Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick
2015-05-01
DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Sarah M Hykin
Full Text Available For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles, attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens-particularly for use in phylogenetic analyses-has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp. We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens
Hykin, Sarah M; Bi, Ke; McGuire, Jimmy A
2015-01-01
For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles), attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens-particularly for use in phylogenetic analyses-has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp). We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens available for
DEFF Research Database (Denmark)
Andersen, Gitte Brinch; Hager, Henrik; Hansen, Lise Lotte
2014-01-01
Chip. Quantitative DNA methylation analysis demonstrated that the methylation profile in PAXgene-fixed tissues showed, in comparison with restored FFPE samples, a higher concordance with the profile detected in frozen samples. We demonstrate, for the first time, that DNA from PAXgene conserved tissue performs better......Formalin fixation has been the standard method for conservation of clinical specimens for decades. However, a major drawback is the high degradation of nucleic acids, which complicates its use in genome-wide analyses. Unbiased identification of biomarkers, however, requires genome-wide studies......, precluding the use of the valuable archives of specimens with long-term follow-up data. Therefore, restoration protocols for DNA from formalin-fixed and paraffin-embedded (FFPE) samples have been developed, although they are cost-intensive and time-consuming. An alternative to FFPE and snap...
Kalmár, Alexandra; Péterfia, Bálint; Hollósi, Péter; Wichmann, Barnabás; Bodor, András; Patai, Árpád V; Schöller, Andrea; Krenács, Tibor; Tulassay, Zsolt; Molnár, Béla
2015-09-01
We aimed to test the applicability of formalin-fixed and paraffin-embedded (FFPE) tissue samples for gene specific DNA methylation analysis after using two commercially available DNA isolation kits. Genomic DNA was isolated from 5 colorectal adenocarcinomas and 5 normal adjacent tissues from "recent", collected within 6 months, and "archived", collected more than 5 years ago, FFPE tissues using either High Pure FFPET DNA Isolation kit or QIAamp DNA FFPE Tissue kit. DNA methylation analysis of MAL, SFRP1 and SFRP2 genes, known to be hypermethylated in CRC, was performed using methylation-sensitive high resolution melting (MS-HRM) analysis and sequencing. QIAamp (Q) method resulted in slightly higher recovery in archived (HP: 1.22 ± 3.18 μg DNA; Q: 3.00 ± 4.04 μg DNA) and significantly (p < 0.05) higher recovery in recent samples compared to High Pure method (HP) (HP: 4.10 ± 2.91 μg DNA; Q: 11.51 ± 7.50 μg DNA). Both OD260/280 and OD260/230 ratios were lower, but still high in the High Pure isolated archived and recent samples compared to those isolated with QIAamp. Identical DNA methylation patterns were detected for all 3 genes tested by MS-HRM with both isolation kits in the recent group. However, despite of higher DNA recovery in QIAamp slightly more reproducible methylation results were obtained from High Pure isolated archived samples. Sequencing confirmed DNA hypermethylation in CRCs. In conclusion, reproducible DNA methylation patterns were obtained from recent samples using both isolation kits. However, long term storage may affect the reliability of the results leading to moderate differences between the efficiency of isolation kits.
Directory of Open Access Journals (Sweden)
MacKinnon Ruth N
2012-02-01
Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
DNA degrades during storage in formalin-fixed and paraffin-embedded tissue blocks.
Guyard, Alice; Boyez, Alice; Pujals, Anaïs; Robe, Cyrielle; Tran Van Nhieu, Jeanne; Allory, Yves; Moroch, Julien; Georges, Odette; Fournet, Jean-Christophe; Zafrani, Elie-Serge; Leroy, Karen
2017-10-01
Formalin-fixed paraffin-embedded (FFPE) tissue blocks are widely used to identify clinically actionable molecular alterations or perform retrospective molecular studies. Our goal was to quantify degradation of DNA occurring during mid to long-term storage of samples in usual conditions. We selected 46 FFPE samples of surgically resected carcinomas of lung, colon, and urothelial tract, of which DNA had been previously extracted. We performed a second DNA extraction on the same blocks under identical conditions after a median period of storage of 5.5 years. Quantitation of DNA by fluorimetry showed a 53% decrease in DNA quantity after storage. Quantitative PCR (qPCR) targeting KRAS exon 2 showed delayed amplification of DNA extracted after storage in all samples but one. The qPCR/fluorimetry quantification ratio decreased from 56 to 15% after storage (p DNA analyzable by qPCR represented only 11% of the amount obtained at first extraction. Maximal length of amplifiable DNA fragments assessed with a multiplex PCR was reduced in DNA extracted from stored tissue, indicating that DNA fragmentation had increased in the paraffin blocks during storage. Next-generation sequencing was performed on 12 samples and showed a mean 3.3-fold decrease in library yield and a mean 4.5-fold increase in the number of single-nucleotide variants detected after storage. In conclusion, we observed significant degradation of DNA extracted from the same FFPE block after 4 to 6 years of storage. Better preservation strategies should be considered for storage of FFPE biopsy specimens.
DNA damage in oral mucosa cells of patients with fixed orthodontic appliances.
Directory of Open Access Journals (Sweden)
Farzin Heravi
2013-12-01
Full Text Available The release of toxic metal ions from orthodontic alloys has induced concerns regarding the biocompatibility of fixed appliances. This study investigated the genotoxic effect of metal appliances in a sample of patients undergoing fixed orthodontic treatment.The study included twenty-five healthy individuals requiring orthodontic therapy in both jaws. The patients were treated by stainless steel orthodontic brackets and nickel-titanium or stainless steel arch wires. The oral mucosa cells were gathered just before the appliance placement and 9 months later. The cells were centrifuged, fixed and dropped onto slides. After staining, the micronucleus (MN assay was used to determine genome alteration. The data were analyzed by paired sample t-test.The mean micronuclei frequency in the buccal mucosa was 10.6 ± 5.7 per 1000 cells before the appliance placement and 9.2 ± 6.37 per 1000 cells 9 months later. No significant difference was found in the MN count before and 9 months after therapy (p=0.336.Under the conditions used in this study, application of fixed orthodontic appliances did not expose healthy individuals to increased risk of DNA damage in oral mucosa cells.
The current state of eukaryotic DNA base damage and repair.
Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W
2015-12-02
DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
P. D. Luka
2014-10-01
Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.
Daugaard, Iben; Kjeldsen, Tina E; Hager, Henrik; Hansen, Lise Lotte; Wojdacz, Tomasz K
2015-12-01
Readily accessible formalin-fixed paraffin embedded (FFPE) tissues are a highly valuable source of genetic material for molecular analyses in both research and in vitro diagnostics but frequently genetic material in those samples is highly degraded. With locus-specific methylation changes being widely investigated for use as biomarkers in various aspects of clinical disease management, we aimed to evaluate to what extent standard laboratory procedures can approximate the quality of the DNA extracted from FFPE samples prior to methylation analyses. DNA quality in 107 FFPE non-small cell lung cancer (NSCLC) samples was evaluated using spectrophotometry and gel electrophoresis. Subsequently, the quality assessment results were correlated with the results of locus specific methylation assessment with methylation sensitive high resolution melting (MS-HRM). The correlation of template quality with PCR amplification performance and HRM based methylation detection indicated a significant influence of DNA quality on PCR amplification but not on methylation assessment. In conclusion, standard laboratory procedures fairly well approximate DNA degradation of FFPE samples and DNA degradation does not seem to considerably affect locus-specific methylation assessment by MS-HRM. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sasou, Megumi; Sugiyama, Shigeru; Ishida, Takao; Ohtani, Toshio; Miyake, Koji
2009-01-01
Methyltrimethoxysilane (MTMS)-coupled mica substrate is reportedly suitable for fixing and straightening of DNA, but 3-aminopropyltriethoxysilane (APTES)-coupled mica substrate has been found less suitable. On MTMS-coupled mica substrate, the straightness of fixed DNA was sufficient, and the adsorption of contaminants was not observed using fluorescence microscopy and atomic force microscopy. For the APTES-coupled mica substrate, however, aggregated or curved DNA and adsorption of contaminants were observed. To clarify the surface factors that are responsible for this suitability, we analyzed the surface free energies of these substrates using the extended Fowkes theory. In each of the surface free energy components, the dispersion force component in the MTMS-coupled mica substrate was lower than that in the APTES-coupled mica substrate. The ratio of the polar force component on the MTMS-coupled mica substrate was about one order of magnitude on the APTES-coupled mica substrate. In addition, the ratio of the hydrogen-bonding force component for the MTMS-coupled mica substrate was about two times larger than that of the APTES-coupled mica substrate. These results suggest that the polar force and hydrogen-bonding force components are important factors for the fixation and straightening of DNA and that the dispersion force components influence the production and adsorption of contaminants.
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Evaluation of the Branched-Chain DNA Assay for Measurement of RNA in Formalin-Fixed Tissues
Knudsen, Beatrice S.; Allen, April N.; McLerran, Dale F.; Vessella, Robert L.; Karademos, Jonathan; Davies, Joan E.; Maqsodi, Botoul; McMaster, Gary K.; Kristal, Alan R.
2008-01-01
We evaluated the branched-chain DNA (bDNA) assay QuantiGene Reagent System to measure RNA in formalin-fixed, paraffin-embedded (FFPE) tissues. The QuantiGene Reagent System does not require RNA isolation, avoids enzymatic preamplification, and has a simple workflow. Five selected genes were measured by bDNA assay; quantitative polymerase chain reaction (qPCR) was used as a reference method. Mixed-effect statistical models were used to partition the overall variance into components attributable to xenograft, sample, and assay. For FFPE tissues, the coefficients of reliability were significantly higher for the bDNA assay (93–100%) than for qPCR (82.4–95%). Correlations between qPCRFROZEN, the gold standard, and bDNAFFPE ranged from 0.60 to 0.94, similar to those from qPCRFROZEN and qPCRFFPE. Additionally, the sensitivity of the bDNA assay in tissue homogenates was 10-fold higher than in purified RNA. In 9- to 13-year-old blocks with poor RNA quality, the bDNA assay allowed the correct identification of the overexpression of known cancer genes. In conclusion, the QuantiGene Reagent System is considerably more reliable, reproducible, and sensitive than qPCR, providing an alternative method for the measurement of gene expression in FFPE tissues. It also appears to be well suited for the clinical analysis of FFPE tissues with diagnostic or prognostic gene expression biomarker panels for use in patient treatment and management. PMID:18276773
Loayza, María Fernanda; Villavicencio, Fernando Xavier; Santander, Stephanie Carolina; Baldeón, Manuel; Ponce, Lourdes Karina; Salvador, Iván; Vivar Díaz, Nicolás
2015-01-01
To assess the molecular events exerted by Helicobacter pylori interacting directly with gastric epithelial cells, an improved procedure for microbial DNA isolation from stained hematoxilin-eosin gastric biopsies was developed based on laser micro-dissection (LM) [1]. Few articles have described the use of LM to select and detect H. pylori genome from formalin-fixed paraffin embedded gastric tissue [2]. To improve the yield and quality of DNA isolated from H. pylori contacting intestinal epithelial cells, the following conditions were established after modification of the QIAamp DNA Micro kit. •Use of at least 25 cut sections of 10-20 μm of diameter and 3 μm thick with more than 10 bacteria in each cut.•Lysis with 30 μL of tissue lysis buffer and 20 μL of proteinase K (PK) with the tube in an upside-down position.•The use of thin purification columns with 35 μL of elution buffer. The mean of DNA concentration obtained from 25 LM cut sections was 1.94± 0 .16 ng/μL, and it was efficiently amplified with qPCR in a Bio Rad iCycler instrument. The LM can improve the sample selection and DNA extraction for molecular analysis of H. pylori associated with human gastric epithelium.
DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis
Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio
2016-01-01
High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753
Directory of Open Access Journals (Sweden)
Florenza Lüder Ripoli
2016-05-01
Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.
DNA-based watermarks using the DNA-Crypt algorithm
Directory of Open Access Journals (Sweden)
Barnekow Angelika
2007-05-01
Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.
DNA-based watermarks using the DNA-Crypt algorithm.
Heider, Dominik; Barnekow, Angelika
2007-05-29
The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.
DNA-based watermarks using the DNA-Crypt algorithm
Heider, Dominik; Barnekow, Angelika
2007-01-01
Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434
Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M
2010-10-01
A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.
Wang, Fuan; Willner, Bilha; Willner, Itamar
2014-01-01
The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.
Kristensen, Lasse S; Wojdacz, Tomasz K; Thestrup, Britta B; Wiuf, Carsten; Hager, Henrik; Hansen, Lise Lotte
2009-12-21
The High Resolution Melting (HRM) technology has recently been introduced as a rapid and robust analysis tool for the detection of DNA methylation. The methylation status of multiple tumor suppressor genes may serve as biomarkers for early cancer diagnostics, for prediction of prognosis and for prediction of response to treatment. Therefore, it is important that methodologies for detection of DNA methylation continue to evolve. Sensitive Melting Analysis after Real Time - Methylation Specific PCR (SMART-MSP) and Methylation Sensitive - High Resolution Melting (MS-HRM) are two methods for single locus DNA methylation detection based on HRM. Here, we have assessed the quality of DNA extracted from up to 30 years old Formalin Fixed Paraffin Embedded (FFPE) tissue for DNA methylation analysis using SMART-MSP and MS-HRM. The quality assessment was performed on DNA extracted from 54 Non-Small Cell Lung Cancer (NSCLC) samples derived from FFPE tissue, collected over 30 years and grouped into five years intervals. For each sample, the methylation levels of the CDKN2A (p16) and RARB promoters were estimated using SMART-MSP and MS-HRM assays designed to assess the methylation status of the same CpG positions. This allowed for a direct comparison of the methylation levels estimated by the two methods for each sample. CDKN2A promoter methylation levels were successfully determined by SMART-MSP and MS-HRM in all 54 samples. Identical methylation estimates were obtained by the two methods in 46 of the samples. The methylation levels of the RARB promoter were successfully determined by SMART-MSP in all samples. When using MS-HRM to assess RARB methylation five samples failed to amplify and 15 samples showed a melting profile characteristic for heterogeneous methylation. Twenty-seven of the remaining 34 samples, for which the methylation level could be estimated, gave the same result as observed when using SMART-MSP. MS-HRM and SMART-MSP can be successfully used for single locus
Principles of DNA architectonics: design of DNA-based nanoobjects
International Nuclear Information System (INIS)
Vinogradova, O A; Pyshnyi, D V
2012-01-01
The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.
Fixed Point Learning Based Intelligent Traffic Control System
Zongyao, Wang; Cong, Sui; Cheng, Shao
2017-10-01
Fixed point learning has become an important tool to analyse large scale distributed system such as urban traffic network. This paper presents a fixed point learning based intelligence traffic network control system. The system applies convergence property of fixed point theorem to optimize the traffic flow density. The intelligence traffic control system achieves maximum road resources usage by averaging traffic flow density among the traffic network. The intelligence traffic network control system is built based on decentralized structure and intelligence cooperation. No central control is needed to manage the system. The proposed system is simple, effective and feasible for practical use. The performance of the system is tested via theoretical proof and simulations. The results demonstrate that the system can effectively solve the traffic congestion problem and increase the vehicles average speed. It also proves that the system is flexible, reliable and feasible for practical use.
On Determining if Tree-based Networks Contain Fixed Trees.
Anaya, Maria; Anipchenko-Ulaj, Olga; Ashfaq, Aisha; Chiu, Joyce; Kaiser, Mahedi; Ohsawa, Max Shoji; Owen, Megan; Pavlechko, Ella; St John, Katherine; Suleria, Shivam; Thompson, Keith; Yap, Corrine
2016-05-01
We address an open question of Francis and Steel about phylogenetic networks and trees. They give a polynomial time algorithm to decide if a phylogenetic network, N, is tree-based and pose the problem: given a fixed tree T and network N, is N based on T? We show that it is [Formula: see text]-hard to decide, by reduction from 3-Dimensional Matching (3DM) and further that the problem is fixed-parameter tractable.
Al-Attas, Asmaa; Assidi, Mourad; Al-Maghrabi, Jaudah; Dallol, Ashraf; Schulten, Hans-Juergen; Abu-Elmagd, Muhammad; Chaudhary, Adeel; Abuzenadah, Adel; Budowle, Bruce; Buhmeida, Abdelbaset; Al-Qahtani, Mohammed
To date, the conventional formalin-fixed, paraffin-embedded (FFPE) technique is the gold-standard for preserving histomorphology. Once FFPE tissues are stained, slides are routinely archived along with their blocks at biobanks/hospitals. However, the reuse of fixed and stained biospecimens as DNA source is not a common routine practice worldwide and, thus, indicates the need of studies to investigate the feasibility of extracting DNA from already immunohistochemistry (IHC) FFPE-stained slides and its possible reuse in subsequent downstream molecular analyses. FFPE IHC slides from colorectal cancer (CRC) patients were prepared and stored in the CEGMR Biobank. The workflow consists of digitalization of IHC stained slide's image, removing the slide cover-slip, crude dissection and DNA extraction. Following DNA quality assessment, mutation analysis of CTNNB1 and methylation profile of CDH1 were performed. High-quality DNA was obtained allowing 60% concordance between CDH1 methylation and membranous E-cadherin expression pattern. Clean CTNNB1 DNA chromatograms with evenly-spaced peaks were observed. This study is a proof of concept to recycle and reuse DNA from IHC stained slides with suitable concentration and integrity for further downstream molecular applications. These findings will enhance the pathologists' knowledge, attitudes and practices (KAP) towards the use of these biospecimens and support the implementation of this approach in clinical pathology practice. Therefore, the scientific community will benefit from the largest comprehensive database of human fully annotated FFPE biospecimens already available at their disposal in order to demystify the complexity and the heterogeneity of many challenging diseases and foster the transition towards precision medicine. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
Yang, Jiao-lan; Chen, Dong-qing; Li, Shu-min; Yue, Yin-ling; Jin, Xin; Zhao, Bing-cheng; Ying, Bo
2010-02-05
The fluorosis derived from coal burning is a very serious problem in China. By using fluorine-fixing technology during coal burning we are able to reduce the release of fluorides in coal at the source in order to reduce pollution to the surrounding environment by coal burning pollutants as well as decrease the intake and accumulating amounts of fluorine in the human body. The aim of this study was to conduct a pilot experiment on calcium-based fluorine-fixing material efficiency during coal burning to demonstrate and promote the technology based on laboratory research. A proper amount of calcium-based fluorine sorbent was added into high-fluorine coal to form briquettes so that the fluorine in high-fluorine coal can be fixed in coal slag and its release into atmosphere reduced. We determined figures on various components in briquettes and fluorine in coal slag as well as the concentrations of indoor air pollutants, including fluoride, sulfur dioxide and respirable particulate matter (RPM), and evaluated the fluorine-fixing efficiency of calcium-based fluorine sorbents and the levels of indoor air pollutants. Pilot experiments on fluorine-fixing efficiency during coal burning as well as its demonstration and promotion were carried out separately in Guiding and Longli Counties of Guizhou Province, two areas with coal burning fluorosis problems. If the calcium-based fluorine sorbent mixed coal was made into honeycomb briquettes the average fluorine-fixing ratio in the pilot experiment was 71.8%. If the burning calcium-based fluorine-fixing bitumite was made into a coalball, the average of fluorine-fixing ratio was 77.3%. The concentration of fluoride, sulfur dioxide and PM10 of indoor air were decreased significantly. There was a 10% increase in the cost of briquettes due to the addition of calcium-based fluorine sorbent. The preparation process of calcium-based fluorine-fixing briquette is simple yet highly flammable and it is applicable to regions with abundant
Agreda, Patricia M.; Beitman, Gerard H.; Gutierrez, Erin C.; Harris, James M.; Koch, Kristopher R.; LaViers, William D.; Leitch, Sharon V.; Maus, Courtney E.; McMillian, Ray A.; Nussbaumer, William A.; Palmer, Marcus L. R.; Porter, Michael J.; Richart, Gregory A.; Schwab, Ryan J.
2013-01-01
We evaluated the effect of storage at 2 to 8°C on the stability of human genomic and human papillomavirus (HPV) DNA stored in BD SurePath and Hologic PreservCyt liquid-based cytology media. DNA retained the ability to be extracted and PCR amplified for more than 2.5 years in both medium types. Prior inability to detect DNA in archived specimens may have been due to failure of the extraction method to isolate DNA from fixed cells. PMID:23678069
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Ancient mtDNA genetic variants modulate mtDNA transcription and replication.
Directory of Open Access Journals (Sweden)
Sarit Suissa
2009-05-01
Full Text Available Although the functional consequences of mitochondrial DNA (mtDNA genetic backgrounds (haplotypes, haplogroups have been demonstrated by both disease association studies and cell culture experiments, it is not clear which of the mutations within the haplogroup carry functional implications and which are "evolutionary silent hitchhikers". We set forth to study the functionality of haplogroup-defining mutations within the mtDNA transcription/replication regulatory region by in vitro transcription, hypothesizing that haplogroup-defining mutations occurring within regulatory motifs of mtDNA could affect these processes. We thus screened >2500 complete human mtDNAs representing all major populations worldwide for natural variation in experimentally established protein binding sites and regulatory regions comprising a total of 241 bp in each mtDNA. Our screen revealed 77/241 sites showing point mutations that could be divided into non-fixed (57/77, 74% and haplogroup/sub-haplogroup-defining changes (i.e., population fixed changes, 20/77, 26%. The variant defining Caucasian haplogroup J (C295T increased the binding of TFAM (Electro Mobility Shift Assay and the capacity of in vitro L-strand transcription, especially of a shorter transcript that maps immediately upstream of conserved sequence block 1 (CSB1, a region associated with RNA priming of mtDNA replication. Consistent with this finding, cybrids (i.e., cells sharing the same nuclear genetic background but differing in their mtDNA backgrounds harboring haplogroup J mtDNA had a >2 fold increase in mtDNA copy number, as compared to cybrids containing haplogroup H, with no apparent differences in steady state levels of mtDNA-encoded transcripts. Hence, a haplogroup J regulatory region mutation affects mtDNA replication or stability, which may partially account for the phenotypic impact of this haplogroup. Our analysis thus demonstrates, for the first time, the functional impact of particular mtDNA
47 CFR 90.1331 - Restrictions on the operation of base and fixed stations.
2010-10-01
...-3700 MHz Band § 90.1331 Restrictions on the operation of base and fixed stations. (a)(1) Except as provided in paragraph (a)(2) of this section, base and fixed stations may not be located within 150 km of... these stations are available at http://www.fcc.gov/ib/sd/3650/. (2) Base and fixed stations may be...
Energy Technology Data Exchange (ETDEWEB)
Dubinin, N P; Filippov, V D
1986-01-01
A suspension of E.coli cells has been subjected to UV radiation, then it has been incubated in the growth medium for 15 min. After that one of the portions was incubated with nalidixic acid (NA), and the other one without it in the presence of an antibiotic. Frequency of mutations depending on or irrespective of photoactivation, has been determined. Dependence of Str mutation fixing, induced by low UV radiation doses, on DNA synthesis is determined. Results indicate that both photoreactivation of mutations and its senstivity to mfd system are simultaneously lost.
Vries, de R.
2011-01-01
A large literature exists on modeling the influence of sequence-specific DNA-binding proteins on the shape of the DNA double helix in terms of one or a few fixed constraints. This approach is inadequate for the many proteins that bind DNA sequence independently, and that are present in very large
Lemkul, Justin A; MacKerell, Alexander D
2017-05-09
Empirical force fields seek to relate the configuration of a set of atoms to its energy, thus yielding the forces governing its dynamics, using classical physics rather than more expensive quantum mechanical calculations that are computationally intractable for large systems. Most force fields used to simulate biomolecular systems use fixed atomic partial charges, neglecting the influence of electronic polarization, instead making use of a mean-field approximation that may not be transferable across environments. Recent hardware and software developments make polarizable simulations feasible, and to this end, polarizable force fields represent the next generation of molecular dynamics simulation technology. In this work, we describe the refinement of a polarizable force field for DNA based on the classical Drude oscillator model by targeting quantum mechanical interaction energies and conformational energy profiles of model compounds necessary to build a complete DNA force field. The parametrization strategy employed in the present work seeks to correct weak base stacking in A- and B-DNA and the unwinding of Z-DNA observed in the previous version of the force field, called Drude-2013. Refinement of base nonbonded terms and reparametrization of dihedral terms in the glycosidic linkage, deoxyribofuranose rings, and important backbone torsions resulted in improved agreement with quantum mechanical potential energy surfaces. Notably, we expand on previous efforts by explicitly including Z-DNA conformational energetics in the refinement.
Celestial Navigation Fix Based on Particle Swarm Optimization
Directory of Open Access Journals (Sweden)
Tsou Ming-Cheng
2015-09-01
Full Text Available A technique for solving celestial fix problems is proposed in this study. This method is based on Particle Swarm Optimization from the field of swarm intelligence, utilizing its superior optimization and searching abilities to obtain the most probable astronomical vessel position. In addition to being applicable to two-body fix, multi-body fix, and high-altitude observation problems, it is also less reliant on the initial dead reckoning position. Moreover, by introducing spatial data processing and display functions in a Geographical Information System, calculation results and chart work used in Circle of Position graphical positioning can both be integrated. As a result, in addition to avoiding tedious and complicated computational and graphical procedures, this work has more flexibility and is more robust when compared to other analytical approaches.
ConSpeciFix: Classifying prokaryotic species based on gene flow.
Bobay, Louis-Marie; Ellis, Brian Shin-Hua; Ochman, Howard
2018-05-16
Classification of prokaryotic species is usually based on sequence similarity thresholds, which are easy to apply but lack a biologically-relevant foundation. Here, we present ConSpeciFix, a program that classifies prokaryotes into species using criteria set forth by the Biological Species Concept, thereby unifying species definition in all domains of life. ConSpeciFix's webserver is freely available at www.conspecifix.com. The local version of the program can be freely downloaded from https://github.com/Bobay-Ochman/ConSpeciFix. ConSpeciFix is written in Python 2.7 and requires the following dependencies: Usearch, MCL, MAFFT and RAxML. ljbobay@uncg.edu.
Novel nitrogen-fixing Acetobacter nitrogenifigens sp. nov., isolated from Kombucha tea.
Dutta, Debasree; Gachhui, Ratan
2006-08-01
The four nitrogen-fixing bacteria so far described in the family Acetobacteraceae belong to the genera Gluconacetobacter and Acetobacter. Nitrogen-fixing bacterial strain RG1(T) was isolated from Kombucha tea and, based on the phylogenetic analysis of 16S rRNA gene sequence which is supported by a high bootstrap value, was found to belong to the genus Acetobacter. Strain RG1(T) differed from Acetobacter aceti, the nearest member with a 16S rRNA gene sequence similarity of 98.2 %, and type strains of other Acetobacter species with regard to several characteristics of growth features in culture media, growth in nitrogen-free medium, production of gamma-pyrone from glucose and dihydroxyacetone from glycerol. Strain RG1(T) utilized maltose, glycerol, sorbitol, fructose, galactose, arabinose and ethanol, but not methanol as a carbon source. These results, along with electrophoretic mobility patterns of nine metabolic enzymes, suggest that strain RG1(T) represents a novel nitrogen-fixing species. The ubiquinone present was Q-9 and DNA G+C content was 64.1 mol%. Strain RG1(T) exhibited a low value of 2-24 % DNA-DNA relatedness to the type strains of related acetobacters, which placed it as a separate taxon. On the basis of this data, the name Acetobacter nitrogenifigens sp. nov. is proposed, with the type strain RG1(T) (=MTCC 6912(T)=LMG 23498(T)).
DNA-Based Applications in Nanobiotechnology
Directory of Open Access Journals (Sweden)
Khalid M. Abu-Salah
2010-01-01
Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Hu, Yun-peng; Chen, Lei; Huang, Jian-yu
2017-08-01
The US Lincoln Laboratory proved that space-based visible (SBV) observation is efficient to observe space objects, especially Geosynchronous Orbit (GEO) objects. After that, SBV observation plays an important role in the space surveillance. In this paper, a novel space-based observation mode is designed to observe all the GEO objects in a relatively short time. A low earth orbit (LEO) satellite, especially a dawn-dusk sun-synchronous orbit satellite, is useful for space-based observation. Thus, the observation mode for GEO objects is based on a dawn-dusk sun-synchronous orbit satellite. It is found that the Pinch Point (PP) regions proposed by the US Lincoln Laboratory are spreading based on the analysis of the evolution principles of GEO objects. As the PP regions becoming more and more widely in the future, many strategies based on it may not be efficient any more. Hence, the key point of the space-based observation strategy design for GEO objects should be emphasized on the whole GEO belt as far as possible. The pseudo-fixed latitude observation mode is proposed in this paper based on the characteristics of GEO belt. Unlike classical space-based observation modes, pseudo-fixed latitude observation mode makes use of the one-dimensional attitude adjustment of the observation satellite. The pseudo-fixed latitude observation mode is more reliable and simple in engineering, compared with the gazing observation mode which needs to adjust the attitude from the two dimensions. It includes two types of attitude adjustment, i.e. daily and continuous attitude adjustment. Therefore, the pseudo-fixed latitude observation mode has two characteristics. In a day, the latitude of the observation region is fixed and the scanning region is about a rectangle, while the latitude of the observation region centre changes each day in a long term based on a daily strategy. The capabilities of a pseudo-fixed latitude observation instrument with a 98° dawn-dusk sun-synchronous orbit are
Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin
2017-10-01
Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary
Kim, Sung-Su; Choi, Hyun-Jeung; Kim, Jin Ju; Kim, M Sun; Lee, In-Seon; Byun, Bohyun; Jia, Lina; Oh, Myung Ryurl; Moon, Youngho; Park, Sarah; Choi, Joon-Seok; Chae, Seoung Wan; Nam, Byung-Ho; Kim, Jin-Soo; Kim, Jihun; Min, Byung Soh; Lee, Jae Seok; Won, Jae-Kyung; Cho, Soo Youn; Choi, Yoon-La; Shin, Young Kee
2018-01-11
In clinical translational research and molecular in vitro diagnostics, a major challenge in the detection of genetic mutations is overcoming artefactual results caused by the low-quality of formalin-fixed paraffin-embedded tissue (FFPET)-derived DNA (FFPET-DNA). Here, we propose the use of an 'internal quality control (iQC) index' as a criterion for judging the minimum quality of DNA for PCR-based analyses. In a pre-clinical study comparing the results from droplet digital PCR-based EGFR mutation test (ddEGFR test) and qPCR-based EGFR mutation test (cobas EGFR test), iQC index ≥ 0.5 (iQC copies ≥ 500, using 3.3 ng of FFPET-DNA [1,000 genome equivalents]) was established, indicating that more than half of the input DNA was amplifiable. Using this criterion, we conducted a retrospective comparative clinical study of the ddEGFR and cobas EGFR tests for the detection of EGFR mutations in non-small cell lung cancer (NSCLC) FFPET-DNA samples. Compared with the cobas EGFR test, the ddEGFR test exhibited superior analytical performance and equivalent or higher clinical performance. Furthermore, iQC index is a reliable indicator of the quality of FFPET-DNA and could be used to prevent incorrect diagnoses arising from low-quality samples.
Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin
2014-01-01
Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.
Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P
2017-06-01
Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Dejmek, Annika; Zendehrokh, Nooreldin; Tomaszewska, Malgorzata; Edsjö, Anders
2013-07-01
Personalized oncology requires molecular analysis of tumor cells. Several studies have demonstrated that cytological material is suitable for DNA analysis, but to the authors' knowledge there are no systematic studies comparing how the yield and quality of extracted DNA is affected by the various techniques used for the preparation of cytological material. DNA yield and quality were compared using cultured human lung cancer cells subjected to different preparation techniques used in routine cytology, including fixation, mounting medium, and staining. The results were compared with the outcome of epidermal growth factor receptor (EGFR) genotyping of 66 clinical cytological samples using the same DNA preparation protocol. All tested protocol combinations resulted in fragment lengths of at least 388 base pairs. The mounting agent EcoMount resulted in higher yields than traditional xylene-based medium. Spray and ethanol fixation resulted in both a higher yield and better DNA quality than air drying. In liquid-based cytology (LBC) methods, CytoLyt solution resulted in a 5-fold higher yield than CytoRich Red. Papanicolaou staining provided twice the yield of hematoxylin and eosin staining in both liquid-based preparations. Genotyping outcome and quality control values from the clinical EGFR genotyping demonstrated a sufficient amount and amplifiability of DNA in both spray-fixed and air-dried cytological samples. Reliable clinical genotyping can be performed using all tested methods. However, in the cell line experiments, spray- or ethanol-fixed, Papanicolaou-stained slides provided the best results in terms of yield and fragment length. In LBC, the DNA recovery efficiency of the preserving medium may differ considerably, which should be taken into consideration when introducing LBC. Cancer (Cancer Cytopathol) 2013;121:344-353. © 2013 American Cancer Society. © 2013 American Cancer Society.
Metallic Nanostructures Based on DNA Nanoshapes
Directory of Open Access Journals (Sweden)
Boxuan Shen
2016-08-01
Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.
Lee, Andrea J; Wallace, Susan S
2017-06-01
The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sadi, Al Muktafi; Wang, Dong-Yu; Youngson, Bruce J; Miller, Naomi; Boerner, Scott; Done, Susan J; Leong, Wey L
2011-01-01
The ability of gene profiling to predict treatment response and prognosis in breast cancers has been demonstrated in many studies using DNA microarray analyses on RNA from fresh frozen tumor specimens. In certain clinical and research situations, performing such analyses on archival formalin fixed paraffin-embedded (FFPE) surgical specimens would be advantageous as large libraries of such specimens with long-term follow-up data are widely available. However, FFPE tissue processing can cause fragmentation and chemical modifications of the RNA. A number of recent technical advances have been reported to overcome these issues. Our current study evaluates whether or not the technology is ready for clinical applications. A modified RNA extraction method and a recent DNA microarray technique, cDNA-mediated annealing, selection, extension and ligation (DASL, Illumina Inc) were evaluated. The gene profiles generated from FFPE specimens were compared to those obtained from paired fresh fine needle aspiration biopsies (FNAB) of 25 breast cancers of different clinical subtypes (based on ER and Her2/neu status). Selected RNA levels were validated using RT-qPCR, and two public databases were used to demonstrate the prognostic significance of the gene profiles generated from FFPE specimens. Compared to FNAB, RNA isolated from FFPE samples was relatively more degraded, nonetheless, over 80% of the RNA samples were deemed suitable for subsequent DASL assay. Despite a higher noise level, a set of genes from FFPE specimens correlated very well with the gene profiles obtained from FNAB, and could differentiate breast cancer subtypes. Expression levels of these genes were validated using RT-qPCR. Finally, for the first time we correlated gene expression profiles from FFPE samples to survival using two independent microarray databases. Specifically, over-expression of ANLN and KIF2C, and under-expression of MAPT strongly correlated with poor outcomes in breast cancer patients. We
A threshold-based fixed predictor for JPEG-LS image compression
Deng, Lihua; Huang, Zhenghua; Yao, Shoukui
2018-03-01
In JPEG-LS, fixed predictor based on median edge detector (MED) only detect horizontal and vertical edges, and thus produces large prediction errors in the locality of diagonal edges. In this paper, we propose a threshold-based edge detection scheme for the fixed predictor. The proposed scheme can detect not only the horizontal and vertical edges, but also diagonal edges. For some certain thresholds, the proposed scheme can be simplified to other existing schemes. So, it can also be regarded as the integration of these existing schemes. For a suitable threshold, the accuracy of horizontal and vertical edges detection is higher than the existing median edge detection in JPEG-LS. Thus, the proposed fixed predictor outperforms the existing JPEG-LS predictors for all images tested, while the complexity of the overall algorithm is maintained at a similar level.
Processing of free radical damaged DNA bases
International Nuclear Information System (INIS)
Wallace, S.
2003-01-01
Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant
Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.
Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae
2016-12-01
In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.
Two-dimensional salt and temperature DNA denaturation analysis using a magnetoresistive sensor
DEFF Research Database (Denmark)
Rizzi, Giovanni; Dufva, Martin; Hansen, Mikkel Fougt
2017-01-01
We present a microfluidic system and its use to measure DNA denaturation curves by varying the temperature or salt (Na+) concentration. The readout is based on real-time measurements of DNA hybridization using magnetoresistive sensors and magnetic nanoparticles (MNPs) as labels. We report the first...... melting curves of DNA hybrids measured as a function of continuously decreasing salt concentration at fixed temperature and compare them to the corresponding curves obtained vs. temperature at fixed salt concentration. The magnetoresistive sensor platform provided reliable results under varying....... The results demonstrate that concentration melting provides an attractive alternative to temperature melting in on-chip DNA denaturation experiments and further show that the magnetoresistive platform is attractive due to its low cross-sensitivity to temperature and liquid composition....
10 CFR 603.300 - Difference between an expenditure-based and a fixed-support TIA.
2010-01-01
... TECHNOLOGY INVESTMENT AGREEMENTS Requirements for Expenditure-Based and Fixed-Support Technology Investment... requirements in this subpart. The fundamental difference between an expenditure-based and a fixed-support TIA...
Synthesis of furan-based DNA binders and their interaction with DNA
International Nuclear Information System (INIS)
Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef
2006-01-01
In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)
32 CFR 37.300 - What is the difference between an expenditure-based and fixed-support TIA?
2010-07-01
... SECRETARY OF DEFENSE DoD GRANT AND AGREEMENT REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Expenditure-Based and Fixed-Support Technology Investment Agreements § 37.300 What is the difference between an expenditure-based and fixed-support TIA? The fundamental difference between an expenditure-based and fixed...
Isolating silkworm genomic DNA without liquid nitrogen suitable for ...
African Journals Online (AJOL)
Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...
Fixed-time synchronization of memristor-based BAM neural networks with time-varying discrete delay.
Chen, Chuan; Li, Lixiang; Peng, Haipeng; Yang, Yixian
2017-12-01
This paper is devoted to studying the fixed-time synchronization of memristor-based BAM neural networks (MBAMNNs) with discrete delay. Fixed-time synchronization means that synchronization can be achieved in a fixed time for any initial values of the considered systems. In the light of the double-layer structure of MBAMNNs, we design two similar feedback controllers. Based on Lyapunov stability theories, several criteria are established to guarantee that the drive and response MBAMNNs can realize synchronization in a fixed time. In particular, by changing the parameters of controllers, this fixed time can be adjusted to some desired value in advance, irrespective of the initial values of MBAMNNs. Numerical simulations are included to validate the derived results. Copyright © 2017 Elsevier Ltd. All rights reserved.
DNA interaction with platinum-based cytostatics revealed by DNA sequencing.
Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech
2017-12-15
The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Dizdaroglu, M.
1985-01-01
Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes
Charge transport through DNA based electronic barriers
Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj
2018-05-01
We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.
MethLAB: a graphical user interface package for the analysis of array-based DNA methylation data.
Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K; Conneely, Karen N
2012-03-01
Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data.
Nechifor-Boilă, Adela Corina; Loghin, Andrada; Vacariu, Victor; Halaţiu, Vasile Bogdan; Borda, Angela
2015-01-01
Optimal recovery of nucleic acids from formalin-fixed paraffin-embedded (FFPE) tissues is highly dependent on a series of pre-extraction steps, mainly related (but not limited) to fixation. The aim of our study was to investigate if the storage period of the FFPE blocks had a significant effect on the isolated DNA. We examined the quantity and purity of the isolated DNA from 83 FFPE blocks, corresponding to malignant thyroid (n=28) and renal (n=55) carcinomas that had been stored in our department for up to eight years. The DNA extraction protocol was based on a precipitation method (MasterPure™ DNA Purification Kit, Epicentre), in accordance to the manufacturer instructions, optimized in our laboratory. A spectrophotometer was used to determine the yield (A260) and purity (A260/A280 ratio) of the isolated DNA. We successfully isolated good DNA quantity and purity from all our study cases (mean concentration: 223.4 ± 104.16 ng/μL; mean A260/A280 ratio: 1.68 ± 0.09). Moreover, no statistically significant differences were observed between tumor blocks stored for 2-3 years and 7-8 years, respectively, both in terms of DNA quantity (p=0.196) and purity (p=0.663). In conclusion, we successfully validated an efficient, reproducible DNA extraction technique that provided a good range of DNA concentrations and purity, regardless the type of tissue (thyroid or kidney). Moreover, we demonstrated that the storage period of the FFPE blocks does not have a significant influence on the DNA quantity and purity.
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
Energy Technology Data Exchange (ETDEWEB)
Geisert, M; Heicke, B; Metzmann, E; Zahn, R K
1975-04-01
Using a radioimmunoassay (RIA) based on the Farr technique with radioactively labeled /sup 3/H-DNA for quantitative measurements of anti-DNA antibodies in sera of patients with systemic lupus erythematosus (SLE), the influence of molecular weight of DNA (ranging from 0.1 x 10/sup 6/ to 22.0 x 10/sup 6/ daltons) on binding and precipitation in this system has been investigated. Comparing our results with mathematical models it follows that one antibody molecule is fixed on the average to a statistical DNA segment of 2 x 10/sup 6/ to 4 x 10/sup 6/ daltons. Furthermore binding capacity of the DNA was found to be independent of the molecular weight, as demonstrated in a double label experiment using /sup 14/C and /sup 3/H-labeled DNA of different size. However, the amount of radioactivity precipitated was found to depend on the molecular weight of the labeled DNA following a non-linear function. It was calculated that a minimal ratio of fixed antibody molecules per a certain size of DNA was necessary for precipitation. The mathematical treatment of the observed non-linear precipitation dependence will be discussed using various statistical models. The results indicate that the quantitative measurements of anti-DNA antibodies with the Farr technique e.g., for diagnosis and control of SLE in clinical immunology is highly dependent on the molecular weight of the labeled DNA used in the assay system and reliable results are only obtained with DNA of a sufficiently high molecular weight. (auth)
LENUS (Irish Health Repository)
Kennedy, Richard D
2011-12-10
Current prognostic factors are poor at identifying patients at risk of disease recurrence after surgery for stage II colon cancer. Here we describe a DNA microarray-based prognostic assay using clinically relevant formalin-fixed paraffin-embedded (FFPE) samples.
An LP-based heuristic for the fixed charge transportation problem
DEFF Research Database (Denmark)
Klose, Andreas
2007-01-01
The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... approach for computing lower and upper bounds on the minimal cost. To this end, the LP relaxation is iteratively strengthened by means of adding cuts; in each iteration the current LP solution is then used to guide a local search heuristic. In addition to standard polyhedral cuts as lifted cover...
International Nuclear Information System (INIS)
Christiansen, D.W.
1982-01-01
This is a reusable system for fixing a nuclear reactor fuel rod to a support. An interlock cap is fixed to the fuel rod and an interlock strip is fixed to the support. The interlock cap has two opposed fingers, which are shaped so that a base is formed with a body part. The interlock strip has an extension, which is shaped so that this is rigidly fixed to the body part of the base. The fingers of the interlock cap are elastic in bending. To fix it, the interlock cap is pushed longitudinally on to the interlock strip, which causes the extension to bend the fingers open in order to engage with the body part of the base. To remove it, the procedure is reversed. (orig.) [de
Nofech-Mozes, Sharon; Khalifa, Mahmoud M; Ismiil, Nadia; Dubé, Valerie; Saad, Reda S; Sun, Peizhu; Seth, Arun; Ghorab, Zeina
2010-01-01
High-risk human papilloma virus (HPV) seems to play a role in the pathogenesis of cervical squamous neoplasia and adenocarcinomas of the mucinous and endometrioid cell types. Cervical serous, clear cell, and small cell carcinomas differ from the conventional endocervical adenocarcinoma in their clinical characteristics. The data on the role of HPV in their pathogenesis are limited. In this study, we examined the presence of high-risk HPV-DNA in rare types of cervical carcinoma using polymerase chain reaction-based test. In-house cervical serous, clear cell, and small cell carcinoma cases accessioned between 2000 and 2008 were tested for HPV by polymerase chain reaction amplification of DNA extracted from deparaffinized sections using Roche AMPLICOR HPV Amplification Detection and Control Kits. The kit detects all 13 high-risk HPV-DNA genotypes. The positive cut-off point for AMPLICOR HPV Test was A450 = 0.2. We identified 4 serous, 3 clear cell, 1 mixed clear cell and serous, and 5 small cell carcinomas. High-risk HPV-DNA tested positive in 3 out of 4 serous carcinomas, 2 out of 3 cervical clear cell carcinomas, and all 5 cases of small cell carcinoma and the mixed cell type. Our report documents HPV status in a series of archival unusual types of adenocarcinoma of the uterine cervix. It suggests a robust association between high-risk HPV and these rare subtypes. Despite their unique clinical setting and morphologic appearance, the majority of these tumors likely share a common HPV-mediated carcinogenic pathway. Our observation is particularly significant in cervical cancer prevention as we enter the HPV vaccination era.
Metallization of DNA on silicon surface
International Nuclear Information System (INIS)
Puchkova, Anastasiya Olegovna; Sokolov, Petr; Petrov, Yuri Vladimirovich; Kasyanenko, Nina Anatolievna
2011-01-01
New simple way for silver deoxyribonucleic acid (DNA)-based nanowires preparation on silicon surface was developed. The electrochemical reduction of silver ions fixed on DNA molecule provides the forming of tightly matched zonate silver clusters. Highly homogeneous metallic clusters have a size about 30 nm. So the thickness of nanowires does not exceed 30–50 nm. The surface of n-type silicon monocrystal is the most convenient substrate for this procedure. The comparative analysis of DNA metallization on of n-type silicon with a similar way for nanowires fabrication on p-type silicon, freshly cleaved mica, and glass surface shows the advantage of n-type silicon, which is not only the substrate for DNA fixation but also the source of electrons for silver reduction. Images of bound DNA molecules and fabricated nanowires have been obtained using an atomic force microscope and a scanning ion helium microscope. DNA interaction with silver ions in a solution was examined by the methods of ultraviolet spectroscopy and circular dichroism.
Q-learning-based adjustable fixed-phase quantum Grover search algorithm
International Nuclear Information System (INIS)
Guo Ying; Shi Wensha; Wang Yijun; Hu, Jiankun
2017-01-01
We demonstrate that the rotation phase can be suitably chosen to increase the efficiency of the phase-based quantum search algorithm, leading to a dynamic balance between iterations and success probabilities of the fixed-phase quantum Grover search algorithm with Q-learning for a given number of solutions. In this search algorithm, the proposed Q-learning algorithm, which is a model-free reinforcement learning strategy in essence, is used for performing a matching algorithm based on the fraction of marked items λ and the rotation phase α. After establishing the policy function α = π(λ), we complete the fixed-phase Grover algorithm, where the phase parameter is selected via the learned policy. Simulation results show that the Q-learning-based Grover search algorithm (QLGA) enables fewer iterations and gives birth to higher success probabilities. Compared with the conventional Grover algorithms, it avoids the optimal local situations, thereby enabling success probabilities to approach one. (author)
Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang
2017-07-05
DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K
2012-10-01
A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.
From forensic epigenetics to forensic epigenomics: broadening DNA investigative intelligence.
Vidaki, Athina; Kayser, Manfred
2017-12-21
Human genetic variation is a major resource in forensics, but does not allow all forensically relevant questions to be answered. Some questions may instead be addressable via epigenomics, as the epigenome acts as an interphase between the fixed genome and the dynamic environment. We envision future forensic applications of DNA methylation analysis that will broaden DNA-based forensic intelligence. Together with genetic prediction of appearance and biogeographic ancestry, epigenomic lifestyle prediction is expected to increase the ability of police to find unknown perpetrators of crime who are not identifiable using current forensic DNA profiling.
A universal DNA-based protein detection system.
Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan
2013-09-25
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.
DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.
Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao
2016-01-13
Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.
Blomme, Jonas; Van Aken, Olivier; Van Leene, Jelle; Jé gu, Teddy; De Rycke, Riet Maria; De Bruyne, Michiel; Vercruysse, Jasmien; Nolf, Jonah; Van Daele, Twiggy; De Milde, Liesbeth; Vermeersch, Mattias; Colas des Francs-Small, Catherine; De Jaeger, Geert; Benhamed, Moussa; Millar, A. Harvey; Inzé , Dirk; Gonzalez, Nathalie
2017-01-01
In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes
Design and synthesis of DNA four-helix bundles
Energy Technology Data Exchange (ETDEWEB)
Rangnekar, Abhijit; Gothelf, Kurt V [Department of Chemistry, Centre for DNA Nanotechnology (CDNA) and Interdisciplinary Nanoscience Center (iNANO), Aarhus University, DK-8000 Aarhus C (Denmark); LaBean, Thomas H, E-mail: kvg@chem.au.dk, E-mail: thl@cs.duke.edu [Department of Chemistry, Duke University, Durham, NC 27708 (United States)
2011-06-10
The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.
Design and synthesis of DNA four-helix bundles
International Nuclear Information System (INIS)
Rangnekar, Abhijit; Gothelf, Kurt V; LaBean, Thomas H
2011-01-01
The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.
McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M
2016-06-01
Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.
Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC
Energy Technology Data Exchange (ETDEWEB)
Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)
2017-10-20
DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.
Analysis of Cellular DNA Content by Flow Cytometry.
Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong
2017-11-01
Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.
Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.
Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A
2018-02-01
The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.
Directory of Open Access Journals (Sweden)
José Veríssimo Fernandes
2004-06-01
Full Text Available OBJETIVO: Padronizar um método alternativo para extração de DNA a partir de tecido fixado em formol e conservado em arquivos de blocos de parafina, visando à realização de estudos retrospectivos. MÉTODOS: Comparou-se a eficiência de protocolos de extração de DNA a partir de tecido parafinado, para análise por reação em cadeia de polimerase (PCR, tomando-se como parâmetro um protocolo baseado em um kit comercial. Foram feitas extrações do DNA de 60 espécimes por três métodos: o protocolo A, baseado no kit GlassMAX; o B, utilizando-se o kit GFX TM; e o C, tendo como base o método de Banerjee et al.(2. A integridade e a suficiência do DNA presente na amostra foram avaliadas pela amplificação por PCR de um segmento de 110pb do gene da beta-globina humana, com visualização por meio de eletroforese em gel de poliacrilamida, corado pela prata. Resultados: Das 60 amostras analisadas, 45 apresentaram resultado positivo na PCR quando o DNA foi extraído por qualquer um dos três protocolos. Em seis amostras, a amplificação foi positiva apenas para o DNA extraído pelos protocolos A e C. Em três amostras, o resultado foi positivo apenas para o DNA extraído pelo protocolo A, e em duas, apenas para o DNA extraído pelo protocolo C. CONCLUSÕES: O protocolo C apresentou desempenho semelhante ao do protocolo A, com as vantagens de apresentar menor custo, dispensar o uso de kit comercial, além de não utilizar solventes orgânicos, revelando-se uma alternativa viável para a obtenção de DNA a partir de tecido fixado em formol e incluído em parafina.OBJECTIVE: To set up a method for DNA extraction from paraffin embedded cervical cancer specimens, previously formalin-fixed, aiming to accomplish retrospective analysis. METHODS: Sixty specimens were submitted to DNA extraction by three different methods. All of them involved digestion of the tissues by proteinase K, followed by DNA purification, based in three different approaches
Energy Technology Data Exchange (ETDEWEB)
Kawaguchi, Hiroshi; Hirano, Yoshiyuki; Kershaw, Jeff; Yoshida, Eiji [Molecular Imaging Center, National Institute of Radiological Sciences, Chiba (Japan); Shiraishi, Takahiro [Molecular Imaging Center, National Institute of Radiological Sciences, Chiba (Japan); Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan); Suga, Mikio [Molecular Imaging Center, National Institute of Radiological Sciences, Chiba (Japan); Center for Frontier Medical Engineering, Chiba University (Japan); Obata, Takayuki [Molecular Imaging Center, National Institute of Radiological Sciences, Chiba (Japan); Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan); Ito, Hiroshi; Yamaya, Taiga [Molecular Imaging Center, National Institute of Radiological Sciences, Chiba (Japan)
2014-07-29
In recent work, we proposed an MRI-based attenuation-coefficient (μ-value) estimation method that uses a weak fixed-position external radiation source to construct an attenuation map for PET/MRI. In this presentation we refer to this method as FixER, and perform a series of simulations to investigate the duration of the transmission scan required to accurately estimate μ-values.
International Nuclear Information System (INIS)
Kawaguchi, Hiroshi; Hirano, Yoshiyuki; Kershaw, Jeff; Yoshida, Eiji; Shiraishi, Takahiro; Suga, Mikio; Obata, Takayuki; Ito, Hiroshi; Yamaya, Taiga
2014-01-01
In recent work, we proposed an MRI-based attenuation-coefficient (μ-value) estimation method that uses a weak fixed-position external radiation source to construct an attenuation map for PET/MRI. In this presentation we refer to this method as FixER, and perform a series of simulations to investigate the duration of the transmission scan required to accurately estimate μ-values.
Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.
Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko
2016-01-01
The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for
Controlling charge current through a DNA based molecular transistor
Energy Technology Data Exchange (ETDEWEB)
Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.
2017-01-05
Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.
DNA-Based Enzyme Reactors and Systems
Directory of Open Access Journals (Sweden)
Veikko Linko
2016-07-01
Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon
2015-01-01
Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Directory of Open Access Journals (Sweden)
Md. Mahbubur Rahman
2015-02-01
Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.
Recent progress on DNA based walkers.
Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun
2015-08-01
DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.
DNA nanostructure-based drug delivery nanosystems in cancer therapy.
Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei
2017-11-25
DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.
Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; Bælum, Jacob; Taş, Neslihan; Elberling, Bo; Jansson, Janet K.; Semenchuk, Philipp; Priemé, Anders
2015-01-01
The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below −10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface. PMID:25983731
Directory of Open Access Journals (Sweden)
MESQUITA Ricardo Alves
2001-01-01
Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
An approach for fixed coefficient RNS-based FIR filter
Srinivasa Reddy, Kotha; Sahoo, Subhendu Kumar
2017-08-01
In this work, an efficient new modular multiplication method for {2k-1, 2k, 2k+1-1} moduli set is proposed to implement a residue number system (RNS)-based fixed coefficient finite impulse response filter. The new multiplication approach reduces the number of partial products by using pre-loaded product block. The reduction in partial products with the proposed modular multiplication improves the clock frequency and reduces the area and power as compared with the conventional modular multiplication. Further, the present approach eliminates a binary number to residue number converter circuit, which is usually needed at the front end of RNS-based system. In this work, two fixed coefficient filter architectures with the new modular multiplication approach are proposed. The filters are implemented using Verilog hardware description language. The United Microelectronics Corporation 90 nm technology library has been used for synthesis and the results area, power and delay are obtained with the help of Cadence register transfer level compiler. The power delay product (PDP) is also considered for performance comparison among the proposed filters. One of the proposed architecture is found to improve PDP gain by 60.83% as compared with the filter implemented with conventional modular multiplier. The filters functionality is validated with the help of Altera DSP Builder.
Analysis of fixed tilt and sun tracking photovoltaic–micro wind based hybrid power systems
International Nuclear Information System (INIS)
Sinha, Sunanda; Chandel, S.S.
2016-01-01
Graphical abstract: 6 kW_p photovoltaic–micro wind based hybrid power system analysis in a Indian Western Himalayan location. - Highlights: • Power generation by a roof mounted photovoltaic–micro wind hybrid system is explored. • Optimum hybrid configurations using fixed and sun tracking photovoltaic systems are determined. • Analysis of hybrid systems with optimally tilted and different sun tracking systems is presented. • Two axis sun tracking systems are found to generate 4.88–26.29% more energy than fixed tilt system. • Hybrid system installed at optimum tilt angle is found to be cost effective than a sun tracking system. - Abstract: In this study fixed tilt and sun tracking photovoltaic based micro wind hybrid power systems are analyzed along with determining the optimum configurations for a 6 kW_p roof mounted micro wind based hybrid system using fixed and tracking photovoltaic systems to enhance the power generation potential in a low windy Indian hilly terrain with good solar resource. The main objective of the study is to enhance power generation by focusing on photovoltaic component of the hybrid system. A comparative power generation analysis of different configurations of hybrid systems with fixed tilt, monthly optimum tilt, yearly optimum tilt and 6 different sun tracking photovoltaic systems is carried out using Hybrid Optimization Model for Electric Renewables. Monthly and seasonal optimum tilt angles determined for the location vary between 0° and 60° with annual optimum tilt angle as 29.25°. The optimum configurations for all sun tracking systems except for the two axis tracking system is found to be 7 kW_p photovoltaic system, one 5 kW_p wind turbine, 10 batteries and a 2 kW_p inverter. The optimum configuration for two axis tracking system and two types of fixed tilt systems, is found to be a 8 kW_p photovoltaic system, one 5 kW_p wind turbine, 10 batteries and a 2 kW_p inverter. The results show that horizontal axis with
DNA-based random number generation in security circuitry.
Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C
2010-06-01
DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.
Svensson, Elin M; Yngman, Gunnar; Denti, Paolo; McIlleron, Helen; Kjellsson, Maria C; Karlsson, Mats O
2018-05-01
Fixed-dose combination formulations where several drugs are included in one tablet are important for the implementation of many long-term multidrug therapies. The selection of optimal dose ratios and tablet content of a fixed-dose combination and the design of individualized dosing regimens is a complex task, requiring multiple simultaneous considerations. In this work, a methodology for the rational design of a fixed-dose combination was developed and applied to the case of a three-drug pediatric anti-tuberculosis formulation individualized on body weight. The optimization methodology synthesizes information about the intended use population, the pharmacokinetic properties of the drugs, therapeutic targets, and practical constraints. A utility function is included to penalize deviations from the targets; a sequential estimation procedure was developed for stable estimation of break-points for individualized dosing. The suggested optimized pediatric anti-tuberculosis fixed-dose combination was compared with the recently launched World Health Organization-endorsed formulation. The optimized fixed-dose combination included 15, 36, and 16% higher amounts of rifampicin, isoniazid, and pyrazinamide, respectively. The optimized fixed-dose combination is expected to result in overall less deviation from the therapeutic targets based on adult exposure and substantially fewer children with underexposure (below half the target). The development of this design tool can aid the implementation of evidence-based formulations, integrating available knowledge and practical considerations, to optimize drug exposures and thereby treatment outcomes.
Mapping Base Modifications in DNA by Transverse-Current Sequencing
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
Observer-based leader-following tracking control under both fixed and switching topologies
Institute of Scientific and Technical Information of China (English)
Jinhuan WANG; Pengxiao ZHANG; Zhixin LIU; Xiaoming HU
2016-01-01
This paper studies the tracking problem for a class of leader-follower multi-agent systems moving on the plane using observer-based cooperative control strategies. In our set-up, only a subset of the followers can obtain some relative information on the leader. We assume that the control input of the leader is not known to any of the followers while the system matrix is broadcast to all the followers. To track such a leader, an observer-based decentralized feedback controller is designed for each follower and detailed analysis for the convergence is presented for both fixed and switching interaction topologies between agents with the method of common Lyapunov function. We can also generalize the result to the higher dimension case for fixed topology and some special system matrices of the leader for switching topology.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Jenkins, J A; Draugelis-Dale, R O; Pinkney, A E; Iwanowicz, L R; Blazer, V S
2015-03-15
Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P < 0.05). This flow cytometric method takes advantage of the propensity of fragmented DNA to be denatured under standard conditions, or 1 minute at 37 °C with 10% buffered formalin-fixed cells. The study of fixed sperm makes possible the restrospective investigation of germplasm fragmentation, spermatogenic ploidy patterns, and chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa. Published by Elsevier Inc.
Analytical Devices Based on Direct Synthesis of DNA on Paper.
Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M
2016-01-05
This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.
Oxidative DNA base modifications as factors in carcinogenesis
International Nuclear Information System (INIS)
Olinski, R.; Jaruga, P.; Zastawny, T.H.
1998-01-01
Reactive oxygen species can cause extensive DNA modifications including modified bases. Some of the DNA base damage has been found to possess premutagenic properties. Therefore, if not repaired, it can contribute to carcinogenesis. We have found elevated amounts of modified bases in cancerous and precancerous tissues as compared with normal tissues. Most of the agents used in anticancer therapy are paradoxically responsible for induction of secondary malignancies and some of them may generate free radicals. The results of our experiments provide evidence that exposure of cancer patients to therapeutic doses of ionizing radiation and anticancer drugs cause base modifications in genomic DNA of lymphocytes. Some of these base damages could lead to mutagenesis in critical genes and ultimately to secondary cancers such as leukemias. This may point to an important role of oxidative base damage in cancer initiation. Alternatively, the increased level of the modified base products may contribute to genetic instability and metastatic potential of tumor cells. (author)
A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis
Directory of Open Access Journals (Sweden)
Fei Chen
2003-01-01
Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.
DEFF Research Database (Denmark)
Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona
2016-01-01
Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...
Freeman, S.; Pham, M.; Rodriguez, R.J.
1993-01-01
Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.
A nuclear DNA-based species determination and DNA quantification assay for common poultry species.
Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S
2014-12-01
DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.
Tinker, Michael L.
1998-01-01
Application of the free-suspension residual flexibility modal test method to the International Space Station Pathfinder structure is described. The Pathfinder, a large structure of the general size and weight of Space Station module elements, was also tested in a large fixed-base fixture to simulate Shuttle Orbiter payload constraints. After correlation of the Pathfinder finite element model to residual flexibility test data, the model was coupled to a fixture model, and constrained modes and frequencies were compared to fixed-base test. modes. The residual flexibility model compared very favorably to results of the fixed-base test. This is the first known direct comparison of free-suspension residual flexibility and fixed-base test results for a large structure. The model correlation approach used by the author for residual flexibility data is presented. Frequency response functions (FRF) for the regions of the structure that interface with the environment (a test fixture or another structure) are shown to be the primary tools for model correlation that distinguish or characterize the residual flexibility approach. A number of critical issues related to use of the structure interface FRF for correlating the model are then identified and discussed, including (1) the requirement of prominent stiffness lines, (2) overcoming problems with measurement noise which makes the antiresonances or minima in the functions difficult to identify, and (3) the use of interface stiffness and lumped mass perturbations to bring the analytical responses into agreement with test data. It is shown that good comparison of analytical-to-experimental FRF is the key to obtaining good agreement of the residual flexibility values.
Dutta, Debasree; Gachhui, Ratan
2007-02-01
A few members of the family Acetobacteraceae are cellulose-producers, while only six members fix nitrogen. Bacterial strain RG3T, isolated from Kombucha tea, displays both of these characteristics. A high bootstrap value in the 16S rRNA gene sequence-based phylogenetic analysis supported the position of this strain within the genus Gluconacetobacter, with Gluconacetobacter hansenii LMG 1527T as its nearest neighbour (99.1 % sequence similarity). It could utilize ethanol, fructose, arabinose, glycerol, sorbitol and mannitol, but not galactose or xylose, as sole sources of carbon. Single amino acids such as L-alanine, L-cysteine and L-threonine served as carbon and nitrogen sources for growth of strain RG3T. Strain RG3T produced cellulose in both nitrogen-free broth and enriched medium. The ubiquinone present was Q-10 and the DNA base composition was 55.8 mol% G+C. It exhibited low values of 5.2-27.77 % DNA-DNA relatedness to the type strains of related gluconacetobacters, which placed it within a separate taxon, for which the name Gluconacetobacter kombuchae sp. nov. is proposed, with the type strain RG3T (=LMG 23726T=MTCC 6913T).
Ultraviolet enhancement of DNA base release by bleomycin
International Nuclear Information System (INIS)
Kakinuma, J.; Tanabe, M.; Orii, H.
1984-01-01
The effect of UV irradiation on base-releasing activity of bleomycin was studied on bleomycin A 2 -DNA reaction mixture in the presence of Fe(II) and 2-mercaptoethanol. This effect was measured by the release of free bases from calf thymus DNA with high-performance liquid chromatography. UV irradiation enhanced DNA base-releasing activity of bleomycin and simultaneously caused disappearance of fluorescence emission maximum at 355 nm assigned to bithiazole rings and increase in the intensity of a peak at 400 nm. UV irradiation at 295 nm, the UV absorption maximum of bleomycin, is the most effective in releasing free bases and in changing fluorescence emission patterns. From these results, we suggest that some alterations in the bithiazole group of bleomycin molecule were initiated by UV irradiation and contributed to increased base-releasing activity of bleomycin through a yet unexplained mechanism, presumably through bleomycin dimer formation. (orig.)
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Hviid, T Vauvert
2002-01-01
only in the male cells, leading to the correct HLA-DPB1 genotyping of the male by DNA sequencing of a nested, linked TSPY-HLA-DPB1 PCR product. CONCLUSION: This approach might be usable on mixed cell populations of fetal and maternal cells obtained after conventional cell-sorting techniques on maternal...... maternal blood samples, the use of such an approach for genotyping by molecular biology techniques in a more routine setting has been hampered by the large contamination of maternal nucleated blood cells in the cell isolates. Therefore, a new method based on in-cell PCR is described, which may overcome...... this problem. Methods and Results: Mixtures of cells from two different individuals were fixed and permeabilized in suspension. After coamplification of a DNA sequence specific for one of the individuals and the DNA sequence to be genotyped, the two PCR products were linked together in the fixed cells positive...
Blomme, Jonas
2017-04-19
In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes are complex compared with their animal counterparts, and although several plant-specific mediators of organelle DNA repair have been reported, many regulators remain to be identified. Here, we show that a mitochondrial SWI/SNF (nucleosome remodeling) complex B protein, SWIB5, is capable of associating with mitochondrial DNA (mtDNA) in Arabidopsis thaliana. Gainand loss-of-function mutants provided evidence for a role of SWIB5 in influencing mtDNA architecture and homologous recombination at specific intermediate-sized repeats both under normal and genotoxic conditions. SWIB5 interacts with other mitochondrial SWIB proteins. Gene expression and mutant phenotypic analysis of SWIB5 and SWIB family members suggests a link between organellar genome maintenance and cell proliferation. Taken together, our work presents a protein family that influences mtDNA architecture and homologous recombination in plants and suggests a link between organelle functioning and plant development.
DNA Based Electrochromic and Photovoltaic Cells
2012-01-01
using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high
A Rewritable, Random-Access DNA-Based Storage System.
Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica
2015-09-18
We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.
DNA damage in preserved specimens and tissue samples: a molecular assessment
Directory of Open Access Journals (Sweden)
Cantin Elizabeth
2008-10-01
Full Text Available Abstract The extraction of genetic information from preserved tissue samples or museum specimens is a fundamental component of many fields of research, including the Barcode of Life initiative, forensic investigations, biological studies using scat sample analysis, and cancer research utilizing formaldehyde-fixed, paraffin-embedded tissue. Efforts to obtain genetic information from these sources are often hampered by an inability to amplify the desired DNA as a consequence of DNA damage. Previous studies have described techniques for improved DNA extraction from such samples or focused on the effect of damaging agents – such as light, oxygen or formaldehyde – on free nucleotides. We present ongoing work to characterize lesions in DNA samples extracted from preserved specimens. The extracted DNA is digested to single nucleosides with a combination of DNase I, Snake Venom Phosphodiesterase, and Antarctic Phosphatase and then analyzed by HPLC-ESI-TOF-MS. We present data for moth specimens that were preserved dried and pinned with no additional preservative and for frog tissue samples that were preserved in either ethanol, or formaldehyde, or fixed in formaldehyde and then preserved in ethanol. These preservation methods represent the most common methods of preserving animal specimens in museum collections. We observe changes in the nucleoside content of these samples over time, especially a loss of deoxyguanosine. We characterize the fragmentation state of the DNA and aim to identify abundant nucleoside lesions. Finally, simple models are introduced to describe the DNA fragmentation based on nicks and double-strand breaks.
Fixed-base recycling of contaminated metals in the commercial market
International Nuclear Information System (INIS)
Loiselle, V.
1993-01-01
Since the establishment of the first fixed-base commercial decontamination facility in 1982, commercial processors have cleaned and recycled more than 120 million lb of metals for productive reuse. This represents enough metal to duplicate the Eiffel Tower eight times. This paper examines the economic conditions that led to the foundation of this industry and the types of decontamination technology that have been successfully employed by the processors
How stable are the mutagenic tautomers of DNA bases?
Directory of Open Access Journals (Sweden)
Brovarets’ O. O.
2010-02-01
Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability
Communication: Electron ionization of DNA bases
Energy Technology Data Exchange (ETDEWEB)
Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in
2016-04-28
No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.
PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.
Belyavsky, A; Vinogradova, T; Rajewsky, K
1989-01-01
A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
Hong, Yuan-Yuan; Ma, Yu-Chao; Zhou, Yu-Guang; Gao, Fei; Liu, Hong-Can; Chen, San-Feng
2009-11-01
A nitrogen-fixing bacterium, designated strain X19-5(T), was isolated from rhizosphere soil of Sonchus oleraceus. Phylogenetic analysis based on a fragment of the nifH gene and the full-length 16S rRNA gene sequence revealed that strain X19-5(T) was a member of the genus Paenibacillus. Strain X19-5(T) showed the highest 16S rRNA gene sequence similarity (98.8 %) with Paenibacillus graminis RSA19(T) and below 97 % similarity with other recognized members of the genus. The level of DNA-DNA relatedness between strain X19-5(T) and P. graminis RSA19(T) was 45.7 %. The DNA G+C content of strain X19-5(T) was 46.8 mol%. The major fatty acids were anteiso-C(15 : 0), C(16 : 0) and iso-C(16 : 0). On the basis of its phenotypic characteristics and the level of DNA-DNA hybridization, strain X19-5(T) is considered to represent a novel species of the genus Paenibacillus, for which the name Paenibacillus sonchi sp. nov. is proposed. The type strain is X19-5(T) (=CCBAU 83901(T)=LMG 24727(T)).
Improved chaos-based video steganography using DNA alphabets
Directory of Open Access Journals (Sweden)
Nirmalya Kar
2018-03-01
Full Text Available DNA based steganography plays a vital role in the field of privacy and secure communication. Here, we propose a DNA properties-based mechanism to send data hidden inside a video file. Initially, the video file is converted into image frames. Random frames are then selected and data is hidden in these at random locations by using the Least Significant Bit substitution method. We analyze the proposed architecture in terms of peak signal-to-noise ratio as well as mean squared error measured between the original and steganographic files averaged over all video frames. The results show minimal degradation of the steganographic video file. Keywords: Chaotic map, DNA, Linear congruential generator, Video steganography, Least significant bit
Espinal, Allyson C; Wang, Dan; Yan, Li; Liu, Song; Tang, Li; Hu, Qiang; Morrison, Carl D; Ambrosone, Christine B; Higgins, Michael J; Sucheston-Campbell, Lara E
2017-02-28
DNA from archival formalin-fixed and paraffin embedded (FFPE) tissue is an invaluable resource for genome-wide methylation studies although concerns about poor quality may limit its use. In this study, we compared DNA methylation profiles of breast tumors using DNA from fresh-frozen (FF) tissues and three types of matched FFPE samples. For 9/10 patients, correlation and unsupervised clustering analysis revealed that the FF and FFPE samples were consistently correlated with each other and clustered into distinct subgroups. Greater than 84% of the top 100 loci previously shown to differentiate ER+ and ER- tumors in FF tissues were also FFPE DML. Weighted Correlation Gene Network Analyses (WCGNA) grouped the DML loci into 16 modules in FF tissue, with ~85% of the module membership preserved across tissue types. Restored FFPE and matched FF samples were profiled using the Illumina Infinium HumanMethylation450K platform. Methylation levels (β-values) across all loci and the top 100 loci previously shown to differentiate tumors by estrogen receptor status (ER+ or ER-) in a larger FF study, were compared between matched FF and FFPE samples using Pearson's correlation, hierarchical clustering and WCGNA. Positive predictive values and sensitivity levels for detecting differentially methylated loci (DML) in FF samples were calculated in an independent FFPE cohort. FFPE breast tumors samples show lower overall detection of DMLs versus FF, however FFPE and FF DMLs compare favorably. These results support the emerging consensus that the 450K platform can be employed to investigate epigenetics in large sets of archival FFPE tissues.
STS-26 MS Nelson on fixed based (FB) shuttle mission simulator (SMS) middeck
1988-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, Mission Specialist (MS) George D. Nelson trains on the middeck of the fixed based (FB) shuttle mission simulator (SMS). Nelson, wearing communications assembly headset, adjusts camera mounting bracket.
DNA hybridization sensor based on pentacene thin film transistor.
Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang
2011-01-15
A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.
Triple-helix molecular switch-based aptasensors and DNA sensors.
Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad
2018-07-15
Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA methylation–based immune response signature improves patient diagnosis in multiple cancers
Jeschke, Jana; Bizet, Martin; Calonne, Emilie; Dedeurwaerder, Sarah; Garaud, Soizic; Koch, Alexander; Larsimont, Denis; Salgado, Roberto; Van den Eynden, Gert; Willard Gallo, Karen; Defrance, Matthieu; Sotiriou, Christos
2017-01-01
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression–based immune markers, respectively. The MeTIL signature also improved the prediction of survival in other malignancies, including melanoma and lung cancer. Furthermore, the MeTIL signature predicted differences in survival for malignancies in which TILs were not known to have a prognostic value. Finally, we showed that MeTIL markers can be determined by bisulfite pyrosequencing of small amounts of DNA from formalin-fixed, paraffin-embedded tumor tissue, supporting clinical applications for this methodology. CONCLUSIONS. This study highlights the power of DNA methylation to evaluate tumor immune responses and the potential of this approach to improve the diagnosis and treatment of breast and other cancers. FUNDING. This work was funded by the Fonds National de la Recherche Scientifique (FNRS) and Télévie, the INNOVIRIS Brussels Region BRUBREAST Project, the IUAP P7/03 program, the Belgian “Foundation against Cancer,” the Breast Cancer Research Foundation (BCRF), and the Fonds Gaston Ithier
High-speed DNA-based rolling motors powered by RNase H
Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.
2016-01-01
DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152
Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.
B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)
1997-01-01
textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA
Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA
Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong
2012-02-01
Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.
Induced Polarization Influences the Fundamental Forces in DNA Base Flipping
Lemkul, Justin A.; Savelyev, Alexey; MacKerell, Alexander D.
2014-01-01
Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base...
International Nuclear Information System (INIS)
Canziani, R.
1999-01-01
Recently, full scale fixed-film or mixed suspended and fixed biomass bioreactors have been applied in many wastewater treatments plants. These process no longer depend on biomass settle ability and can be used to improve the performance of existing plants as required by more stringent discharge permit limits, especially for nutrients and suspended solid. Also, processes may work at high rates making it possible to build small footprint installations. Fixed-film process include trickling filter, moving bed reactors fluidized bed reactors. In the first part, the theoretical base governing fixed-film processes are briefly outlined with some simple examples of calculations underlining the main differences with conventional activated sludge processes [it
DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.
Rieben, W Kurt; Coulombe, Roger A
2004-12-01
Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.
A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis
Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan
2009-01-01
DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301
International Nuclear Information System (INIS)
Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.
1991-01-01
Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies
Recognition of base J in duplex DNA by J-binding protein
Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet
2002-01-01
beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding
Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2007-06-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.
SHOX2 DNA Methylation is a Biomarker for the diagnosis of lung cancer based on bronchial aspirates
International Nuclear Information System (INIS)
Schmidt, Bernd; Lewin, Jörn; Tetzner, Reimo; Weickmann, Sabine; Wille, Ulrike; Liloglou, Triantafillos; Raji, Olaide; Walshaw, Martin; Fleischhacker, Michael; Witt, Christian; Field, John K; Liebenberg, Volker; Dietrich, Dimo; Schlegel, Thomas; Kneip, Christoph; Seegebarth, Anke; Flemming, Nadja; Seemann, Stefanie; Distler, Jürgen
2010-01-01
This study aimed to show that SHOX2 DNA methylation is a tumor marker in patients with suspected lung cancer by using bronchial fluid aspirated during bronchoscopy. Such a biomarker would be clinically valuable, especially when, following the first bronchoscopy, a final diagnosis cannot be established by histology or cytology. A test with a low false positive rate can reduce the need for further invasive and costly procedures and ensure early treatment. Marker discovery was carried out by differential methylation hybridization (DMH) and real-time PCR. The real-time PCR based HeavyMethyl technology was used for quantitative analysis of DNA methylation of SHOX2 using bronchial aspirates from two clinical centres in a case-control study. Fresh-frozen and Saccomanno-fixed samples were used to show the tumor marker performance in different sample types of clinical relevance. Valid measurements were obtained from a total of 523 patient samples (242 controls, 281 cases). DNA methylation of SHOX2 allowed to distinguish between malignant and benign lung disease, i.e. abscesses, infections, obstructive lung diseases, sarcoidosis, scleroderma, stenoses, at high specificity (68% sensitivity [95% CI 62-73%], 95% specificity [95% CI 91-97%]). Hypermethylation of SHOX2 in bronchial aspirates appears to be a clinically useful tumor marker for identifying subjects with lung carcinoma, especially if histological and cytological findings after bronchoscopy are ambiguous
Sugianto, Agus; Indriani, Andi Marini
2017-11-01
Platform construction GTS (Gathering Testing Sattelite) is offshore construction platform with fix pile structure type/fixed platform functioning to support the mining of petroleum exploitation. After construction fabrication process platform was moved to barges, then shipped to the installation site. Moving process is generally done by pull or push based on construction design determined when planning. But at the time of lifting equipment/cranes available in the work area then the moving process can be done by lifting so that moving activity can be implemented more quickly of work. This analysis moving process of GTS platform in a different way that is generally done to GTS platform types by lifting using problem is construction reinforcement required, so the construction can be moved by lifting with analyzing and checking structure working stress that occurs due to construction moving process by lifting AISC code standard and analysis using the SAP2000 structure analysis program. The analysis result showed that existing condition cannot be moved by lifting because stress ratio is above maximum allowable value that is 0.950 (AISC-ASD89). Overstress occurs on the member 295 and 324 with stress ratio value 0.97 and 0.95 so that it is required structural reinforcement. Box plate aplication at both members so that it produces stress ratio values 0.78 at the member 295 and stress ratio of 0.77 at the member 324. These results indicate that the construction have qualified structural reinforcement for being moved by lifting.
Comparison between flipped classroom and team-based learning in fixed prosthodontic education.
Nishigawa, Keisuke; Omoto, Katsuhiro; Hayama, Rika; Okura, Kazuo; Tajima, Toyoko; Suzuki, Yoshitaka; Hosoki, Maki; Shigemoto, Shuji; Ueda, Mayu; Rodis, Omar Marianito Maningo; Matsuka, Yoshizo
2017-04-01
We previously investigated the effects of team-based learning (TBL) on fixed prosthodontic education and reported that TBL could have higher efficiency with high student satisfaction than traditional lecture. In the current report, we introduced flipped classroom to the fixed prosthodontic education and compared their effectiveness based on the final examination score in addition to TBL. Participants were 41 students from Tokushima University School of Dentistry who attended a fixed prosthodontics course. The first six classes adopted the flipped classroom style while the latter eight classes adopted TBL. To evaluate the relationship between learning styles and their effectiveness, we compared results from the term-end examination between the curriculum covered by flipped classroom and TBL-style classes. To draw comparisons, a referential examination with the same questions was conducted to eight faculty members who had not attended any of these classes. Term-end examination results showed that TBL classes had slightly higher scores than flipped classroom classes. Referential examination results also showed higher scores for the same curriculum and no significant interaction was found between class formats and the term-end and referential examination scores. Analysis revealed no noticeable difference in the effectiveness of the class formats. Our previous study reported that TBL had higher efficiency than traditional style lecture. In the current study, there was no statistical difference in the examination score between flipped classroom and TBL. Therefore, we conclude that both styles are highly effective than traditional style lecture and constitute valid formats for clinical dental education. Copyright © 2016 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
Fixed-Point Configurable Hardware Components
Directory of Open Access Journals (Sweden)
Rocher Romuald
2006-01-01
Full Text Available To reduce the gap between the VLSI technology capability and the designer productivity, design reuse based on IP (intellectual properties is commonly used. In terms of arithmetic accuracy, the generated architecture can generally only be configured through the input and output word lengths. In this paper, a new kind of method to optimize fixed-point arithmetic IP has been proposed. The architecture cost is minimized under accuracy constraints defined by the user. Our approach allows exploring the fixed-point search space and the algorithm-level search space to select the optimized structure and fixed-point specification. To significantly reduce the optimization and design times, analytical models are used for the fixed-point optimization process.
STS-26 MS Lounge in fixed based (FB) shuttle mission simulator (SMS)
1988-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, Mission Specialist (MS) John M. Lounge, wearing comunications kit assembly headset and crouched on the aft flight deck, performs checklist inspection during training session. The STS-26 crew is training in the fixed base (FB) shuttle mission simulator (SMS) located in JSC Mission Simulation and Training Facility Bldg 5.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA methylation based biomarkers: Practical considerations and applications
DEFF Research Database (Denmark)
Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg
2012-01-01
of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...
Modulation of DNA base excision repair during neuronal differentiation
DEFF Research Database (Denmark)
Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K
2013-01-01
DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...
Indicator Based and Indicator - Free Electrochemical DNA Biosensors
National Research Council Canada - National Science Library
Kerman, Kagan
2001-01-01
The utility and advantages of an indicator free and MB based sequence specific DNA hybridization biosensor based on guanine and adenine oxidation signals and MB reduction signals have been demonstrated...
Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.
Raghav, Sunil Kumar; Deplancke, Bart
2012-01-01
Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.
DNA-Based Self-Assembly of Fluorescent Nanodiamonds.
Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim
2015-08-12
As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.
Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua
2017-12-15
Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.
Slow elimination of injured liver DNA bases of γ-irradiated old mice
International Nuclear Information System (INIS)
Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.
1982-01-01
The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals
DNA/RNA-based formulations for treatment of breast cancer.
Xie, Zhaolu; Zeng, Xianghui
2017-12-01
To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.
Size and Base Composition of RNA in Supercoiled Plasmid DNA
Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.
1973-01-01
The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488
A novel BEV concept based on fixed and swappable li-ion battery packs
DEFF Research Database (Denmark)
Barreras, Jorge Varela; Pinto, C.; de Castro, R.
2015-01-01
-based ownership models to distribute the cost of the large battery pack over the vehicle lifetime. A methodology is proposed for the analysis and evaluation of the proposed concept in comparison with a direct owned non swappable single pack BEV, proving that significant improvements on city fuel economy (up to 20......In this paper a novel battery electric vehicle (BEV) concept based on a small fixed and a big swappable li-ion battery pack is proposed in order to achieve: longer range, lower initial purchase price and lower energy consumption at short ranges. For short ranges the BEV is only powered...... by the relatively small fixed battery pack, without the large swappable battery pack. In this way the mass of the vehicle is reduced and therefore the energy consumed per unit distance is improved. For higher ranges the BEV is powered by both battery packs. This concept allows the introduction of subscription...
Effects of team-based learning on fixed prosthodontic education in a Japanese School of Dentistry.
Takeuchi, Hisahiro; Omoto, Katsuhiro; Okura, Kazuo; Tajima, Toyoko; Suzuki, Yoshitaka; Hosoki, Maki; Koori, Motoharu; Shigemoto, Shuji; Ueda, Mayu; Nishigawa, Keisuke; Rodis, Omar Marianito Maningo; Matsuka, Yoshizo
2015-04-01
The aims of this study were to evaluate the quality of team-based learning (TBL) in prosthodontics education for fourth-year dental students at Tokushima University School of Dentistry and to compare this teaching method with traditional lecture-based delivery. Participants in the study were 36 students (22 males and 14 females) who attended the TBL-style fixed prosthodontics course. Ten 60-minute classes were held. The first three were traditional lecture-style classes and were followed by one class introducing the TBL style. The remaining six classes constituted the TBL-format fixed prosthodontics course. The effectiveness of TBL was evaluated through student questionnaires at the end of each class and the results of the term-end examination. The questionnaire revealed high student approval for TBL-style learning, and active group discussion among students during TBL was a key factor in these ratings. In the results of the term-end examination, there were significantly higher scores on the questions that covered TBL-taught material than those covering traditional lecture-taught topics. The results of this study suggest that TBL-style lecture was more effective than traditional-style lecture for teaching fixed prosthodontics and that TBL was a more efficient mode of delivering dental education than traditional lecture-based teaching.
Directory of Open Access Journals (Sweden)
Annika Mohr
Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.
International Nuclear Information System (INIS)
Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po
2017-01-01
Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11 g mL −1 and a detection limit of 0.43 × 10 −15 g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16 g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16 g mL −1 level with a dynamic range spanning 5 orders of magnitude.
DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity
Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard
2008-01-01
This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to
Highly sensitive DNA sensors based on cerium oxide nanorods
Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh
2018-04-01
In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.
Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun
2015-02-15
In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.
Biosensor for label-free DNA quantification based on functionalized LPGs.
Gonçalves, Helena M R; Moreira, Luis; Pereira, Leonor; Jorge, Pedro; Gouveia, Carlos; Martins-Lopes, Paula; Fernandes, José R A
2016-10-15
A label-free fiber optic biosensor based on a long period grating (LPG) and a basic optical interrogation scheme using off the shelf components is used for the detection of in-situ DNA hybridization. A new methodology is proposed for the determination of the spectral position of the LPG mode resonance. The experimental limit of detection obtained for the DNA was 62±2nM and the limit of quantification was 209±7nM. The sample specificity was experimentally demonstrated using DNA targets with different base mismatches relatively to the probe and was found that the system has a single base mismatch selectivity. Copyright © 2015 Elsevier B.V. All rights reserved.
INNOVATIVE SYSTEM OF FIXED CAPITAL REPRODUCTION
Directory of Open Access Journals (Sweden)
G. S. Merzlikina
2015-01-01
Full Text Available The article presents the basic problems of fixed capital reproduction. There are considered a significant depreciation of fixed assets of Russian enterprises. There are presented arguments in favor of urgency of the problem of reproduction of fixed assets of the Russian Federation. The paper presents theoretical evidence base basic types of fixed capital reproduction. There are identified all possible sources of simple and expanded reproduction of capital. There are considered the role of value and feasibility of depreciation in the formation of Reserve reproduction. Suggested the formation of accounting and analytical management provision fixed capital, as well as an innovative system of fixed capital reproduction, which implies the creation of depreciation , capital, revaluation, liquidation reserves. The algorithm of business valuation based on an innovative system of capital reproduction. The algorithm and the possibility of formation of reserves are considered on a concrete example of one of the industrial enterprises of the city Volgograd. On the basis of the algorithm presented calculations of business valuation of the enterprise. Calculations have shown an increase in value of the business condition of the formation of special reserves, which underlines the necessary and urgency of their formation in accounting policy and economy organizations and enterprises of Russia as a whole.
International Nuclear Information System (INIS)
Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim
2006-01-01
The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)
DNA Array-Based Gene Profiling
Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario
2005-01-01
Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987
Fixed mobile convergence handbook
Ahson, Syed A
2010-01-01
From basic concepts to future directions, this handbook provides technical information on all aspects of fixed-mobile convergence (FMC). The book examines such topics as integrated management architecture, business trends and strategic implications for service providers, personal area networks, mobile controlled handover methods, SIP-based session mobility, and supervisory and notification aggregator service. Case studies are used to illustrate technical and systematic implementation of unified and rationalized internet access by fixed-mobile network convergence. The text examines the technolo
Research on Image Encryption Based on DNA Sequence and Chaos Theory
Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin
2018-04-01
Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.
Yaney, Perry P.; Ouchen, Fahima; Grote, James G.
2009-08-01
DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.
Decreased stability of DNA in cells treated with alkylating agents
Energy Technology Data Exchange (ETDEWEB)
Frankfurt, O.S. (Cedars Medical Center, Miami, FL (United States))
1990-12-01
A modified highly sensitive procedure for the evaluation of DNA damage in individual cells treated with alkylating agents is reported. The new methodology is based on the amplification of single-strandedness in alkylated DNA by heating in the presence of Mg{sup 2+}. Human ovarian carcinoma cells A2780 were treated with nitrogen mustard (HN2), fixed in methanol, and stained with monoclonal antibody (MOAB) F7-26 generated against HN2-treated DNA. Binding of MOAB was measured by flow cytometry with indirect immunofluorescence. Intensive binding of MOAB to control and drug-treated cells was observed after heating in Tris buffer supplemented with MgCl{sub 2}. Thus, the presence of phosphates and MgCl{sub 2} during heating was necessary for the detection of HN2-induced changes in DNA stability. Fluorescence of HN2-treated cells decreased to background levels after treatment with single-strand-specific S{sub 1} nuclease. MOAB F7-26 interacted with single-stranded regions in DNA and did not bind to dsDNA or other cellular antigens. It is suggested that alkylation of guanines decreased the stability of the DNA molecule and increased the access of MOAB F7-26 to deoxycytidines on the opposite DNA strand.
A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.
Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang
2015-11-09
A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.
One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.
Ensslen, Philipp; Wagenknecht, Hans-Achim
2015-10-20
Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore
DNA-based construction at the nanoscale: emerging trends and applications
Lourdu Xavier, P.; Chandrasekaran, Arun Richard
2018-02-01
The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.
International Nuclear Information System (INIS)
Canziani, R.
1999-01-01
Recently, full scale fixed-film or mixed suspended have been applied in many wastewater treatments plants. These processes no longer depend on biomass settle ability and can be used to improve the performance of existing plants as required by more stringent discharge permit limits, especially for nutrients suspended solids. Also, processes may work at high rates making is possible to build small footprint installations. Fixed-film processes include trickling filters (and combined suspended and fixed-films processes), rotating biological contactors, biological aerated submerged, filters moving bed reactors, fluidized bed reactors. In the first part, the theoretical based governing fixed-film processes are briefly outlined, with some simple examples of calculations, underlining the main differences with conventional activate sludge processes. In the second part, the most common types of reactors are reviewed [it
STS-26 crew on fixed based (FB) shuttle mission simulator (SMS) flight deck
1988-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, Commander Frederick H. Hauck (left) and Pilot Richard O. Covey review checklists in their respective stations on the foward flight deck. The STS-26 crew is training in the fixed base (FB) shuttle mission simulator (SMS) located in JSC Mission Simulation and Training Facility Bldg 5.
Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.
Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül
2018-05-01
Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Adams, Alice; Lindahl, Tomas; Klein, George
1973-01-01
High-molecular-weight DNA from cell line Raji (derived from Burkitt's lymphoma), which contains 50-60 copies of Epstein-Barr virus DNA per cell, was fractionated in neutral solution by several cycles of CsCl gradient centrifugation in fixed-angle rotors. Under the fractionation conditions used, intact Epstein-Barr virus DNA from virus particles can be separated from the less-dense cellular DNA. In contrast, a large proportion of the intrinsic Epstein-Barr virus DNA component of Raji cells remains associated with cellular DNA, as determined by nucleic acid hybridization. This interaction, which is resistant to Pronase and phenol treatment, is not the result of aggregation. When the molecular weight of Raji DNA is reduced by hydrodynamic shear, the amount of virus DNA associated with cell DNA decreases. However, some virus DNA still remains bound to fragments of cellular DNA after shearing. The association is completely destroyed in alkaline solution. Molecular weight analysis of Raji DNA after denaturation showed that the alkali-induced release of Epstein-Barr virus DNA was specific and not the result of random single-strand breaks. These data indicate that Epstein-Barr virus DNA is linearly integrated into Raji cell DNA by alkali-labile bonds. PMID:4355371
DNA barcode-based molecular identification system for fish species.
Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won
2010-12-01
In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .
Arduino-based automation of a DNA extraction system.
Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won
2015-01-01
There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)
2017-05-29
Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.
Opto-electronic DNA chip-based integrated card for clinical diagnostics.
Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric
2008-02-01
Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.
Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.
Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J
2018-01-01
Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.
Biophysical characterization of the association of histones with single-stranded DNA.
Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier
2017-11-01
Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.
UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.
Baldock, Brandi L; Hutchison, James E
2016-12-20
DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.
Trial watch: Naked and vectored DNA-based anticancer vaccines.
Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo
2015-05-01
One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.
Re-design of ITER Glow Discharge Cleaning system based on a fixed electrode concept
International Nuclear Information System (INIS)
Yang, Y.; Maruyama, S.; Kiss, G.; O’Connor, M.; Zhang, Y.; Pitts, R.A.; Shimada, M.; Fang, T.; Wang, Y.; Wang, M.; Pan, Y.; Li, B.; Li, L.
2014-01-01
Highlights: •This paper summarizes the approved new design of ITER GDC. •It is based on the fixed electrode design instead of the previous movable concept. •Estimates were made on the glow current density. •R and D topics on initiation, steady state and heat load were presented. •Other relevant considerations were listed in an exhaustive manner. -- Abstract: A new design of ITER Glow Discharge Cleaning (GDC) system based on a fixed electrode concept replaces the previous design which was based on a movable electrode integrated with the ITER In-Vessel-Viewing-System. Recently the conceptual design of the GDC system was reviewed successfully on the functions, safety, operation and maintenance. The design proposed was checked against the requirements and found to be feasible. This paper gives an overall description of the requirements from physics and operation viewpoints and introduces the design at the conceptual level. Main R and D activities are listed and summarized. Further detailed studies are to be performed in the following design stage
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Alternate mutation based artificial immune algorithm for step fixed charge transportation problem
Directory of Open Access Journals (Sweden)
Mahmoud Moustafa El-Sherbiny
2012-07-01
Full Text Available Step fixed charge transportation problem (SFCTP is considered as a special version of the fixed-charge transportation problem (FCTP. In SFCTP, the fixed cost is incurred for every route that is used in the solution and is proportional to the amount shipped. This cost structure causes the value of the objective function to behave like a step function. Both FCTP and SFCTP are considered to be NP-hard problems. While a lot of research has been carried out concerning FCTP, not much has been done concerning SFCTP. This paper introduces an alternate Mutation based Artificial Immune (MAI algorithm for solving SFCTPs. The proposed MAI algorithm solves both balanced and unbalanced SFCTP without introducing a dummy supplier or a dummy customer. In MAI algorithm a coding schema is designed and procedures are developed for decoding such schema and shipping units. MAI algorithm guarantees the feasibility of all the generated solutions. Due to the significant role of mutation function on the MAI algorithm’s quality, 16 mutation functions are presented and their performances are compared to select the best one. For this purpose, forty problems with different sizes have been generated at random and then a robust calibration is applied using the relative percentage deviation (RPD method. Through two illustrative problems of different sizes the performance of the MAI algorithm has been compared with most recent methods.
Research and Design of Fixed Photovoltaic Support Structure Based on SAP2000
Directory of Open Access Journals (Sweden)
Wang Xingxing
2018-01-01
Full Text Available In the solar photovoltaic power station project, PV support is one of the main structures, and fixed photovoltaic PV support is one of the most commonly used stents. For the the actual demand in a Japanese photovoltaic power, SAP2000 finite element analysis software is used in this paper, based on Japanese Industrial Standard (JIS C 8955-2011, describing the system of fixed photovoltaic support structure design and calculation method and process. The results show that: (1 according to the general requirements of 4 rows and 5 columns fixed photovoltaic support, the typical permanent load of the PV support is 4679.4 N, the wind load being 1.05 kN/m2, the snow load being 0.89 kN/m2 and the seismic load is 5877.51 N; (2 by theoretical calculation of the two ends extended beam model, the beam span under the rail is determined 2200 mm; (3 by the way of using the single factor experiment, through the calculation and analysis of SAP2000, the three best supporting points of the support of the W stent are determined; (4 by comprehensive simulation, the optimal parameters for the rail, beam, support and bolt are 60× 60× 1.0, 60× 60× 1.0, 40× 50× 2.0, and M10 respectively.
Application of DNA-based methods in forensic entomology.
Wells, Jeffrey D; Stevens, Jamie R
2008-01-01
A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.
Directory of Open Access Journals (Sweden)
Wahyu Hari Kristiyanto
2017-08-01
Full Text Available Old guidelines to use the whiteboard stated that teachers were not allowed to write on the whiteboard while talking, because unethical if speak while back facing students. Findings about thinking process profile in information processing were presented with a whiteboard showed that the assimilation process is going to be supported, and audio-visual stimulants. This paper aims to describe the implementation of the latest strategies to use fixed-whiteboard based on student’s thinking process in learning physics with maximum the optimal thought processes and also maintain cultural ethics. This research was conducted through the use of guideline development assessment implementation fixed-slates based on the findings of the process of thinking and ethical culture in physics learning. The results showed that the latest strategy the use of fixed-whiteboard based on the thought process students and ethical culture in learning physics are (1 the assimilation process so that the display contents whiteboard is a material that is correct and does not cause cognitive conflict, (2 they are mutually reinforcing a combination of visual and audio so that the need to write while spelling, and (3 the thinking process to the stage of internalization that stage of the emergence of good information text / image / formula can be seen intact by all students by writing not cover impressions. The implementation results show the subject has been able to implement the latest strategies use fixed-whiteboard with both categories. The conclusions of this study that the use of the latest strategies fixed-whiteboard can be used for the presentation of information which is more than usual for students according to their thinking process and also maintain cultural ethics. The implication of this research is for Workforce Education Institutions need to equip student teachers with the skills to use the whiteboard based on the latest strategy. How to CiteKristiyanto, W. H
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
STS-26 Commander Hauck in fixed based (FB) shuttle mission simulator (SMS)
1988-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, Commander Frederick H. Hauck, wearing comunications kit assembly headset and seated in the commanders seat on forward flight deck, looks over his shoulder toward the aft flight deck. A flight data file (FDF) notebook rests on his lap. The STS-26 crew is training in the fixed base (FB) shuttle mission simulator (SMS) located in JSC Mission Simulation and Training Facility Bldg 5.
STS-26 MS Hilmers on fixed based (FB) shuttle mission simulator (SMS) middeck
1988-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, Mission Specialist (MS) David C. Hilmers prepares to ascend a ladder representing the interdeck access hatch from the shuttle middeck to the flight deck. The STS-26 crew is training in the fixed base (FB) shuttle mission simulator (SMS) located in JSC Mission Simulation and Training Facility Bldg 5.
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
A DNA-based semantic fusion model for remote sensing data.
Directory of Open Access Journals (Sweden)
Heng Sun
Full Text Available Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.
A DNA-based semantic fusion model for remote sensing data.
Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H
2013-01-01
Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.
Radiation chemistry of the base components of DNA and related substances
International Nuclear Information System (INIS)
Teoule, R.
1979-01-01
The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)
DNA & Protein detection based on microbead agglutination
Kodzius, Rimantas
2012-06-06
We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.
Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.
Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris
2016-07-15
A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Fixing the model for transcription: the DNA moves, not the polymerase.
Papantonis, Argyris; Cook, Peter R
2011-01-01
The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.
The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection
International Nuclear Information System (INIS)
Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon
2008-01-01
The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection
Parachuting from fixed objects: descriptive study of 106 fatal events in BASE jumping 1981-2006.
Westman, A; Rosén, M; Berggren, P; Björnstig, U
2008-06-01
To analyse the characteristics of fatal incidents in fixed object sport parachuting (building, antenna, span, earth (BASE) jumping) and create a basis for prevention. Descriptive epidemiological study. Data on reported fatal injury events (n = 106) worldwide in 1981-2006 retrieved from the BASE fatality list. Human, equipment and environmental factors. Identification of typical fatal incident and injury mechanisms for each of the four fixed object types of BASE jumping (building, antenna, span, earth). Human factors included parachutist free fall instability (loss of body control before parachute deployment), free fall acrobatics and deployment failure by the parachutist. Equipment factors included pilot chute malfunction and parachute malfunction. In cliff jumping (BASE object type E), parachute opening towards the object jumped was the most frequent equipment factor. Environmental factors included poor visibility, strong or turbulent winds, cold and water. The overall annual fatality risk for all object types during the year 2002 was estimated at about one fatality per 60 participants. Participants in BASE jumping should target risk factors with training and technical interventions. The mechanisms described in this study should be used by rescue units to improve the management of incidents.
Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene
Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.
2012-02-01
We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.
Directory of Open Access Journals (Sweden)
Hediyeh Karimi
2013-01-01
Full Text Available It has been predicted that the nanomaterials of graphene will be among the candidate materials for postsilicon electronics due to their astonishing properties such as high carrier mobility, thermal conductivity, and biocompatibility. Graphene is a semimetal zero gap nanomaterial with demonstrated ability to be employed as an excellent candidate for DNA sensing. Graphene-based DNA sensors have been used to detect the DNA adsorption to examine a DNA concentration in an analyte solution. In particular, there is an essential need for developing the cost-effective DNA sensors holding the fact that it is suitable for the diagnosis of genetic or pathogenic diseases. In this paper, particle swarm optimization technique is employed to optimize the analytical model of a graphene-based DNA sensor which is used for electrical detection of DNA molecules. The results are reported for 5 different concentrations, covering a range from 0.01 nM to 500 nM. The comparison of the optimized model with the experimental data shows an accuracy of more than 95% which verifies that the optimized model is reliable for being used in any application of the graphene-based DNA sensor.
DNA-based asymmetric organometallic catalysis in water
Oelerich, Jens; Roelfes, Gerard
2013-01-01
Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to
Directory of Open Access Journals (Sweden)
Mário Pinzan Scatena
2008-01-01
Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.
A DNA methylation-based definition of biologically distinct breast cancer subtypes.
Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel
2015-03-01
In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Mining Repair Actions for Guiding Automated Program Fixing
Martinez , Matias; Monperrus , Martin
2012-01-01
Automated program fixing consists of generating source code in order to fix bugs in an automated manner. Our intuition is that automated program fixing can imitate human-based program fixing. Hence, we present a method to mine repair actions from software repositories. A repair action is a small semantic modification on code such as adding a method call. We then decorate repair actions with a probability distribution also learnt from software repositories. Our probabilistic repair models enab...
The Tissue Analysis Core within the AIDS and Cancer Virus Program will process, embed and perform microtomy on fixed tissue samples presented in ethanol. HIV/SIVin situhybridization for detection of vRNA and vDNA will be performed using the next-gene
The role of DNA base excision repair in brain homeostasis and disease
DEFF Research Database (Denmark)
Akbari, Mansour; Morevati, Marya; Croteau, Deborah
2015-01-01
Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....
The essential component in DNA-based information storage system: robust error-tolerating module
Directory of Open Access Journals (Sweden)
Aldrin Kay-Yuen eYim
2014-11-01
Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.
Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.
Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi
2013-12-15
We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.
DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.
Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil
2017-10-01
Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.
THE PROBLEMS OF FIXED ASSETS CLASSIFICATION FOR ACCOUNTING
Directory of Open Access Journals (Sweden)
Sophiia Kafka
2016-06-01
Full Text Available This article provides a critical analysis of research in accounting of fixed assets; the basic issues of fixed assets accounting that have been developed by the Ukrainian scientists during 1999-2016 have been determined. It is established that the problems of non-current assets taxation and their classification are the most noteworthy. In the dissertations the issues of fixed assets classification are of exclusively particular branch nature, so its improvement is important. The purpose of the article is developing science-based classification of fixed assets for accounting purposes since their composition is quite diverse. The classification of fixed assets for accounting purposes have been summarized and developed in Figure 1 according to the results of the research. The accomplished analysis of existing approaches to classification of fixed assets has made it possible to specify its basic types and justify the classification criteria of fixed assets for the main objects of fixed assets. Key words: non-current assets, fixed assets, accounting, valuation, classification of the fixed assets. JEL:G M41
Directory of Open Access Journals (Sweden)
Rosemary A Bamford
Full Text Available Förster resonance energy transfer (FRET technology relies on the close proximity of two compatible fluorophores for energy transfer. Tagged (Cy3 and Cy5 complementary DNA strands forming a stable duplex and a doubly-tagged single strand were shown to demonstrate FRET outside of a cellular environment. FRET was also observed after transfecting these DNA strands into fixed and live cells using methods such as microinjection and electroporation, but not when using lipid based transfection reagents, unless in the presence of the endosomal acidification inhibitor bafilomycin. Avoiding the endocytosis pathway is essential for efficient delivery of intact DNA probes into cells.
STS-46 crewmembers participate in Fixed Base (FB) SMS training at JSC
1992-01-01
STS-46 Atlantis, Orbiter Vehicle (OV) 104, Pilot Andrew M. Allen hands Mission Specialist (MS) and Payload Commander (PLC) Jeffrey A. Hoffman checklists from middeck locker MF43E during training session in JSC's fixed base (FB) shuttle mission simulator (SMS) located in Mission Simulation and Training Facility Bldg 5. European Space Agency (ESA) MS Claude Nicollier outfitted with communications kit assembly headset (HDST) and equipment looks beyond Hoffman to the opposite side of the middeck.
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
It is necessary in the field of post-genoms to know statistical correlation between DNA orientation information and clinical data, which helped growth of DNA probe arrays (DNA chips). However, it is difficult in patent point of view to develop chips in Japan. On the other hand, a movement has begun to use beads fixed with DNA probes in place of DNA chips demarcated on the surface of solids. This is a method to investigate hybridized DNA by means of fluorescent detection, in which each bead retaining the DNA probes is colored to make identification of the retained probes possible, and hybridizing reaction is performed in aqueous solution. Hitachi has developed a DNA measuring technology using bead arrays. The bead array has probe fixing beads of about 100 {mu} m laid sequentially inside a capillary, wherein the array can be used to inspect a large number of genes. Thus, this method can be a DNA measuring technology which is inexpensive, and high in reproducibility. These features lead to a belief that the technology is suitable for gene inspection devices used in the process of medicine development and at the clinical sites. (NEDO)
International Nuclear Information System (INIS)
Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo
2011-01-01
Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.
Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers
Directory of Open Access Journals (Sweden)
MEMEN SURAHMAN
2010-07-01
Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.
Evaluation of a Novel BEV Concept Based on Fixed and Swappable Li-Ion Battery Packs
DEFF Research Database (Denmark)
Barreras, Jorge Varela; Pinto, Claudio; de Castro, Ricardo
2016-01-01
-based ownership models to distribute the cost of the large battery pack over the vehicle lifetime. A methodology is proposed for the analysis and evaluation of the proposed concept in comparison with a direct owned nonswappable single-pack BEV, proving that significant improvements on city fuel economy (up to 14......In this paper, a novel battery electric vehicle (BEV) concept based on a small fixed and a big swappable Li-ion battery pack is proposed in order to achieve longer range, lower initial purchase priceand lower energy consumption at short ranges. For short ranges, the BEV is only powered...... by the relatively small-fixed battery pack, without the large swappable battery pack. In this way, the mass of the vehicle is reduced and, therefore, the energy consumed per unit distance is improved. For higher ranges, the BEV is powered by both battery packs. This concept allows the introduction of subscription...
International Nuclear Information System (INIS)
Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike
2012-01-01
Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.
STS-29 Commander Coats in JSC fixed base (FB) shuttle mission simulator (SMS)
1986-01-01
STS-29 Discovery, Orbiter Vehicle (OV) 103, Commander Michael L. Coats sits at commanders station forward flight deck controls in JSC fixed base (FB) shuttle mission simulator (SMS). Coats, wearing communications kit assembly headset and flight coveralls, looks away from forward control panels to aft flight deck. Pilots station seat back appears in foreground. FB-SMS is located in JSC Mission Simulation and Training Facility Bldg 5.
Random amplified polymorphic DNA based genetic characterization ...
African Journals Online (AJOL)
Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
DNA Origami-Graphene Hybrid Nanopore for DNA Detection.
Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R
2017-01-11
DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.
Hepatitis B virus DNA polymerase gene polymorphism based ...
African Journals Online (AJOL)
Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...
Transforming bases to bytes: Molecular computing with DNA
Indian Academy of Sciences (India)
Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.
A Constant Rate of Spontaneous Mutation in DNA-Based Microbes
Drake, John W.
1991-08-01
In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.
A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos
Directory of Open Access Journals (Sweden)
Chunyan Song
2015-10-01
Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.
Design and specificity of long ssDNA donors for CRISPR-based knock-in
Leonetti, Manuel; Li, Han; Beckman, Kyle; Pessino, Veronica; Huang, Bo; Weissman, Jonathan
2017-01-01
CRISPR/Cas technologies have transformed our ability to manipulate genomes for research and gene-based therapy. In particular, homology-directed repair after genomic cleavage allows for precise modification of genes using exogenous donor sequences as templates. While both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) forms of donors have been used as repair templates, a systematic comparison of the performance and specificity of repair using ssDNA versus dsDNA donors is still la...
A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks
Shaw, Harry
2012-01-01
Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.
DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.
Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui
2014-10-15
An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.
Twisting short dsDNA with applied tension
Zoli, Marco
2018-02-01
The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.
Pérez-Flores, J; Rueda-Calderon, H; Kvist, S; Siddall, M E; Oceguera-Figueroa, A
2016-10-01
Invertebrate-derived ingested DNA (iDNA) is quickly proving to be a valuable, non-invasive tool for monitoring vertebrate species of conservation concern. Using the DNA barcoding locus, we successfully identified both the blood-feeding leech Haementeria acuecueyetzin and its blood meal-the latter is shown to be derived from the Caribbean manatee, Trichechus manatus . DNA amplification was successful despite the fact that the specimen was fixed in Mezcal (a beverage distilled from agave). We report the first confirmed case of a leech feeding on a manatee, the first record of H. acuecueyetzin for the State of Chiapas and, to our knowledge, the first case of successful DNA amplification of a biological sample fixed in Mezcal other than the caterpillar "worms" more commonly found in that beverage.
Directory of Open Access Journals (Sweden)
Koji Hashimoto
2016-05-01
Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond
Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng
2014-06-15
Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model
Savelyev, Alexey; MacKerell, Alexander D.
2014-01-01
Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978
STS-26 crew trains in JSC fixed-based (FB) shuttle mission simulator (SMS)
1987-01-01
STS-26 Discovery, Orbiter Vehicle (OV) 103, crewmembers (left to right) Commander Frederick H. Hauck, Pilot Richard O. Covey, Mission Specialist (MS) George D. Nelson, MS David C. Hilmers, and MS John M. Lounge pose on the middeck in fixed-based (FB) shuttle mission simulator (SMS) located in JSC Mission Simulation and Training Facility Bldg 5. A simulation for their anticipated June 1988 flight began 10-20-87.
Efficient alignment-free DNA barcode analytics.
Kuksa, Pavel; Pavlovic, Vladimir
2009-11-10
In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding.
DNA-based species detection capabilities using laser transmission spectroscopy.
Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M
2013-01-06
Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.
Structuring polymers for delivery of DNA-based therapeutics: updated insights.
Gupta, Madhu; Tiwari, Shailja; Vyas, Suresh
2012-01-01
Gene therapy offers greater opportunities for treating numerous incurable diseases from genetic disorders, infections, and cancer. However, development of appropriate delivery systems could be one of the most important factors to overcome numerous biological barriers for delivery of various therapeutic molecules. A number of nonviral polymer-mediated vectors have been developed for DNA delivery and offer the potential to surmount the associated problems of their viral counterpart. To address the concerns associated with safety issues, a wide range of polymeric vectors are available and have been utilized successfully to deliver their therapeutics in vivo. Today's research is mainly focused on the various natural or synthetic polymer-based delivery carriers that protect the DNA molecule from degradation, which offer specific targeting to the desired cells after systemic administration, have transfection efficiencies equivalent to virus-mediated gene delivery, and have long-term gene expression through sustained-release mechanisms. This review explores an updated overview of different nonviral polymeric delivery system for delivery of DNA-based therapeutics. These polymeric carriers have been evaluated in vitro and in vivo and are being utilized in various stages of clinical evaluation. Continued research and understanding of the principles of polymer-based gene delivery systems will enable us to develop new and efficient delivery systems for the delivery of DNA-based therapeutics to achieve the goal of efficacious and specific gene therapy for a vast array of clinical disorders as the therapeutic solutions of tomorrow.
Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M
2010-03-01
Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.
Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.
An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo
2012-01-01
Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.
[The effect of spermine on acid-base equilibrium in DNA molecule].
Slonitskiĭ, S V; Kuptsov, V Iu
1990-01-01
The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.
Jimenez-Salgado, T; Fuentes-Ramirez, L E; Tapia-Hernandez, A; Mascarua-Esparza, M A; Martinez-Romero, E; Caballero-Mellado, J
1997-09-01
Acetobacter diazotrophicus was isolated from coffee plant tissues and from rhizosphere soils. Isolation frequencies ranged from 15 to 40% and were dependent on soil pH. Attempts to isolate this bacterial species from coffee fruit, from inside vesicular-arbuscular mycorrhizal fungi spores, or from mealybugs (Planococcus citri) associated with coffee plants were not successful. Other acid-producing diazotrophic bacteria were recovered with frequencies of 20% from the coffee rhizosphere. These N2-fixing isolates had some features in common with the genus Acetobacter but should not be assigned to the species Acetobacter diazotrophicus because they differed from A. diazotrophicus in morphological and biochemical traits and were largely divergent in electrophoretic mobility patterns of metabolic enzymes at coefficients of genetic distance as high as 0.950. In addition, these N2-fixing acetobacteria differed in the small-subunit rRNA restriction fragment length polymorphism patterns obtained with EcoRI, and they exhibited very low DNA-DNA homology levels, ranging from 11 to 15% with the A. diazotrophicus reference strain PAI 5T. Thus, some of the diazotrophic acetobacteria recovered from the rhizosphere of coffee plants may be regarded as N2-fixing species of the genus Acetobacter other than A. diazotrophicus. Endophytic diazotrophic bacteria may be more prevalent than previously thought, and perhaps there are many more potentially beneficial N2-fixing bacteria which can be isolated from other agronomically important crops.
DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study
Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein
2013-01-01
DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...
Todorović-Raković, Nataša
2013-01-01
In situ hybridization (ISH) allows evaluation of genetic abnormalities, such as changes in chromosome number, chromosome translocations or gene amplifications, by hybridization of tagged DNA (or RNA) probes with complementary DNA (or RNA) sequences in interphase nuclei of target tissue. However, chromogenic in situ hybridization (CISH) is also applicable to formalin-fixed, paraffin-embedded (FFPE) tissues, besides metaphase chromosome spreads. CISH is similar to fluorescent in situ hybridization (FISH) regarding pretreatments and hybridization protocols but differs in the way of visualization. Indeed, CISH signal detection is similar to that used in immunohistochemistry, making use of a peroxidase-based chromogenic reaction instead of fluorescent dyes. In particular, tagged DNA probes are indirectly detected using an enzyme-conjugated antibody targeting the tags. The enzymatic reaction of the chromogenic substrate leads to the formation of strong permanent brown signals that can be visualized by bright-field microscopy at 40 × magnification. The advantage of CISH is that it allows the simultaneous observation of gene amplification and tissue morphology and the slides can be stored for a long time.
Structural and electrostatic regularities in interactions of homeodomains with operator DNA
International Nuclear Information System (INIS)
Chirgadze, Yu.N.; Ivanov, V.V.; Polozov, R.V.; Zheltukhin, E.I.; Sivozhelezov, V.S.
2008-01-01
Interfaces of five DNA-homeodomain complexes, selected by similarity of structures and patterns of contacting residues, were compared. The long-range stage of the recognition process was characterized by electrostatic potentials about 5 Angstroem away from molecular surfaces of both protein and DNA. For proteins, clear positive potential is displayed only at the side contacting DNA, while grooves of DNA display a strong negative potential. Thus, one functional role of electrostatics is guiding the protein into the DNA major groove. At the close-range stage, neutralization of the phosphate charges by positively charged residues is necessary for decreasing the strong electrostatic potential of DNA, allowing nucleotide bases to participate in formation of protein-DNA atomic contacts in the interface. The protein's recognizing α-helix was shown to form both invariant and variable contacts with DNA by means of the certain specific side groups, with water molecules participating in some of the contacts. The invariant contacts included the highly specific Asn-Ade hydrogen bonds, nonpolar contacts of hydrophobic amino acids serving as barriers for fixing the protein on DNA, and interface water molecule cluster providing local mobility necessary for the dissociation of the protein-DNA complex. One of the water molecules is invariant and located at the center of the interface. Invariant contacts of the proteins are mostly formed with the TAAT motive of promoter DNA's forward strand. They distinguish the homeodomain family from other DNA-binding proteins. Variable contacts are formed with the reverse strand and are responsible for the binding specificity within the homeodomain family
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Kalkan, Ahmet; Ozdarendeli, Aykut; Bulut, Yasemin; Yekeler, Hayrettin; Cobanoglu, Bengu; Doymaz, Mehmet Z
2005-01-01
To investigate etiological role of Epstein-Barr virus (EBV) DNA in breast cancer. The presence of EBV DNA in 57 breast cancer tissues was investigated with a sensitive PCR assay. The breast cancer tissues were from invasive ductular (n=28), lobular (n=20) and other miscellaneous carcinomas (n=9). Tissues from normal breasts and patients with various benign breast diseases (n=55): fibrocystic disease (n=34), fibroadenoma (n=16), hyperplasia, and granulomatous mastitis (n=5), were used as control samples. EBV DNA was detected in 13 (23%) cancerous tissues (7 ductular, 4 lobular, 2 other carcinoma) and 19 (35%) in the control tissues. The difference between EBV presence in malignant and benign tissues was not statistically significant (p>0.05). The presence of EBV DNA was detected almost equally in both breast cancer and normal tissues, which indicates no etiological role for EBV in breast cancer. We suggest further etiological studies. Copyright (c) 2005 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Maggie R Williams
Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a
Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang
2012-05-01
The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.
HLA class I sequence-based typing using DNA recovered from frozen plasma.
Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L
2012-08-31
We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.
A history of the DNA repair and mutagenesis field: The discovery of base excision repair.
Friedberg, Errol C
2016-01-01
This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.
Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism
Jiang, Wen-Yan; Ran, Shi-Yong
2018-05-01
The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.
10 CFR 603.305 - Use of a fixed-support TIA.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Use of a fixed-support TIA. 603.305 Section 603.305 Energy... Expenditure-Based and Fixed-Support Technology Investment Agreements § 603.305 Use of a fixed-support TIA. The contracting officer may use a fixed-support TIA if: (a) The agreement is to support or stimulate RD&D with...
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Statistical length of DNA based on AFM image measured by a computer
International Nuclear Information System (INIS)
Chen Xinqing; Qiu Xijun; Zhang Yi; Hu Jun; Wu Shiying; Huang Yibo; Ai Xiaobai; Li Minqian
2001-01-01
Taking advantage of image processing technology, the contour length of DNA molecule was measured automatically by a computer. Based on the AFM image of DNA, the topography of DNA was simulated into a curve. Then the DNA length was measured automatically by inserting mode. It was shown that the experimental length of a naturally deposited DNA (180.4 +- 16.4 nm) was well consistent with the theoretical length (185.0 nm). Comparing to other methods, the present approach had advantages of precision and automatism. The stretched DNA was also measured. It present approach had advantages of precision and automatism. The stretched DNA was also measured. It was shown that the experimental length (343.6 +- 20.7 nm) was much longer than the theoretical length (307.0 nm). This result indicated that the stretching process had a distinct effect on the DNA length. However, the method provided here avoided the DNA-stretching effect
DNA-based stable isotope probing: a link between community structure and function
International Nuclear Information System (INIS)
Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas
2009-01-01
DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.
Designing thermal diode and heat pump based on DNA nanowire: Multifractal approach
Energy Technology Data Exchange (ETDEWEB)
Behnia, S., E-mail: s.behnia@iaurmia.ac.ir; Panahinia, R.
2017-07-12
The management of heat flow in DNA nano wire was considered. Thermal diode effect in DNA and the domain of its appearance dependent to system parameters have been detected. The appearance of directed thermal flow in thermodynamic sizes proposes the possibility of designing the macroscopic thermal rectifier. By applying driven force, pumping effect has been also observed. The resonance frequency of DNA and threshold amplitudes of driving force for attaining permanent pumping effect have been detected. Forasmuch as detecting negative differential thermal resistance (NDTR) phenomenon, DNA can act as a thermal transistor. By using an analytical parallel investigation based on Rényi spectrum analysis, threshold values to transition to NDTR and pumping regimes have been detected. - Highlights: • The control and management of heat current in DNA have been investigated. • Directed thermal flow and NDTR in DNA have been identified. • By increasing the system size, the reversed thermal rectification appeared. So, it is proposed the possibility of designing the macroscopic thermal rectifier. • Pumping effect accompanied with detection of resonance frequency of DNA has been observed. • To verify the results, we did a parallel analysis based on multifractal concept to detect threshold values for transition to pumping state and NDTR regime.
Programmable molecular recognition based on the geometry of DNA nanostructures.
Woo, Sungwook; Rothemund, Paul W K
2011-07-10
From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.
Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization
DEFF Research Database (Denmark)
Zhan, Zongrui; Ma, Xingyi; Cao, Cuong
2011-01-01
In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...
The price of fixed income market volatility
Mele, Antonio
2015-01-01
Fixed income volatility and equity volatility evolve heterogeneously over time, co-moving disproportionately during periods of global imbalances and each reacting to events of different nature. While the methodology for options-based "model-free" pricing of equity volatility has been known for some time, little is known about analogous methodologies for pricing various fixed income volatilities. This book fills this gap and provides a unified evaluation framework of fixed income volatility while dealing with disparate markets such as interest-rate swaps, government bonds, time-deposits and credit. It develops model-free, forward looking indexes of fixed-income volatility that match different quoting conventions across various markets, and uncovers subtle yet important pitfalls arising from naïve superimpositions of the standard equity volatility methodology when pricing various fixed income volatilities. The ultimate goal of the authors´ efforts is to make interest rate volatility standardization a valuable...
Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.
Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong
2017-12-15
We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.
Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J
2009-10-12
DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.
Fornander, Louise H
2013-12-03
The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.
Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H
2012-07-01
The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.
Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn
2018-07-01
Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification
DENA: A Configurable Microarchitecture and Design Flow for Biomedical DNA-Based Logic Design.
Beiki, Zohre; Jahanian, Ali
2017-10-01
DNA is known as the building block for storing the life codes and transferring the genetic features through the generations. However, it is found that DNA strands can be used for a new type of computation that opens fascinating horizons in computational medicine. Significant contributions are addressed on design of DNA-based logic gates for medical and computational applications but there are serious challenges for designing the medium and large-scale DNA circuits. In this paper, a new microarchitecture and corresponding design flow is proposed to facilitate the design of multistage large-scale DNA logic systems. Feasibility and efficiency of the proposed microarchitecture are evaluated by implementing a full adder and, then, its cascadability is determined by implementing a multistage 8-bit adder. Simulation results show the highlight features of the proposed design style and microarchitecture in terms of the scalability, implementation cost, and signal integrity of the DNA-based logic system compared to the traditional approaches.
An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.
Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat
2018-03-01
A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.
DNA base-calling from a nanopore using a Viterbi algorithm.
Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei
2012-05-16
Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Slow elimination of DNA damaged bases in the liver of old gamma-irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Gaziev, A I; Malakhova, L V; Fomenko, L A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki
1981-01-01
Elimination of the DNA damaged bases in the liver of old and young mice after their gamma-irradiation is studied. It is established that the incision rate of DNA gamma-damaged bases in the liver of old mice is lower than in the liver of the young ones. It is supposed to be connected with the decrease of the activity of DNA reparation ferments or with the presence of limitations in chromatin for the access of these ferments to the damaged parts of DNA in the cells of old animals.
High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study
DEFF Research Database (Denmark)
Sousa, MA de; Boye, Kit; Lencastre, H de
2006-01-01
Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....
Fixed-time stabilization of impulsive Cohen-Grossberg BAM neural networks.
Li, Hongfei; Li, Chuandong; Huang, Tingwen; Zhang, Wanli
2018-02-01
This article is concerned with the fixed-time stabilization for impulsive Cohen-Grossberg BAM neural networks via two different controllers. By using a novel constructive approach based on some comparison techniques for differential inequalities, an improvement theorem of fixed-time stability for impulsive dynamical systems is established. In addition, based on the fixed-time stability theorem of impulsive dynamical systems, two different control protocols are designed to ensure the fixed-time stabilization of impulsive Cohen-Grossberg BAM neural networks, which include and extend the earlier works. Finally, two simulations examples are provided to illustrate the validity of the proposed theoretical results. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fundamental study of the radiation monitoring system based on evaluation of DNA lesions
International Nuclear Information System (INIS)
Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.
2011-01-01
The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso
2015-07-01
In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
DNA-Based Nanobiosensors as an Emerging Platform for Detection of Disease
Directory of Open Access Journals (Sweden)
Khalid M. Abu-Salah
2015-06-01
Full Text Available Detection of disease at an early stage is one of the biggest challenges in medicine. Different disciplines of science are working together in this regard. The goal of nanodiagnostics is to provide more accurate tools for earlier diagnosis, to reduce cost and to simplify healthcare delivery of effective and personalized medicine, especially with regard to chronic diseases (e.g., diabetes and cardiovascular diseases that have high healthcare costs. Up-to-date results suggest that DNA-based nanobiosensors could be used effectively to provide simple, fast, cost-effective, sensitive and specific detection of some genetic, cancer, and infectious diseases. In addition, they could potentially be used as a platform to detect immunodeficiency, and neurological and other diseases. This review examines different types of DNA-based nanobiosensors, the basic principles upon which they are based and their advantages and potential in diagnosis of acute and chronic diseases. We discuss recent trends and applications of new strategies for DNA-based nanobiosensors, and emphasize the challenges in translating basic research to the clinical laboratory.
A Novel Image Encryption Algorithm Based on DNA Subsequence Operation
Directory of Open Access Journals (Sweden)
Qiang Zhang
2012-01-01
Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.
A new automatic fixed peak technology of microcontroller
International Nuclear Information System (INIS)
Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng
1999-01-01
The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources
On the Control of the Fixed Charge Densities in Al2O3-Based Silicon Surface Passivation Schemes.
Simon, Daniel K; Jordan, Paul M; Mikolajick, Thomas; Dirnstorfer, Ingo
2015-12-30
A controlled field-effect passivation by a well-defined density of fixed charges is crucial for modern solar cell surface passivation schemes. Al2O3 nanolayers grown by atomic layer deposition contain negative fixed charges. Electrical measurements on slant-etched layers reveal that these charges are located within a 1 nm distance to the interface with the Si substrate. When inserting additional interface layers, the fixed charge density can be continuously adjusted from 3.5 × 10(12) cm(-2) (negative polarity) to 0.0 and up to 4.0 × 10(12) cm(-2) (positive polarity). A HfO2 interface layer of one or more monolayers reduces the negative fixed charges in Al2O3 to zero. The role of HfO2 is described as an inert spacer controlling the distance between Al2O3 and the Si substrate. It is suggested that this spacer alters the nonstoichiometric initial Al2O3 growth regime, which is responsible for the charge formation. On the basis of this charge-free HfO2/Al2O3 stack, negative or positive fixed charges can be formed by introducing additional thin Al2O3 or SiO2 layers between the Si substrate and this HfO2/Al2O3 capping layer. All stacks provide very good passivation of the silicon surface. The measured effective carrier lifetimes are between 1 and 30 ms. This charge control in Al2O3 nanolayers allows the construction of zero-fixed-charge passivation layers as well as layers with tailored fixed charge densities for future solar cell concepts and other field-effect based devices.
On-bead fluorescent DNA nanoprobes to analyze base excision repair activities
International Nuclear Information System (INIS)
Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier
2014-01-01
Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities
Excited state dynamics of DNA bases
Czech Academy of Sciences Publication Activity Database
Kleinermanns, K.; Nachtigallová, Dana; de Vries, M. S.
2013-01-01
Roč. 32, č. 2 (2013), s. 308-342 ISSN 0144-235X R&D Projects: GA ČR GAP208/12/1318 Grant - others:National Science Foundation(US) CHE-0911564; NASA (US) NNX12AG77G; Deutsche Forschungsgemeinschaft(DE) SFB 663; Deutsche Forschungsgemeinschaft(DE) KI 531-29 Institutional support: RVO:61388963 Keywords : DNA bases * nucleobases * excited state * dynamics * computations * gas phase * conical intersections Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.920, year: 2013
Feasibility study of molecular memory device based on DNA using methylation to store information
Energy Technology Data Exchange (ETDEWEB)
Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)
2016-07-14
DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.
Feasibility study of molecular memory device based on DNA using methylation to store information
International Nuclear Information System (INIS)
Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin
2016-01-01
DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
A new model for ancient DNA decay based on paleogenomic meta-analysis.
Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G
2017-06-20
The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Evolutionary algorithms applied to Landau-gauge fixing
International Nuclear Information System (INIS)
Markham, J.F.
1998-01-01
Current algorithms used to put a lattice gauge configuration into Landau gauge either suffer from the problem of critical slowing-down or involve an additions computational expense to overcome it. Evolutionary Algorithms (EAs), which have been widely applied to other global optimisation problems, may be of use in gauge fixing. Also, being global, they should not suffer from critical slowing-down as do local gradient based algorithms. We apply EA'S and also a Steepest Descent (SD) based method to the problem of Landau Gauge Fixing and compare their performance. (authors)
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
Electroporation-based DNA delivery technology
DEFF Research Database (Denmark)
Gothelf, A; Gehl, Julie
2014-01-01
DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....
Computational modeling of a carbon nanotube-based DNA nanosensor
Energy Technology Data Exchange (ETDEWEB)
Kalantari-Nejad, R; Bahrami, M [Mechanical Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Rafii-Tabar, H [Department of Medical Physics and Biomedical Engineering and Research Centre for Medical Nanotechnology and Tissue Engineering, Shahid Beheshti University of Medical Sciences, Evin, Tehran (Iran, Islamic Republic of); Rungger, I; Sanvito, S, E-mail: mbahrami@aut.ac.ir [School of Physics and CRANN, Trinity College, Dublin 2 (Ireland)
2010-11-05
During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.
Computational modeling of a carbon nanotube-based DNA nanosensor
International Nuclear Information System (INIS)
Kalantari-Nejad, R; Bahrami, M; Rafii-Tabar, H; Rungger, I; Sanvito, S
2010-01-01
During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.
Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.
Directory of Open Access Journals (Sweden)
Eiko E Kuramae
Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.
DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects
Energy Technology Data Exchange (ETDEWEB)
Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)
2014-02-01
The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular
DNA based random key generation and management for OTP encryption.
Zhang, Yunpeng; Liu, Xin; Sun, Manhui
2017-09-01
One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Directory of Open Access Journals (Sweden)
Jens Pedersen
2012-12-01
Full Text Available Fix & Finish “WHO CAN FIX IT?” is an investigation of the needles left behind by drug users in Copenhagen’s Vesterbro district. Based on the praxiological methods developed by Annemarie Mol as well as processes of objectification as described by Daniel Miller, the used needle appears to be a multiple object that is related to opportunities, fear, good intentions and trash. This article is an invitation to study material culture and material practices as a part of semiotic and discursive analyses in order to sharpen a researcher’s analytical focus while remaining grounded in reality.
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study
Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad
2018-06-01
Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.
Li, X Y; Yang, G W; Zheng, D S; Guo, W S; Hung, W N N
2015-04-28
Genetic regulatory networks are the key to understanding biochemical systems. One condition of the genetic regulatory network under different living environments can be modeled as a synchronous Boolean network. The attractors of these Boolean networks will help biologists to identify determinant and stable factors. Existing methods identify attractors based on a random initial state or the entire state simultaneously. They cannot identify the fixed length attractors directly. The complexity of including time increases exponentially with respect to the attractor number and length of attractors. This study used the bounded model checking to quickly locate fixed length attractors. Based on the SAT solver, we propose a new algorithm for efficiently computing the fixed length attractors, which is more suitable for large Boolean networks and numerous attractors' networks. After comparison using the tool BooleNet, empirical experiments involving biochemical systems demonstrated the feasibility and efficiency of our approach.
Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.
Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar
2014-05-01
Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
MitBASE : a comprehensive and integrated mitochondrial DNA database. The present status
Attimonelli, M.; Altamura, N.; Benne, R.; Brennicke, A.; Cooper, J. M.; D'Elia, D.; Montalvo, A.; Pinto, B.; de Robertis, M.; Golik, P.; Knoop, V.; Lanave, C.; Lazowska, J.; Licciulli, F.; Malladi, B. S.; Memeo, F.; Monnerot, M.; Pasimeni, R.; Pilbout, S.; Schapira, A. H.; Sloof, P.; Saccone, C.
2000-01-01
MitBASE is an integrated and comprehensive database of mitochondrial DNA data which collects, under a single interface, databases for Plant, Vertebrate, Invertebrate, Human, Protist and Fungal mtDNA and a Pilot database on nuclear genes involved in mitochondrial biogenesis in Saccharomyces
DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging
Directory of Open Access Journals (Sweden)
Ricardo Gredilla
2011-01-01
Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.
Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study
Mall, Vijaya Shri; Tiwari, Rakesh Kumar
2018-05-01
The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.
Free-free and fixed base modal survey tests of the Space Station Common Module Prototype
Driskill, T. C.; Anderson, J. B.; Coleman, A. D.
1992-01-01
This paper describes the testing aspects and the problems encountered during the free-free and fixed base modal surveys completed on the original Space Station Common Module Prototype (CMP). The CMP is a 40-ft long by 14.5-ft diameter 'waffle-grid' cylinder built by the Boeing Company and housed at the Marshall Space Flight Center (MSFC) near Huntsville, AL. The CMP modal survey tests were conducted at MSFC by the Dynamics Test Branch. The free-free modal survey tests (June '90 to Sept. '90) included interface verification tests (IFVT), often referred to as impedance measurements, mass-additive testing and linearity studies. The fixed base modal survey tests (Feb. '91 to April '91), including linearity studies, were conducted in a fixture designed to constrain the CMP in 7 total degrees-of-freedom at five trunnion interfaces (two primary, two secondary, and the keel). The fixture also incorporated an airbag off-load system designed to alleviate the non-linear effects of friction in the primary and secondary trunnion interfaces. Numerous test configurations were performed with the objective of providing a modal data base for evaluating the various testing methodologies to verify dynamic finite element models used for input to coupled load analysis.
Mao, Shasha; Xiong, Lin; Jiao, Licheng; Feng, Tian; Yeung, Sai-Kit
2017-05-01
Riemannian optimization has been widely used to deal with the fixed low-rank matrix completion problem, and Riemannian metric is a crucial factor of obtaining the search direction in Riemannian optimization. This paper proposes a new Riemannian metric via simultaneously considering the Riemannian geometry structure and the scaling information, which is smoothly varying and invariant along the equivalence class. The proposed metric can make a tradeoff between the Riemannian geometry structure and the scaling information effectively. Essentially, it can be viewed as a generalization of some existing metrics. Based on the proposed Riemanian metric, we also design a Riemannian nonlinear conjugate gradient algorithm, which can efficiently solve the fixed low-rank matrix completion problem. By experimenting on the fixed low-rank matrix completion, collaborative filtering, and image and video recovery, it illustrates that the proposed method is superior to the state-of-the-art methods on the convergence efficiency and the numerical performance.
Magnetophoresis of flexible DNA-based dumbbell structures
Babić, B.; Ghai, R.; Dimitrov, K.
2008-02-01
Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.
Efficient Sleeping Beauty DNA Transposition From DNA Minicircles
Directory of Open Access Journals (Sweden)
Nynne Sharma
2013-01-01
Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.
Gorodetsky, Alon A.; Buzzeo, Marisa C.
2009-01-01
The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370
Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.
Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M
2017-07-05
DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A force-based, parallel assay for the quantification of protein-DNA interactions.
Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E
2014-01-01
Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.
A force-based, parallel assay for the quantification of protein-DNA interactions.
Directory of Open Access Journals (Sweden)
Katja Limmer
Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.
On fuzzy semantic similarity measure for DNA coding.
Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin
2016-02-01
A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Solution-based targeted genomic enrichment for precious DNA samples
Directory of Open Access Journals (Sweden)
Shearer Aiden
2012-05-01
Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.
(Brassicaceae) based on nuclear ribosomal ITS DNA sequences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...
Methodology for performing surveys for fixed contamination
International Nuclear Information System (INIS)
Durham, J.S.; Gardner, D.L.
1994-10-01
This report describes a methodology for performing instrument surveys for fixed contamination that can be used to support the release of material from radiological areas, including release to controlled areas and release from radiological control. The methodology, which is based on a fast scan survey and a series of statistical, fixed measurements, meets the requirements of the U.S. Department of Energy Radiological Control Manual (RadCon Manual) (DOE 1994) and DOE Order 5400.5 (DOE 1990) for surveys for fixed contamination and requires less time than a conventional scan survey. The confidence interval associated with the new methodology conforms to the draft national standard for surveys. The methodology that is presented applies only to surveys for fixed contamination. Surveys for removable contamination are not discussed, and the new methodology does not affect surveys for removable contamination
Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.
Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei
2016-11-01
Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.
Studies of base pair sequence effects on DNA solvation based on all
Indian Academy of Sciences (India)
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...
Hydrogen peroxide biosensor based on DNA-Hb modified gold electrode
International Nuclear Information System (INIS)
Kafi, A.K.M.; Fan Yin; Shin, Hoon-Kyu; Kwon, Young-Soo
2006-01-01
A hydrogen peroxide (H 2 O 2 ) biosensor based on DNA-hemoglobin (Hb) modified electrode is described in this paper. The sensor was designed by DNA and hemoglobin dropletting onto gold electrode surface layer by layer. The sensor based on the direct electron transfer of iron of hemoglobin showed a well electrocatalytic response to the reduction of the H 2 O 2 . This sensor offered an excellent electrochemical response for H 2 O 2 concentration below micromole level with high sensitivity and selectivity and short response time. Experimental conditions influencing the biosensor performance such as, pH, potential were optimized and assessed. The levels of the RSD's ( 2 O 2 was observed from 10 to 120 μM with the detection limit of 0.4 μM (based on the S/N = 3)
Pros and cons of methylation-based enrichment methods for ancient DNA
Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic
2015-01-01
The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828
DNA Qualification Workflow for Next Generation Sequencing of Histopathological Samples
Simbolo, Michele; Gottardi, Marisa; Corbo, Vincenzo; Fassan, Matteo; Mafficini, Andrea; Malpeli, Giorgio; Lawlor, Rita T.; Scarpa, Aldo
2013-01-01
Histopathological samples are a treasure-trove of DNA for clinical research. However, the quality of DNA can vary depending on the source or extraction method applied. Thus a standardized and cost-effective workflow for the qualification of DNA preparations is essential to guarantee interlaboratory reproducible results. The qualification process consists of the quantification of double strand DNA (dsDNA) and the assessment of its suitability for downstream applications, such as high-throughput next-generation sequencing. We tested the two most frequently used instrumentations to define their role in this process: NanoDrop, based on UV spectroscopy, and Qubit 2.0, which uses fluorochromes specifically binding dsDNA. Quantitative PCR (qPCR) was used as the reference technique as it simultaneously assesses DNA concentration and suitability for PCR amplification. We used 17 genomic DNAs from 6 fresh-frozen (FF) tissues, 6 formalin-fixed paraffin-embedded (FFPE) tissues, 3 cell lines, and 2 commercial preparations. Intra- and inter-operator variability was negligible, and intra-methodology variability was minimal, while consistent inter-methodology divergences were observed. In fact, NanoDrop measured DNA concentrations higher than Qubit and its consistency with dsDNA quantification by qPCR was limited to high molecular weight DNA from FF samples and cell lines, where total DNA and dsDNA quantity virtually coincide. In partially degraded DNA from FFPE samples, only Qubit proved highly reproducible and consistent with qPCR measurements. Multiplex PCR amplifying 191 regions of 46 cancer-related genes was designated the downstream application, using 40 ng dsDNA from FFPE samples calculated by Qubit. All but one sample produced amplicon libraries suitable for next-generation sequencing. NanoDrop UV-spectrum verified contamination of the unsuccessful sample. In conclusion, as qPCR has high costs and is labor intensive, an alternative effective standard workflow for
DNA qualification workflow for next generation sequencing of histopathological samples.
Directory of Open Access Journals (Sweden)
Michele Simbolo
Full Text Available Histopathological samples are a treasure-trove of DNA for clinical research. However, the quality of DNA can vary depending on the source or extraction method applied. Thus a standardized and cost-effective workflow for the qualification of DNA preparations is essential to guarantee interlaboratory reproducible results. The qualification process consists of the quantification of double strand DNA (dsDNA and the assessment of its suitability for downstream applications, such as high-throughput next-generation sequencing. We tested the two most frequently used instrumentations to define their role in this process: NanoDrop, based on UV spectroscopy, and Qubit 2.0, which uses fluorochromes specifically binding dsDNA. Quantitative PCR (qPCR was used as the reference technique as it simultaneously assesses DNA concentration and suitability for PCR amplification. We used 17 genomic DNAs from 6 fresh-frozen (FF tissues, 6 formalin-fixed paraffin-embedded (FFPE tissues, 3 cell lines, and 2 commercial preparations. Intra- and inter-operator variability was negligible, and intra-methodology variability was minimal, while consistent inter-methodology divergences were observed. In fact, NanoDrop measured DNA concentrations higher than Qubit and its consistency with dsDNA quantification by qPCR was limited to high molecular weight DNA from FF samples and cell lines, where total DNA and dsDNA quantity virtually coincide. In partially degraded DNA from FFPE samples, only Qubit proved highly reproducible and consistent with qPCR measurements. Multiplex PCR amplifying 191 regions of 46 cancer-related genes was designated the downstream application, using 40 ng dsDNA from FFPE samples calculated by Qubit. All but one sample produced amplicon libraries suitable for next-generation sequencing. NanoDrop UV-spectrum verified contamination of the unsuccessful sample. In conclusion, as qPCR has high costs and is labor intensive, an alternative effective standard
On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor
International Nuclear Information System (INIS)
Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.
2015-01-01
We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor
Influence of amino acids Shiff bases on irradiated DNA stability in vivo.
Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G
2013-01-01
To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.
Diagnostic markers of urothelial cancer based on DNA methylation analysis
International Nuclear Information System (INIS)
Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki
2013-01-01
Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect
Fixed-Rate Compressed Floating-Point Arrays.
Lindstrom, Peter
2014-12-01
Current compression schemes for floating-point data commonly take fixed-precision values and compress them to a variable-length bit stream, complicating memory management and random access. We present a fixed-rate, near-lossless compression scheme that maps small blocks of 4(d) values in d dimensions to a fixed, user-specified number of bits per block, thereby allowing read and write random access to compressed floating-point data at block granularity. Our approach is inspired by fixed-rate texture compression methods widely adopted in graphics hardware, but has been tailored to the high dynamic range and precision demands of scientific applications. Our compressor is based on a new, lifted, orthogonal block transform and embedded coding, allowing each per-block bit stream to be truncated at any point if desired, thus facilitating bit rate selection using a single compression scheme. To avoid compression or decompression upon every data access, we employ a software write-back cache of uncompressed blocks. Our compressor has been designed with computational simplicity and speed in mind to allow for the possibility of a hardware implementation, and uses only a small number of fixed-point arithmetic operations per compressed value. We demonstrate the viability and benefits of lossy compression in several applications, including visualization, quantitative data analysis, and numerical simulation.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 5; Issue 5. Fixed Points - From Russia with Love - A Primer of Fixed Point Theory. A K Vijaykumar. Book Review Volume 5 Issue 5 May 2000 pp 101-102. Fulltext. Click here to view fulltext PDF. Permanent link:
"Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E
2011-03-01
A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.
RELIABILITY BASED DESIGN OF FIXED FOUNDATION WIND TURBINES
Energy Technology Data Exchange (ETDEWEB)
Nichols, R.
2013-10-14
Recent analysis of offshore wind turbine foundations using both applicable API and IEC standards show that the total load demand from wind and waves is greatest in wave driven storms. Further, analysis of overturning moment loads (OTM) reveal that impact forces exerted by breaking waves are the largest contributor to OTM in big storms at wind speeds above the operating range of 25 m/s. Currently, no codes or standards for offshore wind power generators have been adopted by the Bureau of Ocean Energy Management Regulation and Enforcement (BOEMRE) for use on the Outer Continental Shelf (OCS). Current design methods based on allowable stress design (ASD) incorporate the uncertainty in the variation of loads transferred to the foundation and geotechnical capacity of the soil and rock to support the loads is incorporated into a factor of safety. Sources of uncertainty include spatial and temporal variation of engineering properties, reliability of property measurements applicability and sufficiency of sampling and testing methods, modeling errors, and variability of estimated load predictions. In ASD these sources of variability are generally given qualitative rather than quantitative consideration. The IEC 61400‐3 design standard for offshore wind turbines is based on ASD methods. Load and resistance factor design (LRFD) methods are being increasingly used in the design of structures. Uncertainties such as those listed above can be included quantitatively into the LRFD process. In LRFD load factors and resistance factors are statistically based. This type of analysis recognizes that there is always some probability of failure and enables the probability of failure to be quantified. This paper presents an integrated approach consisting of field observations and numerical simulation to establish the distribution of loads from breaking waves to support the LRFD of fixed offshore foundations.
Camposeo, Andrea; Del Carro, Pompilio; Persano, Luana; Cyprych, Konrad; Szukalski, Adam; Sznitko, Lech; Mysliwiec, Jaroslaw; Pisignano, Dario
2014-10-28
Room-temperature nanoimprinted, DNA-based distributed feedback (DFB) laser operation at 605 nm is reported. The laser is made of a pure DNA host matrix doped with gain dyes. At high excitation densities, the emission of the untextured dye-doped DNA films is characterized by a broad emission peak with an overall line width of 12 nm and superimposed narrow peaks, characteristic of random lasing. Moreover, direct patterning of the DNA films is demonstrated with a resolution down to 100 nm, enabling the realization of both surface-emitting and edge-emitting DFB lasers with a typical line width of <0.3 nm. The resulting emission is polarized, with a ratio between the TE- and TM-polarized intensities exceeding 30. In addition, the nanopatterned devices dissolve in water within less than 2 min. These results demonstrate the possibility of realizing various physically transient nanophotonics and laser architectures, including random lasing and nanoimprinted devices, based on natural biopolymers.
The radiation chemistry of the purine bases within DNA and related model compounds
International Nuclear Information System (INIS)
Cadet, J.; Berger, M.; Shaw, A.
1986-01-01
Both the direct and indirect effects of ionizing radiations are believed to contribute to the chemical changes induced in cellular DNA. Relevant information on the possible degradation pathways has been provided by studies using DNA model compounds, the major proportion of which have focused on pyrimidine components and sugar derivatives. With the development of powerful analytical tools such as high performance liquid chromatography and soft ionization mass spectrometry techniques, progress has recently been made in the elucidation of the nature of the radiation-induced chemical modifications of purine bases in DNA and related nucleosides and nucleotides. This short review details recent aspects of the radiation-induced degradation of adenine and guanine bases in DNA and its model compounds as the result of both direct and indirect effects. 11 refs., 2 figs., 1 tab
PDF fit in the fixed-flavour-number scheme
International Nuclear Information System (INIS)
Alekhin, S.; Bluemlein, J.; Moch, S.
2012-02-01
We discuss the heavy-quark contribution to deep inelastic scattering in the scheme with n f =3;4;5 fixed flavors. Based on the recent ABM11 PDF analysis of world data for deep-inelastic scattering and fixed-target data for the Drell-Yan process with the running-mass definition for heavy quarks we show that fixed flavor number scheme is sufficient for describing the deep-inelastic-scattering data in the entire kinematic range. We compare with other PDF sets and comment on the implications for measuring the strong coupling constant α s (M Z ).
DEFF Research Database (Denmark)
Wei, Mu; Chen, Zhe
2013-01-01
Distributed generation systems (DGS) with fixed-speed induction-generator-based wind turbines (FSWT) are sensitive and vulnerable to voltage disturbances and reactive power deficiency. Consequently, the control and protection strategies for such a DGS should be prompt and precise to avoid undesired...
Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage
Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.
1999-01-01
DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315
Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.
Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam
2017-11-02
In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.
International Nuclear Information System (INIS)
Biyikoglu, A.; Akcayol, M.A.; Oezdemir, V.; Sivrioglu, M.
2005-01-01
In this study, steady state combustion in boilers with a fixed bed has been investigated. Temperature distributions in the combustion chamber of a coal fired boiler with a fixed bed are predicted using fuzzy logic based on data obtained from the numerical solution method for various coal and air feeding rates. The numerical solution method and the discretization of the governing equations of two dimensional turbulent flow in the combustion chamber and one dimensional coal combustion in the fixed bed are explained. Control Volume and Finite Difference Methods are used in the discretization of the equations in the combustion chamber and in the fixed bed, respectively. Results are presented as contours within the solution domain and compared with numerical ones. Comparison of the results shows that the difference between the numerical solution and fuzzy logic prediction throughout the computational domain is less than 1.5%. The statistical coefficient of multiple determinations for the investigated cases is about 0.9993 to 0.9998. This accuracy degree is acceptable in predicting the temperature values. So, it can be concluded that fuzzy logic provides a feasible method for defining the system properties
Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho
2011-09-01
An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.
On-bead fluorescent DNA nanoprobes to analyze base excision repair activities
Energy Technology Data Exchange (ETDEWEB)
Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr
2014-02-17
Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair
The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy
Directory of Open Access Journals (Sweden)
Suneetha Amara
2017-03-01
Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.
A dynamic bead-based microarray for parallel DNA detection
International Nuclear Information System (INIS)
Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P
2011-01-01
A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening
Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.
Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine
2012-02-01
Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.
One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.
Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E
2014-06-01
The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.
Zhang, Liangxuan; Chen, Liangjing; Sah, Sachin; Latham, Gary J; Patel, Rajesh; Song, Qinghua; Koeppen, Hartmut; Tam, Rachel; Schleifman, Erica; Mashhedi, Haider; Chalasani, Sreedevi; Fu, Ling; Sumiyoshi, Teiko; Raja, Rajiv; Forrest, William; Hampton, Garret M; Lackner, Mark R; Hegde, Priti; Jia, Shidong
2014-04-01
The success of precision oncology relies on accurate and sensitive molecular profiling. The Ion AmpliSeq Cancer Panel, a targeted enrichment method for next-generation sequencing (NGS) using the Ion Torrent platform, provides a fast, easy, and cost-effective sequencing workflow for detecting genomic "hotspot" regions that are frequently mutated in human cancer genes. Most recently, the U.K. has launched the AmpliSeq sequencing test in its National Health Service. This study aimed to evaluate the clinical application of the AmpliSeq methodology. We used 10 ng of genomic DNA from formalin-fixed, paraffin-embedded human colorectal cancer (CRC) tumor specimens to sequence 46 cancer genes using the AmpliSeq platform. In a validation study, we developed an orthogonal NGS-based resequencing approach (SimpliSeq) to assess the AmpliSeq variant calls. Validated mutational analyses revealed that AmpliSeq was effective in profiling gene mutations, and that the method correctly pinpointed "true-positive" gene mutations with variant frequency >5% and demonstrated high-level molecular heterogeneity in CRC. However, AmpliSeq enrichment and NGS also produced several recurrent "false-positive" calls in clinically druggable oncogenes such as PIK3CA. AmpliSeq provided highly sensitive and quantitative mutation detection for most of the genes on its cancer panel using limited DNA quantities from formalin-fixed, paraffin-embedded samples. For those genes with recurrent "false-positive" variant calls, caution should be used in data interpretation, and orthogonal verification of mutations is recommended for clinical decision making.
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Satellite DNA-based artificial chromosomes for use in gene therapy.
Hadlaczky, G
2001-04-01
Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.
HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.
Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar
2017-01-01
DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.
HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features
Directory of Open Access Journals (Sweden)
Rianon Zaman
2017-01-01
Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.
Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.
Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G
2015-06-17
In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.
Research Report Non-invasive DNA-based species and sex ...
Indian Academy of Sciences (India)
shrushti modi
Non-invasive DNA-based species and sex identification of Asiatic wild dog (Cuon alpinus) .... We did not find any cross-gender amplification with any of the reference or field-collected samples. Success rate for sex discrimination for all field-.
Developing a biological dosimeter based on mitochondrial DNA
Energy Technology Data Exchange (ETDEWEB)
Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)
1996-12-31
Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.
Developing a biological dosimeter based on mitochondrial DNA
International Nuclear Information System (INIS)
Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.
1995-01-01
Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Yamamoto, F; Yamamoto, M
2004-07-01
We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Capital adjustment cost and bias in income based dynamic panel models with fixed effects
Yoseph Yilma Getachew; Keshab Bhattarai; Parantap Basu
2012-01-01
The fixed effects (FE) estimator of "conditional convergence" in income based dynamic panel models could be biased downward when capital adjustment cost is present. Such a capital adjustment cost means a rising marginal cost of investment which could slow down the convergence. The standard FE regression fails to take into account of this capital adjustment cost and thus it could overestimate the rate of convergence. Using a Ramsey model with long-run adjustment cost of capital, we characteriz...
Paz, Andrea; Crawford, Andrew J
2012-11-01
Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.
Floating-to-Fixed-Point Conversion for Digital Signal Processors
Directory of Open Access Journals (Sweden)
Menard Daniel
2006-01-01
Full Text Available Digital signal processing applications are specified with floating-point data types but they are usually implemented in embedded systems with fixed-point arithmetic to minimise cost and power consumption. Thus, methodologies which establish automatically the fixed-point specification are required to reduce the application time-to-market. In this paper, a new methodology for the floating-to-fixed point conversion is proposed for software implementations. The aim of our approach is to determine the fixed-point specification which minimises the code execution time for a given accuracy constraint. Compared to previous methodologies, our approach takes into account the DSP architecture to optimise the fixed-point formats and the floating-to-fixed-point conversion process is coupled with the code generation process. The fixed-point data types and the position of the scaling operations are optimised to reduce the code execution time. To evaluate the fixed-point computation accuracy, an analytical approach is used to reduce the optimisation time compared to the existing methods based on simulation. The methodology stages are described and several experiment results are presented to underline the efficiency of this approach.
Floating-to-Fixed-Point Conversion for Digital Signal Processors
Menard, Daniel; Chillet, Daniel; Sentieys, Olivier
2006-12-01
Digital signal processing applications are specified with floating-point data types but they are usually implemented in embedded systems with fixed-point arithmetic to minimise cost and power consumption. Thus, methodologies which establish automatically the fixed-point specification are required to reduce the application time-to-market. In this paper, a new methodology for the floating-to-fixed point conversion is proposed for software implementations. The aim of our approach is to determine the fixed-point specification which minimises the code execution time for a given accuracy constraint. Compared to previous methodologies, our approach takes into account the DSP architecture to optimise the fixed-point formats and the floating-to-fixed-point conversion process is coupled with the code generation process. The fixed-point data types and the position of the scaling operations are optimised to reduce the code execution time. To evaluate the fixed-point computation accuracy, an analytical approach is used to reduce the optimisation time compared to the existing methods based on simulation. The methodology stages are described and several experiment results are presented to underline the efficiency of this approach.
Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T
2010-05-01
This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor
International Nuclear Information System (INIS)
Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre
2006-01-01
In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable
Directory of Open Access Journals (Sweden)
Elena K Braithwaite
2010-08-01
Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.
PDF fit in the fixed-flavour-number scheme
Energy Technology Data Exchange (ETDEWEB)
Alekhin, S. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Institute for High Energy Physics, Moscow (Russian Federation); Bluemlein, J.; Moch, S. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)
2012-02-15
We discuss the heavy-quark contribution to deep inelastic scattering in the scheme with n{sub f}=3;4;5 fixed flavors. Based on the recent ABM11 PDF analysis of world data for deep-inelastic scattering and fixed-target data for the Drell-Yan process with the running-mass definition for heavy quarks we show that fixed flavor number scheme is sufficient for describing the deep-inelastic-scattering data in the entire kinematic range. We compare with other PDF sets and comment on the implications for measuring the strong coupling constant {alpha}{sub s}(M{sub Z}).
ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.
Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia
2017-12-01
Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.
Ionically conducting Er3+-doped DNA-based biomembranes for electrochromic devices
International Nuclear Information System (INIS)
Leones, R.; Fernandes, M.; Sentanin, F.; Cesarino, I.; Lima, J.F.; Zea Bermudez, V. de; Pawlicka, A.; Magon, C.J.; Donoso, J.P.; Silva, M.M.
2014-01-01
Biopolymer-based membranes have particular interest due to their biocompatibility, Biodegradability, easy extraction from natural resources and low cost. The incorporation of Er 3+ ions into natural macromolecule hosts with the purpose of producing highly efficient emitting phosphors is of widespread interest in materials science, due to their important roles in display devices. Thus, biomembranes may be viewed as innovative materials for the area of optics. This paper describes studies of luminescent material DNA-based membranes doped with erbium triflate and demonstrates that their potential technological applications may be expanded to electrochromic devices. The sample that exhibits the highest ionic conductivity is DNA 10 Er, (1.17 × 10 −5 and 7.76 × 10 −4 S.cm −1 at 30 and 100 °C, respectively). DSC, XRD and POM showed that the inclusion of the guest salt into DNA does not change significantly its amorphous nature. The overall redox stability was ca. 2.0 V indicating that these materials have an acceptable stability window for applications in solid state electrochemical devices. The EPR analysis suggested that the Er 3+ ions are distributed in various environments. A small ECD comprising a Er 3+ -doped DNA-based membrane was assembled and tested by cyclic voltammetry and chronoamperometry. These electrochemical analyses revealed a pale blue color to transparent color change and a decrease of the charge density from -4.0 to -1.2 mC.cm −2 during 4000 color/bleaching cycles
Towards DNA-Based Programmable Matter
2012-02-28
thiolated ssDNA was first immobilized onto the gold...surface. The surface was then passivated with mercaptohexanol. Subsequently, another complementary thiolated ...right). Approach 3: DNA-‐mediated interaction between polymer -‐coated surfaces We also tried
DNA based methods used for characterization and detection of food ...
African Journals Online (AJOL)
Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...
Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.
Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan
2017-09-26
Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.
DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions
Megens, Rik P.; Roelfes, Gerard
2012-01-01
Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as
Directory of Open Access Journals (Sweden)
Xingcan Qian
2018-06-01
Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.
SiPM as miniaturised optical biosensor for DNA-microarray applications
Directory of Open Access Journals (Sweden)
M.F. Santangelo
2015-12-01
Full Text Available A miniaturized optical biosensor for low-level fluorescence emitted by DNA strands labelled with CY5 is showed. Aim of this work is to demonstrate that a Si-based photodetector, having a low noise and a high sensitivity, can replace traditional detection systems in DNA-microarray applications. The photodetector used is a photomultiplier (SiPM, with 25 pixels. It exhibits a higher sensitivity than commercial optical readers and we experimentally found a detection limit for spotted dried samples of ∼1 nM. We measured the fluorescence signal in different operating conditions (angle of analysis, fluorophores concentrations, solution volumes and support. Once fixed the angle of analysis, for samples spotted on Al-TEOS slide dried, the system is proportional to the concentration of the analyte in the sample and is linear in the range 1 nM–1 μM. For solutions, the range of linearity ranges from 100 fM to 10 nM. The system potentialities and the device low costs suggest it as basic component for the design and fabrication of a cheap, easy and portable optical system. Keywords: Optical Biosensor, SiPM, DNA microarray, Fluorophore detection
Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert
2016-07-01
The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Javier Abellón-Ruiz
2016-01-01
Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.
High-Throughput Array Instrument for DNA-Based Breast Cancer Diagnostics
National Research Council Canada - National Science Library
Swerdlow, Harold
2000-01-01
...) for breast-cancer diagnostics. These methods are based upon large numbers of discrete DNA spots placed on glass microscope slides typically, and hybridized to a probe derived from a tIssue or blood sample...
Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.
Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D
2004-11-01
Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.
Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N
2018-02-12
Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Irina D. Demina
2017-01-01
Full Text Available It is indicated that domestic economy is experiencing a shortage of investment.The acceleration of the processes of import substitution is one of the most important challenges facing the domestic economy at present.Investments, especially capital investments and related investment relations constitute the basis for the development of the national economy and improving the efficiency of social production as a whole. A problem of formation of the amortization fundremains actual at the moment. In the modern scientific and educational literature amortization fund means the fund, including the use of funds to complete the restoration and repair of the fixed assets. This paper makesthe analysis of the situation in the area of investment in the fixed capital, which has developed in Russia for the past severalyears. The aim of this paper is to study the investment climate in the country based on the analysis of investments in the fixed capital by the sources of financing and types of the economic activity. The work is based on dynamic and structural analysis of analytical and statistical information on the processes occurring in this field.As a result, it can be noted that in spite of a number of efforts being made, in general, there are low growth rates in industry, there is a deficit of investments in the fixed assets. Most of the investments in fixed assets are carried out at the expense of the organizations’ own funds. A significant number of economic entities do not have the means, necessary for the technological renewal. Unfortunately, the regulatory framework in the field of accounting for the fixed assets and accrual of depreciation does not imply the use of a special account for the accumulation, and, most importantly, for the purposeful control of the use of the depreciation fund.First of all, it is necessary for companies with state participation and monopoly organizations. The lack of control over the targeted use of the depreciation fund
Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.
El-Diasty, Fouad; Abdel-Wahab, Fathy
2015-10-01
The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.
Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng
2018-06-29
The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies
International Nuclear Information System (INIS)
Shamim, S.; Murtaza, S.; Nazar, M.F.
2016-01-01
A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng
2010-09-01
The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
Revisiting the dilatation operator of the Wilson-Fisher fixed point
Energy Technology Data Exchange (ETDEWEB)
Liendo, Pedro [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Theory Group
2017-01-15
We revisit the order ε dilatation operator of the Wilson-Fisher fixed point obtained by Kehrein, Pismak, and Wegner in light of recent results in conformal field theory. Our approach is algebraic and based only on symmetry principles. The starting point of our analysis is that the first correction to the dilatation operator is a conformal invariant, which implies that its form is fixed up to an infinite set of coefficients associated with the scaling dimensions of higher-spin currents. These coefficients can be fixed using well-known perturbative results, however, they were recently re-obtained using CFT arguments without relying on perturbation theory. Our analysis then implies that all order-ε scaling dimensions of the Wilson-Fisher fixed point can be fixed by symmetry.
International Nuclear Information System (INIS)
Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong
2010-01-01
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.
Energy Technology Data Exchange (ETDEWEB)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong
2010-05-17
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.
[Motion control of moving mirror based on fixed-mirror adjustment in FTIR spectrometer].
Li, Zhong-bing; Xu, Xian-ze; Le, Yi; Xu, Feng-qiu; Li, Jun-wei
2012-08-01
The performance of the uniform motion of the moving mirror, which is the only constant motion part in FTIR spectrometer, and the performance of the alignment of the fixed mirror play a key role in FTIR spectrometer, and affect the interference effect and the quality of the spectrogram and may restrict the precision and resolution of the instrument directly. The present article focuses on the research on the uniform motion of the moving mirror and the alignment of the fixed mirror. In order to improve the FTIR spectrometer, the maglev support system was designed for the moving mirror and the phase detection technology was adopted to adjust the tilt angle between the moving mirror and the fixed mirror. This paper also introduces an improved fuzzy PID control algorithm to get the accurate speed of the moving mirror and realize the control strategy from both hardware design and algorithm. The results show that the development of the moving mirror motion control system gets sufficient accuracy and real-time, which can ensure the uniform motion of the moving mirror and the alignment of the fixed mirror.
Energy Technology Data Exchange (ETDEWEB)
Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)
2017-02-01
We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.
Cloud-based adaptive exon prediction for DNA analysis.
Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen
2018-02-01
Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.
Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe
He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing
2011-11-01
The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.
Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe
2018-05-01
This study presents the correlation between energy deposition and clustered DNA damage, based on a Monte Carlo simulation of the spectrum of direct DNA damage induced by low-energy electrons including the dissociative electron attachment. Clustered DNA damage is classified as simple and complex in terms of the combination of single-strand breaks (SSBs) or double-strand breaks (DSBs) and adjacent base damage (BD). The results show that the energy depositions associated with about 90% of total clustered DNA damage are below 150 eV. The simple clustered DNA damage, which is constituted of the combination of SSBs and adjacent BD, is dominant, accounting for 90% of all clustered DNA damage, and the spectra of the energy depositions correlating with them are similar for different primary energies. One type of simple clustered DNA damage is the combination of a SSB and 1-5 BD, which is denoted as SSB + BD. The average contribution of SSB + BD to total simple clustered DNA damage reaches up to about 84% for the considered primary energies. In all forms of SSB + BD, the SSB + BD including only one base damage is dominant (above 80%). In addition, for the considered primary energies, there is no obvious difference between the average energy depositions for a fixed complexity of SSB + BD determined by the number of base damage, but average energy depositions increase with the complexity of SSB + BD. In the complex clustered DNA damage constituted by the combination of DSBs and BD around them, a relatively simple type is a DSB combining adjacent BD, marked as DSB + BD, and it is of substantial contribution (on average up to about 82%). The spectrum of DSB + BD is given mainly by the DSB in combination with different numbers of base damage, from 1 to 5. For the considered primary energies, the DSB combined with only one base damage contributes about 83% of total DSB + BD, and the average energy deposition is about 106 eV. However, the
Directory of Open Access Journals (Sweden)
Diego Javier Jiménez
2011-09-01
Full Text Available With the purpose of isolating and characterizing free nitrogen fixing bacteria (FNFB of the genus Azotobacter, soil samples were collected randomly from different vegetable organic cultures with neutral pH in different zones of Boyacá-Colombia. Isolations were done in selective free nitrogen Ashby-Sucrose agar obtaining a recovery of 40%. Twenty four isolates were evaluated for colony and cellular morphology, pigment production and metabolic activities. Molecular characterization was carried out using amplified ribosomal DNA restriction analysis (ARDRA. After digestion of 16S rDNA Y1-Y3 PCR products (1487pb with AluI, HpaII and RsaI endonucleases, a polymorphism of 16% was obtained. Cluster analysis showed three main groups based on DNA fingerprints. Comparison between ribotypes generated by isolates and in silico restriction of 16S rDNA partial sequences with same restriction enzymes was done with Gen Workbench v.2.2.4 software. Nevertheless, Y1-Y2 PCR products were analysed using BLASTn. Isolate C5T from tomato (Lycopersicon esculentum grown soils presented the same in silico restriction patterns with A. chroococcum (AY353708 and 99% of similarity with the same sequence. Isolate C5CO from cauliflower (Brassica oleracea var. botrytis grown soils showed black pigmentation in Ashby-Benzoate agar and high similarity (91% with A. nigricans (AB175651 sequence. In this work we demonstrated the utility of molecular techniques and bioinformatics tools as a support to conventional techniques in characterization of the genus Azotobacter from vegetable-grown soils.
Detection of anthrax lef with DNA-based photonic crystal sensors
Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong
2011-12-01
Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or inv...
Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali
2018-02-01
Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.
DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA
DEFF Research Database (Denmark)
Christensen, H.; Angen, Øystein; Mutters, R.
2000-01-01
The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...
Energy Technology Data Exchange (ETDEWEB)
Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)
2017-03-08
DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.
Thornberg, Michelle J; Riolo, Christopher S; Bayirli, Burcu; Riolo, Michael L; Van Tubergen, Elizabeth A; Kulbersh, Richard
2009-01-01
This purpose of this study was to document and investigate changes in periodontal pathogen levels before, during, and after orthodontic treatment in adolescents. DNA gene probe analysis was used to quantify the levels of 8 periodontal pathogens before, during, and after treatment with fixed orthodontic appliances in 190 concurrently treated adolescent orthodontic patients. The 8 pathogens examined were Actinobacillus actinomycetemcomitans (AA), Porphyromonas gingivalis (PG), Prevotella intermedia (PI), Tannerella forsythia (TF), Eikenella corrodens (EC), Fusobacterium nucleatum (FN), Treponema denticola (TD), and Campylobacter rectus (CR). Chi-square tests were used to determine whether the percentages of subjects with high counts significantly changed over time. Logistic regression analyses were also performed to derive the relative risk of higher counts of pathogenic bacteria with fixed appliances at the various time intervals studied. For 6 (PI, TF, EC, FN, TD, CR) of the 8 pathogens, the percentages of subjects with high pathogen counts increased significantly after 6 months of fixed appliance treatment, but these returned to pretreatment levels by 12 months of orthodontic treatment. No pathogen level was significantly higher after 12 months of orthodontic treatment, and orthodontic treatment was found to be significantly protective for half of the pathogens (EC, FN, TD, CR) posttreatment. Orthodontic treatment with fixed appliances does not increase the risk of high levels of these periodontal pathogens.
Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor
Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh
2017-09-01
The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.
Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.
Xiao, Lu; Xiang, Yu
2016-06-01
The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dihydropyridines decrease X-ray-induced DNA base damage in mammalian cells
Energy Technology Data Exchange (ETDEWEB)
Wojewodzka, M., E-mail: marylaw@ichtj.waw.pl [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Gradzka, I.; Buraczewska, I.; Brzoska, K.; Sochanowicz, B. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Goncharova, R.; Kuzhir, T. [Institute of Genetics and Cytology, Belarussian National Academy of Sciences, Minsk (Belarus); Szumiel, I. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland)
2009-12-01
Compounds with the structural motif of 1,4-dihydropyridine display a broad spectrum of biological activities, often defined as bioprotective. Among them are L-type calcium channel blockers, however, also derivatives which do not block calcium channels exert various effects at the cellular and organismal levels. We examined the effect of sodium 3,5-bis-ethoxycarbonyl-2,6-dimethyl-1,4-dihydropyridine-4-carboxylate (denoted here as DHP and previously also as AV-153) on X-ray-induced DNA damage and mutation frequency at the HGPRT (hypoxanthine-guanine phosphoribosyl transferase) locus in Chinese hamster ovary CHO-K1 cells. Using formamido-pyrimidine glycosylase (FPG) comet assay, we found that 1-h DHP (10 nM) treatment before X-irradiation considerably reduced the initial level of FPG-recognized DNA base damage, which was consistent with decreased 8-oxo-7,8-dihydro-2'-deoxyguanosine content and mutation frequency lowered by about 40%. No effect on single strand break rejoining or on cell survival was observed. Similar base damage-protective effect was observed for two calcium channel blockers: nifedipine (structurally similar to DHP) or verapamil (structurally unrelated). So far, the specificity of the DHP-caused reduction in DNA damage - practically limited to base damage - has no satisfactory explanation.
Directory of Open Access Journals (Sweden)
Marx Kenneth A
2006-03-01
Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also
Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z
2017-03-14
Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.
Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar
2010-06-04
The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.
A magnetic bead-based method for concentrating DNA from human urine for downstream detection.
Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R
2013-01-01
Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.
Moens, Lotte N J; Falk-Sörqvist, Elin; Ljungström, Viktor; Mattsson, Johanna; Sundström, Magnus; La Fleur, Linnéa; Mathot, Lucy; Micke, Patrick; Nilsson, Mats; Botling, Johan
2015-11-01
In recent years, the advent of massively parallel next-generation sequencing technologies has enabled substantial advances in the study of human diseases. Combined with targeted DNA enrichment methods, high sequence coverage can be obtained for different genes simultaneously at a reduced cost per sample, creating unique opportunities for clinical cancer diagnostics. However, the formalin-fixed, paraffin-embedded (FFPE) process of tissue samples, routinely used in pathology departments, results in DNA fragmentation and nucleotide modifications that introduce a number of technical challenges for downstream biomolecular analyses. We evaluated the HaloPlex target enrichment system for somatic mutation detection in 80 tissue fractions derived from 20 clinical cancer cases with paired tumor and normal tissue available in both FFPE and fresh-frozen format. Several modifications to the standard method were introduced, including a reduced target fragment length and two strand capturing. We found that FFPE material can be used for HaloPlex-based target enrichment and next-generation sequencing, even when starting from small amounts of DNA. By specifically capturing both strands for each target fragment, we were able to reduce the number of false-positive errors caused by FFPE-induced artifacts and lower the detection limit for somatic mutations. We believe that the HaloPlex method presented here will be broadly applicable as a tool for somatic mutation detection in clinical cancer settings. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Route Optimization for Offloading Congested Meter Fixes
Xue, Min; Zelinski, Shannon
2016-01-01
The Optimized Route Capability (ORC) concept proposed by the FAA facilitates traffic managers to identify and resolve arrival flight delays caused by bottlenecks formed at arrival meter fixes when there exists imbalance between arrival fixes and runways. ORC makes use of the prediction capability of existing automation tools, monitors the traffic delays based on these predictions, and searches the best reroutes upstream of the meter fixes based on the predictions and estimated arrival schedules when delays are over a predefined threshold. Initial implementation and evaluation of the ORC concept considered only reroutes available at the time arrival congestion was first predicted. This work extends previous work by introducing an additional dimension in reroute options such that ORC can find the best time to reroute and overcome the 'firstcome- first-reroute' phenomenon. To deal with the enlarged reroute solution space, a genetic algorithm was developed to solve this problem. Experiments were conducted using the same traffic scenario used in previous work, when an arrival rush was created for one of the four arrival meter fixes at George Bush Intercontinental Houston Airport. Results showed the new approach further improved delay savings. The suggested route changes from the new approach were on average 30 minutes later than those using other approaches, and fewer numbers of reroutes were required. Fewer numbers of reroutes reduce operational complexity and later reroutes help decision makers deal with uncertain situations.
International Nuclear Information System (INIS)
Dizdaroglu, M.
1985-01-01
The application of capillary gas chromatography-mass spectrometry (GC-MS) to the chemical characterization of radiation-induced base products of calf thymus DNA is presented. Samples of calf thymus DNA irradiated in N 2 O-saturated aqueous solution were hydrolyzed with HCOOH, trimethylsilylated, and subjected to GC-MS analysis using a fused-silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC properties and easily interpretable mass spectra; an intense molecular ion (M+.) and a characteristic (M-CH 3 )+ ion were observed. The complementary use of t-butyldimethylsilyl derivatives was also demonstrated. These derivatives provided an intense characteristic (M-57)+ ion, which appeared as either the base peak or the second most intense ion in the spectra. All mass spectra obtained are discussed
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
IR fixed points in SU(3 gauge theories
Directory of Open Access Journals (Sweden)
K.-I. Ishikawa
2015-09-01
Full Text Available We propose a novel RG method to specify the location of the IR fixed point in lattice gauge theories and apply it to the SU(3 gauge theories with Nf fundamental fermions. It is based on the scaling behavior of the propagator through the RG analysis with a finite IR cutoff, which we cannot remove in the conformal field theories in sharp contrast to the confining theories. The method also enables us to estimate the anomalous mass dimension in the continuum limit at the IR fixed point. We perform the program for Nf=16,12,8 and Nf=7 and indeed identify the location of the IR fixed points in all cases.
DEFF Research Database (Denmark)
Jensen, P O; Larsen, J K; Christensen, I J
1994-01-01
Bromodeoxyuridine (BrdUrd) labelled and unlabelled mitotic cells, respectively, can be discriminated from interphase cells using a new method, based on immunocytochemical staining of BrdUrd and flow cytometric four-parameter analysis of DNA content, BrdUrd incorporation, and forward and orthogonal...... light scatter. The method was optimized using the human leukemia cell lines HL-60 and K-562. Samples of 10(5) ethanol-fixed cells were treated with pepsin/HCl and stained as a nuclear suspension with anti-BrdUrd antibody, FITC-conjugated secondary antibody, and propidium iodide. Labelled mitoses could...
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
International Nuclear Information System (INIS)
Guo, Yuanyuan; Su, Shao; Wei, Xinpan; Zhong, Yiling; Su, Yuanyuan; He, Yao; Huang, Qing; Fan, Chunhai
2013-01-01
We herein present a new kind of silicon-based electrochemical sensor using a gold nanoparticles-decorated silicon wafer (AuNPs@Si) as a high-performance electrode, which is facilely prepared via in situ AuNPs growth on a silicon wafer. Particularly significantly, the resultant electrochemical sensor is efficacious for label-free DNA detection with high sensitivity due to the unique merits of the prepared silicon-based electrode. Typically, DNA at remarkably low concentrations (1–10 fM) could be readily detected without requiring additional signal-amplification procedures, which is better than or comparable to the lowest DNA concentration ever detected via well-studied signal-amplification-assisted electrochemical sensors. Moreover, the silicon-based sensor features high specificity, allowing unambiguous discrimination of single-based mismatches. We further show that real-time DNA assembly is readily monitored via recording the intensity changes of current signals due to the robust thermal stability of the silicon-based electrode. The unprecedented advantages of the silicon-based electrochemical sensor would offer new opportunities for myriad sensing applications. (paper)
DNA-specific labelling by deoxyribonucleoside 5'-monophosphates in Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Brendel, M.; Faeth, W.W.; Toper, R.
1975-01-01
Growth of 5'-dTMP low-requiring strains is inhibited by exogenous 5'-dGMP and 5'-GMP at concentrations higher than 5 x 10 -4 M. Synthesis of nucleic acids ceases and cells remain fixed in their respective place in the cell cycle. At concentrations lower than 10 -5 M deoxyribonucleoside 5'-monophosphates may be employed for radioactive labelling, the label being preferentially used for DNA synthesis. Affinity to DNA of the 5'-dNMPs is in the order of 5'-dAMPS > 5'-dGMP > 5'-dCMP > 5'-dUMP. DNA-specific label is achieved with 5'-dAMP when the medium is supplemented with adenine and deoxyadenosine. (orig.) [de
Analyzing and Predicting Effort Associated with Finding and Fixing Software Faults
Hamill, Maggie; Goseva-Popstojanova, Katerina
2016-01-01
Context: Software developers spend a significant amount of time fixing faults. However, not many papers have addressed the actual effort needed to fix software faults. Objective: The objective of this paper is twofold: (1) analysis of the effort needed to fix software faults and how it was affected by several factors and (2) prediction of the level of fix implementation effort based on the information provided in software change requests. Method: The work is based on data related to 1200 failures, extracted from the change tracking system of a large NASA mission. The analysis includes descriptive and inferential statistics. Predictions are made using three supervised machine learning algorithms and three sampling techniques aimed at addressing the imbalanced data problem. Results: Our results show that (1) 83% of the total fix implementation effort was associated with only 20% of failures. (2) Both safety critical failures and post-release failures required three times more effort to fix compared to non-critical and pre-release counterparts, respectively. (3) Failures with fixes spread across multiple components or across multiple types of software artifacts required more effort. The spread across artifacts was more costly than spread across components. (4) Surprisingly, some types of faults associated with later life-cycle activities did not require significant effort. (5) The level of fix implementation effort was predicted with 73% overall accuracy using the original, imbalanced data. Using oversampling techniques improved the overall accuracy up to 77%. More importantly, oversampling significantly improved the prediction of the high level effort, from 31% to around 85%. Conclusions: This paper shows the importance of tying software failures to changes made to fix all associated faults, in one or more software components and/or in one or more software artifacts, and the benefit of studying how the spread of faults and other factors affect the fix implementation
Energy Technology Data Exchange (ETDEWEB)
Kumaravel, Ganesan; Raman, Natarajan, E-mail: ramchem1964@gmail.com
2017-01-01
Two novel imidazole derived Schiff bases, (Z)-1-(1H-benzo[d]imidazol-2-yl)-N-benzylidenemethanamine (L{sup 1}) and 1-(1H-benzo[d]imidazol-2-yl)-N-(4-nitrobenzylidene) methanamine, and a series of their transition metal complexes of the types [M(L{sup 1}){sub 2}]Cl{sub 2} and [M(L{sup 2}){sub 2}]Cl{sub 2} where, M = Cu(II), Ni(II), Co(II) and Zn(II) have been designed and synthesized. These compounds were characterized by various spectral and physicochemical data. UV–Vis, magnetic susceptibility and molar conductivity data indicate that all the complexes adopt square planar geometry. The EPR spectral data of the Cu(II) complexes have provided supportive evidence to the conclusion derived on the basis of electronic absorption and magnetic moment values. Moreover, the interaction of complexes with DNA via intercalation has been explored by absorption, fluorescence spectroscopy, cyclic voltammetry, viscosity and circular dichroism. Agarose gel electrophoresis technique reveals that the complexes are good metallonucleases. All the compounds have relatively high antibacterial and antifungal potencies. Among the metal complexes, Cu(II) complexes exhibit higher efficacy against all the pathogens. - Highlights: • Synthesis of new and efficient benzimidazole based DNA targeting complexes • Synthesis of efficient metallointercalators • Excellent DNA exploiting ability of Cu(II) complexes • Efficient antimicrobial agents against various pathogens.
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A
2016-06-21
In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
DEFF Research Database (Denmark)
Sun, Yi; Phuoc Long, Truong; Wolff, Anders
2016-01-01
Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...
Directory of Open Access Journals (Sweden)
Sanjo Zlobec
2017-04-01
Full Text Available A set of sufficient conditions which guarantee the existence of a point x⋆ such that f(x⋆ = x⋆ is called a "fixed point theorem". Many such theorems are named after well-known mathematicians and economists. Fixed point theorems are among most useful ones in applied mathematics, especially in economics and game theory. Particularly important theorem in these areas is Kakutani's fixed point theorem which ensures existence of fixed point for point-to-set mappings, e.g., [2, 3, 4]. John Nash developed and applied Kakutani's ideas to prove the existence of (what became known as "Nash equilibrium" for finite games with mixed strategies for any number of players. This work earned him a Nobel Prize in Economics that he shared with two mathematicians. Nash's life was dramatized in the movie "Beautiful Mind" in 2001. In this paper, we approach the system f(x = x differently. Instead of studying existence of its solutions our objective is to determine conditions which are both necessary and sufficient that an arbitrary point x⋆ is a fixed point, i.e., that it satisfies f(x⋆ = x⋆. The existence of solutions for continuous function f of the single variable is easy to establish using the Intermediate Value Theorem of Calculus. However, characterizing fixed points x⋆, i.e., providing answers to the question of finding both necessary and sufficient conditions for an arbitrary given x⋆ to satisfy f(x⋆ = x⋆, is not simple even for functions of the single variable. It is possible that constructive answers do not exist. Our objective is to find them. Our work may require some less familiar tools. One of these might be the "quadratic envelope characterization of zero-derivative point" recalled in the next section. The results are taken from the author's current research project "Studying the Essence of Fixed Points". They are believed to be original. The author has received several feedbacks on the preliminary report and on parts of the project
Report of the Fixed-Target Proton-Accelerator Group
International Nuclear Information System (INIS)
Abe, K.; Bunce, G.; Fisk, G.
1982-01-01
The fixed target proton accelerator group divided itself into two roughly equal parts. One sub-group concentrated on a high intensity (10 14 protons/sec) moderate energy (30 GeV) machine while the other worked on a moderate intensity (5 x 10 11 protons/sec) very high energy (20 TeV) machine. For experiments where the total available energy is adequate, the fixed target option added to a anti p p 20 TeV collider ring has several attractive features: (1) high luminosity afforded by intense beams striking thick solid targets; (2) secondary beams of hadrons, photons, and leptons; and (3) the versatility of a fixed target facility, where many experiments can be performed independently. The proposed experiments considered by the subgroup, including neutrino, photon, hadron, and very short lived particle beams were based both on scaled up versions of similar experiments proposed for Tevatron II at Fermilab and on the 400 GeV fixed target programs at Fermilab and CERN
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Fixed Base Modal Testing Using the NASA GRC Mechanical Vibration Facility
Staab, Lucas D.; Winkel, James P.; Suarez, Vicente J.; Jones, Trevor M.; Napolitano, Kevin L.
2016-01-01
The Space Power Facility at NASA's Plum Brook Station houses the world's largest and most powerful space environment simulation facilities, including the Mechanical Vibration Facility (MVF), which offers the world's highest-capacity multi-axis spacecraft shaker system. The MVF was designed to perform sine vibration testing of a Crew Exploration Vehicle (CEV)-class spacecraft with a total mass of 75,000 pounds, center of gravity (cg) height above the table of 284 inches, diameter of 18 feet, and capability of 1.25 gravity units peak acceleration in the vertical and 1.0 gravity units peak acceleration in the lateral directions. The MVF is a six-degree-of-freedom, servo-hydraulic, sinusoidal base-shake vibration system that has the advantage of being able to perform single-axis sine vibration testing of large structures in the vertical and two lateral axes without the need to reconfigure the test article for each axis. This paper discusses efforts to extend the MVF's capabilities so that it can also be used to determine fixed base modes of its test article without the need for an expensive test-correlated facility simulation.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
Electrochemical DNA biosensor based on the BDD nanograss array electrode.
Jin, Huali; Wei, Min; Wang, Jinshui
2013-04-10
The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.
DNA barcode goes two-dimensions: DNA QR code web server.
Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin
2012-01-01
The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.
DNA barcode goes two-dimensions: DNA QR code web server.
Directory of Open Access Journals (Sweden)
Chang Liu
Full Text Available The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.
Intelligent DNA-based molecular diagnostics using linked genetic markers
Energy Technology Data Exchange (ETDEWEB)
Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.
1994-12-31
This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.
Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna
2017-08-01
Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.
Profiling the miRNAs for Early Cancer Detection using DNA-based Logic Gates
Directory of Open Access Journals (Sweden)
Tahereh Yahya
2017-12-01
Full Text Available Abstract Background: DNA-based computing is an emerging research aspect that enables the in-vivo computation and decision making with significant correctness. Recent papers show that the expression level of miRNAs are related to the progress status of some diseases such as cancers and DNA computing is introduced as a low cost and concise technique for detection of these biomarkers. In this paper, DNA-based logic gates are implemented in the laboratory to detect the level of miR-21 as the biomarker of cancer. Materials and Methods: At the first, required strands for designing DNA gates are synthesized. Then, double stranded gate is generated in laboratory using a temperature gradient that followed by electrophoresis process. This double strand is the computation engine for detecting the miR-21 biomarker. miR-21 is as input in designed gate. At the end, the expression level of miR-21 is identified by measuring the generated fluorescent. Results: at the first stage, the proposed DNA-based logic gate is evaluated by using the synthesized input strands and then it is experimented on a tumor tissue. Experimental results on synthesized strands show that its detection quality/correctness is 2.5x better than conventional methods. Conclusion: Experimental results on the tumor tissues are successful and are matched with those are extracted from real time PCR results. Also, the results show that this method is significantly more suitable than real time PCR in view of time and cost.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young
2018-09-15
Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Qiling Li
Full Text Available The use of DNA from archival formalin and paraffin embedded (FFPE tissue for genetic and epigenetic analyses may be problematic, since the DNA is often degraded and only limited amounts may be available. Thus, it is currently not known whether genome-wide methylation can be reliably assessed in DNA from archival FFPE tissue.Ovarian tissues, which were obtained and formalin-fixed and paraffin-embedded in either 1999 or 2011, were sectioned and stained with hematoxylin-eosin (H&E.Epithelial cells were captured by laser micro dissection, and their DNA subjected to whole genomic bisulfite conversion, whole genomic polymerase chain reaction (PCR amplification, and purification. Sequencing and software analyses were performed to identify the extent of genomic methylation. We observed that 31.7% of sequence reads from the DNA in the 1999 archival FFPE tissue, and 70.6% of the reads from the 2011 sample, could be matched with the genome. Methylation rates of CpG on the Watson and Crick strands were 32.2% and 45.5%, respectively, in the 1999 sample, and 65.1% and 42.7% in the 2011 sample.We have developed an efficient method that allows DNA methylation to be assessed in archival FFPE tissue samples.
DNA methylation-based variation between human populations.
Kader, Farzeen; Ghai, Meenu
2017-02-01
Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.
SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.
Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra
2016-03-01
Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.
Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai
2009-01-01
SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241
Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N
2004-07-16
A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.
Schonhoft, Joseph D; Stivers, James T
2013-04-16
Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Koepsell, Scott A.; Hinrichs, Steven H.
2012-01-01
A real-time PCR assay to detect Histoplasma capsulatum in formalin-fixed, paraffin-embedded (FFPE) tissue is described. The assay had an analytical sensitivity of 6 pg/μl of fungal DNA, analytical specificity of 100%, and clinical sensitivity of 88.9%. This proof-of-concept study may aid in the diagnosis of histoplasmosis from FFPE tissue. PMID:22855519
International Nuclear Information System (INIS)
Schrempp, B.
1994-10-01
The two loop 'top-down' renormalization group flow for the top, bottom and tau Yukawa couplings, from μ=M GUT ≅O(10 16 GeV) to μ≅m t , is explored in the framework of supersymmetric grand unification; reproduction of the physical bottom and tau masses is required. Instead of following the recent trend of implementing exact Yukawa coupling unification i) a search for infrared (IR) fixed lines and fixed points in the m t pole -tan β plane is performed and ii) the extent to which these imply approximate Yukawa unification is determined. In the m t pole -tan β plane two IR fixed lines, intersecting in an IR fixed point, are located. The more attractive fixed line has a branch of almost constant top mass, m t pole ≅168≅180 GeV (close to the experimental value), for the large interval 2.5 GUT approximately. The less attractive fixed line as well as the fixed point at m t pole ≅170 GeV, tan β≅55 implement approximate top-bottom Yukawa unification at all scales μ. The renormalization group flow is attracted towards the IR fixed point by way of the more attractive IR fixed line. The fixed point and lines are distinct from the much quoted effective IR fixed point m t pole ≅O(200 GeV) sin β. (orig.)
International Nuclear Information System (INIS)
Ahmed, Towfiq; Haraldsen, Jason T; Balatsky, Alexander V; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan
2014-01-01
Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology. (paper)
Ahmed, Towfiq; Haraldsen, Jason T.; Rehr, John J.; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V.
2014-03-01
Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.
Determinants of private fixed investment in emerging country
Directory of Open Access Journals (Sweden)
Goitsemodimo Abel Molocwa
2018-03-01
Full Text Available The neoclassical and Keynesian theories regard private investment not only as a source of economic growth but also as a determinant of the potential extent of the national income. The aim of this research was to examine the determinants of private fixed investment in South Africa by employing the Johansen cointegration technique and the vector error correction model (VECM analysis. Based on the literature survey it appears that the previous studies mainly focused on private investment in manufacturing and infrastructure sectors therefore this is envisaged to add knowledge to a body of economics literature in this area by focusing more on private fixed investment and its determinants in South Africa. The study concludes that for the period under investigation GDP has the positive sign as expected. This suggests that in the long run it impact positively on private fixed investment. The findings of the study also confirmed that tax rate is a complementary to private fixed investment. Similarly, the real exchange rate coefficient was negative as expected which suggests that the depreciation of the currency stimulates the growth of South Africa private fixed investment. It is obvious that even the best economic model cannot achieve the expected outcomes immediately but these results encourage the study to believe that the South African monetary policy on exchange rate complements private fixed investment. Therefore, the study proposes that both even though both growth and general tax rate are difficult to accomplish simultaneously, they should be used to promote the flow of private fixed investment in South Africa.
El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.
2014-01-01
Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790
El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J
2014-12-01
Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.
Reshef, Ayeleth; Barash, Mark; Voskoboinik, Lev; Brauner, Paul; Gafny, Roni
2011-03-01
Sexual assault or rape cases occasionally result in unwanted pregnancies. In almost all such cases the foetus is aborted. A forensic laboratory may receive the foetus, the placenta, or paraffin embedded abortion material for paternity testing. Obtaining a foetal profile DNA from a foetus or placenta may not be successful due to the age or condition of the tissue. Moreover, maternal contamination of placental material will invariably result in a mixed DNA profile. However, the use of properly screened abortion material from paraffin blocks will almost always result in obtaining a foetal DNA profile. Furthermore, foetal tissue fixed in paraffin blocks does not require special conditions for submission and storage as required to preserve fresh foetal or placental tissue. As hospitals routinely prepare foetal tissue in paraffin blocks, which should be readily obtainable by forensic laboratories, these samples would appear to be the preferred choice for paternity testing. 2010 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.
Stretching chimeric DNA: A test for the putative S-form
Whitelam, Stephen; Pronk, Sander; Geissler, Phillip L.
2008-11-01
Double-stranded DNA "overstretches" at a pulling force of about 65 pN, increasing in length by a factor of 1.7. The nature of the overstretched state is unknown, despite its considerable importance for DNA's biological function and technological application. Overstretching is thought by some to be a force-induced denaturation and by others to consist of a transition to an elongated, hybridized state called S-DNA. Within a statistical mechanical model, we consider the effect upon overstretching of extreme sequence heterogeneity. "Chimeric" sequences possessing halves of markedly different AT composition elongate under fixed external conditions via distinct, spatially segregated transitions. The corresponding force-extension data vary with pulling rate in a manner that depends qualitatively and strikingly upon whether the hybridized S-form is accessible. This observation implies a test for S-DNA that could be performed in experiment.
Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization
International Nuclear Information System (INIS)
Liu, P.; Hun, X.; Qing, H.
2011-01-01
We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)
Development of swine-specific DNA markers for biosensor-based halal authentication.
Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B
2012-06-29
The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.
Solving probability reasoning based on DNA strand displacement and probability modules.
Zhang, Qiang; Wang, Xiaobiao; Wang, Xiaojun; Zhou, Changjun
2017-12-01
In computation biology, DNA strand displacement technology is used to simulate the computation process and has shown strong computing ability. Most researchers use it to solve logic problems, but it is only rarely used in probabilistic reasoning. To process probabilistic reasoning, a conditional probability derivation model and total probability model based on DNA strand displacement were established in this paper. The models were assessed through the game "read your mind." It has been shown to enable the application of probabilistic reasoning in genetic diagnosis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Construction of Fixed Rate Non-Binary WOM Codes Based on Integer Programming
Fujino, Yoju; Wadayama, Tadashi
In this paper, we propose a construction of non-binary WOM (Write-Once-Memory) codes for WOM storages such as flash memories. The WOM codes discussed in this paper are fixed rate WOM codes where messages in a fixed alphabet of size $M$ can be sequentially written in the WOM storage at least $t^*$-times. In this paper, a WOM storage is modeled by a state transition graph. The proposed construction has the following two features. First, it includes a systematic method to determine the encoding regions in the state transition graph. Second, the proposed construction includes a labeling method for states by using integer programming. Several novel WOM codes for $q$ level flash memories with 2 cells are constructed by the proposed construction. They achieve the worst numbers of writes $t^*$ that meet the known upper bound in many cases. In addition, we constructed fixed rate non-binary WOM codes with the capability to reduce ICI (inter cell interference) of flash cells. One of the advantages of the proposed construction is its flexibility. It can be applied to various storage devices, to various dimensions (i.e, number of cells), and various kind of additional constraints.
Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes
2012-01-01
Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.
Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc
2011-06-07
We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.
Schoppee Bortz, Pamela D.; Wamhoff, Brian R.
2011-01-01
The “quantitative” ChIP, a tool commonly used to study protein-DNA interactions in cells and tissue, is a difficult assay often plagued with technical error. We present, herein, the process required to merge multiple protocols into a quick, reliable and easy method and an approach to accurately quantify ChIP DNA prior to performing PCR. We demonstrate that high intensity sonication for at least 30 min is required for full cellular disruption and maximum DNA recovery because ChIP lysis buffers fail to lyse formaldehyde-fixed cells. In addition, extracting ChIP DNA with chelex-100 yields samples that are too dilute for evaluation of shearing efficiency or quantification via nanospectrophotometry. However, DNA extracted from the Mock-ChIP supernatant via the phenol-chloroform-isoamyl alcohol (PCIA) method can be used to evaluate DNA shearing efficiency and used as the standard in a fluorescence-based microplate assay. This enabled accurate quantification of DNA in chelex-extracted ChIP samples and normalization to total DNA concentration prior to performing real-time PCR (rtPCR). Thus, a quick ChIP assay that can be completed in nine bench hours over two days has been validated along with a rapid, accurate and repeatable way to quantify ChIP DNA. The resulting rtPCR data more accurately depicts treatment effects on protein-DNA interactions of interest. PMID:22046253
Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence
International Nuclear Information System (INIS)
Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai
2008-01-01
In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability
International Nuclear Information System (INIS)
Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong
2013-01-01
We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)
A magnetic bead-based method for concentrating DNA from human urine for downstream detection.
Directory of Open Access Journals (Sweden)
Hali Bordelon
Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.
Renaissance of the ~1 TeV Fixed-Target Program
Energy Technology Data Exchange (ETDEWEB)
Adams, T.; /Florida State U.; Appel, Jeffrey A.; /Fermilab; Arms, Kregg Elliott; /Minnesota U.; Balantekin, A.B.; /Wisconsin U., Madison; Conrad, Janet Marie; /MIT; Cooper, Peter S.; /Fermilab; Djurcic, Zelimir; /Columbia U.; Dunwoodie, William M.; /SLAC; Engelfried, Jurgen; /San Luis Potosi U.; Fisher, Peter H.; /MIT; Gottschalk, E.; /Fermilab /Northwestern U.
2009-05-01
This document describes the physics potential of a new fixed-target program based on a {approx} TeV proton source. Two proton sources are potentially available in the future: the existing Tevatron at Fermilab, which can provide 800 GeV protons for fixed-target physics, and a possible upgrade to the SPS at CERN, called SPS+, which would produce 1 TeV protons on target. In this paper we use an example Tevatron fixed-target program to illustrate the high discovery potential possible in the charm and neutrino sectors. We highlight examples which are either unique to the program or difficult to accomplish at other venues.
Renaissance of the ~ 1-TeV Fixed-Target Program
Energy Technology Data Exchange (ETDEWEB)
Adams, T.; /Florida State U.; Appel, J.A.; /Fermilab; Arms, K.E.; /Minnesota U.; Balantekin, A.B.; /Wisconsin U., Madison; Conrad, J.M.; /MIT; Cooper, P.S.; /Fermilab; Djurcic, Z.; /Columbia U.; Dunwoodie, W.; /SLAC; Engelfried, J.; /San Luis Potosi U.; Fisher, P.H.; /MIT; Gottschalk, Erik Edward; /Fermilab; de Gouvea, A.; /Northwestern U.; Heller, K.; /Minnesota U.; Ignarra, C.M.; Karagiorgi, G.; /MIT; Kwan, S.; /Fermilab; Loinaz, W.A.; /Amherst Coll.; Meadows, B.; /Cincinnati U.; Moore, R.; Morfin, J.G.; /Fermilab; Naples, D.; /Pittsburgh U. /St. Mary' s Coll., Minnesota /New Mexico State U. /Michigan U. /Wayne State U. /South Carolina U. /Florida U. /Carnegie Mellon U. /Cincinnati U. /Columbia U. /Columbia U. /Northwestern U. /Yale U. /Fermilab /Argonne /Northwestern U. /APC, Paris
2011-12-02
This document describes the physics potential of a new fixed-target program based on a {approx}1 TeV proton source. Two proton sources are potentially available in the future: the existing Tevatron at Fermilab, which can provide 800 GeV protons for fixed-target physics, and a possible upgrade to the SPS at CERN, called SPS+, which would produce 1 TeV protons on target. In this paper we use an example Tevatron fixed-target program to illustrate the high discovery potential possible in the charm and neutrino sectors. We highlight examples which are either unique to the program or difficult to accomplish at other venues.
Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...
African Journals Online (AJOL)
The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...
DEFF Research Database (Denmark)
Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong
2010-01-01
involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting......In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...
Detection of Chlamydia in postmortal formalin-fixed tissue
DEFF Research Database (Denmark)
Lundemose, AG; Lundemose, JB; Birkelund, Svend
1989-01-01
A procedure to detect Chlamydia in postmortal formalin-fixed tissue is described. Monoclonal antibodies against a genus specific chlamydia epitope were used in immunofluorescence to detect chlamydia inclusions in formalin-fixed tissue sections. Lung sections from chlamydia-infected mice were....... Background and non-specific fluorescence were reduced by treating the tissue sections with trypsin, rabbit serum and Evans blue counterstain. Besides giving an exact diagnosis at autopsy, the method provides the possibility of determining the occurrence of chlamydia infections in various tissues, based...
Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.
Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P
2017-09-01
Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
International Nuclear Information System (INIS)
Chen, Mei; Hou, Changjun; Huo, Danqun; Yang, Mei; Fa, Huanbao
2016-01-01
Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10"−"1"4 to 1.0 × 10"−"8 M), with a detection limit of 3.5 × 10"−"1"5 M (signal/noise ratio of 3). The biosensor also showed high selectivity to
Energy Technology Data Exchange (ETDEWEB)
Chen, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Hou, Changjun, E-mail: houcj@cqu.edu.cn [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Huo, Danqun [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Yang, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Fa, Huanbao [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China)
2016-02-28
Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10{sup −14} to 1.0 × 10{sup −8} M), with a detection limit of 3.5 × 10{sup −15} M (signal/noise ratio of 3). The biosensor also showed high
MD study of pyrimidine base damage on DNA and its recognition by repair enzyme
International Nuclear Information System (INIS)
Pinak, M.
2000-01-01
The molecular dynamics (MD) simulation was used on the study of two specific damages of pyrimidine bases of DNA. Pyrimidine bases are major targets either of free radicals induced by ionizing radiation in DNA surrounding environment or UV radiation. Thymine dimer (TD) is UV induced damage, in which two neighboring thymines in one strand are joined by covalent bonds of C(5)-C(5) and C(6)-C(6) atoms of thymines. Thymine glycol (TG) is ionizing radiation induced damage in which the free water radical adds to unsaturated bond C(5)-C(6) of thymine. Both damages are experimentally suggested to be mutagenetic and carcinogenic unless properly repaired by repair enzymes. In the case of MD of TD, there is detected strong kink around the TD site that is not observed in native DNA. In addition there is observed the different value of electrostatic energy at the TD site - negative '-10 kcal/mol', in contrary to nearly neutral value of native thymine site. Structural changes and specific electrostatic energy - seems to be important for proper recognition of TD damaged site, formation of DNA-enzyme complex and thus for subsequent repair of DNA. In the case of TG damaged DNA there is major structural distortion at the TG site, mainly the increased distance between TG and the C5' of adjacent nucleotide. This enlarged gap between the neighboring nucleotides may prevent the insertion of complementary base during replication causing the replication process to stop. In which extend this structural feature together with energy properties of TG contributes to the proper recognition of TG by repair enzyme Endonuclease III is subject of further computational MD study. (author)
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Radiation-induced electron migration along DNA
International Nuclear Information System (INIS)
Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.
1994-04-01
Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to nonrandom types of damage along DNA manifested distal to the sites of the initial energy deposition. Electron migration along DNA is significantly influenced by the DNA base sequence and DNA conformation. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution which compares to average migration distances of 6 to 10 bases for Escherichia coli DNA irradiated in solution and 5.5 base pairs for Escherichia coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along DNA. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation
Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan
2015-09-01
5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.
Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.
Gryson, Nicolas
2010-03-01
The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.
Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang
2009-01-01
A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.
Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs
Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.
2012-01-01
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...
DEFF Research Database (Denmark)
Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina
2013-01-01
in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...
Noise power spectrum of the fixed pattern noise in digital radiography detectors
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Sik, E-mail: dskim@hufs.ac.kr [Department of Electronics Engineering, Hankuk University of Foreign Studies, Gyeonggi-do 449-791 (Korea, Republic of); Kim, Eun [R& D Center, DRTECH Co., Gyeonggi-do 13558 (Korea, Republic of)
2016-06-15
Purpose: The fixed pattern noise in radiography image detectors is caused by various sources. Multiple readout circuits with gate drivers and charge amplifiers are used to efficiently acquire the pixel voltage signals. However, the multiple circuits are not identical and thus yield nonuniform system gains. Nonuniform sensitivities are also produced from local variations in the charge collection elements. Furthermore, in phosphor-based detectors, the optical scattering at the top surface of the columnar CsI growth, the grain boundaries, and the disorder structure causes spatial sensitivity variations. These nonuniform gains or sensitivities cause fixed pattern noise and degrade the detector performance, even though the noise problem can be partially alleviated by using gain correction techniques. Hence, in order to develop good detectors, comparative analysis of the energy spectrum of the fixed pattern noise is important. Methods: In order to observe the energy spectrum of the fixed pattern noise, a normalized noise power spectrum (NNPS) of the fixed pattern noise is considered in this paper. Since the fixed pattern noise is mainly caused by the nonuniform gains, we call the spectrum the gain NNPS. We first asymptotically observe the gain NNPS and then formulate two relationships to calculate the gain NNPS based on a nonuniform-gain model. Since the gain NNPS values are quite low compared to the usual NNPS, measuring such a low NNPS value is difficult. By using the average of the uniform exposure images, a robust measuring method for the gain NNPS is proposed in this paper. Results: By using the proposed measuring method, the gain NNPS curves of several prototypes of general radiography and mammography detectors were measured to analyze their fixed pattern noise properties. We notice that a direct detector, which is based on the a-Se photoconductor, showed lower gain NNPS than the indirect-detector case, which is based on the CsI scintillator. By comparing the gain
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.
Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike
2018-05-01
We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.
Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M
2016-08-02
Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.
Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant
DEFF Research Database (Denmark)
Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens
2017-01-01
approaches. We tested whether the emulsion-based and alpha-tocopherol containing adjuvant Diluvac Forte® has the ability to enhance the immunogenicity of a naked DNA vaccine (i.e., plasmid DNA). As a model vaccine, we used plasmids encoding both a surface-exposed viral glycoprotein (hemagglutinin......) and an internal non-glycosylated nucleoprotein in the Th1/Th2 balanced CB6F1 mouse model. The naked DNA (50 µg) was premixed at a 1:1 volume/volume ratio with Diluvac Forte®, an emulsion containing different concentrations of alpha-tocopherol, the emulsion alone or endotoxin-free phosphate-buffered saline (PBS......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...
Photothermal Transport of DNA in Entropy-Landscape Plasmonic Waveguides
DEFF Research Database (Denmark)
Smith, Cameron; Thilsted, Anil Haraksingh; Pedersen, Jonas Nyvold
2017-01-01
landscapes. Separately, a range of plasmonic configurations have demonstrated active manipulation of nano-objects by harnessing concentrated electric fields. The integration of these two independent techniques promises a range of sophisticated and complementary functions to handle, for example, DNA...... photothermal transport of DNA through the losses of plasmonic modes. The propulsive forces, assisted by in-coupling to propagating channel plasmon polaritons, extend along the V-grooves with a directed motion up to ≈0.5 μm·mW-1 away from the input beam and λ-DNA velocities reaching ≈0.2 μm·s-1·mW-1....... The entropic trapping enables the V-grooves to be flexibly loaded and unloaded with DNA by variation of transverse fluid flow, a process that is selective to biopolymers versus fixed-shape objects and also allows the technique to address the challenges of nanoscale interaction volumes. Our self-aligning, light...
DNA flow cytometric analysis in variable types of hydropic placentas
Directory of Open Access Journals (Sweden)
Fatemeh Atabaki pasdar
2015-05-01
Full Text Available Background: Differential diagnosis between complete hydatidiform mole, partial hydatidiform mole and hydropic abortion, known as hydropic placentas is still a challenge for pathologists but it is very important for patient management. Objective: We analyzed the nuclear DNA content of various types of hydropic placentas by flowcytometry. Materials and Methods: DNA ploidy analysis was performed in 20 non-molar (hydropic and non-hydropic spontaneous abortions and 20 molar (complete and partial moles, formalin-fixed, paraffin-embedded tissue samples by flow cytometry. The criteria for selection were based on the histopathologic diagnosis. Results: Of 10 cases histologically diagnosed as complete hydatiform mole, 9 cases yielded diploid histograms, and 1 case was tetraploid. Of 10 partial hydatidiform moles, 8 were triploid and 2 were diploid. All of 20 cases diagnosed as spontaneous abortions (hydropic and non-hydropic yielded diploid histograms. Conclusion: These findings signify the importance of the combined use of conventional histology and ploidy analysis in the differential diagnosis of complete hydatidiform mole, partial hydatidiform mole and hydropic abortion.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Institute of Scientific and Technical Information of China (English)
Jinqian; DENG; Kangkang; SHAN; Yan; ZHANG
2014-01-01
The rural fundamental and productive fixed-asset investment not only makes active influence on the changes of farmers’ operational,wages and property income,but it also has an optimal scale range for farmers’ income increase. From the perspective of farmers’ income increase,this article evaluates the optimal scale of rural fixed-asset investment by setting up model with statistic data,and the results show that the optimal scale of per capita rural fixed-asset investment is 76. 35% of per capita net income of rural residents,which has been reached in China in 2009. Therefore,compared with the adding of rural fixed-asset investment,a better income increase effect can be achieved through the adjustment of rural fixed-asset investment structure.