designated Duck Tembusu Virus (DTMUV, has spread widely in domestic ducks in China and caused significant economic losses to poultry industry. In this study, we examined in detail structural, antigenic, and evolutionary properties of envelope (E proteins of six DTMUV isolates spanning 2010-2012, each being isolated from individual farms with different geographical locations where disease outbreaks were documented. Structural analysis showed that E proteins of DTMUV and its closely related flavivirus (Japanese Encephalitis Virus shared a conserved array of predicted functional domains and motifs. Among the six DTMUV strains, mutations were observed only at thirteen amino acid positions across three separate domains of the E protein. Interestingly, these genetic polymorphisms resulted in no detectable change in viral neutralization properties as demonstrated in a serum neutralization assay. Furthermore, phylogenetic analysis of the nucleotide sequences of the E proteins showed that viruses evolved into two distinct genotypes, termed as DTMUV.I and DTMUV.II, with II emerging as the dominant genotype. New findings described here shall give insights into the antigenicity and evolution of this new pathogen and provide guidance for further functional studies of the E protein for which no effective vaccine has yet been developed.

  5. A gradient-free method for the purification of infective dengue virus for protein-level investigations.

    Science.gov (United States)

    Jensen, Stephanie M; Nguyen, Celina T; Jewett, John C

    2016-09-01

    Dengue virus (DENV) is a mosquito-transmitted flavivirus that infects approximately 100 million people annually. Multi-day protocols for purification of DENV reduce the infective titer due to viral sensitivity to both temperature and pH. Herein we describe a 5-h protocol for the purification of all DENV serotypes, utilizing traditional gradient-free ultracentrifugation followed by selective virion precipitation. This protocol allows for the separation of DENV from contaminating proteins - including intact C6/36 densovirus, for the production of infective virus at high concentration for protein-level analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Dengue and Zika viruses subvert reticulophagy by NS2B3-mediated cleavage of FAM134B.

    Science.gov (United States)

    Lennemann, Nicholas J; Coyne, Carolyn B

    2017-02-01

    The endoplasmic reticulum (ER) is exploited by several diverse viruses during their infectious life cycles. Flaviviruses, including dengue virus (DENV) and Zika virus (ZIKV), utilize the ER as a source of membranes to establish their replication organelles and to facilitate their assembly and eventual maturation along the secretory pathway. To maintain normal homeostasis, host cells have evolved highly efficient processes to dynamically regulate the ER, such as through reticulophagy, a selective form of autophagy that leads to ER degradation. Here, we identify the ER-localized reticulophagy receptor FAM134B as a host cell restriction factor for both DENV and ZIKV. We show that RNAi-mediated depletion of FAM134B significantly enhances both DENV and ZIKV replication at an early stage of the viral life cycle. Consistent with its role as an antiviral host factor, we found that several flaviviruses including DENV, ZIKV, and West Nile virus (WNV), utilize their NS3 virally-encoded proteases to directly cleave FAM134B at a single site within its reticulon homology domain (RHD). Mechanistically, we show that NS3-mediated cleavage of FAM134B blocks the formation of ER and viral protein-enriched autophagosomes, suggesting that the cleavage of FAM134B serves to specifically suppress the reticulophagy pathway. These findings thus point to an important role for FAM134B and reticulophagy in the regulation of flavivirus infection and suggest that these viruses specifically target these pathways to promote viral replication.

  7. Neurovirulent flavivirus can be attenuated in mice by incorporation of neuron-specific microRNA recognition elements into viral genome.

    Science.gov (United States)

    Yen, Li-Chen; Lin, Yi-Ling; Sung, Hsiang-Hsuan; Liao, Jia-Teh; Tsao, Chang-Huei; Su, Chih-Mao; Lin, Chih-Kung; Liao, Ching-Len

    2013-12-02

    Engineering viruses by inserting microRNA (miRNA) recognition elements (MREs) into the 3'-untranslated region (3'-UTR) of viral RNA can efficiently restrict viral tissue tropism. We used the mosquito-borne Japanese encephalitis virus (JEV) to investigate whether endogenous neuron-specific microRNA-124 (miR-124) could be used to restrict viral neurotropism and, consequently, diminish the neurovirulence of JEV in mice. To recover a neuron-restricted JEV, we inserted 2 copies of a perfectly matched MRE specific to miR-124 into the 3'-UTR to create infectious JEV recombinant RP-124PT (rRP-124PT). The effect of rRP-124PT was attenuated in infected mice as compared with MRE mutant and parental strains, both of which were lethal to challenged mice. Immunization with rRP-124PT appeared to elicit full protective immunity against subsequent JEV lethal challenge. We found neurons of the central nervous system critical targets for infection by JEV, which directly causes lethal encephalitis. The silencing of JEV rRP-124PT in mice by miR-124 illustrates that endogenous miRNA can readily recognize and interact with the 3'-UTR of naturally occurring genomic/mRNAs lacking a polyadenylated tail. Inserting MREs into viral RNA may facilitate further study of flaviviral pathogenesis involving tissue tropism and suggest an additional layer of biosafety for the rational design of safe flavivirus vaccines. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Silencing of neurotropic flavivirus replication in the central nervous system by combining multiple microRNA target insertions in two distinct viral genome regions

    Science.gov (United States)

    Teterina, Natalya L.; Liu, Guangping; Maximova, Olga A.; Pletnev, Alexander G.

    2014-01-01

    In recent years, microRNA-targeting has become an effective strategy for selective control of tissue-tropism and pathogenesis of both DNA and RNA viruses. Here, using a neurotropic flavivirus as a model, we demonstrate that simultaneous miRNA targeting of the viral genome in the open reading frame and 3′-noncoding regions for brain-expressed miRNAs had an additive effect and produced a more potent attenuation of the virus compared to separate targeting of those regions. Multiple miRNA co-targeting of these two distantly located regions completely abolished the virus neurotropism as no viral replication was detected in the developing brain of neonatal mice. Furthermore, no viral antigens were detected in neurons, and neuronal integrity in the brain of mice was well preserved. This miRNA co-targeting approach can be adapted for other viruses in order to minimize their replication in a cell- or tissue-type specific manner, but most importantly, to prevent virus escape from miRNA-mediated silencing. PMID:24889244

  9. Age affects quantity but not quality of antibody responses after vaccination with an inactivated flavivirus vaccine against tick-borne encephalitis.

    Directory of Open Access Journals (Sweden)

    Karin Stiasny

    Full Text Available The impairment of immune functions in the elderly (immunosenescence results in post-vaccination antibody titers that are significantly lower than in young individuals. It is, however, a controversial question whether also the quality of antibodies declines with age. In this study, we have therefore investigated the age-dependence of functional characteristics of antibody responses induced by vaccination with an inactivated flavivirus vaccine against tick-borne encephalitis (TBE. For this purpose, we quantified TBE virus-specific IgG and neutralizing antibody titers in post-vaccination sera from groups of young and elderly healthy adults and determined antibody avidities and NT/ELISA titer ratios (functional activity. In contrast to the quantitative impairment of antibody production in the elderly, we found no age-related differences in the avidity and functional activity of antibodies induced by vaccination, which also appeared to be independent of the age at primary immunization. There was no correlation between antibody avidity and NT/ELISA ratios suggesting that additional factors affect the quality of polyclonal responses, independent of age. Our work indicates that healthy elderly people are able to produce antibodies in response to vaccination with similar avidity and functional activity as young individuals, albeit at lower titers.

  10. VP2-serotyped live-attenuated bluetongue virus without NS3/NS3a expression provided serotype-specific protection and enables DIVA.

    NARCIS (Netherlands)

    Feenstra, F.; Maris-Veldhuis, M.A.; Daus, F.J.; Tacken, M.G.J.; Moormann, R.J.M.; Gennip, van H.G.P.; Rijn, van P.A.

    2014-01-01

    Bluetongue virus (BTV) causes Bluetongue in ruminants and is transmitted by Culicoides biting midges. Vaccination is the most effective measure to control vector borne diseases; however, there are 26 known BTV serotypes showing little cross protection. The BTV serotype is mainly determined by genome

  11. Interaction of Hepatitis C virus proteins with pattern recognition receptors

    Directory of Open Access Journals (Sweden)

    Imran Muhammad

    2012-06-01

    Full Text Available Abstract Hepatitis C virus (HCV is an important human pathogen that causes acute and chronic hepatitis, cirrhosis and hepatocellular carcinoma worldwide. This positive stranded RNA virus is extremely efficient in establishing persistent infection by escaping immune detection or hindering the host immune responses. Recent studies have discovered two important signaling pathways that activate the host innate immunity against viral infection. One of these pathways utilizes members of Toll-like receptor (TLR family and the other uses the RNA helicase retinoic acid inducible gene I (RIG-I as the receptors for intracellular viral double stranded RNA (dsRNA, and activation of transcription factors. In this review article, we summarize the interaction of HCV proteins with various host receptors/sensors through one of these two pathways or both, and how they exploit these interactions to escape from host defense mechanisms. For this purpose, we searched data from Pubmed and Google Scholar. We found that three HCV proteins; Core (C, non structural 3/4 A (NS3/4A and non structural 5A (NS5A have direct interactions with these two pathways. Core protein only in the monomeric form stimulates TLR2 pathway assisting the virus to evade from the innate immune system. NS3/4A disrupts TLR3 and RIG-1 signaling pathways by cleaving Toll/IL-1 receptor domain-containing adapter inducing IFN-beta (TRIF and Cardif, the two important adapter proteins of these signaling cascades respectively, thus halting the defense against HCV. NS5A downmodulates the expressions of NKG2D on natural killer cells (NK cells via TLR4 pathway and impairs the functional ability of these cells. TLRs and RIG-1 pathways have a central role in innate immunity and despite their opposing natures to HCV proteins, when exploited together, HCV as an ever developing virus against host immunity is able to accumulate these mechanisms for near unbeatable survival.

  12. Mean protein evolutionary distance: a method for comparative protein evolution and its application.

    Directory of Open Access Journals (Sweden)

    Michael J Wise

    Full Text Available Proteins are under tight evolutionary constraints, so if a protein changes it can only do so in ways that do not compromise its function. In addition, the proteins in an organism evolve at different rates. Leveraging the history of patristic distance methods, a new method for analysing comparative protein evolution, called Mean Protein Evolutionary Distance (MeaPED, measures differential resistance to evolutionary pressure across viral proteomes and is thereby able to point to the proteins' roles. Different species' proteomes can also be compared because the results, consistent across virus subtypes, concisely reflect the very different lifestyles of the viruses. The MeaPED method is here applied to influenza A virus, hepatitis C virus, human immunodeficiency virus (HIV, dengue virus, rotavirus A, polyomavirus BK and measles, which span the positive and negative single-stranded, doubled-stranded and reverse transcribing RNA viruses, and double-stranded DNA viruses. From this analysis, host interaction proteins including hemagglutinin (influenza, and viroporins agnoprotein (polyomavirus, p7 (hepatitis C and VPU (HIV emerge as evolutionary hot-spots. By contrast, RNA-directed RNA polymerase proteins including L (measles, PB1/PB2 (influenza and VP1 (rotavirus, and internal serine proteases such as NS3 (dengue and hepatitis C virus emerge as evolutionary cold-spots. The hot spot influenza hemagglutinin protein is contrasted with the related cold spot H protein from measles. It is proposed that evolutionary cold-spot proteins can become significant targets for second-line anti-viral therapeutics, in cases where front-line vaccines are not available or have become ineffective due to mutations in the hot-spot, generally more antigenically exposed proteins. The MeaPED package is available from www.pam1.bcs.uwa.edu.au/~michaelw/ftp/src/meaped.tar.gz.

  13. Oncogenic Potential of Hepatitis C Virus Proteins

    Directory of Open Access Journals (Sweden)

    Ranjit Ray

    2010-09-01

    Full Text Available Chronic hepatitis C virus (HCV infection is a major risk factor for liver disease progression, and may lead to cirrhosis and hepatocellular carcinoma (HCC. The HCV genome contains a single-stranded positive sense RNA with a cytoplasmic lifecycle. HCV proteins interact with many host-cell factors and are involved in a wide range of activities, including cell cycle regulation, transcriptional regulation, cell proliferation, apoptosis, lipid metabolism, and cell growth promotion. Increasing experimental evidences suggest that HCV contributes to HCC by modulating pathways that may promote malignant transformation of hepatocytes. At least four of the 10 HCV gene products, namely core, NS3, NS5A and NS5B play roles in several potentially oncogenic pathways. Induction of both endoplasmic reticulum (ER stress and oxidative stress by HCV proteins may also contribute to hepatocyte growth promotion. The current review identifies important functions of the viral proteins connecting HCV infections and potential for development of HCC. However, most of the putative transforming potentials of the HCV proteins have been defined in artificial cellular systems, and need to be established relevant to infection and disease models. The new insight into the mechanisms for HCV mediated disease progression may offer novel therapeutic targets for one of the most devastating human malignancies in the world today.

  14. Non-hemagglutinating flaviviruses: molecular mechanisms for the emergence of new strains via adaptation to European ticks.

    Directory of Open Access Journals (Sweden)

    Maxim A Khasnatinov

    2009-10-01

    Full Text Available Tick-borne encephalitis virus (TBEV causes human epidemics across Eurasia. Clinical manifestations range from inapparent infections and fevers to fatal encephalitis but the factors that determine disease severity are currently undefined. TBEV is characteristically a hemagglutinating (HA virus; the ability to agglutinate erythrocytes tentatively reflects virion receptor/fusion activity. However, for the past few years many atypical HA-deficient strains have been isolated from patients and also from the natural European host tick, Ixodes persulcatus. By analysing the sequences of HA-deficient strains we have identified 3 unique amino acid substitutions (D67G, E122G or D277A in the envelope protein, each of which increases the net charge and hydrophobicity of the virion surface. Therefore, we genetically engineered virus mutants each containing one of these 3 substitutions; they all exhibited HA-deficiency. Unexpectedly, each genetically modified non-HA virus demonstrated increased TBEV reproduction in feeding Ixodes ricinus, not the recognised tick host for these strains. Moreover, virus transmission efficiency between infected and uninfected ticks co-feeding on mice was also intensified by each substitution. Retrospectively, the mutation D67G was identified in viruses isolated from patients with encephalitis. We propose that the emergence of atypical Siberian HA-deficient TBEV strains in Europe is linked to their molecular adaptation to local ticks. This process appears to be driven by the selection of single mutations that change the virion surface thus enhancing receptor/fusion function essential for TBEV entry into the unfamiliar tick species. As the consequence of this adaptive mutagenesis, some of these mutations also appear to enhance the ability of TBEV to cross the human blood-brain barrier, a likely explanation for fatal encephalitis. Future research will reveal if these emerging Siberian TBEV strains continue to disperse westwards

  15. Membrane alterations induced by nonstructural proteins of human norovirus.

    Directory of Open Access Journals (Sweden)

    Sylvie Y Doerflinger

    2017-10-01

    Full Text Available Human noroviruses (huNoV are the most frequent cause of non-bacterial acute gastroenteritis worldwide, particularly genogroup II genotype 4 (GII.4 variants. The viral nonstructural (NS proteins encoded by the ORF1 polyprotein induce vesical clusters harboring the viral replication sites. Little is known so far about the ultrastructure of these replication organelles or the contribution of individual NS proteins to their biogenesis. We compared the ultrastructural changes induced by expression of norovirus ORF1 polyproteins with those induced upon infection with murine norovirus (MNV. Characteristic membrane alterations induced by ORF1 expression resembled those found in MNV infected cells, consisting of vesicle accumulations likely built from the endoplasmic reticulum (ER which included single membrane vesicles (SMVs, double membrane vesicles (DMVs and multi membrane vesicles (MMVs. In-depth analysis using electron tomography suggested that MMVs originate through the enwrapping of SMVs with tubular structures similar to mechanisms reported for picornaviruses. Expression of GII.4 NS1-2, NS3 and NS4 fused to GFP revealed distinct membrane alterations when analyzed by correlative light and electron microscopy. Expression of NS1-2 induced proliferation of smooth ER membranes forming long tubular structures that were affected by mutations in the active center of the putative NS1-2 hydrolase domain. NS3 was associated with ER membranes around lipid droplets (LDs and induced the formation of convoluted membranes, which were even more pronounced in case of NS4. Interestingly, NS4 was the only GII.4 protein capable of inducing SMV and DMV formation when expressed individually. Our work provides the first ultrastructural analysis of norovirus GII.4 induced vesicle clusters and suggests that their morphology and biogenesis is most similar to picornaviruses. We further identified NS4 as a key factor in the formation of membrane alterations of huNoV and

  16. A single dose of any of four different live attenuated tetravalent dengue vaccines is safe and immunogenic in flavivirus-naive adults: a randomized, double-blind clinical trial.

    Science.gov (United States)

    Durbin, Anna P; Kirkpatrick, Beth D; Pierce, Kristen K; Elwood, Daniel; Larsson, Catherine J; Lindow, Janet C; Tibery, Cecilia; Sabundayo, Beulah P; Shaffer, Donna; Talaat, Kawsar R; Hynes, Noreen A; Wanionek, Kimberli; Carmolli, Marya P; Luke, Catherine J; Murphy, Brian R; Subbarao, Kanta; Whitehead, Stephen S

    2013-03-15

    Dengue virus (DENV) causes hundreds of millions of infections annually. Four dengue serotypes exist, and previous infection with one serotype increases the likelihood of severe disease with a second, heterotypic DENV infection. In a randomized, placebo-controlled study, the safety and immunogenicity of 4 different admixtures of a live attenuated tetravalent (LATV) dengue vaccine were evaluated in 113 flavivirus-naive adults. Serum neutralizing antibody levels to all 4 dengue viruses were measured on days 0, 28, 42, and 180. A single dose of each LATV admixture induced a trivalent or better neutralizing antibody response in 75%-90% of vaccinees. There was no significant difference in the incidence of adverse events between vaccinees and placebo-recipients other than rash. A trivalent or better response correlated with rash and with non-black race (P vaccine viremia. TV003 induced a trivalent or greater antibody response in 90% of flavivirus-naive vaccinees and is a promising candidate for the prevention of dengue. Race was identified as a factor influencing the infectivity of the LATV viruses, reflecting observations of the effect of race on disease severity in natural dengue infection.

  17. Use of synthetic peptides to represent surface-exposed epitopes defined by neutralizing dengue complex- and flavivirus group-reactive monoclonal antibodies on the native dengue type-2 virus envelope glycoprotein.

    Science.gov (United States)

    Falconar, Andrew K I

    2008-07-01

    The reactions of neutralizing monoclonal antibodies (mAbs) that defined dengue virus (DENV) complex, flavivirus subgroup or group neutralizing epitopes were tested against synthetic peptide sequences from domains I, II and III of the envelope (E) glycoproteins of different DENV-2 genotypes/strains. The DENV complex-reactive mAb identified the surface-exposed 304-GKFKV/IVKEIA-313 peptides and the DENV complex-conserved 393-KKGSSIGQ/KM-401 peptides in domain III, which were located adjacently in the native glycoprotein. Both flavivirus group-reactive mAbs reacted most strongly with fusion sequence peptides from domain II when they contained a cysteine (C) by glycine (G) substitution (underlined) (101-WGNGGGLFG-109) to represent the native rotated C side chain. The 393-401 sequence represents a newly identified epitope, present as a highly flexible coil located between the 385 and 393 cell-binding sequence and the 401 and 413 sequence involved in the E glycoprotein homo-trimer formation. The 101-109 sequence containing 105-C by G substitution and the 393-401 sequence are good candidates for diagnostic assays and cross-protection experiments.

  18. Immunogenicity of a purified fragment of 17D yellow fever envelope protein.

    Science.gov (United States)

    Brandriss, M W; Schlesinger, J J; Walsh, E E

    1990-06-01

    Information on the immunogenic properties of purified flavivirus proteins may be useful in the development of recombinant or synthetic peptide vaccines. Using a monoclonal antibody, an attempt was made to purify the envelope (E) protein of 17D yellow fever virus (17D YF) by affinity chromatography. The purified material could not be identified as intact E protein but it did bear antigenic determinants of E as determined by selective reactivity with anti-E monoclonal antibodies. Rabbits immunized with this material produced antibodies that neutralized 17D YF and dengue-2 viruses in comparable titers, indicating that cross-reactive antigenic determinants were preserved. Immunization of mice resulted in protection against intracerebral challenge with 17D YF.

  19. The C Terminus of the Core β-Ladder Domain in Japanese Encephalitis Virus Nonstructural Protein 1 Is Flexible for Accommodation of Heterologous Epitope Fusion.

    Science.gov (United States)

    Yen, Li-Chen; Liao, Jia-Teh; Lee, Hwei-Jen; Chou, Wei-Yuan; Chen, Chun-Wei; Lin, Yi-Ling; Liao, Ching-Len

    2016-02-01

    NS1 is the only nonstructural protein that enters the lumen of the endoplasmic reticulum (ER), where NS1 is glycosylated, forms a dimer, and is subsequently secreted during flavivirus replication as dimers or hexamers, which appear to be highly immunogenic to the infected host, as protective immunity can be elicited against homologous flavivirus infections. Here, by using a trans-complementation assay, we identified the C-terminal end of NS1 derived from Japanese encephalitis virus (JEV), which was more flexible than other regions in terms of housing foreign epitopes without a significant impact on virus replication. This mapped flexible region is located in the conserved tip of the core β-ladder domain of the multimeric NS1 structure and is also known to contain certain linear epitopes, readily triggering specific antibody responses from the host. Despite becoming attenuated, recombinant JEV with insertion of a neutralizing epitope derived from enterovirus 71 (EV71) into the C-terminal end of NS1 not only could be normally released from infected cells, but also induced dual protective immunity for the host to counteract lethal challenge with either JEV or EV71 in neonatal mice. These results indicated that the secreted multimeric NS1 of flaviviruses may serve as a natural protein carrier to render epitopes of interest more immunogenic in the C terminus of the core β-ladder domain. The positive-sense RNA genomes of mosquito-borne flaviviruses appear to be flexible in terms of accommodating extra insertions of short heterologous antigens into their virus genes. Here, we illustrate that the newly identified C terminus of the core β-ladder domain in NS1 could be readily inserted into entities such as EV71 epitopes, and the resulting NS1-epitope fusion proteins appeared to maintain normal virus replication, secretion ability, and multimeric formation from infected cells. Nonetheless, such an insertion attenuated the recombinant JEV in mice, despite having retained

  20. Scalability analysis of large-scale LoRaWAN networks in ns-3

    OpenAIRE

    Abeele, Floris Van den; Haxhibeqiri, Jetmir; Moerman, Ingrid; Hoebeke, Jeroen

    2017-01-01

    As LoRaWAN networks are actively being deployed in the field, it is important to comprehend the limitations of this Low Power Wide Area Network technology. Previous work has raised questions in terms of the scalability and capacity of LoRaWAN networks as the number of end devices grows to hundreds or thousands per gateway. Some works have modeled LoRaWAN networks as pure ALOHA networks, which fails to capture important characteristics such as the capture effect and the effects of interference...

  1. Molecular dynamic simulation of complex NS2B-NS3 DENV2 ...

    African Journals Online (AJOL)

    The pathogenic dengue virus (DV) is a growing global threat for which there is no specific treatment and prevention. Several vaccines have been developed against the disease, but they only prevent the disease and reduce the risk of death. Consequently, the antiviral drug becomes the most powerful treatment to solve this ...

  2. Molecular basis for specific viral RNA recognition and 2'-O-ribose methylation by the dengue virus nonstructural protein 5 (NS5).

    Science.gov (United States)

    Zhao, Yongqian; Soh, Tingjin Sherryl; Lim, Siew Pheng; Chung, Ka Yan; Swaminathan, Kunchithapadam; Vasudevan, Subhash G; Shi, Pei-Yong; Lescar, Julien; Luo, Dahai

    2015-12-01

    Dengue virus (DENV) causes several hundred million human infections and more than 20,000 deaths annually. Neither an efficacious vaccine conferring immunity against all four circulating serotypes nor specific drugs are currently available to treat this emerging global disease. Capping of the DENV RNA genome is an essential structural modification that protects the RNA from degradation by 5' exoribonucleases, ensures efficient expression of viral proteins, and allows escape from the host innate immune response. The large flavivirus nonstructural protein 5 (NS5) (105 kDa) has RNA methyltransferase activities at its N-terminal region, which is responsible for capping the virus RNA genome. The methyl transfer reactions are thought to occur sequentially using the strictly conserved flavivirus 5' RNA sequence as substrate (GpppAG-RNA), leading to the formation of the 5' RNA cap: G0pppAG-RNA → (m7)G0pppAG-RNA ("cap-0")→(m7)G0pppAm2'-O-G-RNA ("cap-1"). To elucidate how viral RNA is specifically recognized and methylated, we determined the crystal structure of a ternary complex between the full-length NS5 protein from dengue virus, an octameric cap-0 viral RNA substrate bearing the authentic DENV genomic sequence (5'-(m7)G0pppA1G2U3U4G5U6U7-3'), and S-adenosyl-l-homocysteine (SAH), the by-product of the methylation reaction. The structure provides for the first time, to our knowledge, a molecular basis for specific adenosine 2'-O-methylation, rationalizes mutagenesis studies targeting the K61-D146-K180-E216 enzymatic tetrad as well as residues lining the RNA binding groove, and offers previously unidentified mechanistic and evolutionary insights into cap-1 formation by NS5, which underlies innate immunity evasion by flaviviruses.

  3. A Physical Interaction Network of Dengue Virus and Human Proteins*

    Science.gov (United States)

    Khadka, Sudip; Vangeloff, Abbey D.; Zhang, Chaoying; Siddavatam, Prasad; Heaton, Nicholas S.; Wang, Ling; Sengupta, Ranjan; Sahasrabudhe, Sudhir; Randall, Glenn; Gribskov, Michael; Kuhn, Richard J.; Perera, Rushika; LaCount, Douglas J.

    2011-01-01

    Dengue virus (DENV), an emerging mosquito-transmitted pathogen capable of causing severe disease in humans, interacts with host cell factors to create a more favorable environment for replication. However, few interactions between DENV and human proteins have been reported to date. To identify DENV-human protein interactions, we used high-throughput yeast two-hybrid assays to screen the 10 DENV proteins against a human liver activation domain library. From 45 DNA-binding domain clones containing either full-length viral genes or partially overlapping gene fragments, we identified 139 interactions between DENV and human proteins, the vast majority of which are novel. These interactions involved 105 human proteins, including six previously implicated in DENV infection and 45 linked to the replication of other viruses. Human proteins with functions related to the complement and coagulation cascade, the centrosome, and the cytoskeleton were enriched among the DENV interaction partners. To determine if the cellular proteins were required for DENV infection, we used small interfering RNAs to inhibit their expression. Six of 12 proteins targeted (CALR, DDX3X, ERC1, GOLGA2, TRIP11, and UBE2I) caused a significant decrease in the replication of a DENV replicon. We further showed that calreticulin colocalized with viral dsRNA and with the viral NS3 and NS5 proteins in DENV-infected cells, consistent with a direct role for calreticulin in DENV replication. Human proteins that interacted with DENV had significantly higher average degree and betweenness than expected by chance, which provides additional support for the hypothesis that viruses preferentially target cellular proteins that occupy central position in the human protein interaction network. This study provides a valuable starting point for additional investigations into the roles of human proteins in DENV infection. PMID:21911577

  4. A physical interaction network of dengue virus and human proteins.

    Science.gov (United States)

    Khadka, Sudip; Vangeloff, Abbey D; Zhang, Chaoying; Siddavatam, Prasad; Heaton, Nicholas S; Wang, Ling; Sengupta, Ranjan; Sahasrabudhe, Sudhir; Randall, Glenn; Gribskov, Michael; Kuhn, Richard J; Perera, Rushika; LaCount, Douglas J

    2011-12-01

    Dengue virus (DENV), an emerging mosquito-transmitted pathogen capable of causing severe disease in humans, interacts with host cell factors to create a more favorable environment for replication. However, few interactions between DENV and human proteins have been reported to date. To identify DENV-human protein interactions, we used high-throughput yeast two-hybrid assays to screen the 10 DENV proteins against a human liver activation domain library. From 45 DNA-binding domain clones containing either full-length viral genes or partially overlapping gene fragments, we identified 139 interactions between DENV and human proteins, the vast majority of which are novel. These interactions involved 105 human proteins, including six previously implicated in DENV infection and 45 linked to the replication of other viruses. Human proteins with functions related to the complement and coagulation cascade, the centrosome, and the cytoskeleton were enriched among the DENV interaction partners. To determine if the cellular proteins were required for DENV infection, we used small interfering RNAs to inhibit their expression. Six of 12 proteins targeted (CALR, DDX3X, ERC1, GOLGA2, TRIP11, and UBE2I) caused a significant decrease in the replication of a DENV replicon. We further showed that calreticulin colocalized with viral dsRNA and with the viral NS3 and NS5 proteins in DENV-infected cells, consistent with a direct role for calreticulin in DENV replication. Human proteins that interacted with DENV had significantly higher average degree and betweenness than expected by chance, which provides additional support for the hypothesis that viruses preferentially target cellular proteins that occupy central position in the human protein interaction network. This study provides a valuable starting point for additional investigations into the roles of human proteins in DENV infection.

  5. Tick-Borne Langat/Mosquito-Borne Dengue Flavivirus Chimera, a Candidate Live Attenuated Vaccine for Protection against Disease Caused by Members of the Tick-Borne Encephalitis Virus Complex: Evaluation in Rhesus Monkeys and in Mosquitoes

    Science.gov (United States)

    Pletnev, Alexander G.; Bray, Michael; Hanley, Kathryn A.; Speicher, Jim; Elkins, Randy

    2001-01-01

    Langat virus (LGT), strain TP21, a naturally avirulent tick-borne flavivirus, was used to construct a chimeric candidate virus vaccine which contained LGT genes for premembrane (preM) and envelope (E) glycoprotein and all other sequences derived from dengue type 4 virus (DEN4). The live virus vaccine was developed to provide resistance to the highly virulent, closely related tick-borne flaviviruses that share protective E epitopes among themselves and with LGT. Toward that end the chimera, initially recovered in mosquito cells, was adapted to grow to high titer in qualified simian Vero cells. When inoculated intraperitoneally (i.p.), the Vero cell-adapted LGT TP21/DEN4 chimera remained completely attenuated for SCID mice. Significantly, the chimera protected immunocompetent mice against the most virulent tick-borne encephalitis virus (TBEV). Subsequently, rhesus monkeys were immunized in groups of 4 with 105 or 107 PFU of LGT strain TP21, with 105 PFU of DEN4, or with 103, 105, or 107 PFU of the chimera. Each of the monkeys inoculated with DEN4 or LGT TP21 became viremic, and the duration of viremia ranged from 1 to 5 days. In contrast, viremia was detected in only 1 of 12 monkeys inoculated with the LGT TP21/DEN4 chimera; in this instance the level of viremia was at the limit of detection. All monkeys immunized with the chimera or LGT TP21 virus developed a moderate to high level of neutralizing antibodies against LGT TP21 as well as TBEV and were completely protected against subsequent LGT TP21 challenge, whereas monkeys previously immunized with DEN4 virus became viremic when challenged with LGT TP21. These observations suggest that the chimera is attenuated, immunogenic, and able to induce a protective immune response. Furthermore, passive transfer of serum from monkeys immunized with chimera conferred significant protection to mice subsequently challenged with 100 i.p. 50% lethal doses of the highly virulent TBEV. The issue of transmissibility of the chimera

  6. An External Loop Region of Domain III of Dengue Virus Type 2 Envelope Protein Is Involved in Serotype-Specific Binding to Mosquito but Not Mammalian Cells

    OpenAIRE

    Hung, Jan-Jong; Hsieh, Meng-Ti; Young, Ming-Jer; Kao, Chuan-Liang; King, Chwan-Chuen; Chang, Wen

    2004-01-01

    Dengue virus (DV) is a flavivirus and infects mammalian cells through mosquito vectors. This study investigates the roles of domain III of DV type 2 envelope protein (EIII) in DV binding to the host cell. Recombinant EIII interferes with DV infection to BHK21 and C6/36 cells by blocking dengue virion adsorption to these cells. Inhibition of EIII on BHK21 cells was broad with no serotype specificity; however, inhibition of EIII on C6/36 cells was relatively serotype specific. Soluble heparin c...

  7. Safety and immunogenicity of a recombinant live attenuated tetravalent dengue vaccine (DENVax) in flavivirus-naive healthy adults in Colombia: a randomised, placebo-controlled, phase 1 study

    Science.gov (United States)

    Osorio, Jorge E; Velez, Ivan D; Thomson, Cynthia; Lopez, Liliana; Jimenez, Alejandra; Haller, Aurelia A; Silengo, Shawn; Scott, Jaclyn; Boroughs, Karen L; Stovall, Janae L; Luy, Betty E; Arguello, John; Beatty, Mark E; Santangelo, Joseph; Gordon, Gilad S; Huang, Claire Y-H; Stinchcomb, Dan T

    2015-01-01

    %) participants assigned to receive placebo. Both formulations were well tolerated with mostly mild and transient local or systemic reactions. No clinically meaningful differences were recorded in the overall incidence of local and systemic adverse events between patients in the vaccine and placebo groups; 68 (86%) of 79 participants in the vaccine groups had solicited systemic adverse events compared with 13 (76%) of 17 of those in the placebo groups. By contrast, 67 participants (85%) in the vaccine group had local solicited reactions compared with five (29%) participants in the placebo group. Immunisation with either high-dose or low-dose DENVax formulations induced neutralising antibody responses to all four dengue virus serotypes; 30 days after the second dose, 47 (62%) of 76 participants given vaccine seroconverted to all four serotypes and 73 (96%) participants seroconverted to three or more dengue viruses. Infectious DENVax viruses were detected in only ten (25%) of 40 participants in the low-dose group and 13 (33%) of 39 participants in the high-dose group. Interpretation Our findings emphasise the acceptable tolerability and immunogenicity of the tetravalent DENVax formulations in healthy, flavivirus-naive adults. Further clinical testing of DENVax in different age groups and in dengue-endemic areas is warranted. Funding Takeda Vaccines. PMID:25087476

  8. Protein Foods

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Protein Foods Foods high in protein such as fish, ... for the vegetarian proteins, whether they have carbohydrate. Protein Choices Plant-Based Proteins Plant-based protein foods ...

  9. Identification of novel target sites and an inhibitor of the dengue virus E protein

    Science.gov (United States)

    Yennamalli, Ragothaman; Subbarao, Naidu; Kampmann, Thorsten; McGeary, Ross P.; Young, Paul R.; Kobe, Bostjan

    2009-06-01

    Dengue and related flaviviruses represent a significant global health threat. The envelope glycoprotein E mediates virus attachment to a host cell and the subsequent fusion of viral and host cell membranes. The fusion process is driven by conformational changes in the E protein and is an essential step in the virus life cycle. In this study, we analyzed the pre-fusion and post-fusion structures of the dengue virus E protein to identify potential novel sites that could bind small molecules, which could interfere with the conformational transitions that mediate the fusion process. We used an in silico virtual screening approach combining three different docking algorithms (DOCK, GOLD and FlexX) to identify compounds that are likely to bind to these sites. Seven structurally diverse molecules were selected to test experimentally for inhibition of dengue virus propagation. The best compound showed an IC50 in the micromolar range against dengue virus type 2.

  10. Quantitative Proteomic Analysis of Mosquito C6/36 Cells Reveals Host Proteins Involved in Zika Virus Infection.

    Science.gov (United States)

    Xin, Qi-Lin; Deng, Cheng-Lin; Chen, Xi; Wang, Jun; Wang, Shao-Bo; Wang, Wei; Deng, Fei; Zhang, Bo; Xiao, Gengfu; Zhang, Lei-Ke

    2017-06-15

    Zika virus (ZIKV) is an emerging arbovirus belonging to the genus Flavivirus of the family Flaviviridae During replication processes, flavivirus manipulates host cell systems to facilitate its replication, while the host cells activate antiviral responses. Identification of host proteins involved in the flavivirus replication process may lead to the discovery of antiviral targets. The mosquitoes Aedes aegypti and Aedes albopictus are epidemiologically important vectors for ZIKV, and effective restrictions of ZIKV replication in mosquitoes will be vital in controlling the spread of virus. In this study, an iTRAQ-based quantitative proteomic analysis of ZIKV-infected Aedes albopictus C6/36 cells was performed to investigate host proteins involved in the ZIKV infection process. A total of 3,544 host proteins were quantified, with 200 being differentially regulated, among which CHCHD2 can be upregulated by ZIKV infection in both mosquito C6/36 and human HeLa cells. Our further study indicated that CHCHD2 can promote ZIKV replication and inhibit beta interferon (IFN-β) production in HeLa cells, suggesting that ZIKV infection may upregulate CHCHD2 to inhibit IFN-I production and thus promote virus replication. Bioinformatics analysis of regulated host proteins highlighted several ZIKV infection-regulated biological processes. Further study indicated that the ubiquitin proteasome system (UPS) plays roles in the ZIKV entry process and that an FDA-approved inhibitor of the 20S proteasome, bortezomib, can inhibit ZIKV infection in vivo Our study illustrated how host cells respond to ZIKV infection and also provided a candidate drug for the control of ZIKV infection in mosquitoes and treatment of ZIKV infection in patients. IMPORTANCE ZIKV infection poses great threats to human health, and there is no FDA-approved drug available for the treatment of ZIKV infection. During replication, ZIKV manipulates host cell systems to facilitate its replication, while host cells activate

  11. Inhibition of Hepatitis C virus (HCV Core protein- induced Cell Growth by Non-structural Protein 4A (NS4A is Mediated by Mitochondrial Dysregulation

    Directory of Open Access Journals (Sweden)

    Denis Selimović

    2008-02-01

    Full Text Available Hepatitis C virus (HCV is a significant health problem facing the world. More than 170 million people are infected with HCV worldwide. HCV encodes a large polyprotein precursor that is processed into at least 10 distinct products including structural (core, E1 and E2 and non-structural (NS2, NS3, NS4A, NS4B, NS5A and NS5B. Besides its importance in virus replication, NS4A functions as a cofactor for NS3 and contributes to viral pathogenesis by influencing cellular functions. Here, we investigated the effect of NS4A protein on the growth rate induced by core protein in liver cells. Using our established tetracycline inducible system, we demonstrated the ability of NS4A protein to inhibit core protein-induced cell growth in Hepatoma cell line, HepG2. Induction of both core and NS4A proteins in HepG2- core/NS4A transfectants inhibited core-induced growth advantage in HepG2-core transfectants and blocked NS4A protein-induced cell growth inhibition in HepG2-NS4A transfectants. Using both immune fluorescence staining and Western blot analysis, we confirmed the localization of NS4A protein to the mitochondria in HepG2-NS4A transfectants expressing NS4A protein. Data obtained from flow cytometry analysis, using JC-1 demonstrated the loss of mitochondrial membrane potential (ΔΨ^ by the expression of NS4A protein in HepG2-NS4A transfectants, but not by the expression of core protein in HepG2-core transfectants. Whereas, the induction of the expression of both core and NS4A proteins in HepG2-core/NS4A transfectants blocked NS4A-induced loss of ΔΨm in HepG2 cells. Taken together, our data suggest an important role for mitochondria in the modulation HCV NS4A-induced inhibition of HCV core-mediated cell growth.

  12. Identifying protein biomarkers in predicting disease severity of dengue virus infection using immune-related protein microarray.

    Science.gov (United States)

    Soe, Hui Jen; Yong, Yean K; Al-Obaidi, Mazen M Jamil; Raju, Chandramathi Samudi; Gudimella, Ranganath; Manikam, Rishya; Sekaran, Shamala Devi

    2018-02-01

    Dengue virus is one of the most widespread flaviviruses that re-emerged throughout recent decades. The progression from mild dengue to severe dengue (SD) with the complications such as vascular leakage and hemorrhage increases the fatality rate of dengue. The pathophysiology of SD is not entirely clear. To investigate potential biomarkers that are suggestive of pathogenesis of SD, a small panel of serum samples selected from 1 healthy individual, 2 dengue patients without warning signs (DWS-), 2 dengue patients with warning signs (DWS+), and 5 patients with SD were subjected to a pilot analysis using Sengenics Immunome protein array. The overall fold changes of protein expressions and clustering heat map revealed that PFKFB4, TPM1, PDCL3, and PTPN20A were elevated among patients with SD. Differential expression analysis identified that 29 proteins were differentially elevated greater than 2-fold in SD groups than DWS- and DWS+. From the 29 candidate proteins, pathways enrichment analysis also identified insulin signaling and cytoskeleton pathways were involved in SD, suggesting that the insulin pathway may play a pivotal role in the pathogenesis of SD.

  13. Crystal Structure of the Capsid Protein from Zika Virus.

    Science.gov (United States)

    Shang, Zifang; Song, Hao; Shi, Yi; Qi, Jianxun; Gao, George F

    2018-03-30

    Recently, Zika virus (ZIKV) emerged as a global public health concern and is distinct from other flaviviruses in many aspects, for example, causing transplacental infection, fetal abnormalities and vector-independent transmission through body fluids in humans. The capsid (C) protein is a multifunctional protein, since it binds to viral RNA in the process of nucleocapsid assembly and plays important roles in virus infection processes by interacting with cellular proteins, modulating cellular metabolism, apoptosis and immune response. Here we solved the crystal structure of ZIKV C protein at a resolution of 1.9Å. The ZIKV C protein structure contains four α helices with a long pre-α1 loop and forms dimers. The unique long pre-α1 loop in ZIKV C contributes to the tighter association of dimeric assembly and renders a divergent hydrophobic feature at the lipid bilayer interface in comparison with the known C structures of West Nile and dengue viruses. We reported the interaction between the ZIKV C protein and lipid droplets through confocal microscopy analysis. Substitutions of key amino acids in the pre-α1 loop of ZIKV C disrupted the interaction with lipid droplets, indicating that the loop is critical for membrane association. We also recognized that ZIKV C protein possesses broad binding capability to different nucleotide types, including single-stranded and double-stranded RNAs or DNAs. Furthermore, the highly positively charged interface, mainly formed by α4 helix, is proposed to be responsible for nucleotide binding. These findings will greatly enhance our understanding of ZIKV C protein, providing information for anti-ZIKV drug design targeting the C protein. Copyright © 2018. Published by Elsevier Ltd.

  14. Comprehensive Mapping Antigenic Epitopes of NS1 Protein of Japanese Encephalitis Virus with Monoclonal Antibodies.

    Directory of Open Access Journals (Sweden)

    Rong-Hong Hua

    Full Text Available Japanese encephalitis virus (JEV non-structural protein 1 (NS1 contributes to virus replication and elicits protective immune responses during infection. JEV NS1-specific antibody responses could be a target in the differential diagnosis of different flavivirus infections. However, the epitopes on JEV NS1 are poorly characterized. The present study describes the full mapping of linear B-cell epitopes in JEV NS1. We generated eleven NS1-specific monoclonal antibodies from mice immunized with recombinant NS1. For epitope mapping of monoclonal antibodies, a set of 51 partially-overlapping peptides covering the entire NS1 protein were expressed with a GST-tag and then screened using monoclonal antibodies. Through enzyme-linked immunosorbent assay (ELISA, five linear epitope-containing peptides were identified. By sequentially removing amino acid residues from the carboxy and amino terminal of peptides, the minimal units of the five linear epitopes were identified and confirmed using monoclonal antibodies. Five linear epitopes are located in amino acids residues (5AIDITRK(11, (72RDELNVL(78, (251KSKHNRREGY(260, (269DENGIVLD(276, and (341DETTLVRS(348. Furthermore, it was found that the epitopes are highly conserved among JEV strains through sequence alignment. Notably, none of the homologous regions on NS1 proteins from other flaviviruses reacted with the MAbs when they were tested for cross-reactivity, and all five epitope peptides were not recognized by sera against West Nile virus or Dengue virus. These novel virus-specific linear B-cell epitopes of JEV NS1 would benefit the development of new vaccines and diagnostic assays.

  15. Protein-protein interactions

    DEFF Research Database (Denmark)

    Byron, Olwyn; Vestergaard, Bente

    2015-01-01

    Responsive formation of protein:protein interaction (PPI) upon diverse stimuli is a fundament of cellular function. As a consequence, PPIs are complex, adaptive entities, and exist in structurally heterogeneous interplays defined by the energetic states of the free and complexed protomers......, are reported. The aim is to depict how the elucidation of the interplay of structures requires the interplay of methods....

  16. Purification and crystallization of Kokobera virus helicase

    Energy Technology Data Exchange (ETDEWEB)

    De Colibus, Luigi; Speroni, Silvia [Department of Genetics and Microbiology, University of Pavia, Via Ferrata 1, 27100 Pavia (Italy); Coutard, Bruno [Architecture et Fonction des Macromolécules Biologiques, UMR 6098 CNRS et Université Aix-Marseille I et II, ESIL, Campus de Luminy, 13288 Marseille CEDEX 09 (France); Forrester, Naomi L.; Gould, Ernest [Centre for Ecology and Hydrology (formerly Institute of Virology), Mansfield Road, Oxford OX1 3SR (United Kingdom); Canard, Bruno [Architecture et Fonction des Macromolécules Biologiques, UMR 6098 CNRS et Université Aix-Marseille I et II, ESIL, Campus de Luminy, 13288 Marseille CEDEX 09 (France); Mattevi, Andrea, E-mail: mattevi@ipvgen.unipv.it [Department of Genetics and Microbiology, University of Pavia, Via Ferrata 1, 27100 Pavia (Italy)

    2007-03-01

    Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which is the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.

  17. Purification and crystallization of Kokobera virus helicase

    International Nuclear Information System (INIS)

    De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno; Forrester, Naomi L.; Gould, Ernest; Canard, Bruno; Mattevi, Andrea

    2007-01-01

    Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which is the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3 1 21 (or P3 2 21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å

  18. The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion

    International Nuclear Information System (INIS)

    Huang, Claire Y.-H.; Butrapet, Siritorn; Moss, Kelly J.; Childers, Thomas; Erb, Steven M.; Calvert, Amanda E.; Silengo, Shawn J.; Kinney, Richard M.; Blair, Carol D.; Roehrig, John T.

    2010-01-01

    The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could not re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.

  19. A single amino acid substitution in the core protein of West Nile virus increases resistance to acidotropic compounds.

    Directory of Open Access Journals (Sweden)

    Miguel A Martín-Acebes

    Full Text Available West Nile virus (WNV is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu on the highly basic internal capsid or core (C protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.

  20. A single amino acid substitution in the core protein of West Nile virus increases resistance to acidotropic compounds.

    Science.gov (United States)

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; de Oya, Nereida Jiménez; Escribano-Romero, Estela; Shi, Pei-Yong; Saiz, Juan-Carlos

    2013-01-01

    West Nile virus (WNV) is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu) on the highly basic internal capsid or core (C) protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A) and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.

  1. Analysis of chikungunya virus proteins reveals that non-structural proteins nsP2 and nsP3 exhibit RNA interference (RNAi) suppressor activity.

    Science.gov (United States)

    Mathur, Kalika; Anand, Abhishek; Dubey, Sunil Kumar; Sanan-Mishra, Neeti; Bhatnagar, Raj K; Sunil, Sujatha

    2016-11-30

    RNAi pathway is an antiviral defence mechanism employed by insects that result in degradation of viral RNA thereby curbing infection. Several viruses including flaviviruses encode viral suppressors of RNAi (VSRs) to counteract the antiviral RNAi pathway. Till date, no VSR has been reported in alphaviruses. The present study was undertaken to evaluate chikungunya virus (CHIKV) proteins for RNAi suppressor activity. We systematically analyzed all nine CHIKV proteins for RNAi suppressor activity using Sf21 RNAi sensor cell line based assay. Two non-structural proteins, namely, nsP2 and nsP3 were found to exhibit RNAi suppressor activity. We further validated the findings in natural hosts, namely in Aedes and in mammalian cell lines and further through EMSA and Agrobacterium infiltration in GFP silenced transgenic tobacco plants. Domains responsible for maximum RNAi suppressor activity were also identified within these proteins. RNA binding motifs in these domains were identified and their participation in RNAi suppression evaluated using site directed mutagenesis. Sequence alignment of these motifs across all species of known alphaviruses revealed conservation of these motifs emphasizing on a similar role of action in other species of alphaviruses as well. Further validation of RNAi suppressor activity of these proteins awaits establishment of specific virus infection models.

  2. [Effect of Hepatitis C virus proteins on the production of proinflammatory and profibrotic cytokines in Huh7.5 human hepatoma cells].

    Science.gov (United States)

    Masalova, O V; Lesnova, E I; Permyakova, K Yu; Samokhvalov, E I; Ivanov, A V; Kochetkov, S N; Kushch, A A

    2016-01-01

    Hepatitis C virus (HCV) is a widespread dangerous human pathogen. Up to 80% of HCV-infected individuals develop chronic infection, which is often accompanied by liver inflammation and fibrosis and, at terminal stages, liver cirrhosis and cancer. Treatment of patients with end-stage liver disease is often ineffective, and even patients with suppressed HCV replication have higher risk of death as compared with noninfected subjects. Therefore, investigating the mechanisms that underlie HCV pathogenesis and developing treatments for virus-associated liver dysfunction remain an important goal. The effect of individual HCV proteins on the production of proinflammatory and profibrotic cytokines in hepatocellular carcinoma Huh7.5 cells was analyzed in a systematic manner. Cells were transfected with plasmids encoding HCV proteins. Cytokine production and secretion was accessed by immunocytochemistry and ELISA of the culture medium, and transcription of the cytokine genes was assessed using reverse transcription and PCR. HCV proteins proved to differ in effect on cytokine production. Downregulation of interleukin 6 (IL-6) production was observed in cells expressing the HCV core, NS3, and NS5A proteins. Production of transforming growth factor β1 (TGF-β1) was lower in cells expressing the core proteins, NS3, or E1/E2 glycoproteins. A pronounced increase in production and secretion of tumor necrosis factor α (TNF-α) was observed in response to expression of the HCV E1/E2 glycoproteins. A higher biosynthesis, but a lower level in the cell culture medium, was detected for interleukin 1β (IL-1β) in cells harboring NS4 and IL-6 in cells expressing NS5В. The finding was possibly explained by protein-specific retention and consequent accumulation of the respective cytokines in the cell.

  3. Comparative proteomics reveals that YK51, a 4-Hydroxypandurantin-A analogue, downregulates the expression of proteins associated with dengue virus infection

    Directory of Open Access Journals (Sweden)

    Wei-Lian Tan

    2018-01-01

    Full Text Available Dengue is endemic throughout tropical and subtropical regions of the world. Currently, there is no clinically approved therapeutic drug available for this acute viral infection. Although the first dengue vaccine Dengvaxia has been approved for use in certain countries, it is limited to those without a previous dengue infection while the safety and efficacy of the vaccine in those elderly and younger children still need to be identified. Therefore, it is becoming increasingly important to develop therapeutics/drugs to combat dengue virus (DENV infection. YK51 is a synthetic analogue of 4-Hydroxypandurantin A (a compound found in the crude extract of the rhizomes of Boesenbergia rotunda that has been extensively studied by our research group. It has been shown to possess outstanding antiviral activity due to its inhibitory activity against NS2B/NS3 DENV2 protease. However, it is not known how YK51 affects the proteome of DENV infected cells. Therefore, we performed a comparative proteomics analysis to identify changes in protein expression in DENV infected HepG2 cells treated with YK51. Classical two-dimensional gel electrophoresis followed by protein identification using tandem mass spectrometry was employed in this study. Thirty proteins were found to be down-regulated with YK51 treatment. In silico analysis predicted that the down-regulation of eight of these proteins may inhibit viral infection. Our results suggested that apart from inhibiting the NS2B/NS3 DENV2 protease, YK51 may also be causing the down-regulation of a number of proteins that may be responsible in, and/or essential to virus infection. However, functional characterization of these proteins will be necessary before we can conclusively determine their roles in DENV infection.

  4. Comparative proteomics reveals that YK51, a 4-Hydroxypandurantin-A analogue, downregulates the expression of proteins associated with dengue virus infection.

    Science.gov (United States)

    Tan, Wei-Lian; Lee, Yean Kee; Ho, Yen Fong; Yusof, Rohana; Abdul Rahman, Noorsaadah; Karsani, Saiful Anuar

    2018-01-01

    Dengue is endemic throughout tropical and subtropical regions of the world. Currently, there is no clinically approved therapeutic drug available for this acute viral infection. Although the first dengue vaccine Dengvaxia has been approved for use in certain countries, it is limited to those without a previous dengue infection while the safety and efficacy of the vaccine in those elderly and younger children still need to be identified. Therefore, it is becoming increasingly important to develop therapeutics/drugs to combat dengue virus (DENV) infection. YK51 is a synthetic analogue of 4-Hydroxypandurantin A (a compound found in the crude extract of the rhizomes of Boesenbergia rotunda ) that has been extensively studied by our research group. It has been shown to possess outstanding antiviral activity due to its inhibitory activity against NS2B/NS3 DENV2 protease. However, it is not known how YK51 affects the proteome of DENV infected cells. Therefore, we performed a comparative proteomics analysis to identify changes in protein expression in DENV infected HepG2 cells treated with YK51. Classical two-dimensional gel electrophoresis followed by protein identification using tandem mass spectrometry was employed in this study. Thirty proteins were found to be down-regulated with YK51 treatment. In silico analysis predicted that the down-regulation of eight of these proteins may inhibit viral infection. Our results suggested that apart from inhibiting the NS2B/NS3 DENV2 protease, YK51 may also be causing the down-regulation of a number of proteins that may be responsible in, and/or essential to virus infection. However, functional characterization of these proteins will be necessary before we can conclusively determine their roles in DENV infection.

  5. Rab5 Enhances Classical Swine Fever Virus Proliferation and Interacts with Viral NS4B Protein to Facilitate Formation of NS4B Related Complex

    Directory of Open Access Journals (Sweden)

    Jihui Lin

    2017-08-01

    Full Text Available Classical swine fever virus (CSFV is a fatal pig pestivirus and causes serious financial losses to the pig industry. CSFV NS4B protein is one of the most important viral replicase proteins. Rab5, a member of the small Rab GTPase family, is involved in infection and replication of numerous viruses including hepatitis C virus and dengue virus. Until now, the effects of Rab5 on the proliferation of CSFV are poorly defined. In the present study, we showed that Rab5 could enhance CSFV proliferation by utilizing lentivirus-mediated constitutive overexpression and eukaryotic plasmid transient overexpression approaches. On the other hand, lentivirus-mediated short hairpin RNA knockdown of Rab5 dramatically inhibited virus production. Co-immunoprecipitation, glutathione S-transferase pulldown and laser confocal microscopy assays further confirmed the interaction between Rab5 and CSFV NS4B protein. In addition, intracellular distribution of NS4B-Red presented many granular fluorescent signals (GFS in CSFV infected PK-15 cells. Inhibition of basal Rab5 function with Rab5 dominant negative mutant Rab5S34N resulted in disruption of the GFS. These results indicate that Rab5 plays a critical role in facilitating the formation of the NS4B related complexes. Furthermore, it was observed that NS4B co-localized with viral NS3 and NS5A proteins in the cytoplasm, suggesting that NS3 and NS5A might be components of the NS4B related complex. Taken together, these results demonstrate that Rab5 positively modulates CSFV propagation and interacts with NS4B protein to facilitate the NS4B related complexes formation.

  6. Identification of one B-cell epitope from NS1 protein of duck Tembusu virus with monoclonal antibodies.

    Directory of Open Access Journals (Sweden)

    Jinfeng Ti

    Full Text Available This study describes the identification of one linear B-cell epitope on TMUV NS1 protein with monoclonal antibody (mAb 3G2 by indirect enzyme-linked immunosorbent assay (ELISA. In this study, NS1 protein was expressed in prokaryotic expression system and purified. One mAb against NS1 protein was generated from Balb/c mice immunized with recombinant protein NS1. A set of 35 partially-overlapping polypeptides covering the entire NS1 protein was expressed with PGEX-6P-1 vector and screened with mAb 3G2. One polypeptide against the mAb was acquired and identified by indirect ELISA and western-blot. To map the epitope accurately, one or two amino acid residues were removed from the carboxy and amino terminal of polypeptide sequentially. A series of truncated oligopeptides were expressed and purified. The minimal determinant of the linear B cell epitope was recognized and identified with mAb 3G2. The accurate linear B-cell epitope was 269DEKEIV274 located in NS1 protein. Furthermore, sequence alignment showed that the epitope was highly conserved and specific among TMUV strains and other flavivirus respectively. The linear B-cell epitope of TMUV NS1 protein could benefit the development of new vaccines and diagnostic assays.

  7. Interfacial Protein-Protein Associations

    OpenAIRE

    Langdon, Blake B.; Kastantin, Mark; Walder, Robert; Schwartz, Daniel K.

    2013-01-01

    While traditional models of protein adsorption focus primarily on direct protein-surface interactions, recent findings suggest that protein-protein interactions may play a central role. Using high-throughput intermolecular resonance energy transfer (RET) tracking, we directly observed dynamic, protein-protein associations of bovine serum albumin on poly(ethylene glycol) modified surfaces. The associations were heterogeneous and reversible, and associating molecules resided on the surface for ...

  8. A mutation in the envelope protein fusion loop attenuates mouse neuroinvasiveness of the NY99 strain of West Nile virus

    International Nuclear Information System (INIS)

    Zhang Shuliu; Li Li; Woodson, Sara E.; Huang, Claire Y.-H.; Kinney, Richard M.; Barrett, Alan D.T.; Beasley, David W.C.

    2006-01-01

    Substitutions were engineered individually and in combinations at the fusion loop, receptor-binding domain and a stem-helix structure of the envelope protein of a West Nile virus strain, NY99, and their effects on mouse virulence and presentation of epitopes recognized by monoclonal antibodies (MAbs) were assessed. A single substitution within the fusion loop (L107F) attenuated mouse neuroinvasiveness of NY99. No substitutions attenuated NY99 neurovirulence. The L107F mutation also abolished binding of a non-neutralizing MAb, 3D9, whose epitope had not been previously identified. MAb 3D9 was subsequently shown to be broadly cross-reactive with other flaviviruses, consistent with binding near the highly conserved fusion loop

  9. Robust and Balanced Immune Responses to All 4 Dengue Virus Serotypes Following Administration of a Single Dose of a Live Attenuated Tetravalent Dengue Vaccine to Healthy, Flavivirus-Naive Adults.

    Science.gov (United States)

    Kirkpatrick, Beth D; Durbin, Anna P; Pierce, Kristen K; Carmolli, Marya P; Tibery, Cecilia M; Grier, Palmtama L; Hynes, Noreen; Diehl, Sean A; Elwood, Dan; Jarvis, Adrienne P; Sabundayo, Beulah P; Lyon, Caroline E; Larsson, Catherine J; Jo, Matthew; Lovchik, Janece M; Luke, Catherine J; Walsh, Mary C; Fraser, Ellen A; Subbarao, Kanta; Whitehead, Steven S

    2015-09-01

    The 4 serotypes of dengue virus, DENV-1-4, are the leading cause of arboviral disease globally. The ideal dengue vaccine would provide protection against all serotypes after a single dose. Two randomized, placebo-controlled trials were performed with 168 flavivirus-naive adults to demonstrate the safety and immunogenicity of a live attenuated tetravalent dengue vaccine (TV003), compared with those of a second tetravalent vaccine with an enhanced DENV-2 component (TV005), and to evaluate the benefit of a booster dose at 6 months. Safety data, viremia, and neutralizing antibody titers were evaluated. A single dose of TV005 elicited a tetravalent response in 90% of vaccinees by 3 months after vaccination and a trivalent response in 98%. Compared with TV003, the higher-dose DENV-2 component increased the observed frequency of immunogenicity to DENV-2 in the TV005 trial. Both the first and second doses were well tolerated. Neither vaccine viremia, rash, nor a significant antibody boost were observed following a second dose. A single subcutaneous dose of TV005 dengue vaccine is safe and induces a tetravalent antibody response at an unprecedented frequency among vaccinees. A second dose has limited benefit and appears to be unnecessary. Studies to confirm these findings and assess vaccine efficacy will now move to populations in regions where DENV transmission is endemic. NCT01072786 and NCT01436422. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Computer-based comparison of structural features of envelope protein of Alkhurma hemorrhagic fever virus with the homologous proteins of two closest viruses.

    Science.gov (United States)

    Mohabatkar, Hassan

    2011-06-01

    The aim of this study was prediction of epitopes and medically important structural properties of protein E of Alkhurma hemorrhagic fever virus (AHFV) and comparing these features with two closely relates viruses, i.e. Kyasanur Forest disease virus (KFDV) and Tick-borne encephalitis virus (TBEV) by bioinformatics tools. Prediction of evolutionary distance, localization, sequence of signal peptides, C, N O glycosylation sites, transmembrane helices (TMHs), cysteine bond positions and B cell and T cell epitopes of E proteins were performed. 2D-MH, Virus-PLoc, Signal-CF, EnsembleGly, MemBrain, DiANNA, BCPREDS and MHCPred servers were applied for the prediction. According to the results, the evolutionary distance of E protein of AHFV and two other viruses was almost equal. In all three proteins of study, residues 1-35 were predicted as signal sequences and one asparagine was predicted to be glycosylated. Results of prediction of transmembrane helices showed one TMH at position 444-467 and the other one at position 476-490. Twelve cysteines were potentially involved to form six disulfide bridges in the proteins. Four parts were predicted as B cell epitopes in E protein of AHFV. One epitope was conserved between three proteins of study. The only conserved major histocompatibility complex (MHC) binding epitope between three viruses was for DRB0401 allele. As there are not much experimental data available about AHFV, computer-aided study and comparison of E protein of this virus with two closely related flaviviruses can help in better understanding of medical properties of the virus.

  11. Hepatitis C virus nonstructural protein 5A modulates the toll-like receptor-MyD88-dependent signaling pathway in macrophage cell lines.

    Science.gov (United States)

    Abe, Takayuki; Kaname, Yuuki; Hamamoto, Itsuki; Tsuda, Yoshimi; Wen, Xiaoyu; Taguwa, Shuhei; Moriishi, Kohji; Takeuchi, Osamu; Kawai, Taro; Kanto, Tatsuya; Hayashi, Norio; Akira, Shizuo; Matsuura, Yoshiharu

    2007-09-01

    Hepatitis C virus (HCV) infection induces a wide range of chronic liver injuries; however, the mechanism through which HCV evades the immune surveillance system remains obscure. Blood dendritic cells (DCs) play a pivotal role in the recognition of viral infection and the induction of innate and adaptive immune responses. Several reports suggest that HCV infection induces the dysfunction of DCs in patients with chronic hepatitis C. Toll-like receptor (TLR) has been shown to play various roles in many viral infections; however, the involvement of HCV proteins in the TLR signaling pathway has not yet been precisely elucidated. In this study, we established mouse macrophage cell lines stably expressing HCV proteins and determined the effect of HCV proteins on the TLR signaling pathways. Immune cells expressing NS3, NS3/4A, NS4B, or NS5A were found to inhibit the activation of the TLR2, TLR4, TLR7, and TLR9 signaling pathways. Various genotypes of NS5A bound to MyD88, a major adaptor molecule in TLR, inhibited the recruitment of interleukin-1 receptor-associated kinase 1 to MyD88, and impaired cytokine production in response to TLR ligands. Amino acid residues 240 to 280, previously identified as the interferon sensitivity-determining region (ISDR) in NS5A, interacted with the death domain of MyD88, and the expression of a mutant NS5A lacking the ISDR partially restored cytokine production. These results suggest that the expression of HCV proteins modulates the TLR signaling pathway in immune cells.

  12. Genome-wide RNAi screen identifies novel host proteins required for alphavirus entry.

    Directory of Open Access Journals (Sweden)

    Yaw Shin Ooi

    Full Text Available The enveloped alphaviruses include important and emerging human pathogens such as Chikungunya virus and Eastern equine encephalitis virus. Alphaviruses enter cells by clathrin-mediated endocytosis, and exit by budding from the plasma membrane. While there has been considerable progress in defining the structure and function of the viral proteins, relatively little is known about the host factors involved in alphavirus infection. We used a genome-wide siRNA screen to identify host factors that promote or inhibit alphavirus infection in human cells. Fuzzy homologue (FUZ, a protein with reported roles in planar cell polarity and cilia biogenesis, was required for the clathrin-dependent internalization of both alphaviruses and the classical endocytic ligand transferrin. The tetraspanin membrane protein TSPAN9 was critical for the efficient fusion of low pH-triggered virus with the endosome membrane. FUZ and TSPAN9 were broadly required for infection by the alphaviruses Sindbis virus, Semliki Forest virus, and Chikungunya virus, but were not required by the structurally-related flavivirus Dengue virus. Our results highlight the unanticipated functions of FUZ and TSPAN9 in distinct steps of alphavirus entry and suggest novel host proteins that may serve as targets for antiviral therapy.

  13. Disabled infectious single animal (DISA) vaccine against Bluetongue by deletion of viroporin-like NS3/NS3a expression is effective, safe, and enables differentiation of infected from vaccinated animals (DIVA)

    Science.gov (United States)

    The prototype virus species of the genus Orbivirus (family Reoviridae) is bluetongue virus (BTV) consisting of at least 27 serotypes. Bluetongue is a noncontagious haemorrhagic disease of ruminants spread by competent species of Culicoides biting midges in large parts of the world leading to huge ec...

  14. Proteins engineering

    International Nuclear Information System (INIS)

    2000-01-01

    At the - Departement d'Ingenierie et d'etudes de proteines (Deip) of the CEA more than seventy researchers are working hard to understand the function of proteins. For that they use the molecular labelling technique (F.M.)

  15. Total protein

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003483.htm Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  16. Evolution of hepatitis C virus quasispecies during repeated treatment with the NS3/4A protease inhibitor telaprevir

    NARCIS (Netherlands)

    Susser, Simone; Flinders, Mathieu; Reesink, Henk W.; Zeuzem, Stefan; Lawyer, Glenn; Ghys, Anne; van Eygen, Veerle; Witek, James; de Meyer, Sandra; Sarrazin, Christoph

    2015-01-01

    In treating hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infections, the rapid reselection of resistance-associated variants (RAVs) is well known in patients with repeated exposure to the same class of antiviral agents. For chronic hepatitis C patients who have experienced

  17. Nucleolin Interacts with the Dengue Virus Capsid Protein and Plays a Role in Formation of Infectious Virus Particles

    Science.gov (United States)

    Balinsky, Corey A.; Schmeisser, Hana; Ganesan, Sundar; Singh, Kavita; Pierson, Theodore C.

    2013-01-01

    Dengue virus (DENV) is a mosquito-transmitted flavivirus that can cause severe disease in humans and is considered a reemerging pathogen of significant importance to public health. The DENV capsid (C) protein functions as a structural component of the infectious virion; however, it may have additional functions in the virus replicative cycle. Here, we show that the DENV C protein interacts and colocalizes with the multifunctional host protein nucleolin (NCL). Furthermore, we demonstrate that this interaction can be disrupted by the addition of an NCL binding aptamer (AS1411). Knockdown of NCL with small interfering RNA (siRNA) or treatment of cells with AS1411 results in a significant reduction of viral titers after DENV infection. Western blotting and quantitative RT-PCR (qRT-PCR) analysis revealed no differences in viral RNA or protein levels at early time points postinfection, suggesting a role for NCL in viral morphogenesis. We support this hypothesis by showing that treatment with AS1411 alters the migration characteristics of the viral capsid, as visualized by native electrophoresis. Here, we identify a critical interaction between DENV C protein and NCL that represents a potential new target for the development of antiviral therapeutics. PMID:24027323

  18. A novel mosquito ubiquitin targets viral envelope protein for degradation and reduces virion production during dengue virus infection.

    Science.gov (United States)

    Troupin, Andrea; Londono-Renteria, Berlin; Conway, Michael J; Cloherty, Erin; Jameson, Samuel; Higgs, Stephen; Vanlandingham, Dana L; Fikrig, Erol; Colpitts, Tonya M

    2016-09-01

    Dengue virus (DENV) is a mosquito-borne flavivirus that causes significant human disease and mortality in the tropics and subtropics. By examining the effects of virus infection on gene expression, and interactions between virus and vector, new targets for prevention of infection and novel treatments may be identified in mosquitoes. We previously performed a microarray analysis of the Aedes aegypti transcriptome during infection with DENV and found that mosquito ubiquitin protein Ub3881 (AAEL003881) was specifically and highly down-regulated. Ubiquitin proteins have multiple functions in insects, including marking proteins for proteasomal degradation, regulating apoptosis and mediating innate immune signaling. We used qRT-PCR to quantify gene expression and infection, and RNAi to reduce Ub3881 expression. Mosquitoes were infected with DENV through blood feeding. We transfected DENV protein expression constructs to examine the effect of Ub3881 on protein degradation. We used site-directed mutagenesis and transfection to determine what amino acids are involved in Ub3881-mediated protein degradation. Immunofluorescence, Co-immunoprecipitation and Western blotting were used to examine protein interactions and co-localization. The overexpression of Ub3881, but not related ubiquitin proteins, decreased DENV infection in mosquito cells and live Ae. aegypti. The Ub3881 protein was demonstrated to be involved in DENV envelope protein degradation and reduce the number of infectious virions released. We conclude that Ub3881 has several antiviral functions in the mosquito, including specific viral protein degradation. Our data highlights Ub3881 as a target for future DENV prevention strategies in the mosquito transmission vector. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Dengue virus capsid protein binds core histones and inhibits nucleosome formation in human liver cells.

    Directory of Open Access Journals (Sweden)

    Tonya M Colpitts

    Full Text Available Dengue virus (DENV is a member of the Flaviviridae and a globally (reemerging pathogen that causes serious human disease. There is no specific antiviral or vaccine for dengue virus infection. Flavivirus capsid (C is a structural protein responsible for gathering the viral RNA into a nucleocapsid that forms the core of a mature virus particle. Flaviviral replication is known to occur in the cytoplasm yet a large portion of capsid protein localizes to the nucleus during infection. The reasons for the nuclear presences of capsid are not completely understood. Here, we expressed mature DENV C in a tandem affinity purification assay to identify potential binding partners in human liver cells. DENV C targeted the four core histones, H2A, H2B, H3 and H4. DENV C bound recombinant histones in solution and colocalized with histones in the nucleus and cytoplasm of liver cells during DENV infection. We show that DENV C acts as a histone mimic, forming heterodimers with core histones, binding DNA and disrupting nucleosome formation. We also demonstrate that DENV infection increases the amounts of core histones in livers cells, which may be a cellular response to C binding away the histone proteins. Infection with DENV additionally alters levels of H2A phosphorylation in a time-dependent manner. The interactions of C and histones add an interesting new role for the presence of C in the nucleus during DENV infection.

  20. Dengue virus capsid protein binds core histones and inhibits nucleosome formation in human liver cells.

    Science.gov (United States)

    Colpitts, Tonya M; Barthel, Sebastian; Wang, Penghua; Fikrig, Erol

    2011-01-01

    Dengue virus (DENV) is a member of the Flaviviridae and a globally (re)emerging pathogen that causes serious human disease. There is no specific antiviral or vaccine for dengue virus infection. Flavivirus capsid (C) is a structural protein responsible for gathering the viral RNA into a nucleocapsid that forms the core of a mature virus particle. Flaviviral replication is known to occur in the cytoplasm yet a large portion of capsid protein localizes to the nucleus during infection. The reasons for the nuclear presences of capsid are not completely understood. Here, we expressed mature DENV C in a tandem affinity purification assay to identify potential binding partners in human liver cells. DENV C targeted the four core histones, H2A, H2B, H3 and H4. DENV C bound recombinant histones in solution and colocalized with histones in the nucleus and cytoplasm of liver cells during DENV infection. We show that DENV C acts as a histone mimic, forming heterodimers with core histones, binding DNA and disrupting nucleosome formation. We also demonstrate that DENV infection increases the amounts of core histones in livers cells, which may be a cellular response to C binding away the histone proteins. Infection with DENV additionally alters levels of H2A phosphorylation in a time-dependent manner. The interactions of C and histones add an interesting new role for the presence of C in the nucleus during DENV infection.

  1. Dengue Virus Capsid Protein Binds Core Histones and Inhibits Nucleosome Formation in Human Liver Cells

    Science.gov (United States)

    Colpitts, Tonya M.; Barthel, Sebastian; Wang, Penghua; Fikrig, Erol

    2011-01-01

    Dengue virus (DENV) is a member of the Flaviviridae and a globally (re)emerging pathogen that causes serious human disease. There is no specific antiviral or vaccine for dengue virus infection. Flavivirus capsid (C) is a structural protein responsible for gathering the viral RNA into a nucleocapsid that forms the core of a mature virus particle. Flaviviral replication is known to occur in the cytoplasm yet a large portion of capsid protein localizes to the nucleus during infection. The reasons for the nuclear presences of capsid are not completely understood. Here, we expressed mature DENV C in a tandem affinity purification assay to identify potential binding partners in human liver cells. DENV C targeted the four core histones, H2A, H2B, H3 and H4. DENV C bound recombinant histones in solution and colocalized with histones in the nucleus and cytoplasm of liver cells during DENV infection. We show that DENV C acts as a histone mimic, forming heterodimers with core histones, binding DNA and disrupting nucleosome formation. We also demonstrate that DENV infection increases the amounts of core histones in livers cells, which may be a cellular response to C binding away the histone proteins. Infection with DENV additionally alters levels of H2A phosphorylation in a time-dependent manner. The interactions of C and histones add an interesting new role for the presence of C in the nucleus during DENV infection. PMID:21909430

  2. Protein Extractability

    African Journals Online (AJOL)

    Results showed that protein extractability was dependent on pH, type of salt, salt concentrations and extraction time. Salts extracted more proteins from the moringa seed flour than water. Maximum extraction of protein was. 85.06% and 84.72% with 0.5 M CaCl and 0.75 M NaCl respectively. On varying the pH, maximum ...

  3. Lipid droplet-binding protein TIP47 regulates hepatitis C Virus RNA replication through interaction with the viral NS5A protein.

    Directory of Open Access Journals (Sweden)

    Dorothee A Vogt

    Full Text Available The nonstructural protein NS5A has emerged as a new drug target in antiviral therapies for Hepatitis C Virus (HCV infection. NS5A is critically involved in viral RNA replication that takes place at newly formed membranes within the endoplasmic reticulum (membranous web and assists viral assembly in the close vicinity of lipid droplets (LDs. To identify host proteins that interact with NS5A, we performed a yeast two-hybrid screen with the N-terminus of NS5A (amino acids 1-31, a well-studied α-helical domain important for the membrane tethering of NS5A. Our studies identified the LD-associated host protein, Tail-Interacting Protein 47 (TIP47 as a novel NS5A interaction partner. Coimmunoprecipitation experiments in Huh7 hepatoma cells confirmed the interaction of TIP47 with full-length NS5A. shRNA-mediated knockdown of TIP47 caused a more than 10-fold decrease in the propagation of full-length infectious HCV in Huh7.5 hepatoma cells. A similar reduction was observed when TIP47 was knocked down in cells harboring an autonomously replicating HCV RNA (subgenomic replicon, indicating that TIP47 is required for efficient HCV RNA replication. A single point mutation (W9A in NS5A that disrupts the interaction with TIP47 but preserves proper subcellular localization severely decreased HCV RNA replication. In biochemical membrane flotation assays, TIP47 cofractionated with HCV NS3, NS5A, NS5B proteins, and viral RNA, and together with nonstructural viral proteins was uniquely distributed to lower-density LD-rich membrane fractions in cells actively replicating HCV RNA. Collectively, our data support a model where TIP47--via its interaction with NS5A--serves as a novel cofactor for HCV infection possibly by integrating LD membranes into the membranous web.

  4. Protein politics

    NARCIS (Netherlands)

    Vijver, Marike

    2005-01-01

    This study is part of the program of the interdisciplinary research group Profetas (protein foods, environment, technology and society). Profetas consists of technological, environmental and socio-economic research projects on protein food systems which result in the development of scenarios and

  5. Whey Protein

    Science.gov (United States)

    ... Fraction de Lactosérum, Fraction de Petit-Lait, Goat Milk Whey, Goat Whey, Isolat de Protéine de Lactosérum, Isolat de Protéine de Petit-Lait, Lactosérum de Lait de Chèvre, MBP, Milk Protein, Milk Protein Isolate, Mineral Whey Concentrate, Proteínas ...

  6. Protein adhesives

    Science.gov (United States)

    Charles R. Frihart; Linda F. Lorenz

    2018-01-01

    Nature uses a wide variety of chemicals for providing adhesion internally (e.g., cell to cell) and externally (e.g., mussels to ships and piers). This adhesive bonding is chemically and mechanically complex, involving a variety of proteins, carbohydrates, and other compounds.Consequently,the effect of protein structures on adhesive properties is only partially...

  7. Tau protein

    DEFF Research Database (Denmark)

    Frederiksen, Jette Lautrup Battistini; Kristensen, Kim; Bahl, Jmc

    2011-01-01

    Background: Tau protein has been proposed as biomarker of axonal damage leading to irreversible neurological impairment in MS. CSF concentrations may be useful when determining risk of progression from ON to MS. Objective: To investigate the association between tau protein concentration and 14......-3-3 protein in the cerebrospinal fluid (CSF) of patients with monosymptomatic optic neuritis (ON) versus patients with monosymptomatic onset who progressed to multiple sclerosis (MS). To evaluate results against data found in a complete literature review. Methods: A total of 66 patients with MS and/or ON from...... the Department of Neurology of Glostrup Hospital, University of Copenhagen, Denmark, were included. CSF samples were analysed for tau protein and 14-3-3 protein, and clinical and paraclinical information was obtained from medical records. Results: The study shows a significantly increased concentration of tau...

  8. Dengue virus capsid protein usurps lipid droplets for viral particle formation.

    Directory of Open Access Journals (Sweden)

    Marcelo M Samsa

    2009-10-01

    Full Text Available Dengue virus is responsible for the highest rates of disease and mortality among the members of the Flavivirus genus. Dengue epidemics are still occurring around the world, indicating an urgent need of prophylactic vaccines and antivirals. In recent years, a great deal has been learned about the mechanisms of dengue virus genome amplification. However, little is known about the process by which the capsid protein recruits the viral genome during encapsidation. Here, we found that the mature capsid protein in the cytoplasm of dengue virus infected cells accumulates on the surface of ER-derived organelles named lipid droplets. Mutagenesis analysis using infectious dengue virus clones has identified specific hydrophobic amino acids, located in the center of the capsid protein, as key elements for lipid droplet association. Substitutions of amino acid L50 or L54 in the capsid protein disrupted lipid droplet targeting and impaired viral particle formation. We also report that dengue virus infection increases the number of lipid droplets per cell, suggesting a link between lipid droplet metabolism and viral replication. In this regard, we found that pharmacological manipulation of the amount of lipid droplets in the cell can be a means to control dengue virus replication. In addition, we developed a novel genetic system to dissociate cis-acting RNA replication elements from the capsid coding sequence. Using this system, we found that mislocalization of a mutated capsid protein decreased viral RNA amplification. We propose that lipid droplets play multiple roles during the viral life cycle; they could sequester the viral capsid protein early during infection and provide a scaffold for genome encapsidation.

  9. Protein-Protein Interaction Databases

    DEFF Research Database (Denmark)

    Szklarczyk, Damian; Jensen, Lars Juhl

    2015-01-01

    of research are explored. Here we present an overview of the most widely used protein-protein interaction databases and the methods they employ to gather, combine, and predict interactions. We also point out the trade-off between comprehensiveness and accuracy and the main pitfall scientists have to be aware...

  10. Protein deamidation

    OpenAIRE

    Robinson, Noah E.

    2002-01-01

    A completely automatic computerized technique for the quantitative estimation of the deamidation rates of any protein for which the three-dimensional structure is known has been developed. Calculations of the specific deamidation rates of 170,014 asparaginyl residues in 13,335 proteins have been carried out. The calculated values have good quantitative reliability when compared with experimental measurements. These rates demonstrate that deamidation may be a biologically ...

  11. Recombinant domains III of Tick-Borne Encephalitis Virus envelope protein in combination with dextran and CpGs induce immune response and partial protectiveness against TBE virus infection in mice.

    Science.gov (United States)

    Ershova, Anna S; Gra, Olga A; Lyaschuk, Alexander M; Grunina, Tatyana M; Tkachuk, Artem P; Bartov, Mikhail S; Savina, Darya M; Sergienko, Olga V; Galushkina, Zoya M; Gudov, Vladimir P; Kozlovskaya, Liubov I; Kholodilov, Ivan S; Gmyl, Larissa V; Karganova, Galina G; Lunin, Vladimir G; Karyagina, Anna S; Gintsburg, Alexander L

    2016-10-07

    E protein of tick-borne encephalitis virus (TBEV) and other flaviviruses is located on the surface of the viral particle. Domain III of this protein seems to be a promising component of subunit vaccines for prophylaxis of TBE and kits for diagnostics of TBEV. Three variants of recombinant TBEV E protein domain III of European, Siberian and Far Eastern subtypes fused with dextran-binding domain of Leuconostoc citreum KM20 were expressed in E. coli and purified. The native structure of domain III was confirmed by ELISA antibody kit and sera of patients with tick-borne encephalitis. Immunogenic and protective properties of the preparation comprising these recombinant proteins immobilized on a dextran carrier with CpG oligonucleotides as an adjuvant were investigated on the mice model. All 3 variants of recombinant proteins immobilized on dextran demonstrate specific interaction with antibodies from the sera of TBE patients. Thus, constructed recombinant proteins seem to be promising for TBE diagnostics. The formulation comprising the 3 variants of recombinant antigens immobilized on dextran and CpG oligonucleotides, induces the production of neutralizing antibodies against TBEV of different subtypes and demonstrates partial protectivity against TBEV infection. Studied proteins interact with the sera of TBE patients, and, in combination with dextran and CPGs, demonstrate immunogenicity and limited protectivity on mice compared with reference "Tick-E-Vac" vaccine.

  12. Polysulfonate suramin inhibits Zika virus infection.

    Science.gov (United States)

    Tan, Chee Wah; Sam, I-Ching; Chong, Wei Lim; Lee, Vannajan Sanghiran; Chan, Yoke Fun

    2017-07-01

    Zika virus (ZIKV) is an arthropod-borne flavivirus that causes newborn microcephaly and Guillian-Barré syndrome in adults. No therapeutics are available to treat ZIKV infection or other flaviviruses. In this study, we explored the inhibitory effect of glycosaminoglycans and analogues against ZIKV infection. Highly sulfated heparin, dextran sulfate and suramin significantly inhibited ZIKV infection in Vero cells. De-sulfated heparin analogues lose inhibitory effect, implying that sulfonate groups are critical for viral inhibition. Suramin, an FDA-approved anti-parasitic drug, inhibits ZIKV infection with 3-5 log 10  PFU viral reduction with IC 50 value of ∼2.5-5 μg/ml (1.93 μM-3.85 μM). A time-of-drug-addition study revealed that suramin remains potent even when administrated at 1-24 hpi. Suramin inhibits ZIKV infection by preventing viral adsorption, entry and replication. Molecular dynamics simulation revealed stronger interaction of suramin with ZIKV NS3 helicase than with the envelope protein. Suramin warrants further investigation as a potential antiviral candidate for ZIKV infection. Heparan sulfate (HS) is a cellular attachment receptor for multiple flaviviruses. However, no direct ZIKV-heparin interaction was observed in heparin-binding analysis, and downregulate or removal of cellular HS with sodium chlorate or heparinase I/III did not inhibit ZIKV infection. This indicates that cell surface HS is not utilized by ZIKV as an attachment receptor. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Protein Crystallizability.

    Science.gov (United States)

    Smialowski, Pawel; Wong, Philip

    2016-01-01

    Obtaining diffracting quality crystals remains a major challenge in protein structure research. We summarize and compare methods for selecting the best protein targets for crystallization, construct optimization and crystallization condition design. Target selection methods are divided into algorithms predicting the chance of successful progression through all stages of structural determination (from cloning to solving the structure) and those focusing only on the crystallization step. We tried to highlight pros and cons of different approaches examining the following aspects: data size, redundancy and representativeness, overfitting during model construction, and results evaluation. In summary, although in recent years progress was made and several sequence properties were reported to be relevant for crystallization, the successful prediction of protein crystallization behavior and selection of corresponding crystallization conditions continue to challenge structural researchers.

  14. Synthesis of bluetongue virus (BTV) corelike particles by a recombinant baculovirus expressing the two major structural core proteins of BTV.

    Science.gov (United States)

    French, T J; Roy, P

    1990-04-01

    The L3 and M7 genes of bluetongue virus (BTV), which encode the two major core proteins of the virus (VP3 and VP7, respectively), were inserted into a baculovirus dual-expression transfer vector and a recombinant baculovirus expressing both foreign genes isolated following in vivo recombination with wild-type Autographa californica nuclear polyhedrosis virus DNA. Spodoptera frugiperda insect cells infected with the recombinant synthesized large amounts of BTV corelike particles. These particles have been shown to be similar to authentic BTV cores in terms of size, appearance, stoichiometric arrangement of VP3 to VP7 (ratio, 2:15), and the predominance of VP7 on the surface of the particles. In infected insect cells, the corelike particles were observed in paracrystalline arrays. The formation of these structures indicates that neither the BTV double-stranded viral RNA species nor the associated minor core proteins are necessary for assembly of cores in insect cells. Furthermore, the three BTV nonstructural proteins NS1, NS2, and NS3, are not required to assist or direct the formation of empty corelike particles from VP3 and VP7.

  15. Functional characterization of nuclear localization and export signals in hepatitis C virus proteins and their role in the membranous web.

    Directory of Open Access Journals (Sweden)

    Aviad Levin

    Full Text Available The hepatitis C virus (HCV is a positive strand RNA virus of the Flavivirus family that replicates in the cytoplasm of infected hepatocytes. Previously, several nuclear localization signals (NLS and nuclear export signals (NES have been identified in HCV proteins, however, there is little evidence that these proteins travel into the nucleus during infection. We have recently shown that nuclear pore complex (NPC proteins (termed nucleoporins or Nups are present in the membranous web and are required during HCV infection. In this study, we identify a total of 11 NLS and NES sequences in various HCV proteins. We show direct interactions between HCV proteins and importin α5 (IPOA5/kapα1, importin β3 (IPO5/kap β3, and exportin 1 (XPO1/CRM1 both in-vitro and in cell culture. These interactions can be disrupted using peptides containing the specific NLS or NES sequences of HCV proteins. Moreover, using a synchronized infection system, we show that these peptides inhibit HCV infection during distinct phases of the HCV life cycle. The inhibitory effects of these peptides place them in two groups. The first group binds IPOA5 and inhibits infection during the replication stage of HCV life cycle. The second group binds IPO5 and is active during both early replication and early assembly. This work delineates the entire life cycle of HCV and the active involvement of NLS sequences during HCV replication and assembly. Given the abundance of NLS sequences within HCV proteins, our previous finding that Nups play a role in HCV infection, and the relocation of the NLS double-GFP reporter in HCV infected cells, this work supports our previous hypothesis that NPC-like structures and nuclear transport factors function in the membranous web to create an environment conducive to viral replication.

  16. [Low-molecular-weight regulators of biogenic polyamine metabolism affect cytokine production and expression of hepatitis С virus proteins in Huh7.5 human hepatocarcinoma cells].

    Science.gov (United States)

    Masalova, O V; Lesnova, E I; Samokhvalov, E I; Permyakova, K Yu; Ivanov, A V; Kochetkov, S N; Kushch, A A

    2017-01-01

    Hepatitis C virus (HCV) induces the expression of the genes of proinflammatory cytokines, the excessive production of which may cause cell death, and contribute to development of liver fibrosis and hepatocarcinoma. The relationship between cytokine production and metabolic disorders in HCV-infected cells remains obscure. The levels of biogenic polyamines, spermine, spermidine, and their precursor putrescine, may be a potential regulator of these processes. The purpose of the present work was to study the effects of the compounds which modulate biogenic polyamines metabolism on cytokine production and HCV proteins expression. Human hepatocarcinoma Huh7.5 cells have been transfected with the plasmids that encode HCV proteins and further incubated with the following low-molecular compounds that affect different stages of polyamine metabolism: (1) difluoromethylornithine (DFMO), the inhibitor of ornithine decarboxylase, the enzyme that catalyzes the biosynthesis of polyamines; (2) N,N'-bis(2,3-butane dienyl)-1,4-diaminobutane (MDL72.527), the inhibitor of proteins involved in polyamine degradation; and (3) synthetic polyamine analog N^(I),N^(II)-diethylnorspermine (DENSpm), an inducer of polyamine degradation enzyme. The intracellular accumulation and secretion of cytokines (IL-6, IL-1β, TNF-α, and TGF-β) was assessed by immunocytochemistry and in the immunoenzyme assay, while the cytokine gene expression was studied using reverse transcription and PCR. The effects of the compounds under analysis on the expression of HCV proteins were analyzed using the indirect immunofluorescence with anti-HCV monoclonal antibodies. It has been demonstrated that, in cells transfected with HCV genes, DFMO reduces the production of three out of four tested cytokines, namely, TNF-α and TGF-β in cells that express HCV core, Е1Е2, NS3, NS5A, and NS5B proteins, and IL-1β in the cells that express HCV core, Е1Е2, and NS3 proteins. MDL72527 and DENSpm decreased cytokine production

  17. Protein nanoparticles for therapeutic protein delivery.

    Science.gov (United States)

    Herrera Estrada, L P; Champion, J A

    2015-06-01

    Therapeutic proteins can face substantial challenges to their activity, requiring protein modification or use of a delivery vehicle. Nanoparticles can significantly enhance delivery of encapsulated cargo, but traditional small molecule carriers have some limitations in their use for protein delivery. Nanoparticles made from protein have been proposed as alternative carriers and have benefits specific to therapeutic protein delivery. This review describes protein nanoparticles made by self-assembly, including protein cages, protein polymers, and charged or amphipathic peptides, and by desolvation. It presents particle fabrication and delivery characterization for a variety of therapeutic and model proteins, as well as comparison of the features of different protein nanoparticles.

  18. Probing the Mechanism of pH-Induced Large-Scale Conformational Changes in Dengue Virus Envelope Protein Using Atomistic Simulations

    Science.gov (United States)

    Prakash, Meher K.; Barducci, Alessandro; Parrinello, Michele

    2010-01-01

    Abstract One of the key steps in the infection of the cell by dengue virus is a pH-induced conformational change of the viral envelope proteins. These envelope proteins undergo a rearrangement from a dimer to a trimer, with large conformational changes in the monomeric unit. In this article, metadynamics simulations were used to enable us to understand the mechanism of these large-scale changes in the monomer. By using all-atom, explicit solvent simulations of the monomers, the stability of the protein structure is studied under low and high pH conditions. Free energy profiles obtained along appropriate collective coordinates demonstrate that pH affects the domain interface in both the conformations of E monomer, stabilizing one and destabilizing the other. These simulations suggest a mechanism with an intermediate detached state between the two monomeric structures. Using further analysis, we comment on the key residue interactions responsible for the instability and the pH-sensing role of a histidine that could not otherwise be studied experimentally. The insights gained from this study and methodology can be extended for studying similar mechanisms in the E proteins of the other members of class II flavivirus family. PMID:20643078

  19. Precisely Molded Nanoparticle Displaying DENV-E Proteins Induces Robust Serotype-Specific Neutralizing Antibody Responses.

    Directory of Open Access Journals (Sweden)

    Stefan W Metz

    2016-10-01

    Full Text Available Dengue virus (DENV is the causative agent of dengue fever and dengue hemorrhagic fever. The virus is endemic in over 120 countries, causing over 350 million infections per year. Dengue vaccine development is challenging because of the need to induce simultaneous protection against four antigenically distinct DENV serotypes and evidence that, under some conditions, vaccination can enhance disease due to specific immunity to the virus. While several live-attenuated tetravalent dengue virus vaccines display partial efficacy, it has been challenging to induce balanced protective immunity to all 4 serotypes. Instead of using whole-virus formulations, we are exploring the potentials for a particulate subunit vaccine, based on DENV E-protein displayed on nanoparticles that have been precisely molded using Particle Replication in Non-wetting Template (PRINT technology. Here we describe immunization studies with a DENV2-nanoparticle vaccine candidate. The ectodomain of DENV2-E protein was expressed as a secreted recombinant protein (sRecE, purified and adsorbed to poly (lactic-co-glycolic acid (PLGA nanoparticles of different sizes and shape. We show that PRINT nanoparticle adsorbed sRecE without any adjuvant induces higher IgG titers and a more potent DENV2-specific neutralizing antibody response compared to the soluble sRecE protein alone. Antigen trafficking indicate that PRINT nanoparticle display of sRecE prolongs the bio-availability of the antigen in the draining lymph nodes by creating an antigen depot. Our results demonstrate that PRINT nanoparticles are a promising platform for delivering subunit vaccines against flaviviruses such as dengue and Zika.

  20. West Nile virus differentially modulates the unfolded protein response to facilitate replication and immune evasion.

    Science.gov (United States)

    Ambrose, Rebecca L; Mackenzie, Jason M

    2011-03-01

    For intracellular survival it is imperative that viruses have the capacity to manipulate various cellular responses, including metabolic and biosynthetic pathways. The unfolded protein response (UPR) is induced by various external and internal stimuli, including the accumulation of misfolded proteins in the endoplasmic reticulum (ER). Our previous studies have indicated that the replication and assembly of the flavivirus West Nile virus strain Kunjin virus (WNV(KUN)) is intimately associated with the ER. Thus, we sought to determine whether the UPR was induced during WNV(KUN) infection. WNV(KUN) induces UPR signaling during replication, which is coordinated with peak replication. Interestingly, signaling is biased toward the ATF6/IRE-1 arm of the response, with high levels of Xbp-1 activation but negligible eukaryotic translation initiation factor 2α phosphorylation and downstream transcription. We show that the PERK-mediated response may partially regulate replication, since external UPR stimulation had a limiting effect on early replication events and cells deficient for PERK demonstrated increased replication and virus release. Significantly, we show that the WNV(KUN) hydrophobic nonstructural proteins NS4A and NS4B are potent inducers of the UPR, which displayed a high correlation in inhibiting Jak-STAT signaling in response to alpha interferon (IFN-α). Sequential removal of the transmembrane domains of NS4A showed that reducing hydrophobicity decreased UPR signaling and restored IFN-α-mediated activation. Overall, these results suggest that WNV(KUN) can stimulate the UPR to facilitate replication and that the induction of a general ER stress response, regulated by hydrophobic WNV(KUN) proteins, can potentiate the inhibition of the antiviral signaling pathway.

  1. Predicted protein interactions of IFITMs may shed light on mechanisms of Zika virus-induced microcephaly and host invasion [version 2; referees: 2 approved, 1 approved with reservations, 1 not approved

    Directory of Open Access Journals (Sweden)

    Madhavi K. Ganapathiraju

    2017-11-01

    Full Text Available After the first reported case of Zika virus (ZIKV in Brazil, in 2015, a significant increase in the reported cases of microcephaly was observed. Microcephaly is a neurological condition in which the infant’s head is significantly smaller with complications in brain development. Recently, two small membrane-associated interferon-inducible transmembrane proteins (IFITM1 and IFITM3 have been shown to repress members of the flaviviridae family which includes ZIKV. However, the exact mechanisms leading to the inhibition of the virus are yet unknown. Here, we assembled an interactome of IFITM1 and IFITM3 with known protein-protein interactions (PPIs collected from publicly available databases and novel PPIs predicted using the High-confidence Protein-Protein Interaction Prediction (HiPPIP model. We analyzed the functional and pathway associations of the interacting proteins, and found that there are several immunity pathways (toll-like receptor signaling, cd28 signaling in T-helper cells, crosstalk between dendritic cells and natural killer cells, neuronal pathways (axonal guidance signaling, neural tube closure and actin cytoskeleton signaling and developmental pathways (neural tube closure, embryonic skeletal system development that are associated with these interactors. Our novel PPIs associate cilia dysfunction in ependymal cells to microcephaly, and may also shed light on potential targets of ZIKV for host invasion by immunosuppression and cytoskeletal rearrangements. These results could help direct future research in elucidating the mechanisms underlying host defense to ZIKV and other flaviviruses.

  2. Recombinant protein production technology

    Science.gov (United States)

    Recombinant protein production is an important technology for antibody production, biochemical activity study, and structural determination during the post-genomic era. Limiting factors in recombinant protein production include low-level protein expression, protein precipitation, and loss of protein...

  3. Aquaporin Protein-Protein Interactions

    Directory of Open Access Journals (Sweden)

    Jennifer Virginia Roche

    2017-10-01

    Full Text Available Aquaporins are tetrameric membrane-bound channels that facilitate transport of water and other small solutes across cell membranes. In eukaryotes, they are frequently regulated by gating or trafficking, allowing for the cell to control membrane permeability in a specific manner. Protein–protein interactions play crucial roles in both regulatory processes and also mediate alternative functions such as cell adhesion. In this review, we summarize recent knowledge about aquaporin protein–protein interactions; dividing the interactions into three types: (1 interactions between aquaporin tetramers; (2 interactions between aquaporin monomers within a tetramer (hetero-tetramerization; and (3 transient interactions with regulatory proteins. We particularly focus on the structural aspects of the interactions, discussing the small differences within a conserved overall fold that allow for aquaporins to be differentially regulated in an organism-, tissue- and trigger-specific manner. A deep knowledge about these differences is needed to fully understand aquaporin function and regulation in many physiological processes, and may enable design of compounds targeting specific aquaporins for treatment of human disease.

  4. Protein immobilization strategies for protein biochips

    NARCIS (Netherlands)

    Rusmini, F.; Rusmini, Federica; Zhong, Zhiyuan; Feijen, Jan

    2007-01-01

    In the past few years, protein biochips have emerged as promising proteomic and diagnostic tools for obtaining information about protein functions and interactions. Important technological innovations have been made. However, considerable development is still required, especially regarding protein

  5. Illustrating and homology modeling the proteins of the Zika virus [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sean Ekins

    2016-09-01

    Full Text Available The Zika virus (ZIKV is a flavivirus of the family Flaviviridae, which is similar to dengue virus, yellow fever and West Nile virus. Recent outbreaks in South America, Latin America, the Caribbean and in particular Brazil have led to concern for the spread of the disease and potential to cause Guillain-Barré syndrome and microcephaly. Although ZIKV has been known of for over 60 years there is very little in the way of knowledge of the virus with few publications and no crystal structures. No antivirals have been tested against it either in vitro or in vivo. ZIKV therefore epitomizes a neglected disease. Several suggested steps have been proposed which could be taken to initiate ZIKV antiviral drug discovery using both high throughput screens as well as structure-based design based on homology models for the key proteins. We now describe preliminary homology models created for NS5, FtsJ, NS4B, NS4A, HELICc, DEXDc, peptidase S7, NS2B, NS2A, NS1, E stem, glycoprotein M, propeptide, capsid and glycoprotein E using SWISS-MODEL. Eleven out of 15 models pass our model quality criteria for their further use. While a ZIKV glycoprotein E homology model was initially described in the immature conformation as a trimer, we now describe the mature dimer conformer which allowed the construction of an illustration of the complete virion. By comparing illustrations of ZIKV based on this new homology model and the dengue virus crystal structure we propose potential differences that could be exploited for antiviral and vaccine design. The prediction of sites for glycosylation on this protein may also be useful in this regard. While we await a cryo-EM structure of ZIKV and eventual crystal structures of the individual proteins, these homology models provide the community with a starting point for structure-based design of drugs and vaccines as well as a for computational virtual screening.

  6. Learning about Proteins

    Science.gov (United States)

    ... Videos for Educators Search English Español Learning About Proteins KidsHealth / For Kids / Learning About Proteins What's in ... from the foods you eat. Different Kinds of Protein Protein from animal sources, such as meat and ...

  7. Suppression of host immune response by the core protein of hepatitis C virus: possible implications for hepatitis C virus persistence.

    Science.gov (United States)

    Large, M K; Kittlesen, D J; Hahn, Y S

    1999-01-15

    Hepatitis C virus (HCV) is a major human pathogen causing mild to severe liver disease worldwide. This positive strand RNA virus is remarkably efficient at establishing chronic infections. Although a high rate of genetic variability may facilitate viral escape and persistence in the face of Ag-specific immune responses, HCV may also encode proteins that facilitate evasion of immunological surveillance. To address the latter possibility, we examined the influence of specific HCV gene products on the host immune response to vaccinia virus in a murine model. Various vaccinia/HCV recombinants expressing different regions of the HCV polyprotein were used for i.p. inoculation of BALB/c mice. Surprisingly, a recombinant expressing the N-terminal half of the polyprotein (including the structural proteins, p7, NS2, and a portion of NS3; vHCV-S) led to a dose-dependent increase in mortality. Increased mortality was not observed for a recombinant expressing the majority of the nonstructural region or for a negative control virus expressing the beta-galactosidase protein. Examination of T cell responses in these mice revealed a marked suppression of vaccinia-specific CTL responses and a depressed production of IFN-gamma and IL-2. By using a series of vaccinia/HCV recombinants, we found that the HCV core protein was sufficient for immunosuppression, prolonged viremia, and increased mortality. These results suggest that the HCV core protein plays an important role in the establishment and maintenance of HCV infection by suppressing host immune responses, in particular the generation of virus-specific CTLs.

  8. Structure-based mutational analysis of several sites in the E protein: implications for understanding the entry mechanism of Japanese encephalitis virus.

    Science.gov (United States)

    Liu, Haibin; Liu, Yi; Wang, Shaobo; Zhang, Yanjun; Zu, Xiangyang; Zhou, Zheng; Zhang, Bo; Xiao, Gengfu

    2015-05-01

    Japanese encephalitis virus (JEV), which causes viral encephalitis in humans, is a serious risk to global public health. The JEV envelope protein mediates the viral entry pathway, including receptor-binding and low-pH-triggered membrane fusion. Utilizing mutagenesis of a JEV infectious cDNA clone, mutations were introduced into the potential receptor-binding motif or into residues critical for membrane fusion in the envelope protein to systematically investigate the JEV entry mechanism. We conducted experiments evaluating infectious particle, recombinant viral particle, and virus-like particle production and found that most mutations impaired virus production. Subcellular fractionation confirmed that five mutations--in I0, ij, BC, and FG and the R9A substitution-impaired virus assembly, and the assembled virus particles of another five mutations--in kl and the E373A, F407A, L221S, and W217A substitutions--were not released into the secretory pathway. Next, we examined the entry activity of six mutations yielding infectious virus. The results showed N154 and the DE loop are not the only or major receptor-binding motifs for JEV entry into BHK-21 cells; four residues, H144, H319, T410, and Q258, participating in the domain I (DI)-DIII interaction or zippering reaction are important to maintain the efficiency of viral membrane fusion. By continuous passaging of mutants, adaptive mutations from negatively charged amino acids to positively charged or neutral amino acids, such as E138K and D389G, were selected and could restore the viral entry activity. Recently, there has been much interest in the entry mechanism of flaviviruses into host cells, including the viral entry pathway and membrane fusion mechanism. Our study provides strong evidence for the critical role of several residues in the envelope protein in the assembly, release, and entry of JEV, which also contributes to our understanding of the flaviviral entry mechanism. Furthermore, we demonstrate that the H144A

  9. Fusion-protein-assisted protein crystallization.

    Science.gov (United States)

    Kobe, Bostjan; Ve, Thomas; Williams, Simon J

    2015-07-01

    Fusion proteins can be used directly in protein crystallization to assist crystallization in at least two different ways. In one approach, the `heterologous fusion-protein approach', the fusion partner can provide additional surface area to promote crystal contact formation. In another approach, the `fusion of interacting proteins approach', protein assemblies can be stabilized by covalently linking the interacting partners. The linker connecting the proteins plays different roles in the two applications: in the first approach a rigid linker is required to reduce conformational heterogeneity; in the second, conversely, a flexible linker is required that allows the native interaction between the fused proteins. The two approaches can also be combined. The recent applications of fusion-protein technology in protein crystallization from the work of our own and other laboratories are briefly reviewed.

  10. Membrane bending by protein-protein crowding.

    Science.gov (United States)

    Stachowiak, Jeanne C; Schmid, Eva M; Ryan, Christopher J; Ann, Hyoung Sook; Sasaki, Darryl Y; Sherman, Michael B; Geissler, Phillip L; Fletcher, Daniel A; Hayden, Carl C

    2012-09-01

    Curved membranes are an essential feature of dynamic cellular structures, including endocytic pits, filopodia protrusions and most organelles. It has been proposed that specialized proteins induce curvature by binding to membranes through two primary mechanisms: membrane scaffolding by curved proteins or complexes; and insertion of wedge-like amphipathic helices into the membrane. Recent computational studies have raised questions about the efficiency of the helix-insertion mechanism, predicting that proteins must cover nearly 100% of the membrane surface to generate high curvature, an improbable physiological situation. Thus, at present, we lack a sufficient physical explanation of how protein attachment bends membranes efficiently. On the basis of studies of epsin1 and AP180, proteins involved in clathrin-mediated endocytosis, we propose a third general mechanism for bending fluid cellular membranes: protein-protein crowding. By correlating membrane tubulation with measurements of protein densities on membrane surfaces, we demonstrate that lateral pressure generated by collisions between bound proteins drives bending. Whether proteins attach by inserting a helix or by binding lipid heads with an engineered tag, protein coverage above ~20% is sufficient to bend membranes. Consistent with this crowding mechanism, we find that even proteins unrelated to membrane curvature, such as green fluorescent protein (GFP), can bend membranes when sufficiently concentrated. These findings demonstrate a highly efficient mechanism by which the crowded protein environment on the surface of cellular membranes can contribute to membrane shape change.

  11. EDITORIAL: Precision proteins Precision proteins

    Science.gov (United States)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  12. Protein docking prediction using predicted protein-protein interface

    Directory of Open Access Journals (Sweden)

    Li Bin

    2012-01-01

    Full Text Available Abstract Background Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. Results We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm, is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. Conclusion We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

  13. In silico design of a Zika virus non-structural protein 5 aiming vaccine protection against zika and dengue in different human populations.

    Science.gov (United States)

    Dos Santos Franco, Lorrany; Oliveira Vidal, Paloma; Amorim, Jaime Henrique

    2017-11-23

    The arboviruses Zika virus (ZIKV) and Dengue virus (DENV) have important epidemiological impact in Brazil and other tropical regions of the world. Recently, it was shown that previous humoral immunity to DENV enhances ZIKV replication in vitro, which may lead to more severe forms of the disease. Thus, traditional approaches of vaccine development aiming to control viral infection through neutralizing antibodies may induce cross-reactive enhancing antibodies. In contrast, cellular immune response was shown to be capable of controlling DENV infection independently of antibodies. The aim of the present study was to design a flavivirus NS5 protein capable of inducing a cellular immune response against DENV and ZIKV. A consensus sequence of ZIKV NS5 protein was designed among isolates from various continents. Epitopes were predicted for the most prevalent alleles of class I and II HLA in the Brazilian population. Then, this epitopes were analyzed with regard to their conservation, population coverage and distribution along the whole antigen. Nineteen epitopes predicted to be more reactive (percentile rank immune response to ZIKV and DENV in different human populations of the world.

  14. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  15. Our interests in protein-protein interactions

    Indian Academy of Sciences (India)

    protein interactions. Evolution of P-P partnerships. Evolution of P-P structures. Evolutionary dynamics of P-P interactions. Dynamics of P-P interaction network. Host-pathogen interactions. CryoEM mapping of gigantic protein assemblies.

  16. Evolution of protein-protein interactions

    Indian Academy of Sciences (India)

    Evolution of protein-protein interactions · Our interests in protein-protein interactions · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19 · Slide 20.

  17. Ontological visualization of protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Hill David P

    2005-02-01

    Full Text Available Abstract Background Cellular processes require the interaction of many proteins across several cellular compartments. Determining the collective network of such interactions is an important aspect of understanding the role and regulation of individual proteins. The Gene Ontology (GO is used by model organism databases and other bioinformatics resources to provide functional annotation of proteins. The annotation process provides a mechanism to document the binding of one protein with another. We have constructed protein interaction networks for mouse proteins utilizing the information encoded in the GO annotations. The work reported here presents a methodology for integrating and visualizing information on protein-protein interactions. Results GO annotation at Mouse Genome Informatics (MGI captures 1318 curated, documented interactions. These include 129 binary interactions and 125 interaction involving three or more gene products. Three networks involve over 30 partners, the largest involving 109 proteins. Several tools are available at MGI to visualize and analyze these data. Conclusions Curators at the MGI database annotate protein-protein interaction data from experimental reports from the literature. Integration of these data with the other types of data curated at MGI places protein binding data into the larger context of mouse biology and facilitates the generation of new biological hypotheses based on physical interactions among gene products.

  18. 24-hour urine protein

    Science.gov (United States)

    Urine protein - 24 hour; Chronic kidney disease - urine protein; Kidney failure - urine protein ... Heart failure High blood pressure during pregnancy ( preeclampsia ) Kidney disease caused by diabetes, high blood pressure, autoimmune disorders, ...

  19. Protein-losing enteropathy

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  20. Protein in diet

    Science.gov (United States)

    Diet - protein ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a ... to eat animal products to get all the protein you need in your diet. Amino acids are ...

  1. Oligomeric protein structure networks: insights into protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Brinda KV

    2005-12-01

    Full Text Available Abstract Background Protein-protein association is essential for a variety of cellular processes and hence a large number of investigations are being carried out to understand the principles of protein-protein interactions. In this study, oligomeric protein structures are viewed from a network perspective to obtain new insights into protein association. Structure graphs of proteins have been constructed from a non-redundant set of protein oligomer crystal structures by considering amino acid residues as nodes and the edges are based on the strength of the non-covalent interactions between the residues. The analysis of such networks has been carried out in terms of amino acid clusters and hubs (highly connected residues with special emphasis to protein interfaces. Results A variety of interactions such as hydrogen bond, salt bridges, aromatic and hydrophobic interactions, which occur at the interfaces are identified in a consolidated manner as amino acid clusters at the interface, from this study. Moreover, the characterization of the highly connected hub-forming residues at the interfaces and their comparison with the hubs from the non-interface regions and the non-hubs in the interface regions show that there is a predominance of charged interactions at the interfaces. Further, strong and weak interfaces are identified on the basis of the interaction strength between amino acid residues and the sizes of the interface clusters, which also show that many protein interfaces are stronger than their monomeric protein cores. The interface strengths evaluated based on the interface clusters and hubs also correlate well with experimentally determined dissociation constants for known complexes. Finally, the interface hubs identified using the present method correlate very well with experimentally determined hotspots in the interfaces of protein complexes obtained from the Alanine Scanning Energetics database (ASEdb. A few predictions of interface hot

  2. Intracellular hepatitis C modeling predicts infection dynamics and viral protein mechanisms.

    Science.gov (United States)

    Aunins, Thomas R; Marsh, Katherine A; Subramanya, Gitanjali; Uprichard, Susan L; Perelson, Alan S; Chatterjee, Anushree

    2018-03-21

    Hepatitis C virus infection is a global health problem, with nearly 2 million new infections occurring every year and up to 85% of these becoming chronic infections that pose serious long-term health risks. To effectively reduce the prevalence of HCV infection and associated diseases, it is important to understand the intracellular dynamics of the viral lifecycle. Here, we present a detailed mathematical model that represents the full hepatitis C lifecycle. It is the first full HCV model to be fit to acute intracellular infection data and the first to explore the functions of distinct viral proteins, probing multiple hypotheses of cis - and trans -acting mechanisms to provide insights for drug targeting. Model parameters were derived from the literature, experiments, and fitting to experimental intracellular viral RNA, extracellular viral titer, and HCV core and NS3 protein kinetic data from viral inoculation to steady-state. Our model predicts faster rates for protein translation and polyprotein cleavage than previous replicon models and demonstrates that the processes of translation and synthesis of viral RNA have the most influence on the levels of the species we tracked in experiments. Overall, our experimental data and the resulting mathematical infection model reveal information about the regulation of core protein during infection, produce specific insights into the roles of the viral core, NS5A, and NS5B proteins, and demonstrate the sensitivities of viral proteins and RNA to distinct reactions within the lifecycle. IMPORTANCE We have designed a model for the full lifecycle of hepatitis C virus. Past efforts have largely focused on modeling hepatitis C replicon systems, in which transfected subgenomic HCV RNA maintains autonomous replication in the absence of virion production or spread. We started with the general structure of these previous replicon models and expanded to create a model that incorporates the full virus lifecycle as well as additional

  3. Protein surface shielding agents in protein crystallization

    International Nuclear Information System (INIS)

    Hašek, J.

    2011-01-01

    The crystallization process can be controlled by protein surface shielding agents blocking undesirable competitive adhesion modes during non-equilibrium processes of deposition of protein molecules on the surface of growing crystalline blocks. The hypothesis is based on a number of experimental proofs from diffraction experiments and also retrieved from the Protein Data Bank. The molecules adhering temporarily on the surface of protein molecules change the propensity of protein molecules to deposit on the crystal surface in a definite position and orientation. The concepts of competitive adhesion modes and protein surface shielding agents acting on the surface of molecules in a non-equilibrium process of protein crystallization provide a useful platform for the control of crystallization. The desirable goal, i.e. a transient preference of a single dominating adhesion mode between protein molecules during crystallization, leads to uniform deposition of proteins in a crystal. This condition is the most important factor for diffraction quality and thus also for the accuracy of protein structure determination. The presented hypothesis is a generalization of the experimentally well proven behaviour of hydrophilic polymers on the surface of protein molecules of other compounds

  4. Insight into SNPs and epitopes of E protein of newly emerged genotype-I isolates of JEV from Midnapur, West Bengal, India.

    Science.gov (United States)

    Banerjee, Shyamashree; Sen Gupta, Parth Sarthi; Bandyopadhyay, Amal Kumar

    2017-03-06

    Japanese encephalitis virus (JEV) is a mosquito-borne flavivirus that causes Japanese Encephalitis (JE) and Acute Encephalitis Syndrome (AES) in humans. Genotype-I (as co-circulating cases with Genotype-III) was isolated in 2010 (JEV28, JEV21) and then in 2011 (JEV45) from Midnapur district, West Bengal (WB) for the first time from clinical patients who were previously been vaccinated with live attenuated SA14-14-2 strain. We apply bioinformatics and immunoinformatics on sequence and structure of E protein for analysis of crucial substitutions that might cause the genotypic transition, affecting protein-function and altering specificity of epitopes. Although frequency of substitutions in E glycoprotein of JEV28, JEV21 and JEV45 isolates vary, its homologous patterns remain exactly similar as earlier Japan isolate (Ishikawa). Sequence and 3D model-structure based analyses of E protein show that only four of all substitutions are critical for genotype-I specific effect of which N103K is common among all isolates indicating its role in the transition of genotype-III to genotype-I. Predicted B-cell and T-cell epitopes are seen to harbor these critical substitutions that affect overall conformational stability of the protein. These epitopes were subjected to conservation analyses using a large set of the protein from Asian continent. The study identifies crucial substitutions that contribute to the emergence of genotype-I. Predicted epitopes harboring these substitutions may alter specificity which might be the reason of reported failure of vaccine. Conservation analysis of these epitopes would be useful for design of genotype-I specific vaccine.

  5. Nanotechnologies in protein microarrays.

    Science.gov (United States)

    Krizkova, Sona; Heger, Zbynek; Zalewska, Marta; Moulick, Amitava; Adam, Vojtech; Kizek, Rene

    2015-01-01

    Protein microarray technology became an important research tool for study and detection of proteins, protein-protein interactions and a number of other applications. The utilization of nanoparticle-based materials and nanotechnology-based techniques for immobilization allows us not only to extend the surface for biomolecule immobilization resulting in enhanced substrate binding properties, decreased background signals and enhanced reporter systems for more sensitive assays. Generally in contemporarily developed microarray systems, multiple nanotechnology-based techniques are combined. In this review, applications of nanoparticles and nanotechnologies in creating protein microarrays, proteins immobilization and detection are summarized. We anticipate that advanced nanotechnologies can be exploited to expand promising fields of proteins identification, monitoring of protein-protein or drug-protein interactions, or proteins structures.

  6. Substitutions at NS3 Residue 155, 156, or 168 of Hepatitis C Virus Genotypes 2 to 6 Induce Complex Patterns of Protease Inhibitor Resistance

    DEFF Research Database (Denmark)

    Jensen, Sanne B.; Serre, Stephanie B. N.; Humes, Daryl G.

    2015-01-01

    but were not characterized systematically. To elucidate the impact of key PI resistance substitutions on genotypes 2-6, we engineered the substitutions R155A/E/G/H/K/Q/T, A156G/S/T/V, D/Q168A/E/G/H/N/V into HCV recombinants expressing genotype 2-6 proteases. We evaluated viral fitness and sensitivity...... resistant. For the remaining PIs, most genotype 2-, 4-, 5-, and 6-, but not genotype 3-variants, showed varying resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants.This is the first comprehensive study revealing the impact of described key PI...

  7. Mutations in the NS2B and NS3 genes affect mouse neuroinvasiveness of a Western European field strain of tick-borne encephalitis virus

    Czech Academy of Sciences Publication Activity Database

    Růžek, Daniel; Gritsun, T. S.; Forrester, N. L.; Gould, E. A.; Kopecký, Jan; Golovchenko, Maryna; Rudenko, Natalia; Grubhoffer, Libor

    2008-01-01

    Roč. 374, č. 2 (2008), s. 249-255 ISSN 0042-6822 R&D Projects: GA ČR GA524/08/1509; GA ČR(CZ) GA524/06/1479; GA MŠk(CZ) LC06009 Grant - others:European Commission(GB) LSHG-CT-2004-511960 Institutional research plan: CEZ:AV0Z60220518 Keywords : tick-borne encephalitis virus * neuroinvasiveness * viral phenotype Subject RIV: EE - Microbiology, Virology Impact factor: 3.539, year: 2008

  8. Differential efficacy of protease inhibitors against HCV genotypes 2a, 3a, 5a, and 6a NS3/4A protease recombinant viruses

    DEFF Research Database (Denmark)

    Gottwein, Judith M; Scheel, Troels K H; Jensen, Tanja B

    2011-01-01

    The hepatitis C virus (HCV) genotype influences efficacy of interferon (IFN)-based therapy. HCV protease inhibitors are being licensed for treatment of genotype 1 infection. Because there are limited or no data on efficacy against HCV genotypes 2-7, we aimed at developing recombinant infectious c...

  9. Protein sequence comparison and protein evolution

    Energy Technology Data Exchange (ETDEWEB)

    Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  10. Protein digestion in ruminants

    African Journals Online (AJOL)

    digestibility, or the contribution of endogenous protein to the indigestible feed .... endogenous protein fractions. Alternatively, Stern & Satter (1984) suggested a method whereby the increased protein outflow to the small intestine, resulting from the incremental addition of ..... definition of the various protein fractions. Finally ...

  11. The Protein Model Portal

    OpenAIRE

    Arnold, Konstantin; Kiefer, Florian; Kopp, J?rgen; Battey, James N. D.; Podvinec, Michael; Westbrook, John D.; Berman, Helen M.; Bordoli, Lorenza; Schwede, Torsten

    2008-01-01

    Structural Genomics has been successful in determining the structures of many unique proteins in a high throughput manner. Still, the number of known protein sequences is much larger than the number of experimentally solved protein structures. Homology (or comparative) modeling methods make use of experimental protein structures to build models for evolutionary related proteins. Thereby, experimental structure determination efforts and homology modeling complement each other in the exploratio...

  12. Photoswitchable cyan fluorescent protein for protein tracking.

    Science.gov (United States)

    Chudakov, Dmitriy M; Verkhusha, Vladislav V; Staroverov, Dmitry B; Souslova, Ekaterina A; Lukyanov, Sergey; Lukyanov, Konstantin A

    2004-11-01

    In recent years diverse photolabeling techniques using green fluorescent protein (GFP)-like proteins have been reported, including photoactivatable PA-GFP, photoactivatable protein Kaede, the DsRed 'greening' technique and kindling fluorescent proteins. So far, only PA-GFP, which is monomeric and gives 100-fold fluorescence contrast, could be applied for protein tracking. Here we describe a dual-color monomeric protein, photoswitchable cyan fluorescent protein (PS-CFP). PS-CFP is capable of efficient photoconversion from cyan to green, changing both its excitation and emission spectra in response to 405-nm light irradiation. Complete photoactivation of PS-CFP results in a 1,500-fold increase in the green-to-cyan fluorescence ratio, making it the highest-contrast monomeric photoactivatable fluorescent protein described to date. We used PS-CFP as a photoswitchable tag to study trafficking of human dopamine transporter in living cells. At moderate excitation intensities, PS-CFP can be used as a pH-stable cyan label for protein tagging and fluorescence resonance energy transfer applications.

  13. Protein- protein interaction detection system using fluorescent protein microdomains

    Science.gov (United States)

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  14. Comparing side chain packing in soluble proteins, protein-protein interfaces, and transmembrane proteins.

    Science.gov (United States)

    Gaines, J C; Acebes, S; Virrueta, A; Butler, M; Regan, L; O'Hern, C S

    2018-05-01

    We compare side chain prediction and packing of core and non-core regions of soluble proteins, protein-protein interfaces, and transmembrane proteins. We first identified or created comparable databases of high-resolution crystal structures of these 3 protein classes. We show that the solvent-inaccessible cores of the 3 classes of proteins are equally densely packed. As a result, the side chains of core residues at protein-protein interfaces and in the membrane-exposed regions of transmembrane proteins can be predicted by the hard-sphere plus stereochemical constraint model with the same high prediction accuracies (>90%) as core residues in soluble proteins. We also find that for all 3 classes of proteins, as one moves away from the solvent-inaccessible core, the packing fraction decreases as the solvent accessibility increases. However, the side chain predictability remains high (80% within 30°) up to a relative solvent accessibility, rSASA≲0.3, for all 3 protein classes. Our results show that ≈40% of the interface regions in protein complexes are "core", that is, densely packed with side chain conformations that can be accurately predicted using the hard-sphere model. We propose packing fraction as a metric that can be used to distinguish real protein-protein interactions from designed, non-binding, decoys. Our results also show that cores of membrane proteins are the same as cores of soluble proteins. Thus, the computational methods we are developing for the analysis of the effect of hydrophobic core mutations in soluble proteins will be equally applicable to analyses of mutations in membrane proteins. © 2018 Wiley Periodicals, Inc.

  15. Conservation and variability of dengue virus proteins: implications for vaccine design.

    Directory of Open Access Journals (Sweden)

    Asif M Khan

    2008-08-01

    Full Text Available Genetic variation and rapid evolution are hallmarks of RNA viruses, the result of high mutation rates in RNA replication and selection of mutants that enhance viral adaptation, including the escape from host immune responses. Variability is uneven across the genome because mutations resulting in a deleterious effect on viral fitness are restricted. RNA viruses are thus marked by protein sites permissive to multiple mutations and sites critical to viral structure-function that are evolutionarily robust and highly conserved. Identification and characterization of the historical dynamics of the conserved sites have relevance to multiple applications, including potential targets for diagnosis, and prophylactic and therapeutic purposes.We describe a large-scale identification and analysis of evolutionarily highly conserved amino acid sequences of the entire dengue virus (DENV proteome, with a focus on sequences of 9 amino acids or more, and thus immune-relevant as potential T-cell determinants. DENV protein sequence data were collected from the NCBI Entrez protein database in 2005 (9,512 sequences and again in 2007 (12,404 sequences. Forty-four (44 sequences (pan-DENV sequences, mainly those of nonstructural proteins and representing approximately 15% of the DENV polyprotein length, were identical in 80% or more of all recorded DENV sequences. Of these 44 sequences, 34 ( approximately 77% were present in >or=95% of sequences of each DENV type, and 27 ( approximately 61% were conserved in other Flaviviruses. The frequencies of variants of the pan-DENV sequences were low (0 to approximately 5%, as compared to variant frequencies of approximately 60 to approximately 85% in the non pan-DENV sequence regions. We further showed that the majority of the conserved sequences were immunologically relevant: 34 contained numerous predicted human leukocyte antigen (HLA supertype-restricted peptide sequences, and 26 contained T-cell determinants identified by

  16. IGSF9 Family Proteins

    DEFF Research Database (Denmark)

    Hansen, Maria; Walmod, Peter Schledermann

    2013-01-01

    The Drosophila protein Turtle and the vertebrate proteins immunoglobulin superfamily (IgSF), member 9 (IGSF9/Dasm1) and IGSF9B are members of an evolutionarily ancient protein family. A bioinformatics analysis of the protein family revealed that invertebrates contain only a single IGSF9 family gene......, whereas vertebrates contain two to four genes. In cnidarians, the gene appears to encode a secreted protein, but transmembrane isoforms of the protein have also evolved, and in many species, alternative splicing facilitates the expression of both transmembrane and secreted isoforms. In most species......, the longest isoforms of the proteins have the same general organization as the neural cell adhesion molecule family of cell adhesion molecule proteins, and like this family of proteins, IGSF9 family members are expressed in the nervous system. A review of the literature revealed that Drosophila Turtle...

  17. Prediction of Protein-Protein Interactions Related to Protein Complexes Based on Protein Interaction Networks

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2015-01-01

    Full Text Available A method for predicting protein-protein interactions based on detected protein complexes is proposed to repair deficient interactions derived from high-throughput biological experiments. Protein complexes are pruned and decomposed into small parts based on the adaptive k-cores method to predict protein-protein interactions associated with the complexes. The proposed method is adaptive to protein complexes with different structure, number, and size of nodes in a protein-protein interaction network. Based on different complex sets detected by various algorithms, we can obtain different prediction sets of protein-protein interactions. The reliability of the predicted interaction sets is proved by using estimations with statistical tests and direct confirmation of the biological data. In comparison with the approaches which predict the interactions based on the cliques, the overlap of the predictions is small. Similarly, the overlaps among the predicted sets of interactions derived from various complex sets are also small. Thus, every predicted set of interactions may complement and improve the quality of the original network data. Meanwhile, the predictions from the proposed method replenish protein-protein interactions associated with protein complexes using only the network topology.

  18. Personalizing Protein Nourishment

    Science.gov (United States)

    DALLAS, DAVID C.; SANCTUARY, MEGAN R.; QU, YUNYAO; KHAJAVI, SHABNAM HAGHIGHAT; VAN ZANDT, ALEXANDRIA E.; DYANDRA, MELISSA; FRESE, STEVEN A.; BARILE, DANIELA; GERMAN, J. BRUCE

    2016-01-01

    Proteins are not equally digestible—their proteolytic susceptibility varies by their source and processing method. Incomplete digestion increases colonic microbial protein fermentation (putrefaction), which produces toxic metabolites that can induce inflammation in vitro and have been associated with inflammation in vivo. Individual humans differ in protein digestive capacity based on phenotypes, particularly disease states. To avoid putrefaction-induced intestinal inflammation, protein sources and processing methods must be tailored to the consumer’s digestive capacity. This review explores how food processing techniques alter protein digestibility and examines how physiological conditions alter digestive capacity. Possible solutions to improving digestive function or matching low digestive capacity with more digestible protein sources are explored. Beyond the ileal digestibility measurements of protein digestibility, less invasive, quicker and cheaper techniques for monitoring the extent of protein digestion and fermentation are needed to personalize protein nourishment. Biomarkers of protein digestive capacity and efficiency can be identified with the toolsets of peptidomics, metabolomics, microbial sequencing and multiplexed protein analysis of fecal and urine samples. By monitoring individual protein digestive function, the protein component of diets can be tailored via protein source and processing selection to match individual needs to minimize colonic putrefaction and, thus, optimize gut health. PMID:26713355

  19. Polymer Directed Protein Assemblies

    Directory of Open Access Journals (Sweden)

    Patrick van Rijn

    2013-05-01

    Full Text Available Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e.g., virus particles. Viruses are a multi-protein assembly of which the morphology is dictated by poly-nucleotides namely RNA or DNA. This “biopolymer” directs the proteins and imposes limitations on the structure like the length or diameter of the particle. Not only do these bionanoparticles use polymer-directed self-assembly, also processes like amyloid formation are in a way a result of directed protein assembly by partial unfolded/misfolded biopolymers namely, polypeptides. The combination of proteins and synthetic polymers, inspired by the natural processes, are therefore regarded as a highly promising area of research. Directed protein assembly is versatile with respect to the possible interactions which brings together the protein and polymer, e.g., electrostatic, v.d. Waals forces or covalent conjugation, and possible combinations are numerous due to the large amounts of different polymers and proteins available. The protein-polymer interacting behavior and overall morphology is envisioned to aid in clarifying protein-protein interactions and are thought to entail some interesting new functions and properties which will ultimately lead to novel bio-hybrid materials.

  20. Protein Data Bank (PDB)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Protein Data Bank (PDB) archive is the single worldwide repository of information about the 3D structures of large biological molecules, including proteins and...

  1. Protein electrophoresis - urine

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003589.htm Urine protein electrophoresis test To use the sharing features on this page, please enable JavaScript. The urine protein electrophoresis (UPEP) test is used to estimate how much ...

  2. Protein electrophoresis - serum

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003540.htm Protein electrophoresis - serum To use the sharing features on ... JavaScript. This lab test measures the types of protein in the fluid (serum) part of a blood ...

  3. Apo B100 similarities to viral proteins suggest basis for LDL-DNA binding and transfection capacity.

    Science.gov (United States)

    Guevara, Juan; Prashad, Nagindra; Ermolinsky, Boris; Gaubatz, John W; Kang, Dongcheul; Schwarzbach, Andrea E; Loose, David S; Guevara, Natalia Valentinova

    2010-07-01

    LDL mediates transfection with plasmid DNA in a variety of cell types in vitro and in several tissues in vivo in the rat. The transfection capacity of LDL is based on apo B100, as arginine/lysine clusters, suggestive of nucleic acid-binding domains and nuclear localization signal sequences, are present throughout the molecule. Apo E may also contribute to this capacity because of its similarity to the Dengue virus capsid proteins and its ability to bind DNA. Synthetic peptides representing two apo B100 regions with prominent Arg/Lys clusters were shown to bind DNA. Region 1 (0014Lys-Ser0160) shares sequence motifs present in DNA binding domains of Interferon Regulatory Factors and Flaviviridae capsid/core proteins. It also contains a close analog of the B/E receptor ligand of apo E. Region 1 peptides, B1-1 (0014Lys-Glu0054) and B1-2 (0055Leu-Ala0096), mediate transfection of HeLa cells but are cytotoxic. Region 2 (3313Asp-Thr3431), containing the known B/E receptor ligand, shares analog motifs with the human herpesvirus 5 immediate-early transcriptional regulator (UL122) and Flaviviridae NS3 helicases. Region 2 peptides, B2-1 (3313Asp-Glu3355), and B2-2 (3356Gly-Thr3431) are ineffective in cell transfection and are noncytotoxic. These results confirm the role of LDL as a natural transfection vector in vivo, a capacity imparted by the apo B100, and suggest a basis for Flaviviridae cell entry.

  4. CSF total protein

    Science.gov (United States)

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 milligrams per deciliter (mg/dL) ...

  5. Protein sequence databases.

    Science.gov (United States)

    Apweiler, Rolf; Bairoch, Amos; Wu, Cathy H

    2004-02-01

    A variety of protein sequence databases exist, ranging from simple sequence repositories, which store data with little or no manual intervention in the creation of the records, to expertly curated universal databases that cover all species and in which the original sequence data are enhanced by the manual addition of further information in each sequence record. As the focus of researchers moves from the genome to the proteins encoded by it, these databases will play an even more important role as central comprehensive resources of protein information. Several the leading protein sequence databases are discussed here, with special emphasis on the databases now provided by the Universal Protein Knowledgebase (UniProt) consortium.

  6. Protein hydration and dynamics

    International Nuclear Information System (INIS)

    Nakagawa, Hiroshi; Kataoka, Mikio

    2015-01-01

    Inelastic neutron scattering can measure the protein thermal fluctuations under the physiological aqueous environment, especially it is powerful to observe the low-energy protein dynamics in THz region, which are revealed theoretically to be coupled with solvations. Neutron enables the selective observation of protein and hydration water by deuteration. The complementary analysis with molecular dynamics simulation is also effective for the study of protein hydration. Some examples of the application toward the understanding of molecular basis of protein functions will be introduced. (author)

  7. Highly thermostable fluorescent proteins

    Science.gov (United States)

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

    2011-03-22

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  8. Targeting proteins for degradation.

    Science.gov (United States)

    Schrader, Erin K; Harstad, Kristine G; Matouschek, Andreas

    2009-11-01

    Protein degradation plays a central role in many cellular functions. Misfolded and damaged proteins are removed from the cell to avoid toxicity. The concentrations of regulatory proteins are adjusted by degradation at the appropriate time. Both foreign and native proteins are digested into small peptides as part of the adaptive immune response. In eukaryotic cells, an ATP-dependent protease called the proteasome is responsible for much of this proteolysis. Proteins are targeted for proteasomal degradation by a two-part degron, which consists of a proteasome binding signal and a degradation initiation site. Here we describe how both components contribute to the specificity of degradation.

  9. Protein supplementation with aging.

    Science.gov (United States)

    Bauer, Juergen M; Diekmann, Rebecca

    2015-01-01

    To highlight the recent evicence for optimal protein intake and protein supplementation in older adults. A special focus has been placed on the effects on muscle protein synthesis, strength and overall performance in this population. Although for older adults, some additional evidence on the benefits of a higher protein intake than 0.8 g/kg body weight per day has been provided, the results of studies focusing on the timing of protein intake over the day have been contradictory. Supplementation with so-called 'fast' proteins, which are also rich in leucine, for example whey protein, proved superior with regard to muscle protein synthesis. First studies in frail older persons showed increased strength after supplementation with milk protein, whereas the combination with physical exercise increased muscle mass without additional benefit for strength or functionality. Recent evidence suggests positive effects of protein supplementation on muscle protein synthesis, muscle mass and muscle strength. However, as most studies included only small numbers of participants for short treatment periods, larger studies with longer duration are necessary to support the clinical relevance of these observations.

  10. Racemic protein crystallography.

    Science.gov (United States)

    Yeates, Todd O; Kent, Stephen B H

    2012-01-01

    Although natural proteins are chiral and are all of one "handedness," their mirror image forms can be prepared by chemical synthesis. This opens up new opportunities for protein crystallography. A racemic mixture of the enantiomeric forms of a protein molecule can crystallize in ways that natural proteins cannot. Recent experimental data support a theoretical prediction that this should make racemic protein mixtures highly amenable to crystallization. Crystals obtained from racemic mixtures also offer advantages in structure determination strategies. The relevance of these potential advantages is heightened by advances in synthetic methods, which are extending the size limit for proteins that can be prepared by chemical synthesis. Recent ideas and results in the area of racemic protein crystallography are reviewed.

  11. Intracellular protein breakdown. 8

    International Nuclear Information System (INIS)

    Bohley, P.; Kirschke, H.; Langner, J.; Wiederanders, B.; Ansorge, S.

    1976-01-01

    Double-labelled proteins from rat liver cytosol ( 14 C in long-lived, 3 H in short-lived proteins after in-vivo-labelling) are used as substrates for unlabelled proteinases in vitro. Differences in the degradation rates of short-lived and long-lived proteins in vitro by different proteinases and after addition of different effectors allow conclusions concerning their importance for the in-vivo-turnover of substrate proteins. The main activity (>90%) of soluble lysosomal proteinases at pH 6.1 and pH 6.9 is caused by thiolproteinases, which degrade preferentially short-lived cytosol proteins. These proteinases are inhibited by leupeptin. Autolysis of double-labelled cell fractions shows a remarkably faster breakdown of short-lived substrate proteins only in the soluble part of lysosomes. Microsomal fractions degrade in vitro preferentially long-lived substrate proteins. (author)

  12. Protein solubility modeling

    Science.gov (United States)

    Agena, S. M.; Pusey, M. L.; Bogle, I. D.

    1999-01-01

    A thermodynamic framework (UNIQUAC model with temperature dependent parameters) is applied to model the salt-induced protein crystallization equilibrium, i.e., protein solubility. The framework introduces a term for the solubility product describing protein transfer between the liquid and solid phase and a term for the solution behavior describing deviation from ideal solution. Protein solubility is modeled as a function of salt concentration and temperature for a four-component system consisting of a protein, pseudo solvent (water and buffer), cation, and anion (salt). Two different systems, lysozyme with sodium chloride and concanavalin A with ammonium sulfate, are investigated. Comparison of the modeled and experimental protein solubility data results in an average root mean square deviation of 5.8%, demonstrating that the model closely follows the experimental behavior. Model calculations and model parameters are reviewed to examine the model and protein crystallization process. Copyright 1999 John Wiley & Sons, Inc.

  13. Inhibition of the Membrane Attack Complex by Dengue Virus NS1 through Interaction with Vitronectin and Terminal Complement Proteins.

    Science.gov (United States)

    Conde, Jonas Nascimento; da Silva, Emiliana Mandarano; Allonso, Diego; Coelho, Diego Rodrigues; Andrade, Iamara da Silva; de Medeiros, Luciano Neves; Menezes, Joice Lima; Barbosa, Angela Silva; Mohana-Borges, Ronaldo

    2016-11-01

    Dengue virus (DENV) infects millions of people worldwide and is a major public health problem. DENV nonstructural protein 1 (NS1) is a conserved glycoprotein that associates with membranes and is also secreted into the plasma in DENV-infected patients. The present study describes a novel mechanism by which NS1 inhibits the terminal complement pathway. We first identified the terminal complement regulator vitronectin (VN) as a novel DENV2 NS1 binding partner by using a yeast two-hybrid system. This interaction was further assessed by enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (SPR) assay. The NS1-VN complex was also detected in plasmas from DENV-infected patients, suggesting that this interaction occurs during DENV infection. We also demonstrated that the DENV2 NS1 protein, either by itself or by interacting with VN, hinders the formation of the membrane attack complex (MAC) and C9 polymerization. Finally, we showed that DENV2, West Nile virus (WNV), and Zika virus (ZIKV) NS1 proteins produced in mammalian cells inhibited C9 polymerization. Taken together, our results points to a role for NS1 as a terminal pathway inhibitor of the complement system. Dengue is the most important arthropod-borne viral disease nowadays and is caused by dengue virus (DENV). The flavivirus NS1 glycoprotein has been characterized functionally as a complement evasion protein that can attenuate the activation of the classical, lectin, and alternative pathways. The present study describes a novel mechanism by which DENV NS1 inhibits the terminal complement pathway. We identified the terminal complement regulator vitronectin (VN) as a novel DENV NS1 binding partner, and the NS1-VN complex was detected in plasmas from DENV-infected patients, suggesting that this interaction occurs during DENV infection. We also demonstrated that the NS1-VN complex inhibited membrane attack complex (MAC) formation, thus interfering with the complement terminal pathway. Interestingly

  14. Protein kinesis: The dynamics of protein trafficking and stability

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-31

    The purpose of this conference is to provide a multidisciplinary forum for exchange of state-of-the-art information on protein kinesis. This volume contains abstracts of papers in the following areas: protein folding and modification in the endoplasmic reticulum; protein trafficking; protein translocation and folding; protein degradation; polarity; nuclear trafficking; membrane dynamics; and protein import into organelles.

  15. Disa vaccines for Bluetongue: A novel vaccine approach for insect-borne diseases

    Science.gov (United States)

    Bluetongue virus (BTV) lacking functional NS3/NS3a protein is named Disabled Infectious Single Animal (DISA) vaccine. The BT DISA vaccine platform is broadly applied by exchange of serotype specific proteins. BT DISA vaccines are produced in standard cell lines in established production facilities, ...

  16. PROTEIN - WHICH IS BEST?

    Directory of Open Access Journals (Sweden)

    Michael J. Falvo

    2004-09-01

    Full Text Available Protein intake that exceeds the recommended daily allowance is widely accepted for both endurance and power athletes. However, considering the variety of proteins that are available much less is known concerning the benefits of consuming one protein versus another. The purpose of this paper is to identify and analyze key factors in order to make responsible recommendations to both the general and athletic populations. Evaluation of a protein is fundamental in determining its appropriateness in the human diet. Proteins that are of inferior content and digestibility are important to recognize and restrict or limit in the diet. Similarly, such knowledge will provide an ability to identify proteins that provide the greatest benefit and should be consumed. The various techniques utilized to rate protein will be discussed. Traditionally, sources of dietary protein are seen as either being of animal or vegetable origin. Animal sources provide a complete source of protein (i.e. containing all essential amino acids, whereas vegetable sources generally lack one or more of the essential amino acids. Animal sources of dietary protein, despite providing a complete protein and numerous vitamins and minerals, have some health professionals concerned about the amount of saturated fat common in these foods compared to vegetable sources. The advent of processing techniques has shifted some of this attention and ignited the sports supplement marketplace with derivative products such as whey, casein and soy. Individually, these products vary in quality and applicability to certain populations. The benefits that these particular proteins possess are discussed. In addition, the impact that elevated protein consumption has on health and safety issues (i.e. bone health, renal function are also reviewed

  17. Protein oxidation and peroxidation

    DEFF Research Database (Denmark)

    Davies, Michael Jonathan

    2016-01-01

    Proteins are major targets for radicals and two-electron oxidants in biological systems due to their abundance and high rate constants for reaction. With highly reactive radicals damage occurs at multiple side-chain and backbone sites. Less reactive species show greater selectivity with regard...... and modified turnover. In the presence of O2, high yields of peroxyl radicals and peroxides (protein peroxidation) are formed; the latter account for up to 70% of the initial oxidant flux. Protein peroxides can oxidize both proteins and other targets. One-electron reduction results in additional radicals...... and chain reactions with alcohols and carbonyls as major products; the latter are commonly used markers of protein damage. Direct oxidation of cysteine (and less commonly) methionine residues is a major reaction; this is typically faster than with H2O2, and results in altered protein activity and function...

  18. Protein Misfolding Diseases.

    Science.gov (United States)

    Hartl, F Ulrich

    2017-06-20

    The majority of protein molecules must fold into defined three-dimensional structures to acquire functional activity. However, protein chains can adopt a multitude of conformational states, and their biologically active conformation is often only marginally stable. Metastable proteins tend to populate misfolded species that are prone to forming toxic aggregates, including soluble oligomers and fibrillar amyloid deposits, which are linked with neurodegeneration in Alzheimer and Parkinson disease, and many other pathologies. To prevent or regulate protein aggregation, all cells contain an extensive protein homeostasis (or proteostasis) network comprising molecular chaperones and other factors. These defense systems tend to decline during aging, facilitating the manifestation of aggregate deposition diseases. This volume of the Annual Review of Biochemistry contains a set of three articles addressing our current understanding of the structures of pathological protein aggregates and their associated disease mechanisms. These articles also discuss recent insights into the strategies cells have evolved to neutralize toxic aggregates by sequestering them in specific cellular locations.

  19. Computational Protein Design

    DEFF Research Database (Denmark)

    Johansson, Kristoffer Enøe

    with a novel method based on probability theory. With the aim of assembling a complete pipeline for protein design, this work touches upon several aspects of protein design. The presented work is the computational half of a design project where the other half is dedicated to the experimental part......Proteins are the major functional group of molecules in biology. The impact of protein science on medicine and chemical productions is rapidly increasing. However, the greatest potential remains to be realized. The fi eld of protein design has advanced computational modeling from a tool of support...... to a central method that enables new developments. For example, novel enzymes with functions not found in natural proteins have been de novo designed to give enough activity for experimental optimization. This thesis presents the current state-of-the-art within computational design methods together...

  20. Computational Protein Design

    DEFF Research Database (Denmark)

    Johansson, Kristoffer Enøe

    Proteins are the major functional group of molecules in biology. The impact of protein science on medicine and chemical productions is rapidly increasing. However, the greatest potential remains to be realized. The fi eld of protein design has advanced computational modeling from a tool of support...... to a central method that enables new developments. For example, novel enzymes with functions not found in natural proteins have been de novo designed to give enough activity for experimental optimization. This thesis presents the current state-of-the-art within computational design methods together...... with a novel method based on probability theory. With the aim of assembling a complete pipeline for protein design, this work touches upon several aspects of protein design. The presented work is the computational half of a design project where the other half is dedicated to the experimental part...

  1. Specificity and affinity quantification of protein-protein interactions.

    Science.gov (United States)

    Yan, Zhiqiang; Guo, Liyong; Hu, Liang; Wang, Jin

    2013-05-01

    Most biological processes are mediated by the protein-protein interactions. Determination of the protein-protein structures and insight into their interactions are vital to understand the mechanisms of protein functions. Currently, compared with the isolated protein structures, only a small fraction of protein-protein structures are experimentally solved. Therefore, the computational docking methods play an increasing role in predicting the structures and interactions of protein-protein complexes. The scoring function of protein-protein interactions is the key responsible for the accuracy of the computational docking. Previous scoring functions were mostly developed by optimizing the binding affinity which determines the stability of the protein-protein complex, but they are often lack of the consideration of specificity which determines the discrimination of native protein-protein complex against competitive ones. We developed a scoring function (named as SPA-PP, specificity and affinity of the protein-protein interactions) by incorporating both the specificity and affinity into the optimization strategy. The testing results and comparisons with other scoring functions show that SPA-PP performs remarkably on both predictions of binding pose and binding affinity. Thus, SPA-PP is a promising quantification of protein-protein interactions, which can be implemented into the protein docking tools and applied for the predictions of protein-protein structure and affinity. The algorithm is implemented in C language, and the code can be downloaded from http://dl.dropbox.com/u/1865642/Optimization.cpp.

  2. Successful Protein Production

    OpenAIRE

    Culp, J.

    2011-01-01

    Successful production of functional proteins is more than an immunoreactive band on a Western blot. Availability of multiple expression vectors make accessible a variety of expression systems and parallel expression approaches can speed results and increase chance of success. The next hurdle is isolation of the protein target in sufficient amounts and with sufficient purity to support subsequent experimental work. Occasionally, protein refolding is the only method available to achieve the des...

  3. Pressure cryocooling protein crystals

    Science.gov (United States)

    Kim, Chae Un [Ithaca, NY; Gruner, Sol M [Ithaca, NY

    2011-10-04

    Preparation of cryocooled protein crystal is provided by use of helium pressurizing and cryocooling to obtain cryocooled protein crystal allowing collection of high resolution data and by heavier noble gas (krypton or xenon) binding followed by helium pressurizing and cryocooling to obtain cryocooled protein crystal for collection of high resolution data and SAD phasing simultaneously. The helium pressurizing is carried out on crystal coated to prevent dehydration or on crystal grown in aqueous solution in a capillary.

  4. Structure and Expression of Genes for Flavivirus Immunogens.

    Science.gov (United States)

    1983-09-01

    on MacConkey indicator plates and detected as red colonies. Transformants which fail to express functional lacZ remain white. We have verified that...strain and 6) screening for restored lacZ activity on lactose MacConkey plates. 6. Preparation of immunological probes for detection of viral gene

  5. Structure and Expression of Genes for Flavivirus Immunogens.

    Science.gov (United States)

    1985-09-01

    Japanese encephalitis, Dengue , gene cloning, 06 01 neutralizing antibody, monoclonal antibody, synthetic 06 13 Ivaccine, viral diagnosis 19 ABSTRACT... peptide immunogens that could be appropriate for use as an antiviral vaccine and for viral diagnosis. Approximately 10.25 kb or 93% of the estimated 11...host and to identify peptide immunogens that could be appropriate for use as an antiviral vaccine and for viral diagnosis. Approximately 10.25 kb or 93

  6. Protein intakes in India.

    Science.gov (United States)

    Swaminathan, Sumathi; Vaz, Mario; Kurpad, Anura V

    2012-08-01

    Indian diets derive almost 60 % of their protein from cereals with relatively low digestibility and quality. There have been several surveys of diets and protein intakes in India by the National Nutrition Monitoring Board (NNMB) over the last 25 years, in urban and rural, as well as in slum dwellers and tribal populations. Data of disadvantaged populations from slums, tribals and sedentary rural Indian populations show that the protein intake (mainly from cereals) is about 1 gm/kg/day. However, the protein intake looks less promising in terms of the protein digestibility corrected amino acid score (PDCAAS), using lysine as the first limiting amino acid, where all populations, particularly rural and tribal, appear to have an inadequate quality to their protein intake. The protein: energy (PE) ratio is a measure of dietary quality, and has been used in the 2007 WHO/FAO/UNU report to define reference requirement values with which the adequacy of diets can be evaluated in terms of a protein quality corrected PE ratio. It is likely that about one third of this sedentary rural population is at risk of not meeting their requirements. These levels of risk of deficiency are in a population with relatively low BMI populations, whose diets are also inadequate in fruits and vegetables. Therefore, while the burden of enhancing the quality of protein intake in rural India exists, the quality of the diet, in general, represents a challenge that must be met.

  7. Protein carbonylation in plants

    DEFF Research Database (Denmark)

    Møller, Ian Max; Havelund, Jesper; Rogowska-Wrzesinska, Adelina

    2017-01-01

    This chapter provides an overview of the current knowledge on protein carbonylation in plants and its role in plant physiology. It starts with a brief outline of the turnover and production sites of reactive oxygen species (ROS) in plants and the causes of protein carbonylation. This is followed...... by a description of the methods used to study protein carbonylation in plants, which is also very brief as the methods are similar to those used in studies on animals. The chapter also focuses on protein carbonylation in plants in general and in mitochondria and in seeds in particular, as case stories where...

  8. MicroProteins

    DEFF Research Database (Denmark)

    Eguen, Teinai Ebimienere; Straub, Daniel; Graeff, Moritz

    2015-01-01

    MicroProteins (miPs) are short, usually single-domain proteins that, in analogy to miRNAs, heterodimerize with their targets and exert a dominant-negative effect. Recent bioinformatic attempts to identify miPs have resulted in a list of potential miPs, many of which lack the defining characterist......MicroProteins (miPs) are short, usually single-domain proteins that, in analogy to miRNAs, heterodimerize with their targets and exert a dominant-negative effect. Recent bioinformatic attempts to identify miPs have resulted in a list of potential miPs, many of which lack the defining...

  9. Acanthamoeba castellanii STAT protein.

    Science.gov (United States)

    Kicinska, Anna; Leluk, Jacek; Jarmuszkiewicz, Wieslawa

    2014-01-01

    STAT (signal transducers and activators of transcription) proteins are one of the important mediators of phosphotyrosine-regulated signaling in metazoan cells. We described the presence of STAT protein in a unicellular, free-living amoebae with a simple life cycle, Acanthamoeba castellanii. A. castellanii is the only, studied to date, Amoebozoan that does not belong to Mycetozoa but possesses STATs. A sequence of the A. castellanii STAT protein includes domains similar to those of the Dictyostelium STAT proteins: a coiled coil (characteristic for Dictyostelium STAT coiled coil), a STAT DNA-binding domain and a Src-homology domain. The search for protein sequences homologous to A. castellanii STAT revealed 17 additional sequences from lower eukaryotes. Interestingly, all of these sequences come from Amoebozoa organisms that belong to either Mycetozoa (slime molds) or Centramoebida. We showed that there are four separated clades within the slime mold STAT proteins. The A. castellanii STAT protein branches next to a group of STATc proteins from Mycetozoa. We also demonstrate that Amoebozoa form a distinct monophyletic lineage within the STAT protein world that is well separated from the other groups.

  10. Acanthamoeba castellanii STAT protein.

    Directory of Open Access Journals (Sweden)

    Anna Kicinska

    Full Text Available STAT (signal transducers and activators of transcription proteins are one of the important mediators of phosphotyrosine-regulated signaling in metazoan cells. We described the presence of STAT protein in a unicellular, free-living amoebae with a simple life cycle, Acanthamoeba castellanii. A. castellanii is the only, studied to date, Amoebozoan that does not belong to Mycetozoa but possesses STATs. A sequence of the A. castellanii STAT protein includes domains similar to those of the Dictyostelium STAT proteins: a coiled coil (characteristic for Dictyostelium STAT coiled coil, a STAT DNA-binding domain and a Src-homology domain. The search for protein sequences homologous to A. castellanii STAT revealed 17 additional sequences from lower eukaryotes. Interestingly, all of these sequences come from Amoebozoa organisms that belong to either Mycetozoa (slime molds or Centramoebida. We showed that there are four separated clades within the slime mold STAT proteins. The A. castellanii STAT protein branches next to a group of STATc proteins from Mycetozoa. We also demonstrate that Amoebozoa form a distinct monophyletic lineage within the STAT protein world that is well separated from the other groups.

  11. Comprehensive mapping of common immunodominant epitopes in the West Nile virus nonstructural protein 1 recognized by avian antibody responses.

    Directory of Open Access Journals (Sweden)

    Encheng Sun

    Full Text Available West Nile virus (WNV is a mosquito-borne flavivirus that primarily infects birds but occasionally infects humans and horses. Certain species of birds, including crows, house sparrows, geese, blue jays and ravens, are considered highly susceptible hosts to WNV. The nonstructural protein 1 (NS1 of WNV can elicit protective immune responses, including NS1-reactive antibodies, during infection of animals. The antigenicity of NS1 suggests that NS1-reactive antibodies could provide a basis for serological diagnostic reagents. To further define serological reagents for diagnostic use, the antigenic sites in NS1 that are targeted by host immune responses need to be identified and the potential diagnostic value of individual antigenic sites also needs to be defined. The present study describes comprehensive mapping of common immunodominant linear B-cell epitopes in the WNV NS1 using avian WNV NS1 antisera. We screened antisera from chickens, ducks and geese immunized with purified NS1 for reactivity against 35 partially overlapping peptides covering the entire WNV NS1. This study identified twelve, nine and six peptide epitopes recognized by chicken, duck and goose antibody responses, respectively. Three epitopes (NS1-3, 14 and 24 were recognized by antibodies elicited by immunization in all three avian species tested. We also found that NS1-3 and 24 were WNV-specific epitopes, whereas the NS1-14 epitope was conserved among the Japanese encephalitis virus (JEV serocomplex viruses based on the reactivity of avian WNV NS1 antisera against polypeptides derived from the NS1 sequences of viruses of the JEV serocomplex. Further analysis showed that the three common polypeptide epitopes were not recognized by antibodies in Avian Influenza Virus (AIV, Newcastle Disease Virus (NDV, Duck Plague Virus (DPV and Goose Parvovirus (GPV antisera. The knowledge and reagents generated in this study have potential applications in differential diagnostic approaches and

  12. What properties characterize the hub proteins of the protein-protein interaction network of Saccharomyces cerevisiae?

    OpenAIRE

    Ekman, Diana; Light, Sara; Bj?rklund, ?sa K; Elofsson, Arne

    2006-01-01

    Background Most proteins interact with only a few other proteins while a small number of proteins (hubs) have many interaction partners. Hub proteins and non-hub proteins differ in several respects; however, understanding is not complete about what properties characterize the hubs and set them apart from proteins of low connectivity. Therefore, we have investigated what differentiates hubs from non-hubs and static hubs (party hubs) from dynamic hubs (date hubs) in the protein-protein interact...

  13. A cDNA Clone-Launched Platform for High-Yield Production of Inactivated Zika Vaccine

    Directory of Open Access Journals (Sweden)

    Yujiao Yang

    2017-03-01

    Full Text Available A purified inactivated vaccine (PIV using the Zika virus (ZIKV Puerto Rico strain PRVABC59 showed efficacy in monkeys, and is currently in a phase I clinical trial. High-yield manufacture of this PIV is essential for its development and vaccine access. Here we report an infectious cDNA clone-launched platform to maximize its yield. A single NS1 protein substitution (K265E was identified to increase ZIKV replication on Vero cells (a cell line approved for vaccine production for both Cambodian FSS13025 and Puerto Rico PRVABC59 strains. The NS1 mutation did not affect viral RNA synthesis, but significantly increased virion assembly through an increased interaction between NS1 and NS2A (a known regulator of flavivirus assembly. The NS1 mutant virus retained wild-type virulence in the A129 mouse model, but decreased its competence to infect Aedes aegypti mosquitoes. To further increase virus yield, we constructed an infectious cDNA clone of the clinical trial PIV strain PRVABC59 containing three viral replication-enhancing mutations (NS1 K265E, prM H83R, and NS3 S356F. The mutant cDNA clone produced >25-fold more ZIKV than the wild-type parent on Vero cells. This cDNA clone-launched manufacture platform has the advantages of higher virus yield, shortened manufacture time, and minimized chance of contamination.

  14. Construction and characterization of a stable subgenomic dengue virus type 2 replicon system for antiviral compound and siRNA testing.

    Science.gov (United States)

    Ng, Chuan Young; Gu, Feng; Phong, Wai Yee; Chen, Yen-Liang; Lim, Siew Pheng; Davidson, Andrew; Vasudevan, Subhash G

    2007-12-01

    Self-replicating, non-infectious flavivirus subgenomic replicons have been broadly used in the studies of trans-complementation, adaptive mutation, viral assembly and packaging in Kunjin, yellow fever and West Nile viruses. We describe here the construction of subgenomic EGFP- or Renilla luciferase-reporter based dengue replicons of the type 2 New Guinea C (NGC) strain and the establishment of stable BHK21 cell lines harboring the replicons. In replicon cells, viral proteins and RNAs are stably expressed at levels similar to cells transfected with the full length NGC infectious RNA. Furthermore, the replicon can be packaged by separately transfected C (core)-prM (pre-membrane)-E (envelope) polyprotein construct. The replicon cells were subjected to treatment with several antiviral compounds and inhibition of the replicon was observed in treatment with known nucleoside analog inhibitors of NS5 such as 2'-C-methyladenosine (EC(50)=2.42 +/- 0.59 microM), or ribavirin (EC(50)=6.77 +/- 1.33 microM), mycophenolic acid (EC(50)=1.31 +/- 0.27 microM) and siRNA against NS3. The BHK-replicon cells have been stably maintained for about 10 passages without significant loss in reporter intensity and are sufficiently robust for both research and drug discovery.

  15. Allosteric Regulation of Proteins

    Indian Academy of Sciences (India)

    For example, the structural changes that allowed for allosteric regulation of haemoglobin were re- vealed through structural elucidation of the protein in free and oxygen-bound forms by X-ray crystallography. Following this,. X-ray crystallography has been utilized to study a variety of al- losteric proteins including ATCase. 2.

  16. Modular protein domains

    National Research Council Canada - National Science Library

    Cesareni, Giovanni

    2005-01-01

    ... encodes not only sequence, but somehow explicitly specifies folding, structure, and biological function as well. How, then, can one learn to read this 'language of proteins'? One of the most powerful approaches to 'cracking the protein code' has involved sequence comparisons between and within species, a task now greatly simplified by the ever...

  17. Amino acids and proteins

    NARCIS (Netherlands)

    van Goudoever, Johannes B.; Vlaardingerbroek, Hester; van den Akker, Chris H.; de Groof, Femke; van der Schoor, Sophie R. D.

    2014-01-01

    Amino acids and protein are key factors for growth. The neonatal period requires the highest intake in life to meet the demands. Those demands include amino acids for growth, but proteins and amino acids also function as signalling molecules and function as neurotransmitters. Often the nutritional

  18. MODELS OF PROTEIN FOLDING

    Directory of Open Access Journals (Sweden)

    Unnati Ahluwalia

    2012-12-01

    Full Text Available In an attempt to explore the understanding of protein folding mechanism, various models have been proposed in the literature. Advances in recent experimental and computational techniques rationalized our understanding on some of the fundamental features of the protein folding pathways. The goal of this review is to revisit the various models and outline the essential aspects of the folding reaction.

  19. Green fluorescent protein.

    Science.gov (United States)

    Chalfie, M

    1995-10-01

    Several bioluminescent coelenterates use a secondary fluorescent protein, the green fluorescent protein (GFP), in an energy transfer reaction to produce green light. The most studied of these proteins have been the GFPs from the jellyfish Aequorea victoria and the sea pansy Renilla reniformis. Although the proteins from these organisms are not identical, they are thought to have the same chromophore, which is derived from the primary amino acid sequence of GFP. The differences are thought to be due to changes in the protein environment of the chromophore. Recent interest in these molecules has arisen from the cloning of the Aequorea gfp cDNA and the demonstration that its expression in the absence of other Aequorea proteins results in a fluorescent product. This demonstration indicated that GFP could be used as a marker of gene expression and protein localization in living and fixed tissues. Bacterial, plant and animal (including mammalian) cells all express GFP. The heterologous expression of the gfp cDNA has also meant that it could be mutated to produce proteins with different fluorescent properties. Variants with more intense fluorescence or alterations in the excitation and emission spectra have been produced.

  20. Proteins at surfaces

    NARCIS (Netherlands)

    Efimova, Y.M.

    2006-01-01

    Understanding protein adsorption is of vital importance in many fields of medicine and industry that can be divided into two categories: those in which it is desired to minimize adsorption, and those in which protein adsorption is desired. The first category covers materials for kidney dialysis

  1. Protein Attachment on Nanodiamonds.

    Science.gov (United States)

    Lin, Chung-Lun; Lin, Cheng-Huang; Chang, Huan-Cheng; Su, Meng-Chih

    2015-07-16

    A recent advance in nanotechnology is the scale-up production of small and nonaggregated diamond nanoparticles suitable for biological applications. Using detonation nanodiamonds (NDs) with an average diameter of ∼4 nm as the adsorbents, we have studied the static attachment of three proteins (myoglobin, bovine serum albumin, and insulin) onto the nanoparticles by optical spectroscopy, mass spectrometry, and dynamic light scattering, and electrophoretic zeta potential measurements. Results show that the protein surface coverage is predominantly determined by the competition between protein-protein and protein-ND interactions, giving each protein a unique and characteristic structural configuration in its own complex. Specifically, both myoglobin and bovine serum albumin show a Langmuir-type adsorption behavior, forming 1:1 complexes at saturation, whereas insulin folds into a tightly bound multimer before adsorption. The markedly different adsorption patterns appear to be independent of the protein concentration and are closely related to the affinity of the individual proteins for the NDs. The present study provides a fundamental understanding for the use of NDs as a platform for nanomedical drug delivery.

  2. Poxviral Ankyrin Proteins

    Directory of Open Access Journals (Sweden)

    Michael H. Herbert

    2015-02-01

    Full Text Available Multiple repeats of the ankyrin motif (ANK are ubiquitous throughout the kingdoms of life but are absent from most viruses. The main exception to this is the poxvirus family, and specifically the chordopoxviruses, with ANK repeat proteins present in all but three species from separate genera. The poxviral ANK repeat proteins belong to distinct orthologue groups spread over different species, and align well with the phylogeny of their genera. This distribution throughout the chordopoxviruses indicates these proteins were present in an ancestral vertebrate poxvirus, and have since undergone numerous duplication events. Most poxviral ANK repeat proteins contain an unusual topology of multiple ANK motifs starting at the N-terminus with a C-terminal poxviral homologue of the cellular F-box enabling interaction with the cellular SCF ubiquitin ligase complex. The subtle variations between ANK repeat proteins of individual poxviruses suggest an array of different substrates may be bound by these protein-protein interaction domains and, via the F-box, potentially directed to cellular ubiquitination pathways and possible degradation. Known interaction partners of several of these proteins indicate that the NF-κB coordinated anti-viral response is a key target, whilst some poxviral ANK repeat domains also have an F-box independent affect on viral host-range.

  3. Advances in Protein Precipitation

    NARCIS (Netherlands)

    Golubovic, M.

    2009-01-01

    Proteins are biological macromolecules, which are among the key components of all living organisms. Proteins are nowadays present in all fields of biotech industry, such as food and feed, synthetic and pharmaceutical industry. They are isolated from their natural sources or produced in different

  4. NMR of unfolded proteins

    Indian Academy of Sciences (India)

    Unknown

    2005-01-03

    Jan 3, 2005 ... emerged as the sole, most powerful technique to help characterize these disordered protein systems. In ... tion of a protein is related to its significant and ...... This is likely to allow a number of both charged and hydrophobic groups to be presented to fibronectin for highly spe- cific binding.76. 5.3 Lysozyme.

  5. NMR of unfolded proteins

    Indian Academy of Sciences (India)

    In the post-genomic era, as more and more genome sequences are becoming known and hectic efforts are underway to decode the information content in them, it is becoming increasingly evident that flexibility in proteins plays a crucial role in many of the biological functions. Many proteins have intrinsic disorder either ...

  6. Brushes and proteins

    NARCIS (Netherlands)

    Bosker, W.T.E.

    2011-01-01

      Brushes and Proteins   Wouter T. E. Bosker         Protein adsorption at solid surfaces can be prevented by applying a polymer brush at the surface. A polymer brush consists of polymer chains end-grafted to the surface at such a grafting density that

  7. Artificially Engineered Protein Polymers.

    Science.gov (United States)

    Yang, Yun Jung; Holmberg, Angela L; Olsen, Bradley D

    2017-06-07

    Modern polymer science increasingly requires precise control over macromolecular structure and properties for engineering advanced materials and biomedical systems. The application of biological processes to design and synthesize artificial protein polymers offers a means for furthering macromolecular tunability, enabling polymers with dispersities of ∼1.0 and monomer-level sequence control. Taking inspiration from materials evolved in nature, scientists have created modular building blocks with simplified monomer sequences that replicate the function of natural systems. The corresponding protein engineering toolbox has enabled the systematic development of complex functional polymeric materials across areas as diverse as adhesives, responsive polymers, and medical materials. This review discusses the natural proteins that have inspired the development of key building blocks for protein polymer engineering and the function of these elements in material design. The prospects and progress for scalable commercialization of protein polymers are reviewed, discussing both technology needs and opportunities.

  8. Protein restriction and cancer.

    Science.gov (United States)

    Yin, Jie; Ren, Wenkai; Huang, Xingguo; Li, Tiejun; Yin, Yulong

    2018-03-26

    Protein restriction without malnutrition is currently an effective nutritional intervention known to prevent diseases and promote health span from yeast to human. Recently, low protein diets are reported to be associated with lowered cancer incidence and mortality risk of cancers in human. In murine models, protein restriction inhibits tumor growth via mTOR signaling pathway. IGF-1, amino acid metabolic programing, FGF21, and autophagy may also serve as potential mechanisms of protein restriction mediated cancer prevention. Together, dietary intervention aimed at reducing protein intake can be beneficial and has the potential to be widely adopted and effective in preventing and treating cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Sensitizing properties of proteins

    DEFF Research Database (Denmark)

    Poulsen, Lars K.; Ladics, Gregory S; McClain, Scott

    2014-01-01

    The scope of allergy risk is diverse considering the myriad ways in which protein allergenicity is affected by physiochemical characteristics of proteins. The complexity created by the matrices of foods and the variability of the human immune system add additional challenges to understanding...... the relationship between sensitization potential and allergy disease. To address these and other issues, an April 2012 international symposium was held in Prague, Czech Republic, to review and discuss the state-of-the-science of sensitizing properties of protein allergens. The symposium, organized by the Protein...... Allergenicity Technical Committee of the International Life Sciences Institute's Health and Environmental Sciences Institute, featured presentations on current methods, test systems, research trends, and unanswered questions in the field of protein sensitization. A diverse group of over 70 interdisciplinary...

  10. The Protein Model Portal.

    Science.gov (United States)

    Arnold, Konstantin; Kiefer, Florian; Kopp, Jürgen; Battey, James N D; Podvinec, Michael; Westbrook, John D; Berman, Helen M; Bordoli, Lorenza; Schwede, Torsten

    2009-03-01

    Structural Genomics has been successful in determining the structures of many unique proteins in a high throughput manner. Still, the number of known protein sequences is much larger than the number of experimentally solved protein structures. Homology (or comparative) modeling methods make use of experimental protein structures to build models for evolutionary related proteins. Thereby, experimental structure determination efforts and homology modeling complement each other in the exploration of the protein structure space. One of the challenges in using model information effectively has been to access all models available for a specific protein in heterogeneous formats at different sites using various incompatible accession code systems. Often, structure models for hundreds of proteins can be derived from a given experimentally determined structure, using a variety of established methods. This has been done by all of the PSI centers, and by various independent modeling groups. The goal of the Protein Model Portal (PMP) is to provide a single portal which gives access to the various models that can be leveraged from PSI targets and other experimental protein structures. A single interface allows all existing pre-computed models across these various sites to be queried simultaneously, and provides links to interactive services for template selection, target-template alignment, model building, and quality assessment. The current release of the portal consists of 7.6 million model structures provided by different partner resources (CSMP, JCSG, MCSG, NESG, NYSGXRC, JCMM, ModBase, SWISS-MODEL Repository). The PMP is available at http://www.proteinmodelportal.org and from the PSI Structural Genomics Knowledgebase.

  11. An external loop region of domain III of dengue virus type 2 envelope protein is involved in serotype-specific binding to mosquito but not mammalian cells.

    Science.gov (United States)

    Hung, Jan-Jong; Hsieh, Meng-Ti; Young, Ming-Jer; Kao, Chuan-Liang; King, Chwan-Chuen; Chang, Wen

    2004-01-01

    Dengue virus (DV) is a flavivirus and infects mammalian cells through mosquito vectors. This study investigates the roles of domain III of DV type 2 envelope protein (EIII) in DV binding to the host cell. Recombinant EIII interferes with DV infection to BHK21 and C6/36 cells by blocking dengue virion adsorption to these cells. Inhibition of EIII on BHK21 cells was broad with no serotype specificity; however, inhibition of EIII on C6/36 cells was relatively serotype specific. Soluble heparin completely blocks binding of EIII to BHK21 cells, suggesting that domain III binds mainly to cell surface heparan sulfates. This suggestion is supported by the observation that EIII binds very weakly to gro2C and sog9 mutant mammalian cell lines that lack heparan sulfate. In contrast, heparin does not block binding of EIII to mosquito cells. Furthermore, a synthetic peptide that includes amino acids (aa) 380 to 389 of EIII, IGVEPGQLKL, inhibits binding of EIII to C6/36 but not BHK21 cells. This peptide corresponds to a lateral loop region on domain III of E protein, indicating a possible role of this loop in binding to mosquito cells. In summary, these results suggest that EIII plays an important role in binding of DV type 2 to host cells. In addition, EIII interacts with heparan sulfates when binding to BHK21 cells, and a loop region containing aa 380 to 389 of EIII may participate in DV type 2 binding to C6/36 cells.

  12. Host-derived apolipoproteins play comparable roles with viral secretory proteins Erns and NS1 in the infectious particle formation of Flaviviridae.

    Directory of Open Access Journals (Sweden)

    Takasuke Fukuhara

    2017-06-01

    Full Text Available Amphipathic α-helices of exchangeable apolipoproteins have shown to play crucial roles in the formation of infectious hepatitis C virus (HCV particles through the interaction with viral particles. Among the Flaviviridae members, pestivirus and flavivirus possess a viral structural protein Erns or a non-structural protein 1 (NS1 as secretory glycoproteins, respectively, while Hepacivirus including HCV has no secretory glycoprotein. In case of pestivirus replication, the C-terminal long amphipathic α-helices of Erns are important for anchoring to viral membrane. Here we show that host-derived apolipoproteins play functional roles similar to those of virally encoded Erns and NS1 in the formation of infectious particles. We examined whether Erns and NS1 could compensate for the role of apolipoproteins in particle formation of HCV in apolipoprotein B (ApoB and ApoE double-knockout Huh7 (BE-KO, and non-hepatic 293T cells. We found that exogenous expression of either Erns or NS1 rescued infectious particle formation of HCV in the BE-KO and 293T cells. In addition, expression of apolipoproteins or NS1 partially rescued the production of infectious pestivirus particles in cells upon electroporation with an Erns-deleted non-infectious RNA. As with exchangeable apolipoproteins, the C-terminal amphipathic α-helices of Erns play the functional roles in the formation of infectious HCV or pestivirus particles. These results strongly suggest that the host- and virus-derived secretory glycoproteins have overlapping roles in the viral life cycle of Flaviviridae, especially in the maturation of infectious particles, while Erns and NS1 also participate in replication complex formation and viral entry, respectively. Considering the abundant hepatic expression and liver-specific propagation of these apolipoproteins, HCV might have evolved to utilize them in the formation of infectious particles through deletion of a secretory viral glycoprotein gene.

  13. Combined prime-boost vaccination against tick-borne encephalitis (TBE using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

    Directory of Open Access Journals (Sweden)

    Zakharova LG

    2005-08-01

    Full Text Available Abstract Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines.

  14. Protein trapping of nanoparticles

    International Nuclear Information System (INIS)

    Ang, Joo C.; Lin, Jack M.; Yaron, Peter N.; White, John W.

    2009-01-01

    Full text: We have observed the formation of protein-nanoparticle complexes at the air-water interfaces from three different methods of presenting the nanoparticles to proteins. The structures formed resemble the 'protein-nanoparticle corona' proposed by Lynch et al. [1-3) in relation to a possible route for nanoparticle entry into living cells. To do this, the methods of x-ray and neutron reflectivity (with isotopic contrast variation between the protein and nanoparticles) have been used to study the structures formed at the air-water interface of l 3 - casein presented to silica nanoparticle dispersions. Whilst the silica dispersions showed no observable reflectivity, strong signals appear in the reflectivity when protein is present. Drop-wise spreading of a small amount of protein at the air-silica sol interface and presentation of the silica sol to an isolated monomolecular protein film (made by the 'flow-trough' method [4]) gave an immediate signal. Mixing the components in solution only produces a slow response but in all cases a similar structure is formed. The different responses are interpreted in structural and stoichiometric ways.

  15. Anchored design of protein-protein interfaces.

    Directory of Open Access Journals (Sweden)

    Steven M Lewis

    Full Text Available Few existing protein-protein interface design methods allow for extensive backbone rearrangements during the design process. There is also a dichotomy between redesign methods, which take advantage of the native interface, and de novo methods, which produce novel binders.Here, we propose a new method for designing novel protein reagents that combines advantages of redesign and de novo methods and allows for extensive backbone motion. This method requires a bound structure of a target and one of its natural binding partners. A key interaction in this interface, the anchor, is computationally grafted out of the partner and into a surface loop on the design scaffold. The design scaffold's surface is then redesigned with backbone flexibility to create a new binding partner for the target. Careful choice of a scaffold will bring experimentally desirable characteristics into the new complex. The use of an anchor both expedites the design process and ensures that binding proceeds against a known location on the target. The use of surface loops on the scaffold allows for flexible-backbone redesign to properly search conformational space.This protocol was implemented within the Rosetta3 software suite. To demonstrate and evaluate this protocol, we have developed a benchmarking set of structures from the PDB with loop-mediated interfaces. This protocol can recover the correct loop-mediated interface in 15 out of 16 tested structures, using only a single residue as an anchor.

  16. Intercellular protein-protein interactions at synapses.

    Science.gov (United States)

    Yang, Xiaofei; Hou, Dongmei; Jiang, Wei; Zhang, Chen

    2014-06-01

    Chemical synapses are asymmetric intercellular junctions through which neurons send nerve impulses to communicate with other neurons or excitable cells. The appropriate formation of synapses, both spatially and temporally, is essential for brain function and depends on the intercellular protein-protein interactions of cell adhesion molecules (CAMs) at synaptic clefts. The CAM proteins link pre- and post-synaptic sites, and play essential roles in promoting synapse formation and maturation, maintaining synapse number and type, accumulating neurotransmitter receptors and ion channels, controlling neuronal differentiation, and even regulating synaptic plasticity directly. Alteration of the interactions of CAMs leads to structural and functional impairments, which results in many neurological disorders, such as autism, Alzheimer's disease and schizophrenia. Therefore, it is crucial to understand the functions of CAMs during development and in the mature neural system, as well as in the pathogenesis of some neurological disorders. Here, we review the function of the major classes of CAMs, and how dysfunction of CAMs relates to several neurological disorders.

  17. Protein oxidation in aquatic foods

    DEFF Research Database (Denmark)

    Baron, Caroline P.

    2014-01-01

    The chapter discusses general considerations about protein oxidation and reviews the mechanisms involved in protein oxidation and consequences of protein oxidation on fish proteins. It presents two case studies, the first deals with protein and lipid oxidation in frozen rainbow trout......, and the second with oxidation in salted herring. The mechanisms responsible for initiation of protein oxidation are unclear, but it is generally accepted that free radical species initiating lipid oxidation can also initiate protein oxidation. The chapter focuses on interaction between protein and lipid...... oxidation. The protein carbonyl group measurement is the widely used method for estimating protein oxidation in foods and has been used in fish muscle. The chapter also talks about the impact of protein oxidation on protein functionality, fish muscle texture, and food nutritional value. Protein oxidation...

  18. Identification and characterization of a virus-specific continuous B-cell epitope on the PrM/M protein of Japanese Encephalitis Virus: potential application in the detection of antibodies to distinguish Japanese Encephalitis Virus infection from West Nile Virus and Dengue Virus infections

    Directory of Open Access Journals (Sweden)

    Liu Wen-Xin

    2010-09-01

    Full Text Available Abstract Background Differential diagnose of Japanese encephalitis virus (JEV infection from other flavivirus especially West Nile virus (WNV and Dengue virus (DV infection was greatly hindered for the serological cross-reactive. Virus specific epitopes could benefit for developing JEV specific antibodies detection methods. To identify the JEV specific epitopes, we fully mapped and characterized the continuous B-cell epitope of the PrM/M protein of JEV. Results To map the epitopes on the PrM/M protein, we designed a set of 20 partially overlapping fragments spanning the whole PrM, fused them with GST, and expressed them in an expression vector. Linear epitope M14 (105VNKKEAWLDSTKATRY120 was detected by enzyme-linked immunosorbent assay (ELISA. By removing amino acid residues individually from the carboxy and amino terminal of peptide M14, we confirmed that the minimal unit of the linear epitope of PrM/M was M14-13 (108KEAWLDSTKAT118. This epitope was highly conserved across different JEV strains. Moreover, this epitope did not cross-react with WNV-positive and DENV-positive sera. Conclusion Epitope M14-13 was a JEV specific lineal B-cell epitpe. The results may provide a useful basis for the development of epitope-based virus specific diagnostic clinical techniques.

  19. Protein oxidation and ageing

    DEFF Research Database (Denmark)

    Linton, S; Davies, Michael Jonathan; Dean, R T

    2001-01-01

    of redox-active metal ions that could catalyse oxidant formation. As a result of this decrease in antioxidant defences, and increased rate of ROS formation, it is possible that the impact of ROS increases with age. ROS are known to oxidise biological macromolecules, with proteins an important target....... If the argument that the impact of ROS increases with age is true, then proteins would be expected to accumulate oxidised materials with age, and the rate of such accumulation should increase with time, reflecting impaired inefficiency of homeostasis. Here we review the evidence for the accumulation of oxidised......, or modified, extra- and intra-cellular proteins in vivo....

  20. Protein crystallography prescreen kit

    Science.gov (United States)

    Segelke, Brent W.; Krupka, Heike I.; Rupp, Bernhard

    2005-07-12

    A kit for prescreening protein concentration for crystallization includes a multiplicity of vials, a multiplicity of pre-selected reagents, and a multiplicity of sample plates. The reagents and a corresponding multiplicity of samples of the protein in solutions of varying concentrations are placed on sample plates. The sample plates containing the reagents and samples are incubated. After incubation the sample plates are examined to determine which of the sample concentrations are too low and which the sample concentrations are too high. The sample concentrations that are optimal for protein crystallization are selected and used.

  1. Sound of proteins

    DEFF Research Database (Denmark)

    2007-01-01

    In my group we work with Molecular Dynamics to model several different proteins and protein systems. We submit our modelled molecules to changes in temperature, changes in solvent composition and even external pulling forces. To analyze our simulation results we have so far used visual inspection...... and statistical analysis of the resulting molecular trajectories (as everybody else!). However, recently I started assigning a particular sound frequency to each amino acid in the protein, and by setting the amplitude of each frequency according to the movement amplitude we can "hear" whenever two aminoacids...

  2. Alpha Shapes and Proteins

    DEFF Research Database (Denmark)

    Winter, Pawel; Sterner, Henrik; Sterner, Peter

    2009-01-01

    We provide a unified description of (weighted) alpha shapes, beta shapes and the corresponding simplicialcomplexes. We discuss their applicability to various protein-related problems. We also discuss filtrations of alpha shapes and touch upon related persistence issues.We claim that the full...... potential of alpha-shapes and related geometrical constructs in protein-related problems yet remains to be realized and verified. We suggest parallel algorithms for (weighted) alpha shapes, and we argue that future use of filtrations and kinetic variants for larger proteins will need such implementation....

  3. Protein Crystal Malic Enzyme

    Science.gov (United States)

    1992-01-01

    Malic Enzyme is a target protein for drug design because it is a key protein in the life cycle of intestinal parasites. After 2 years of effort on Earth, investigators were unable to produce any crystals that were of high enough quality and for this reason the structure of this important protein could not be determined. Crystals obtained from one STS-50 were of superior quality allowing the structure to be determined. This is just one example why access to space is so vital for these studies. Principal Investigator is Larry DeLucas.

  4. Designing microcapsules based on protein fibrils and protein - polysaccharide complexes

    NARCIS (Netherlands)

    Hua, K.N.P.

    2012-01-01

    Keywords: encapsulation, microcapsule, protein, fibril, protein-polysaccharide complex, controlled release, interfacial rheology, lysozyme, ovalbumin This thesis describes the design of encapsulation systems using mesostructures from proteins and polysaccharides. The approach was to first

  5. Designing microcapsules based on protein fibrils and protein - polysaccharide complexes

    NARCIS (Netherlands)

    Hua, K.N.P.

    2012-01-01

    Keywords: encapsulation, microcapsule, protein, fibril, protein-polysaccharide complex, controlled release, interfacial rheology, lysozyme, ovalbumin

    This thesis describes the design of encapsulation systems using mesostructures from proteins and polysaccharides. The approach

  6. Integral UBL domain proteins: a family of proteasome interacting proteins

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Gordon, Colin

    2004-01-01

    The family of ubiquitin-like (UBL) domain proteins (UDPs) comprises a conserved group of proteins involved in a multitude of different cellular activities. However, recent studies on UBL-domain proteins indicate that these proteins appear to share a common property in their ability to interact......-domain proteins catalyse the formation of ubiquitin-protein conjugates, whereas others appear to target ubiquitinated proteins for degradation and interact with chaperones. Hence, by binding to the 26S proteasome the UBL-domain proteins seem to tailor and direct the basic proteolytic functions of the particle...

  7. Interactive protein manipulation

    Energy Technology Data Exchange (ETDEWEB)

    SNCrivelli@lbl.gov

    2003-07-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  8. Retinoblastoma protein partners.

    Science.gov (United States)

    Morris, E J; Dyson, N J

    2001-01-01

    Studies of the retinoblastoma gene (Rb) have shown that its protein product (pRb) acts to restrict cell proliferation, inhibit apoptosis, and promote cell differentiation. The frequent mutation of the Rb gene, and the functional inactivation of pRb in tumor cells, have spurred interest in the mechanism of pRb action. Recently, much attention has focused on pRb's role in the regulation of the E2F transcription factor. However, biochemical studies have suggested that E2F is only one of many pRb-targets and, to date, at least 110 cellular proteins have been reported to associate with pRb. The plethora of pRb-binding proteins raises several important questions. How many functions does pRb possess, which of these functions are important for development, and which contribute to tumor suppression? The goal of this review is to summarize the current literature of pRb-associated proteins.

  9. Interactive protein manipulation

    International Nuclear Information System (INIS)

    2003-01-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures

  10. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  11. Protein Colloidal Aggregation Project

    Science.gov (United States)

    Oliva-Buisson, Yvette J. (Compiler)

    2014-01-01

    To investigate the pathways and kinetics of protein aggregation to allow accurate predictive modeling of the process and evaluation of potential inhibitors to prevalent diseases including cataract formation, chronic traumatic encephalopathy, Alzheimer's Disease, Parkinson's Disease and others.

  12. The protein protocols handbook

    National Research Council Canada - National Science Library

    Walker, John M

    2002-01-01

    .... The new chapters cover with many rapidly developing areas, particularly the application of mass spectrometry in protein characterization, as well as the now well-established 2-D PAGE technique in proteomics...

  13. Polymers for Protein Conjugation

    Directory of Open Access Journals (Sweden)

    Gianfranco Pasut

    2014-01-01

    Full Text Available Polyethylene glycol (PEG at the moment is considered the leading polymer for protein conjugation in view of its unique properties, as well as to its low toxicity in humans, qualities which have been confirmed by its extensive use in clinical practice. Other polymers that are safe, biodegradable and custom-designed have, nevertheless, also been investigated as potential candidates for protein conjugation. This review will focus on natural polymers and synthetic linear polymers that have been used for protein delivery and the results associated with their use. Genetic fusion approaches for the preparation of protein-polypeptide conjugates will be also reviewed and compared with the best known chemical conjugation ones.

  14. Recombinant Collagenlike Proteins

    Science.gov (United States)

    Fertala, Andzej

    2007-01-01

    A group of collagenlike recombinant proteins containing high densities of biologically active sites has been invented. The method used to express these proteins is similar to a method of expressing recombinant procollagens and collagens described in U. S. Patent 5,593,859, "Synthesis of human procollagens and collagens in recombinant DNA systems." Customized collagenous proteins are needed for biomedical applications. In particular, fibrillar collagens are attractive for production of matrices needed for tissue engineering and drug delivery. Prior to this invention, there was no way of producing customized collagenous proteins for these and other applications. Heretofore, collagenous proteins have been produced by use of such biological systems as yeasts, bacteria, and transgenic animals and plants. These products are normal collagens that can also be extracted from such sources as tendons, bones, and hides. These products cannot be made to consist only of biologically active, specific amino acid sequences that may be needed for specific applications. Prior to this invention, it had been established that fibrillar collagens consist of domains that are responsible for such processes as interaction with cells, binding of growth factors, and interaction with a number of structural proteins present in the extracellular matrix. A normal collagen consists of a sequence of domains that can be represented by a corresponding sequence of labels, e.g., D1D2D3D4. A collagenlike protein of the present invention contains regions of collagen II that contain multiples of a single domain (e.g., D1D1D1D1 or D4D4D4D4) chosen for its specific biological activity. By virtue of the multiplicity of the chosen domain, the density of sites having that specific biological activity is greater than it is in a normal collagen. A collagenlike protein according to this invention can thus be made to have properties that are necessary for tissue engineering.

  15. Protein targeting protocols

    National Research Council Canada - National Science Library

    Clegg, Roger A

    1998-01-01

    ... of intracellular environment. Because the concept of protein targeting is intuitive rather than explicitly defined, it has been variously used by different groups of researchers in cell biology, biochemistry, and molecular biology. For those working in the field of intracellular signaling, an influential introduction to the topic was the seminal article by Hubbard & Cohen (TIBS [1993] 18, 172- 177), which was based on the work of Cohen's laboratory on protein phosphatases. Subsequently, the ideas that t...

  16. Protein conducting nanopores

    International Nuclear Information System (INIS)

    Harsman, Anke; Krueger, Vivien; Bartsch, Philipp; Honigmann, Alf; Wagner, Richard; Schmidt, Oliver; Rao, Sanjana; Meisinger, Christof

    2010-01-01

    About 50% of the cellular proteins have to be transported into or across cellular membranes. This transport is an essential step in the protein biosynthesis. In eukaryotic cells secretory proteins are transported into the endoplasmic reticulum before they are transported in vesicles to the plasma membrane. Almost all proteins of the endosymbiotic organelles chloroplasts and mitochondria are synthesized on cytosolic ribosomes and posttranslationally imported. Genetic, biochemical and biophysical approaches led to rather detailed knowledge on the composition of the translocon-complexes which catalyze the membrane transport of the preproteins. Comprehensive concepts on the targeting and membrane transport of polypeptides emerged, however little detail on the molecular nature and mechanisms of the protein translocation channels comprising nanopores has been achieved. In this paper we will highlight recent developments of the diverse protein translocation systems and focus particularly on the common biophysical properties and functions of the protein conducting nanopores. We also provide a first analysis of the interaction between the genuine protein conducting nanopore Tom40 SC as well as a mutant Tom40 SC (S 54 →E) containing an additional negative charge at the channel vestibule and one of its native substrates, CoxIV, a mitochondrial targeting peptide. The polypeptide induced a voltage-dependent increase in the frequency of channel closure of Tom40 SC corresponding to a voltage-dependent association rate, which was even more pronounced for the Tom40 SC S54E mutant. The corresponding dwelltime reflecting association/transport of the peptide could be determined with t-bar off ≅1.1 ms for the wildtype, whereas the mutant Tom40 SC S54E displayed a biphasic dwelltime distribution ( t-bar off 1 ≅0.4 ms; t-bar off 2 ≅4.6 ms).

  17. The effect of protein-protein and protein-membrane interactions on membrane fouling in ultrafiltration

    NARCIS (Netherlands)

    Huisman, I.H.; Prádanos, P.; Hernández, A.

    2000-01-01

    It was studied how protein-protein and protein-membrane interactions influence the filtration performance during the ultrafiltration of protein solutions over polymeric membranes. This was done by measuring flux, streaming potential, and protein transmission during filtration of bovine serum albumin

  18. Similarity measures for protein ensembles

    DEFF Research Database (Denmark)

    Lindorff-Larsen, Kresten; Ferkinghoff-Borg, Jesper

    2009-01-01

    Analyses of similarities and changes in protein conformation can provide important information regarding protein function and evolution. Many scores, including the commonly used root mean square deviation, have therefore been developed to quantify the similarities of different protein conformatio...

  19. Similarity measures for protein ensembles

    DEFF Research Database (Denmark)

    Lindorff-Larsen, Kresten; Ferkinghoff-Borg, Jesper

    2009-01-01

    Analyses of similarities and changes in protein conformation can provide important information regarding protein function and evolution. Many scores, including the commonly used root mean square deviation, have therefore been developed to quantify the similarities of different protein conformations...

  20. Protein: MPA1 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPA1 TLR signaling molecules RSAD2 CIG5 Radical S-adenosyl methionine domain-containing protein 2 Cytomegalo...virus-induced gene 5 protein, Viperin, Virus inhibitory protein, endoplasmic reticu

  1. More protein in cereals?

    International Nuclear Information System (INIS)

    1969-01-01

    Ways in which the protein content of plant crops may be raised by the use of nuclear radiation are to be discussed at a symposium in Vienna in June next year, organized by the joint Food and Agriculture Organization/Agency Division of Atomic Energy in Food and Agriculture. Plant crops - especially cereal grains - are the basic food and protein source of most of the world's population, particularly in less-developed countries. But their natural protein content is low; increasing the quantity and nutritional quality of plant protein is potentially the most feasible way to combat widespread protein malnutrition. This improvement in seed stock can be achieved by plant breeding methods in which nuclear irradiation techniques are used to induce mutations in grain, and other isotopic techniques can be used to select only those mutants which have the desired properties. The scientists who attend the symposium will have an opportunity to review what mutation plant breeders have achieved, the application of nuclear techniques to screening for protein and amino-acid content and nutritional value, and isotopic methods which contribute to research in plant nutrition and physiology. (author)

  2. Disease specific protein corona

    Science.gov (United States)

    Rahman, M.; Mahmoudi, M.

    2015-03-01

    It is now well accepted that upon their entrance into the biological environments, the surface of nanomaterials would be covered by various biomacromolecules (e.g., proteins and lipids). The absorption of these biomolecules, so called `protein corona', onto the surface of (nano)biomaterials confers them a new `biological identity'. Although the formation of protein coronas on the surface of nanoparticles has been widely investigated, there are few reports on the effect of various diseases on the biological identity of nanoparticles. As the type of diseases may tremendously changes the composition of the protein source (e.g., human plasma/serum), one can expect that amount and composition of associated proteins in the corona composition may be varied, in disease type manner. Here, we show that corona coated silica and polystyrene nanoparticles (after interaction with in the plasma of the healthy individuals) could induce unfolding of fibrinogen, which promotes release of the inflammatory cytokines. However, no considerable releases of inflammatory cytokines were observed for corona coated graphene sheets. In contrast, the obtained corona coated silica and polystyrene nanoparticles from the hypofibrinogenemia patients could not induce inflammatory cytokine release where graphene sheets do. Therefore, one can expect that disease-specific protein coronas can provide a novel approach for applying nanomedicine to personalized medicine, improving diagnosis and treatment of different diseases tailored to the specific conditions and circumstances.

  3. Electrophoretic transfer protein zymography.

    Science.gov (United States)

    Pan, Daniel; Hill, Adam P; Kashou, Anthony; Wilson, Karl A; Tan-Wilson, Anna

    2011-04-15

    Zymography detects and characterizes proteolytic enzymes by electrophoresis of protease-containing samples into a nonreducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel containing a copolymerized protein substrate. The usefulness of zymography for molecular weight determination and proteomic analysis is hampered by the fact that some proteases exhibit slower migration through a gel that contains substrate protein. This article introduces electrophoretic transfer protein zymography as one solution to this problem. In this technique, samples containing proteolytic enzymes are first resolved in nonreducing SDS-PAGE on a gel without protein substrate. The proteins in the resolving gel are then electrophoretically transferred to a receiving gel previously prepared with a copolymerized protein substrate. The receiving gel is then developed as a zymogram to visualize clear or lightly stained bands in a dark background. Band intensities are linearly related to the amount of protease, extending the usefulness of the technique so long as conditions for transfer and development of the zymogram are kept constant. Conditions of transfer, such as the pore sizes of resolving and receiving gels and the transfer time relative to the molecular weight of the protease, are explored. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Modelling of proteins in membranes

    DEFF Research Database (Denmark)

    Sperotto, Maria Maddalena; May, S.; Baumgaertner, A.

    2006-01-01

    This review describes some recent theories and simulations of mesoscopic and microscopic models of lipid membranes with embedded or attached proteins. We summarize results supporting our understanding of phenomena for which the activities of proteins in membranes are expected to be significantly...... oppositely charged lipid membranes, lipid-induced tilting of proteins embedded in lipid bilayers, protein-induced bilayer deformations, protein insertion and assembly, and lipid-controlled functioning of membrane proteins....

  5. Peptide Signals Encode Protein Localization▿

    OpenAIRE

    Russell, Jay H.; Keiler, Kenneth C.

    2007-01-01

    Many bacterial proteins are localized to precise intracellular locations, but in most cases the mechanism for encoding localization information is not known. Screening libraries of peptides fused to green fluorescent protein identified sequences that directed the protein to helical structures or to midcell. These peptides indicate that protein localization can be encoded in 20-amino-acid peptides instead of complex protein-protein interactions and raise the possibility that the location of a ...

  6. Protein hydrolysates in sports nutrition

    Directory of Open Access Journals (Sweden)

    Manninen Anssi H

    2009-09-01

    Full Text Available Abstract It has been suggested that protein hydrolysates providing mainly di- and tripeptides are superior to intact (whole proteins and free amino acids in terms of skeletal muscle protein anabolism. This review provides a critical examination of protein hydrolysate studies conducted in healthy humans with special reference to sports nutrition. The effects of protein hydrolysate ingestion on blood amino acid levels, muscle protein anabolism, body composition, exercise performance and muscle glycogen resynthesis are discussed.

  7. Modeling Mercury in Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Jere