WorldWideScience

Sample records for field screening methods

  1. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  2. Cost comparison of laboratory methods and four field screening technologies for uranium-contaminated soil

    International Nuclear Information System (INIS)

    Douthat, D.M.; Armstrong, A.Q.

    1994-01-01

    To address the problem of characterizing uranium-contaminated surface soil at federal facilities, the Department of Energy has the development of four uranium field screening technologies, under the direction of the Uranium-in-Soils Integrated Demonstration (USID) Program. These four technologies include: a long-range alpha detector a beta scintillation detector, an in situ gamma detector, and a mobile laser ablation-inductively coupled plasma/atomic emission spectrometry (LA-ICP/AES) laboratory. As part of the performance assessment for these field screening technologies, cost estimates for the development and operation of each technology were created. A cost study was conducted to compare three of the USID field screening technologies to the use of traditional field surveying equipment to adequately characterize surface soils of a one-acre site. The results indicate that the use of traditional equipment costs more than the in situ gamma detector, but less than the beta scintillation detector and LRAD. The use of traditional field surveying equipment results in cost savings of 4% and 34% over the use of the beta scintillation and LRAD technologies, respectively. A study of single-point surface soil sampling and laboratory analysis costs was also conducted. Operational costs of the mobile LA-ICP/AES laboratory were compared with operational costs of traditional sampling and analysis, which consists of collecting soil samples and conducting analysis in a radiochemical laboratory. The cost study indicates that the use of the mobile LA-ICP/AES laboratory results in cost savings of 23% and 40% over traditional field sampling and laboratory analysis conducted by characterization groups at two DOE facilities

  3. Magnetic field screens

    International Nuclear Information System (INIS)

    Mansfield, P.; Turner, R.; Chapman, B.L.W.; Bowley, R.M.

    1990-01-01

    A screen for a magnetic coil, for producing, for example, a homogeneous, gradient or RF field in nuclear magnetic resonance imaging, is described. It is provided by surround the coil with a set of electrical conductors. The currents within the conductors are controlled in such a manner that the field is neutralised in a specific region of space. The current distribution within the conductors is determined by calculating the current within a hypothetical superconductive shield which would have the effect of neutralising the field, the current through the conductors thereby being a substitute for the superconductive shield. The conductors may be evenly spaced and connected in parallel, their resistances being determined by thickness or composition to provide the desired current, or they may carry equal currents but be differently spaced. A further set or sets of controlled conductors outside the first set may ensure that the first set does not upset the field from the NMR coil. The shield may selectively reflect certain fields while transmitting others and may prevent acoustic vibration e.g. when switching gradient fields. An RF coil arrangement may consist of two orthogonal coils, one coil within the other for use as a transmit/receive set or as a double resonance transmitter; a shield between the coils is in series with, and formed from the same winding as, the inner coil. (author)

  4. Non-invasive method for screening and early detection of breast tumors using thermal field analysis

    Directory of Open Access Journals (Sweden)

    O. Drosu

    2009-10-01

    Full Text Available The paper refers to general presentation of international and European evaluation regarding breast cancer incidence and mortality as well as recommendations for prevention, screening, detection and treatment.The past years international research development in biomedical engineering has put a particular emphasis on the thermography use in breast pathology diagnosis and its main advantages, such as: an early diagnose of the breast cancer, in that stage when the mammography or ultrasounds can not easily detect the changes of the tissue; a totally non-invasive interaction with human body; very low costs and possibilities for the women to do a self thermographic test.We also present some important results of our research within the field of breast tumor detection using the numerical analysis of the thermal inverse problem.

  5. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  6. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in the field in barley

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Rengasamy, Pichu; McDonald, Glenn K.

    2012-01-01

    Success in breeding crops for yield and other quantitative traits depends on the use of methods to evaluate genotypes accurately under field conditions. Although many screening criteria have been suggested to distinguish between genotypes for their salt tolerance under controlled environmental conditions, there is a need to test these criteria in the field. In this study, the salt tolerance, ion concentrations, and accumulation of compatible solutes of genotypes of barley with a range of putative salt tolerance were investigated using three growing conditions (hydroponics, soil in pots, and natural saline field). Initially, 60 genotypes of barley were screened for their salt tolerance and uptake of Na+, Cl–, and K+ at 150 mM NaCl and, based on this, a subset of 15 genotypes was selected for testing in pots and in the field. Expression of salt tolerance in saline solution culture was not a reliable indicator of the differences in salt tolerance between barley plants that were evident in saline soil-based comparisons. Significant correlations were observed in the rankings of genotypes on the basis of their grain yield production at a moderately saline field site and their relative shoot growth in pots at ECe 7.2 [Spearman’s rank correlation (rs)=0.79] and ECe 15.3 (rs=0.82) and the crucial parameter of leaf Na+ (rs=0.72) and Cl– (rs=0.82) concentrations at ECe 7.2 dS m−1. This work has established screening procedures that correlated well with grain yield at sites with moderate levels of soil salinity. This study also showed that both salt exclusion and osmotic tolerance are involved in salt tolerance and that the relative importance of these traits may differ with the severity of the salt stress. In soil, ion exclusion tended to be more important at low to moderate levels of stress but osmotic stress became more important at higher stress levels. Salt exclusion coupled with a synthesis of organic solutes were shown to be important components of salt

  7. Field screening for hexavalent chromium in soil: A fast-turnaround field method based on water extraction

    International Nuclear Information System (INIS)

    McCain, R.G.; Baechler, M.A.

    1994-01-01

    Sodium dichromate has been identified as a contaminant of concern at several waste sites on the Hanford Site. Although chromium standards for soil are typically stated in terms of total chrome, much of the toxicity and carcinogenicity are attributed to the hexavalent state, which typically exists as a relatively mobile anion. Investigation and removal of crushed drums potentially containing residual sodium dichromate required a field test for hexavalent chromium to support characterization and remediation activities. Previous experience with a commercially available field test kit had been unsuccessful. This stimulated an effort to determine potential sources of error in the field test and led to a number of modifications that significantly improved the reliability of the test

  8. Evaluating Sheath Blight Resistance in Rice Using Detached Tiller and Field Screening Method

    Directory of Open Access Journals (Sweden)

    Bedanand Chaudhary

    2015-12-01

    Full Text Available In present study physical resistance test on 12 rice varieties against sheath blight (ShB caused by Rhizoctonia solani was examined. A detached tiller test was used to measure components of ShB physiological resistance at Regional Agricultural Research Station (RARS, Tarahara, Nepal. The varieties were evaluated in a randomized complete block design (RCBD with 3 replications in year 2010-12. A sclerotium was inserted below the leaf collar of individual tillers maintained in tubes filled with water. Only the 56-day old susceptible plants were inoculated. After 7 days of inoculation, number of lesions, dead leaves, vertical sheath colonization and disease severity were measured. In 2011, field experiments were conducted with three replications to address morphological resistance in 28 rice genotypes. Disease incidence was recorded on 14, 21 and 28 days after inoculation. The number of dead leaves differed only numerically while disease variables significantly (P=0.004 varied among varieties. The other variables were highly correlated with each other. Cluster analysis of variables formed three varietal groups; Sabitri with lowest, and Jasmine-85 and Betichikon having highest values. Rice genotypes differed significantly (P=0.05 for disease incidence and area Under Disease Progress Curve (AUDPC. Tetep and IAC-165 had the lowest and highest terminal disease incidences and AUDPC, respectively. Sabitri, MTU-1010 and IR-26 recorded lower AUDPC values. Hence, Tetep and Sabitri could be used as donors in hybridization and their plant morphology could be considered as selection guide for improving ShB resistance in rice.

  9. Comparison of field screening techniques with fuel-contaminated soils

    International Nuclear Information System (INIS)

    Klopp, C.; Turriff, D.

    1995-01-01

    This paper presents the results of a comparison of four field screening techniques. Field screenings, is an important part of conducting cost-effective and comprehensive site investigations. Regulators limit the use of field screening in lieu of laboratory analyses, in part, because there is little information on the accuracy and precision of field screening techniques. The results here represent a step forward towards a better understanding of the accuracy and practicality of field screening methods. The authors hope that the role of field screening in site investigation will increase as this type of information becomes more available. Innovative techniques for homogenizing soils were used to allow simultaneous analysis of hydrocarbon contaminated soils using field GCs, immunoassays, ''jar headspace'' and ''Lab in a Bag.'' The results shown here illustrate the variability of field screening results and the importance of good method development and operator competency. Certainly more work in this area is needed to truly characterize field screening techniques

  10. FIELD SCREENING FOR HALOGENATED VOLATILE ORGANIC COMPOUNDS

    Energy Technology Data Exchange (ETDEWEB)

    John F. Schabron; Joseph F. Rovani Jr.; Theresa M. Bomstad

    2002-06-01

    Western Research Institute (WRI) initiated exploratory work towards the development of new field screening methodology and a test kit to measure halogenated volatile organic compounds (VOCs) in the field. Heated diode and corona discharge sensors are commonly used to detect leaks of refrigerants from air conditioners, freezers, and refrigerators. They are both selective to the presence of carbon-halogen bonds. Commercially available heated diode and corona discharge leak detectors were procured and evaluated for halogenated VOC response. The units were modified to provide a digital readout of signal related to VOC concentration. Sensor response was evaluated with carbon tetrachloride and tetrachloroethylene (perchloroethylene, PCE), which represent halogenated VOCs with and without double bonds. The response characteristics were determined for the VOCs directly in headspace in Tedlar bag containers. Quantitation limits in air were estimated. Potential interferences from volatile hydrocarbons, such as toluene and heptane, were evaluated. The effect of humidity was studied also. The performance of the new devices was evaluated in the laboratory by spiking soil samples and monitoring headspace for halogenated VOCs. A draft concept of the steps for a new analytical method was outlined. The results of the first year effort show that both devices show potential utility for future analytical method development work towards the goal of developing a portable test kit for screening halogenated VOCs in the field.

  11. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  12. Walkthrough screening evaluation field guide

    International Nuclear Information System (INIS)

    Eder, S.J.; Eli, M.W.; Salmon, M.W.

    1993-11-01

    The US Department of Energy (DOE) has a large inventory of existing facilities. Many of these facilities were not designed and constructed to current natural phenomena hazard (NPH) criteria. The NPH events include earthquakes, extreme winds and tornadoes, and floods. DOE Order 5480.28 establishes policy and requirements for NPH mitigation for DOE facilities. DOE is conducting a multiyear project to develop evaluation guidelines for assessing the condition and determining the need for upgrades at DOE facilities. One element of the NPH evaluation guidelines' development involves the existing systems and components at DOE facilities. This effort is described in detail in a cited reference. In the interim period prior to availability of the final guidelines, DOE facilities are encouraged to implement an NPH walk through screening evaluation process by which systems and components that need attention can be rapidly identified. Guidelines for conducting the walk through screening evaluations are contained herein. The result of the NPH walk through screening evaluation should be a prioritized list of systems and components that need further action. Simple and inexpensive fixes for items identified in the walk through as marginal or inadequate should be implemented without further study. By implementing an NPH walk through screening evaluation, DOE facilities may realize significant reduction in risk from NPH in the short term

  13. Screening vector field modifications of general relativity

    International Nuclear Information System (INIS)

    Beltrán Jiménez, Jose; Delvas Fróes, André Luís; Mota, David F.

    2013-01-01

    A screening mechanism for conformal vector–tensor modifications of general relativity is proposed. The conformal factor depends on the norm of the vector field and makes the field to vanish in high dense regions, whereas drives it to a non-null value in low density environments. Such process occurs due to a spontaneous symmetry breaking mechanism and gives rise to both the screening of fifth forces as well as Lorentz violations. The cosmology and local constraints are also computed

  14. Synthesis Of Ultrasound Field Sources Based on Phase Screen Approximation

    Directory of Open Access Journals (Sweden)

    Sukhanov Dmitry

    2018-01-01

    Full Text Available Here is proposed the method for synthesizing the sources of an acoustic field on the basis of an approximation of the phase screen. The technology of manufacturing ultrasonic phased arrays providing the formation of a field of a given distribution is proposed. An experimental setup has been developed for the formation of a vortex field at a distance of 10 cm.

  15. FIELD SCREENING FOR HALOGENATED VOLATILE ORGANIC COMPOUNDS

    Energy Technology Data Exchange (ETDEWEB)

    John F. Schabron; Joseph F. Rovani, Jr.; Theresa M. Bomstad

    2003-07-01

    Western Research Institute (WRI) is continuing work toward the development of new screening methodology and a test kit to measure halogenated volatile organic compounds (VOCs) in the field. Heated diode and corona discharge sensors are commonly used to detect leaks of refrigerants from air conditioners, freezers, and refrigerators. They are both selective to the presence of halogens. In prior work, the devices were tested for response to carbon tetrachloride, heptane, toluene, and water vapors. In the current work, sensor response was evaluated with sixteen halogenated VOCs relative to carbon tetrachloride. The results show that the response of the various chlorinated VOCs is within an order of magnitude of the response to carbon tetrachloride for each of the sensors. Thus, for field screening a single response factor can be used. Both types of leak detectors are being further modified to provide an on-board LCD signal readout, which is related to VOC concentration. The units will be fully portable and will operate with 115-V line or battery power. Signal background, noise level, and response data on the Bacharach heated diode detector and the TIF corona discharge detector show that when the response curves are plotted against the log of concentration, the plot is linear to the upper limit for the particular unit, with some curvature at lower levels. When response is plotted directly against concentration, the response is linear at the low end and is curved at the high end. The dynamic ranges for carbon tetrachloride of the two devices from the lower detection limit (S/N=2) to signal saturation are 4-850 vapor parts per million (vppm) for the corona discharge unit and 0.01-70 vppm for the heated diode unit. Additional circuit modifications are being made to lower the detection limit and increase the dynamic response range of the corona discharge unit. The results indicate that both devices show potential utility for future analytical method development work toward

  16. High throughput screening method for assessing heterogeneity of microorganisms

    NARCIS (Netherlands)

    Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert

    2006-01-01

    The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.

  17. Apparatus and method for radioactive waste screening

    Science.gov (United States)

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  18. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  19. Methods for simulating turbulent phase screen

    International Nuclear Information System (INIS)

    Zhang Jianzhu; Zhang Feizhou; Wu Yi

    2012-01-01

    Some methods for simulating turbulent phase screen are summarized, and their characteristics are analyzed by calculating the phase structure function, decomposing phase screens into Zernike polynomials, and simulating laser propagation in the atmosphere. Through analyzing, it is found that, the turbulent high-frequency components are well contained by those phase screens simulated by the FFT method, but the low-frequency components are little contained. The low-frequency components are well contained by screens simulated by Zernike method, but the high-frequency components are not contained enough. The high frequency components contained will be improved by increasing the order of the Zernike polynomial, but they mainly lie in the edge-area. Compared with the two methods above, the fractal method is a better method to simulate turbulent phase screens. According to the radius of the focal spot and the variance of the focal spot jitter, there are limitations in the methods except the fractal method. Combining the FFT and Zernike method or combining the FFT method and self-similar theory to simulate turbulent phase screens is an effective and appropriate way. In general, the fractal method is probably the best way. (authors)

  20. Variational methods for field theories

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Menahem, S.

    1986-09-01

    Four field theory models are studied: Periodic Quantum Electrodynamics (PQED) in (2 + 1) dimensions, free scalar field theory in (1 + 1) dimensions, the Quantum XY model in (1 + 1) dimensions, and the (1 + 1) dimensional Ising model in a transverse magnetic field. The last three parts deal exclusively with variational methods; the PQED part involves mainly the path-integral approach. The PQED calculation results in a better understanding of the connection between electric confinement through monopole screening, and confinement through tunneling between degenerate vacua. This includes a better quantitative agreement for the string tensions in the two approaches. Free field theory is used as a laboratory for a new variational blocking-truncation approximation, in which the high-frequency modes in a block are truncated to wave functions that depend on the slower background modes (Boron-Oppenheimer approximation). This ''adiabatic truncation'' method gives very accurate results for ground-state energy density and correlation functions. Various adiabatic schemes, with one variable kept per site and then two variables per site, are used. For the XY model, several trial wave functions for the ground state are explored, with an emphasis on the periodic Gaussian. A connection is established with the vortex Coulomb gas of the Euclidean path integral approach. The approximations used are taken from the realms of statistical mechanics (mean field approximation, transfer-matrix methods) and of quantum mechanics (iterative blocking schemes). In developing blocking schemes based on continuous variables, problems due to the periodicity of the model were solved. Our results exhibit an order-disorder phase transition. The transfer-matrix method is used to find a good (non-blocking) trial ground state for the Ising model in a transverse magnetic field in (1 + 1) dimensions.

  1. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  2. Magnetic field and screening effects in condensed and ultradense matter

    International Nuclear Information System (INIS)

    Roussel, K.M.

    1974-01-01

    The investigations of three topics are presented: the origin of magnetic fields in white dwarfs and neutron stars, the detection of magnetic fields in white dwarfs, and screening effects due to free charged particles, particularly in semiconductors. (U.S.)

  3. Genealogical series method. Hyperpolar points screen effect

    International Nuclear Information System (INIS)

    Gorbatov, A.M.

    1991-01-01

    The fundamental values of the genealogical series method -the genealogical integrals (sandwiches) have been investigated. The hyperpolar points screen effect has been found. It allows one to calculate the sandwiches for the Fermion systems with large number of particles and to ascertain the validity of the iterated-potential method as well. For the first time the genealogical-series method has been realized numerically for the central spin-independent potential

  4. Mechanical behaviour of vacuum chambers and beam screens under quench conditions in dipole and quadrupole fields

    CERN Document Server

    Rathjen, C

    2002-01-01

    A method based on analytical formulas is described to calculate bending moments, stresses, and deformations of vacuum chambers and beam screens in dipole and in quadrupole fields during a magnet quench. Solutions are given for circular and racetrack shaped structures. Without the need of time consuming calculations the solutions enable a quick design and verification of vacuum chambers and beam screens.

  5. Assessment of a landfill methane emission screening method using an unmanned aerial vehicle mounted thermal infrared camera – A field study

    DEFF Research Database (Denmark)

    Fjelsted, Lotte; Christensen, A. G.; Larsen, J. E.

    2018-01-01

    An unmanned aerial vehicle (UAV)-mounted thermal infrared (TIR) camera’s ability to delineate landfill gas (LFG) emission hotspots was evaluated in a field test at two Danish landfills (Hedeland landfill and Audebo landfill). At both sites, a test area of 100 m2 was established and divided into a...

  6. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  7. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  8. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  9. Effect of critical field on screened dielectric breakdown growth

    International Nuclear Information System (INIS)

    Wang Wei.

    1993-10-01

    In this paper we have shown that due to a critical field, the patterns growing in the screened Laplacian field will be affected. When the critical field is zero, there is a transition from a dense growing to single branch of aggregate. At a higher critical field, the pattern shows a spiky-type aggregate, and for a small critical field the transition is cut. For an intermediate critical field, the result shows that below the transition, there no dense structure. (author). 9 refs, 2 figs

  10. Methods for magnetostatic field calculation

    International Nuclear Information System (INIS)

    Vorozhtsov, S.B.

    1984-01-01

    Two methods for magnetostatic field calculation: differential and integrat are considered. Both approaches are shown to have certain merits and drawbacks, choice of the method depend on the type of the solved problem. An opportunity of combination of these tWo methods in one algorithm (hybrid method) is considered

  11. The Plastic Tension Field Method

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2005-01-01

    This paper describes a calculation method for steel plate girders with transverse web stiffeners subjected to shear. It may be used for predicting the failure load or, as a design method, to determine the optimal amount of internal web stiffeners. The new method is called the plastic tension field...... method. The method is based on the theory of plasticity and is analogous to the so-called diagonal compression field method developed for reinforced concrete beams with transverse stirrups, which is adopted in the common European concrete code (Eurocode 2). Many other theories have been developed...

  12. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    A new screening method for discovering antibacterial agents from filamentous fungi. ... African Journal of Biotechnology ... Keywords: Drug-resistant bacterial pathogens, novel antibiotics; screening method, filamentous fungi products ...

  13. Screening of Geomechanical Risks for Malaysian Development Field

    Directory of Open Access Journals (Sweden)

    Syed Najmuddin Syed Muhammad Syafiq

    2017-01-01

    Full Text Available Deeper drilling and exploitation of difficult reservoir is the new trend in oil and gas industry. Geomechanics study has, therefore, become a new requirement particularly for oil and gas field development. However, a complete geomechanics study is limited with the number of experts, time consuming and not a straightforward task. Therefore, there is an urgent need of a quick geomechanics screening criterion to be used as a standard guideline to evaluate the high level geomechanical risks and suitable analysis can be recommended for the identified development fields. The aim of this paper is to propose a screening criterion for geomechanical risks study based on four key parameters, drilling, depletion, injection and storage and sand production. The screening approach is designed based on Risk Assessment Matrix (RAM risk screening where the likelihood is based on a set of scores developed to specific questions. The consequence for each failure scenarios is assessed based on educated estimation of the impact towards people, asset, environment and reputation. Recommendations for geomechanical study are made based on the severity of each failure category on the RAM risk matrix. Fourteen development fields in offshore Peninsular Malaysia, offshore Sarawak and offshore Sabah are selected for the assessment. Based on results, fields in offshore Sarawak and Sabah have higher potential for geomechacnical issues mainly because of their geological settings and formation characteristics. A set of geomechanical study is proposed for each individual field for prudent management of potential geomechanics risk associated with the depletion and EOR injection scheme planned for the fields.

  14. Field screening procedures for determining the presence of volatile organic compounds in soil

    International Nuclear Information System (INIS)

    Crockett, A.B.; DeHaan, M.S.

    1991-01-01

    Many field screening procedures have been used to detect the presence of volatile organic compounds (VOC) in soils but almost none have been documented and verified. Users of these procedures have not really known whether their objectives in screening were met. A reliable VOC screening procedure could significantly reduce the number of samples currently being submitted to laboratories, thereby reducing costs and improving site characterization. The Environmental Protection Agency's Environmental Monitoring Systems Laboratory in Las Vegas (EMSL-LV) has therefore sponsored a research effort to evaluate and improve headspace methods for screening soils for VOC in the field. The research involved comparing several extraction procedures using soils from actual waste sites, and determining the agitation and mixing necessary to achieve equilibrium. Headspace was analyzed using a relatively simple portable gas chromatograph with a short column. The results were variable and show that several procedures should be attempted and the results evaluated before selecting a screening procedure. 10 refs., 6 tabs

  15. Subtask 1.11 - Spectroscopic field screening of hazardous waste and toxic spills. Final report

    International Nuclear Information System (INIS)

    Grisanti, A.A.

    1997-10-01

    Techniques for the field characterization of soil contamination due to spillage of hazardous waste or toxic chemicals are time-consuming and expensive. Thus more economical, less time-intensive methods are needed to facilitate rapid field screening of contaminated sites. The overall objective of this project is to study the feasibility of using an evanescent field absorbance sensor Fourier transform infrared spectroscopic sensor coupled with cone penetrometry as a field screening method. The specific objectives of this project are as follows: design an accessory for use with FT-IR that interfaces the spectrometer to a cone penetrometer; characterize the response of the FT-IR accessory to selected hydrocarbons in a laboratory-simulated field environment; and determine the ability of the FT-IR-CPT instrument to measure hydrocarbon contamination in soil by direct comparison with a reference method (e.g., Soxhlet extraction followed by gas chromatography) to quantify hydrocarbons from the same soil

  16. Overview of DOE's field screening technology development activities

    International Nuclear Information System (INIS)

    Frank, C.W.; Anderson, T.D.; Cooley, C.R.; Hain, K.E.; Lien, S.C.T.; Erickson, M.D.

    1991-01-01

    The Department of Energy (DOE) has recently created the Office of Environmental Restoration and Waste Management, into which it consolidated those activities. Within this new organization, the Office of Technology Development (OTD) is responsible for research, development, demonstration, testing, and evaluation (RDDT ampersand E) activities aimed at meeting DOE cleanup goals, while minimizing cost and risk. Site characterization using traditional drilling, sampling, and analytical methods comprises a significant part of the environmental restoration efforts in terms of both cost and time to accomplish. It can also be invasive and create additional pathways for spread of contaminants. Consequently, DOE is focusing on site characterization as one of the areas in which significant technological advances are possible which will decrease cost, reduce risk, and shorten schedules for achieving restoration goals. DOE is investing considerably in R ampersand D and demonstration activities which will improve the abilities to screen chemical, radiological, and physical parameters in the field. This paper presents an overview of the program objectives and status and reviews some of the projects which are currently underway in the area. 1 ref

  17. FieldChopper, a new tool for automatic model generation and virtual screening based on molecular fields.

    Science.gov (United States)

    Kalliokoski, Tuomo; Ronkko, Toni; Poso, Antti

    2008-06-01

    Algorithms were developed for ligand-based virtual screening of molecular databases. FieldChopper (FC) is based on the discretization of the electrostatic and van der Waals field into three classes. A model is built from a set of superimposed active molecules. The similarity of the compounds in the database to the model is then calculated using matrices that define scores for comparing field values of different categories. The method was validated using 12 publicly available data sets by comparing the method to the electrostatic similarity comparison program EON. The results suggest that FC is competitive with more complex descriptors and could be used as a molecular sieve in virtual screening experiments when multiple active ligands are known.

  18. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  19. Local electric field screening in bi-layer graphene devices

    Directory of Open Access Journals (Sweden)

    Vishal ePanchal

    2014-02-01

    Full Text Available We present experimental studies of both local and macroscopic electrical effects in uniform single- (1LG and bi-layer graphene (2LG devices as well as in devices with non-uniform graphene coverage, under ambient conditions. DC transport measurements on sub-micron scale Hall bar devices were used to show a linear rise in carrier density with increasing amounts of 2LG coverage. Electrical scanning gate microscopy was used to locally top gate uniform and non-uniform devices in order to observe the effect of local electrical gating. We experimentally show a significant level of electric field screening by 2LG. We demonstrate that SGM technique is an extremely useful research tool for studies of local screening effects, which provides a complementary view on phenomena that are usually considered only within a macroscopic experimental scheme.

  20. Semiclassical methods in field theories

    International Nuclear Information System (INIS)

    Ventura, I.

    1978-10-01

    A new scheme is proposed for semi-classical quantization in field theory - the expansion about the charge (EAC) - which is developed within the canonical formalism. This method is suitable for quantizing theories that are invariant under global gauge transformations. It is used in the treatment of the non relativistic logarithmic theory that was proposed by Bialynicki-Birula and Mycielski - a theory we can formulate in any number of spatial dimensions. The non linear Schroedinger equation is also quantized by means of the EAC. The classical logarithmic theories - both, the non relativistic and the relativistic one - are studied in detail. It is shown that the Bohr-Sommerfeld quantization rule(BSQR) in field theory is, in many cases, equivalent to charge quantization. This rule is then applied to the massive Thirring Model and the logarithmic theories. The BSQR can be see as a simplified and non local version of the EAC [pt

  1. Qualitative vs. quantitative data: Controls on the accuracy of PID field screening in petroleum contamination assessment applications

    International Nuclear Information System (INIS)

    Luessen, M.J.; Allex, M.K.; Holzel, F.R.

    1995-01-01

    The use of photoionization detectors (PIDs) for field screening of soils for volatile organic contaminants has become a standard industry practice. PID screening data is generally utilized as a qualitative basis for selection of samples for laboratory analysis to quantify concentrations of specific contaminants of concern. Both qualitative field screening data and quantitative laboratory analytical data were reviewed for more than 100 hydrogeologic assessment sites in Ohio to evaluate controls on the effectiveness of field screening data. Assessment data evaluated was limited to sites at which the suspected contaminant source was a gasoline underground storage tanks system. In each case, a 10.0 eV (or greater) PID calibrated for benzene was used to screen soils which were analyzed for benzene, toluene, ethylbenzene and xylene (BTEX) by SW 846 method 8020. Controls on field screening which were evaluated for each site included (1) soil classification, (2) soil moisture, (3) weather conditions, (4) background levels, (5) equipment quality, (6) screening methodology, and (7) laboratory QA/QC. Statistical data analysis predictably indicated a general overestimate of total BTEX levels based on field screening (gasoline is approximately 25 weight percent BTEX). However, data locally indicated cases of both significant (i.e., more than an order of magnitude difference) over- and under-estimation of actual BTEX concentrations (i.e., quantitative laboratory data) by field screening data

  2. Relaxation methods for gauge field equilibrium equations

    International Nuclear Information System (INIS)

    Adler, S.L.; Piran, T.

    1984-01-01

    This article gives a pedagogical introduction to relaxation methods for the numerical solution of elliptic partial differential equations, with particular emphasis on treating nonlinear problems with delta-function source terms and axial symmetry, which arise in the context of effective Lagrangian approximations to the dynamics of quantized gauge fields. The authors present a detailed theoretical analysis of three models which are used as numerical examples: the classical Abelian Higgs model (illustrating charge screening), the semiclassical leading logarithm model (illustrating flux confinement within a free boundary or ''bag''), and the axially symmetric Bogomol'nyi-Prasad-Sommerfield monopoles (illustrating the occurrence of p topological quantum numbers in non-Abelian gauge fields). They then proceed to a self-contained introduction to the theory of relaxation methods and allied iterative numerical methods and to the practical aspects of their implementation, with attention to general issues which arise in the three examples. The authors conclude with a brief discussion of details of the numerical solution of the models, presenting sample numerical results

  3. A method for calculating effective lifetime risk of radiation-induced cancer from screening mammography

    International Nuclear Information System (INIS)

    Ali, R.M.; England, A.; McEntee, M.F.; Hogg, P.

    2015-01-01

    Purpose: To propose a method for evaluating the effective lifetime risk of radiation-induced cancer from screening mammography and to present initial data for the UK National Breast Screening Programme. Material and methods: The imaging was undertaken using a Hologic Selenia full field digital mammographic unit. The proposed method utilises an ATOM phantom containing thermoluminescent dosimeters and a perspex-polyethylene breast phantom to measure organ doses during a standard four view screening mammogram. Effective dose was calculated and effective risk was modelled for a range of client ages. The total lifetime effective risk was then calculated for the UK national screening programme. Calculation of effective risk includes the radiation dose to examined and contralateral breasts in addition to other body organs; this is an advantage over the mean glandular dose. Results: The contralateral breast, thyroid, thymus, brain, lung, salivary glands, and bone marrow all receive more than 1 μGy radiation dose during screening mammography. A major difference exists for total effective lifetime risk of radiation-induced cancer between clients with average and high breast cancer risk. Differences are attributed to the commencement age of screening and time interval between screens. Conclusion: This study proposes a method to evaluate effective lifetime risk of radiation-induced cancer from screening mammography in order to compare different mammography screening programmes. - Highlights: • We proposed a method for the calculation of radiation-induced cancer from screening mammography. • We measured the radiation absorbed dose of different organs during screening mammography. • There are major differences between mammography screening programme categories with regard to radiation effective risk.

  4. A new screening method for selection of desired recombinant ...

    African Journals Online (AJOL)

    A new screening method for selection of desired recombinant plasmids in molecular cloning. ... African Journal of Biotechnology ... Regarding the facts of this study, after digestion process, the products directly were subjected to ligation. Due to ...

  5. The evolving role of new imaging methods in breast screening.

    Science.gov (United States)

    Houssami, Nehmat; Ciatto, Stefano

    2011-09-01

    The potential to avert breast cancer deaths through screening means that efforts continue to identify methods which may enhance early detection. While the role of most new imaging technologies remains in adjunct screening or in the work-up of mammography-detected abnormalities, some of the new breast imaging tests (such as MRI) have roles in screening groups of women defined by increased cancer risk. This paper highlights the evidence and the current role of new breast imaging technologies in screening, focusing on those that have broader application in population screening, including digital mammography, breast ultrasound in women with dense breasts, and computer-aided detection. It highlights that evidence on new imaging in screening comes mostly from non-randomised studies that have quantified test detection capability as adjunct to mammography, or have compared measures of screening performance for new technologies with that of conventional mammography. Two RCTs have provided high-quality evidence on the equivalence of digital and conventional mammography and on outcomes of screen-reading complemented by CAD. Many of these imaging technologies enhance cancer detection but also increase recall and false positives in screening. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. An alternative green screen keying method for film visual effects

    OpenAIRE

    Zhi, Jin

    2015-01-01

    This study focuses on a green screen keying method developed especially for film visual effects. There are a series of ways of using existing tools for creating mattes from green or blue screen plates. However, it is still a time-consuming process, and the results vary especially when it comes to retaining tiny details, such as hair and fur. This paper introduces an alternative concept and method for retaining edge details of characters on a green screen plate, also, a number of connected mat...

  7. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  8. NUMERICAL SIMULATION OF MAGNETIC FIELD STRUCTURE IN CYLINDRICAL FILM SCREEN

    Directory of Open Access Journals (Sweden)

    G. F. Gromyko

    2016-01-01

    Full Text Available A numerical method for solving the boundary value problem for a nonlinear magnetostatic equation describing the external magnetostatic field penetration through the cylindrical film coating is developed. A mathematical model of the shielding problem based on the use of the boundary conditions of the third kind on the film surface is studied. The nonlinear dependence of the film magnetic permeability on magnetic field conforms with experimental data. The distribution of the magnetic field strength in the film layer and the magnetic permeability of the film material depending on the magnitude of the external magnetic field strength are investigated numerically.

  9. Efficient Training Methods for Conditional Random Fields

    National Research Council Canada - National Science Library

    Sutton, Charles A

    2008-01-01

    .... In this thesis, I investigate efficient training methods for conditional random fields with complex graphical structure, focusing on local methods which avoid propagating information globally along the graph...

  10. Apparatuses and methods for generating electric fields

    Science.gov (United States)

    Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L

    2013-08-06

    Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.

  11. Size measurement of radioactive aerosol particles in intense radiation fields using wire screens and imaging plates

    Energy Technology Data Exchange (ETDEWEB)

    Oki, Yuichi; Tanaka, Toru; Takamiya, Koichi; Ishi, Yoshihiro; UesugI, Tomonori; Kuriyama, Yasutoshi; Sakamoto, Masaaki; Ohtsuki, Tsutomu [Kyoto University Research Reactor Institute, Osaka (Japan); Nitta, Shinnosuke [Graduate School of Engineering, Kyoto University, Kyoto (Japan); Osada, Naoyuki [Advanced Science Research Center, Okayama University, Okayama (Japan)

    2016-09-15

    Very fine radiation-induced aerosol particles are produced in intense radiation fields, such as high-intensity accelerator rooms and containment vessels such as those in the Fukushima Daiichi nuclear power plant (FDNPP). Size measurement of the aerosol particles is very important for understanding the behavior of radioactive aerosols released in the FDNPP accident and radiation safety in high-energy accelerators. A combined technique using wire screens and imaging plates was developed for size measurement of fine radioactive aerosol particles smaller than 100 nm in diameter. This technique was applied to the radiation field of a proton accelerator room, in which radioactive atoms produced in air during machine operation are incorporated into radiation-induced aerosol particles. The size of 11C-bearing aerosol particles was analyzed using the wire screen technique in distinction from other positron emitters in combination with a radioactive decay analysis. The size distribution for 11C-bearing aerosol particles was found to be ca. 70 μm in geometric mean diameter. The size was similar to that for 7Be-bearing particles obtained by a Ge detector measurement, and was slightly larger than the number-based size distribution measured with a scanning mobility particle sizer. The particle size measuring method using wire screens and imaging plates was successfully applied to the fine aerosol particles produced in an intense radiation field of a proton accelerator. This technique is applicable to size measurement of radioactive aerosol particles produced in the intense radiation fields of radiation facilities.

  12. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  13. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  14. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  15. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  16. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  17. PHYSICAL FIELDS OF CIRCULAR CYLINDRICAL PIEZOCERAMIC RECEIVER IN PRESENCE OF A FLAT ACOUSTIC SOFT SCREEN

    Directory of Open Access Journals (Sweden)

    A. V. Derepa

    2017-01-01

    Full Text Available System in the form of a circular cylindrical piezoceramic transducer near a flat acoustic screen was analyzed. The aim of the work was to solve the problem of receiving plane sound waves by «cylindrical piezoceramic transducer – flat acoustically soft screen» system.Considered system was characterized by a violation of the radial symmetry of the radiation load of the transducer while maintaining the radial symmetry of the electric load. At the same time, the energy perceived by the system under consideration is distributed between all modes of oscillation of the transducer, while the conversion of mechanical energy into electric is realized only at zero mole of oscillations.Special attention was paid to the method of coupled fields in multiply connected domains using the imaging method. The design model of the «transducer–creen» system was formulated taking into account the interaction of acoustic, mechanical and electric fields in the process of energy conversion, the interaction of a cylindrical transducer with a flat screen and the interaction of a converter with elastic media outside and inside it. The physical fields of the system under consideration were determined by following solutions: the wave equation; equations of motion of thin piezoceramic cylindrical shells in displacements; equations of stimulated electrostatics for piezoceramics for given boundary conditions, conditions for coupling fields at interfaces and electrical conditions.A general conclusion was made concerning solving of an infinite system of linear algebraic equations with respect to the unknown coefficients of the expansion of the fields. As an example of the application of the obtained relations, a calculation was made and an analysis of the dependences of the electric fields of the system under consideration for various parameters of its construction on the direction of arrival on the plane wave system was conducted.

  18. Screening for diabetic retinopathy in rural area using single-field, digital fundus images.

    Science.gov (United States)

    Ruamviboonsuk, Paisan; Wongcumchang, Nattapon; Surawongsin, Pattamaporn; Panyawatananukul, Ekchai; Tiensuwan, Montip

    2005-02-01

    To evaluate the practicability of using single-field, 2.3 million-pixel, digital fundus images for screening of diabetic retinopathy in rural areas. All diabetic patients who regularly attended the diabetic clinic at Kabcheang Community Hospital, located at 15 kilometers from the Thailand-Cambodia border, were appointed to the hospital for a 3-day diabetic retinopathy screening programme. The fundi of all patients were captured in single-field, 45 degrees, 2.3 million-pixel images using nonmydriatic digital fundus camera and then sent to a reading center in Bangkok. The fundi were also examined through dilated pupils by a retinal specialist at this hospital. The grading of diabetic retinopathy from two methods was compared for an exact agreement. The average duration of single digital fundus image capture was 2 minutes. The average file size of each image was 750 kilobytes. The average duration of single image transmission to a reading center in Bangkok via satellite was 3 minutes; via a conventional telephone line was 8 minutes. Of all 150 patients, 130 were assessed for an agreement between dilated fundus examination and digital fundus images in diagnosis of diabetic retinopathy. The exact agreement was 0.87, the weighted kappa statistics was 0.74. The sensitivity of digital fundus images in detecting diabetic retinopathy was 80%, the specificity was 96%. For diabetic macular edema the exact agreement was 0.97, the weighted kappa was 0.43, the sensitivity was 43%, and the specificity was 100%. The image capture of the nonmydriatic digital fundus camera is suitable for screening of diabetic retinopathy and single-field digital fundus images are potentially acceptable tools for the screening. The real-time image transmission via telephone lines to remote reading center, however, may not be practical for routine diabetic retinopathy screening in rural areas.

  19. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  20. Methods of thermal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Mallik, S [Saha Institute of Nuclear Physics, Calcutta (India)

    1998-11-01

    We introduce the basic ideas of thermal field theory and review its path integral formulation. We then discuss the problems of QCD theory at high and at low temperatures. At high temperature the naive perturbation expansion breaks down and is cured by resummation. We illustrate this improved perturbation expansion with the g{sup 2}{phi}{sup 4} theory and then sketch its application to find the gluon damping rate in QCD theory. At low temperature the hadronic phase is described systematically by the chiral perturbation theory. The results obtained from this theory for the quark and the gluon condensates are discussed. (author) 22 refs., 6 figs.

  1. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  2. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  3. In vitro screening methods for assessing plant disease resistance

    International Nuclear Information System (INIS)

    Lebeda, A.; Svabova, L.

    2010-01-01

    A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)

  4. Evaluation of Quantitative Environmental Stress Screening (ESS) Methods. Volume 1

    Science.gov (United States)

    1991-11-01

    required information on screening strength from the curvefitting parameters. The underlying theory and approach taken are discussed in Appendix A. To...in field 1020 arm St.,Vas AJ Ptr 0.4i Currpnt. c- ugt ~ing DU?/SYS 2.7264 Wll/IY.3 at Factory Stress- NaxiLMw outgoing W?is’ys 0.288 DrW/5?S at Field...182 125 K.W.Fertig and V.X. Murthy, Models for Reliability Growth During Burn-in: Theory and Applicat’ons,Proceedings 1978 Annual Reliability and

  5. A comparison of the accuracy of film-screen mammography, full-field digital mammography, and digital breast tomosynthesis

    International Nuclear Information System (INIS)

    Michell, M.J.; Iqbal, A.; Wasan, R.K.; Evans, D.R.; Peacock, C.; Lawinski, C.P.; Douiri, A.; Wilson, R.; Whelehan, P.

    2012-01-01

    Aim: To measure the change in diagnostic accuracy of conventional film-screen mammography and full-field digital mammography (FFDM) with the addition of digital breast tomosynthesis (DBT) in women recalled for assessment following routine screening. Materials and methods: Ethics approval for the study was granted. Women recalled for assessment following routine screening with screen-film mammography were invited to participate. Participants underwent bilateral, two-view FFDM and two-view DBT. Readers scored each lesion separately for probability of malignancy on screen-film mammography, FFDM, and then DBT. The scores were compared with the presence or absence of malignancy based on the final histopathology outcome. Results: Seven hundred and thirty-eight women participated (93.2% recruitment rate). Following assessment 204 (26.8%) were diagnosed as malignant (147 invasive and 57 in-situ tumours), 286 (37.68%) as benign, and 269 (35.4%) as normal. The diagnostic accuracy was evaluated by using receiving operating characteristic (ROC) and measurement of area under the curve (AUC). The AUC values demonstrated a significant (p = 0.0001) improvement in the diagnostic accuracy with the addition of DBT combined with FFDM and film-screen mammography (AUC = 0.9671) when compared to FFDM plus film-screen mammography (AUC = 0.8949) and film-screen mammography alone (AUC = 0.7882). The effect was significantly greater for soft-tissue lesions [AUC was 0.9905 with the addition of DBT and AUC was 0.9201 for FFDM with film-screen mammography combined (p = 0.0001)] compared to microcalcification [with the addition of DBT (AUC = 0.7920) and for FFDM with film-screen mammography combined (AUC = 0.7843; p = 0.3182)]. Conclusion: The addition of DBT increases the accuracy of mammography compared to FFDM and film-screen mammography combined and film-screen mammography alone in the assessment of screen-detected soft-tissue mammographic abnormalities.

  6. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  7. A deep learning method for early screening of lung cancer

    Science.gov (United States)

    Zhang, Kunpeng; Jiang, Huiqin; Ma, Ling; Gao, Jianbo; Yang, Xiaopeng

    2018-04-01

    Lung cancer is the leading cause of cancer-related deaths among men. In this paper, we propose a pulmonary nodule detection method for early screening of lung cancer based on the improved AlexNet model. In order to maintain the same image quality as the existing B/S architecture PACS system, we convert the original CT image into JPEG format image by analyzing the DICOM file firstly. Secondly, in view of the large size and complex background of CT chest images, we design the convolution neural network on basis of AlexNet model and sparse convolution structure. At last we train our models on the software named DIGITS which is provided by NVIDIA. The main contribution of this paper is to apply the convolutional neural network for the early screening of lung cancer and improve the screening accuracy by combining the AlexNet model with the sparse convolution structure. We make a series of experiments on the chest CT images using the proposed method, of which the sensitivity and specificity indicates that the method presented in this paper can effectively improve the accuracy of early screening of lung cancer and it has certain clinical significance at the same time.

  8. Digital Breast Tomosynthesis with Synthesized Two-Dimensional Images versus Full-Field Digital Mammography for Population Screening: Outcomes from the Verona Screening Program.

    Science.gov (United States)

    Caumo, Francesca; Zorzi, Manuel; Brunelli, Silvia; Romanucci, Giovanna; Rella, Rossella; Cugola, Loredana; Bricolo, Paola; Fedato, Chiara; Montemezzi, Stefania; Houssami, Nehmat

    2018-04-01

    Purpose To examine the outcomes of a breast cancer screening program based on digital breast tomosynthesis (DBT) plus synthesized two-dimensional (2D) mammography compared with those after full-field digital mammography (FFDM). Materials and Methods This prospective study included 16 666 asymptomatic women aged 50-69 years who were recruited in April 2015 through March 2016 for DBT plus synthetic 2D screening in the Verona screening program. A comparison cohort of women screened with FFDM (n = 14 423) in the previous year was included. Screening detection measures for the two groups were compared by calculating the proportions associated with each outcome, and the relative rates (RRs) were estimated with multivariate logistic regression. Results Cancer detection rate (CDR) for DBT plus synthetic 2D imaging was 9.30 per 1000 screening examinations versus 5.41 per 1000 screening examinations with FFDM (RR, 1.72; 95% confidence interval [CI]: 1.30, 2.29). CDR was significantly higher in patients screened with DBT plus synthetic 2D imaging than in those screened with FFDM among women classified as having low breast density (RR, 1.53; 95% CI: 1.13, 2.10) or high breast density (RR, 2.86; 95% CI: 1.42, 6.25). The positive predictive value (PPV) for recall was almost doubled with DBT plus synthetic 2D imaging: 23.3% versus 12.9% of recalled patients who were screened with FFDM (RR, 1.81; 95% CI: 1.34, 2.47). The recall rate was similar between groups (RR, 0.95; 95% CI: 0.84, 1.06), whereas the recall rate with invasive assessment was higher for DBT plus synthetic 2D imaging than for FFDM (RR, 1.93; 95% CI: 1.31, 2.03). The mean number of screening studies interpreted per hour was significantly lower for screening examinations performed with DBT plus synthetic 2D imaging (38.5 screens per hour) than with FFDM (60 screens per hour) (P < .001). Conclusion DBT plus synthetic 2D imaging increases CDRs with recall rates comparable to those of FFDM. DBT plus synthetic 2D imaging

  9. Introduction to the background field method

    International Nuclear Information System (INIS)

    Abbott, L.F.; Brandeis Univ., Waltham, MA

    1982-01-01

    The background field approach to calculations in gauge field theories is presented. Conventional functional techniques are reviewed and the background field method is introduced. Feynman rules and renormalization are discussed and, as an example, the Yang-Mills β function is computed. (author)

  10. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  11. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  12. Automatic teleaudiometry: a low cost method to auditory screening

    Directory of Open Access Journals (Sweden)

    Campelo, Victor Eulálio Sousa

    2010-03-01

    Full Text Available Introduction: The auditory screening' benefits has been demonstrated, however these programs has been restricted to the big centers. Objectives: (a Developing a auditory screening method to distance; (b Testing its accuracy and comparing to the screening audiometry test (AV. Method: The teleaudiometry (TA, consists in a developed software, installed in a computer with phone TDH39. It was realized a study in series in 73 individuals between 17 and 50 years, being 57,%% of the female sex, they were randomly selected between patients and companions of the Hospital das Clínicas. Before were subjected to a symptom questionnaire and otoscopy, the individuals realized the tests of TA AV, with scanning in 20dB in the frequencies of 1,2 and 4kHz following the ASHA (1997 protocol and to the gold standard test of audiometry of pure tones in soundproof booth in aleatory order. Results: the TA has lasted average 125+11s and the AV 65+18s. 69 individuals (94,5% declaring to be found difficult or very easy to performing the TA and 61 (83,6% have considered easy or very easy the AV. The accuracy results of TA and AV were respectively: sensibility (86,7% / 86,7%, specificity (75,9%/ 72,4% and negative predictive value (95,7% / 95,5%, positive predictive value (48,1% / 55,2%. Conclusion: The teleaudiometry has showed a good option as an auditory screening method, presenting accuracy next to screening audiometry. In comparison with this method, the teleaudiometry has presented a similar sensibility, major specificity, negative predictive value and endurance time and, under positive predictive value.

  13. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Intravenous DSA as a screening method for cerebral aneurysms

    International Nuclear Information System (INIS)

    Fukaya, Hiroyuki; Sunami, Kaneo; Hoshi, Seiichiro; Komiya, Hirokazu; Saeki, Naokatsu.

    1990-01-01

    Intravenous DSA (IVDSA) was evaluated as a screening method for cerebral aneurysms. It was performed 390 times in 372 cases. Clinically useful images were obtained in 94.1% in all examinations. Nineteen aneurysms were visualized in cerebral angiography among 21 cases with SAH or 3rd nerve palsy, whereas in IVDSA 15 aneurysms were noted. Aneurysms not visualized in IVDSA were all 4 mm or less in size. Therefore, aneurysms, more than 4 mm in size, which have higher risks for rupture, were detectable in IVDSA. Based on these findings, IVDSA is considered to be clinically useful in screening for aneurysms. In all 372 cases, 33 aneurysms were suspected in IVDSA findings, whereas in cerebral angiography 21 of them turned to be aneurysms. Such 12 false positive cases were distributed mainly at anterior communicating and middle cerebral arteries. Improvement of image resolution, avoidance of vessel overlapping and proper selection of screened cases should be investigated for further development of this screening method. (author)

  15. Modeling granular phosphor screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, Panagiotis F.; Kandarakis, Ioannis S.; Cavouras, Dionisis A.; Delis, Harry B.; Panayiotakis, George S.

    2006-01-01

    The intrinsic phosphor properties are of significant importance for the performance of phosphor screens used in medical imaging systems. In previous analytical-theoretical and Monte Carlo studies on granular phosphor materials, values of optical properties, and light interaction cross sections were found by fitting to experimental data. These values were then employed for the assessment of phosphor screen imaging performance. However, it was found that, depending on the experimental technique and fitting methodology, the optical parameters of a specific phosphor material varied within a wide range of values, i.e., variations of light scattering with respect to light absorption coefficients were often observed for the same phosphor material. In this study, x-ray and light transport within granular phosphor materials was studied by developing a computational model using Monte Carlo methods. The model was based on the intrinsic physical characteristics of the phosphor. Input values required to feed the model can be easily obtained from tabulated data. The complex refractive index was introduced and microscopic probabilities for light interactions were produced, using Mie scattering theory. Model validation was carried out by comparing model results on x-ray and light parameters (x-ray absorption, statistical fluctuations in the x-ray to light conversion process, number of emitted light photons, output light spatial distribution) with previous published experimental data on Gd 2 O 2 S:Tb phosphor material (Kodak Min-R screen). Results showed the dependence of the modulation transfer function (MTF) on phosphor grain size and material packing density. It was predicted that granular Gd 2 O 2 S:Tb screens of high packing density and small grain size may exhibit considerably better resolution and light emission properties than the conventional Gd 2 O 2 S:Tb screens, under similar conditions (x-ray incident energy, screen thickness)

  16. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  17. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  18. The sensitivity and specificity of one field non-mydriatic digital fundus photography for DR screening

    Directory of Open Access Journals (Sweden)

    Bin-Bin Li

    2013-07-01

    Full Text Available AIM:To evaluate the sensitivity and specificity of one-field non-mydriatic digital fundus photography and direct ophthalmoscopy for diabetic retinopathy(DRscreening, compared with fundus fluorescein angiography( FFA .METHODS:All 93 patients of type 1 or 2 diabetic who have underwent one-field non-mydriatic digital fundus photography, and direct ophthalmoscopy with dilation of their pupils, and FFA by ophthalmologists. The sensitivity and specificity of one-field non-mydriatic digital fundus photography and direct ophthalmoscopy were calculated respectively, compared with FFA.RESULTS: The sensitivity and specificity of one-field non-mydriatic digital fundus photography for detection of any DR were 80.4% and 94.7%; The sensitivity and specificity of direct ophthalmoscopy for detection of any DR were 64.2% and 84.2%; After the standard for referable DR being lowered down to the moderate non-proliferative diabetic retinopathy(M-NPDR, the sensitivity and specificity of non-mydriatic digital fundus photography for detection were 88.9% and 98.4%, the sensitivity and specificity of direct ophthalmoscopy for detection were 71.5% and 96.7%.CONCLUSION: One-field non-mydriatic digital fundus photography is an effective method for DR screening.

  19. Historic Methods for Capturing Magnetic Field Images

    Science.gov (United States)

    Kwan, Alistair

    2016-01-01

    I investigated two late 19th-century methods for capturing magnetic field images from iron filings for historical insight into the pedagogy of hands-on physics education methods, and to flesh out teaching and learning practicalities tacit in the historical record. Both methods offer opportunities for close sensory engagement in data-collection…

  20. Studies Comparing Screen-Film Mammography and Full-Field Digital Mammography in Breast Cancer Screening: Updated Review

    International Nuclear Information System (INIS)

    Skaane, P.

    2009-01-01

    Full-field digital mammography (FFDM) has several potential benefits as compared with screen-film mammography (SFM) in mammography screening. Digital technology also opens for implementation of advanced applications, including computer-aided detection (CAD) and tomosynthesis. Phantom studies and experimental clinical studies have shown that FFDM is equal or slightly superior to SFM for detection and characterization of mammographic abnormalities. Despite obvious advantages, the conversion to digital mammography has been slower than anticipated, and not only due to higher costs. Until very recently, some countries did not even permit the use of digital mammography in breast cancer screening. The reason for this reluctant attitude was concern about lower spatial resolution and about using soft-copy reading. Furthermore, there was a lack of data supporting improved diagnostic accuracy using FFDM in a screening setting, since two pioneer trials both showed nonsignificantly lower cancer detection rate at FFDM. The 10 studies comparing FFDM and SFM in mammography screening published so far have shown divergent and rather conflicting results. Nevertheless, there is a rapid conversion to digital mammography in breast cancer screening in many western countries. The aim of this article is to give an updated review of these studies, discuss the conflicting findings, and draw some conclusions from the results

  1. Visual field measurement with motion sensitivity screening test

    African Journals Online (AJOL)

    has been shown that early ocular lesions which manifest as visual field defects or ... easy-to-understand computer perimetry that could be useful in monitoring visual field changes in onchocer- .... education with the equivalent of ordinary level.

  2. Computational methods for reversed-field equilibrium

    International Nuclear Information System (INIS)

    Boyd, J.K.; Auerbach, S.P.; Willmann, P.A.; Berk, H.L.; McNamara, B.

    1980-01-01

    Investigating the temporal evolution of reversed-field equilibrium caused by transport processes requires the solution of the Grad-Shafranov equation and computation of field-line-averaged quantities. The technique for field-line averaging and the computation of the Grad-Shafranov equation are presented. Application of Green's function to specify the Grad-Shafranov equation boundary condition is discussed. Hill's vortex formulas used to verify certain computations are detailed. Use of computer software to implement computational methods is described

  3. A novel accelerated oxidative stability screening method for pharmaceutical solids.

    Science.gov (United States)

    Zhu, Donghua Alan; Zhang, Geoff G Z; George, Karen L S T; Zhou, Deliang

    2011-08-01

    Despite the fact that oxidation is the second most frequent degradation pathway for pharmaceuticals, means of evaluating the oxidative stability of pharmaceutical solids, especially effective stress testing, are still lacking. This paper describes a novel experimental method for peroxide-mediated oxidative stress testing on pharmaceutical solids. The method utilizes urea-hydrogen peroxide, a molecular complex that undergoes solid-state decomposition and releases hydrogen peroxide vapor at elevated temperatures (e.g., 30°C), as a source of peroxide. The experimental setting for this method is simple, convenient, and can be operated routinely in most laboratories. The fundamental parameter of the system, that is, hydrogen peroxide vapor pressure, was determined using a modified spectrophotometric method. The feasibility and utility of the proposed method in solid form selection have been demonstrated using various solid forms of ephedrine. No degradation was detected for ephedrine hydrochloride after exposure to the hydrogen peroxide vapor for 2 weeks, whereas both anhydrate and hemihydrate free base forms degraded rapidly under the test conditions. In addition, both the anhydrate and the hemihydrate free base degraded faster when exposed to hydrogen peroxide vapor at 30°C under dry condition than at 30°C/75% relative humidity (RH). A new degradation product was also observed under the drier condition. The proposed method provides more relevant screening conditions for solid dosage forms, and is useful in selecting optimal solid form(s), determining potential degradation products, and formulation screening during development. Copyright © 2011 Wiley-Liss, Inc.

  4. Geostatistical methods applied to field model residuals

    DEFF Research Database (Denmark)

    Maule, Fox; Mosegaard, K.; Olsen, Nils

    consists of measurement errors and unmodelled signal), and is typically assumed to be uncorrelated and Gaussian distributed. We have applied geostatistical methods to analyse the residuals of the Oersted(09d/04) field model [http://www.dsri.dk/Oersted/Field_models/IGRF_2005_candidates/], which is based...

  5. Teaching Geographic Field Methods Using Paleoecology

    Science.gov (United States)

    Walsh, Megan K.

    2014-01-01

    Field-based undergraduate geography courses provide numerous pedagogical benefits including an opportunity for students to acquire employable skills in an applied context. This article presents one unique approach to teaching geographic field methods using paleoecological research. The goals of this course are to teach students key geographic…

  6. Electromagnetic field computation by network methods

    CERN Document Server

    Felsen, Leopold B; Russer, Peter

    2009-01-01

    This monograph proposes a systematic and rigorous treatment of electromagnetic field representations in complex structures. The book presents new strong models by combining important computational methods. This is the last book of the late Leopold Felsen.

  7. Circling motion and screen edges as an alternative input method for on-screen target manipulation.

    Science.gov (United States)

    Ka, Hyun W; Simpson, Richard C

    2017-04-01

    To investigate a new alternative interaction method, called circling interface, for manipulating on-screen objects. To specify a target, the user makes a circling motion around the target. To specify a desired pointing command with the circling interface, each edge of the screen is used. The user selects a command before circling the target. To evaluate the circling interface, we conducted an experiment with 16 participants, comparing the performance on pointing tasks with different combinations of selection method (circling interface, physical mouse and dwelling interface) and input device (normal computer mouse, head pointer and joystick mouse emulator). A circling interface is compatible with many types of pointing devices, not requiring physical activation of mouse buttons, and is more efficient than dwell-clicking. Across all common pointing operations, the circling interface had a tendency to produce faster performance with a head-mounted mouse emulator than with a joystick mouse. The performance accuracy of the circling interface outperformed the dwelling interface. It was demonstrated that the circling interface has the potential as another alternative pointing method for selecting and manipulating objects in a graphical user interface. Implications for Rehabilitation A circling interface will improve clinical practice by providing an alternative pointing method that does not require physically activating mouse buttons and is more efficient than dwell-clicking. The Circling interface can also work with AAC devices.

  8. Trojan Horse Method: A tool to explore electron screening effect

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R G; Spitaleri, C; Cherubini, S; Cognata, M La; Lamia, L; Romano, S; Sergi, M L [Laboratori Nazionali del Sud-INFN, Catania (Italy) and Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Rolfs, C; Strieder, F [Ruhr Universitaet Bochum (Germany); Burjan, V; Kroha, V; Mrazek, J [Cyclotron Institute, Academy of Science, Rez (Czech Republic); Li, C; Wen, Q; Zhou, S [CIAE, Beijing (China); Tumino, A, E-mail: rgpizzone@lns.infn.i [Universita Kore, Erma (Italy)

    2010-01-01

    Owing the presence of the Coulomb barrier at astrophysically relevant energies, it is very difficult, or sometimes impossible to measure reaction rates for charged particle induced reactions. Moreover due to the presence of the electron screening effect in direct measurements, the relevant nuclear input for astrophysics, i.e. the bare nucleus S(E)-factor, can hardly be extracted. This is why different indirect techniques are being used along with direct measurements. The THM is an unique: indirect technique which allows one to measure reactions cross sections of astrophysical interest down the thermal energies typical of the different scenarios. The basic principle and a review of the main applications of the Trojan Horse Method are given. The applications aiming at the extraction of the bare S{sub b}(E) astrophysical factor and electron screening potentials U{sub e} for several two body processes are discussed.

  9. The Investigation of Screening of Chromoelectric and Chromomagnetic Fields in QGP in Noncovariant Gauges

    International Nuclear Information System (INIS)

    Veliev, E.S.

    2004-01-01

    According to Thermal Quantum Chromodynamics (TQCD) hadron matter may be exist in different phase states, in particular, in the form of quark-gluon plasma (QGP). The aim of the present work is to investigate the screening of chromoelectric and chromomagnetic fields in QGP in temporal gauge. In temporal gauge gluon propagator has the unphysical poles. Hence, in the gluon self energy diagram calculations the singularities appear. In order to remove these singularities we used Leibbrandt-Mandelstam prescription. We obtained that chromoelectric fields are screened, but chromomagnetic fields are not screened. In coordinate space, the screening of chromoelectric fields reduces the range of gauge interactions. In momentum space, it contributes to regulate the infrared behavior of the various n-point Green functions. Also, it is shown that the obtained results are gauge invariant

  10. Rapid screening of guar gum using portable Raman spectral identification methods.

    Science.gov (United States)

    Srivastava, Hirsch K; Wolfgang, Steven; Rodriguez, Jason D

    2016-01-25

    Guar gum is a well-known inactive ingredient (excipient) used in a variety of oral pharmaceutical dosage forms as a thickener and stabilizer of suspensions and as a binder of powders. It is also widely used as a food ingredient in which case alternatives with similar properties, including chemically similar gums, are readily available. Recent supply shortages and price fluctuations have caused guar gum to come under increasing scrutiny for possible adulteration by substitution of cheaper alternatives. One way that the U.S. FDA is attempting to screen pharmaceutical ingredients at risk for adulteration or substitution is through field-deployable spectroscopic screening. Here we report a comprehensive approach to evaluate two field-deployable Raman methods--spectral correlation and principal component analysis--to differentiate guar gum from other gums. We report a comparison of the sensitivity of the spectroscopic screening methods with current compendial identification tests. The ability of the spectroscopic methods to perform unambiguous identification of guar gum compared to other gums makes them an enhanced surveillance alternative to the current compendial identification tests, which are largely subjective in nature. Our findings indicate that Raman spectral identification methods perform better than compendial identification methods and are able to distinguish guar gum from other gums with 100% accuracy for samples tested by spectral correlation and principal component analysis. Published by Elsevier B.V.

  11. Method of valuation of water field capacity

    International Nuclear Information System (INIS)

    Dancette, C.; Maertens, C.

    1973-01-01

    A method allowing the obtention of an approximation of field capacity, with only the determination of water retention at pF=3, is described. In alluvial soils, the accuracy of this method appears sufficient to satisfy the current needs in agriculture problems [fr

  12. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  13. Compressible cavitation with stochastic field method

    Science.gov (United States)

    Class, Andreas; Dumond, Julien

    2012-11-01

    Non-linear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally the simulation of pdf transport requires Monte-Carlo codes based on Lagrange particles or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic field method solving pdf transport based on Euler fields has been proposed which eliminates the necessity to mix Euler and Lagrange techniques or prescribed pdf assumptions. In the present work, part of the PhD Design and analysis of a Passive Outflow Reducer relying on cavitation, a first application of the stochastic field method to multi-phase flow and in particular to cavitating flow is presented. The application considered is a nozzle subjected to high velocity flow so that sheet cavitation is observed near the nozzle surface in the divergent section. It is demonstrated that the stochastic field formulation captures the wide range of pdf shapes present at different locations. The method is compatible with finite-volume codes where all existing physical models available for Lagrange techniques, presumed pdf or binning methods can be easily extended to the stochastic field formulation.

  14. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  15. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  16. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    To provide a systematic overview of the various tools available to screen for post-stroke visual impairment. A review of the literature was conducted including randomised controlled trials, controlled trials, cohort studies, observational studies, systematic reviews and retrospective medical note reviews. All languages were included and translation was obtained. Participants included adults ≥18 years old diagnosed with a visual impairment as a direct cause of a stroke. We searched a broad range of scholarly online resources and hand-searched articles registers of published, unpublished and on-going trials. Search terms included a variety of MESH terms and alternatives in relation to stroke and visual conditions. Study selection was performed by two authors independently. The quality of the evidence and risk of bias were assessed using the STROBE, GRACE and PRISMA statements. A total of 25 articles (n = 2924) were included in this review. Articles appraised reported on tools screening solely for visual impairments or for general post-stroke disabilities inclusive of vision. The majority of identified tools screen for visual perception including visual neglect (VN), with few screening for visual acuity (VA), visual field (VF) loss or ocular motility (OM) defects. Six articles reported on nine screening tools which combined visual screening assessment alongside screening for general stroke disabilities. Of these, three included screening for VA; three screened for VF loss; three screened for OM defects and all screened for VN. Two tools screened for all visual impairments. A further 19 articles were found which reported on individual vision screening tests in stroke populations; two for VF loss; 11 for VN and six for other visual perceptual defects. Most tools cannot accurately account for those with aphasia or communicative deficits, which are common problems following a stroke. There is currently no standardised visual screening tool which can accurately

  17. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  18. Method for in vitro screening of aquatic fungicides

    Science.gov (United States)

    Bailey, T.A.

    1983-01-01

    Methods were developed for in vitro screening of candidate aquatic fungicides for efficacy against Achlya fiagellata, A. racemosa, Saprolegnia hypogyna and S. megasperma. Agar plugs containing fungal hyphae, removed from the edge of actively growing colonies, were placed in the depressions of spot plates containing 1a??0, 10a??0 and 100 mg/I of the candidate compounds for 15 or 60 min. After exposure, the plugs were transferred on to filter papers (0a??45-A?m pore) in a holder, rinsed, and then placed on cornmeal agar medium in tri-petri dishes. The plates were checked for mycelial growth after 48, 96 and 168 h of incubation in a lighted (400-800 A?m) environmental control chamber at 20A?2A?C. Criteria for the acceptance or rejection of candidate aquatic fungicides for further study were based on the antifungal spectrum index (ASI) comparisons between respective compounds and malachite green after 48 h and the concentration level producing complete growth inhibition. Candidate compounds whose ASI was less than 50% that of malachite green after 48 h or did not inhibit growth at levels less than 100 mg/l were rejected. This method provides a base from which in vivo and definitive test regimens can be developed. Preliminary in vitro screening of candidate fungicides reduces the need for costly in vivo tests on compounds that have low antifungal activity.

  19. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  20. Teaching Basic Field Skills Using Screen-Based Virtual Reality Landscapes

    Science.gov (United States)

    Houghton, J.; Robinson, A.; Gordon, C.; Lloyd, G. E. E.; Morgan, D. J.

    2016-12-01

    We are using screen-based virtual reality landscapes, created using the Unity 3D game engine, to augment the training geoscience students receive in preparing for fieldwork. Students explore these landscapes as they would real ones, interacting with virtual outcrops to collect data, determine location, and map the geology. Skills for conducting field geological surveys - collecting, plotting and interpreting data; time management and decision making - are introduced interactively and intuitively. As with real landscapes, the virtual landscapes are open-ended terrains with embedded data. This means the game does not structure student interaction with the information as it is through experience the student learns the best methods to work successfully and efficiently. These virtual landscapes are not replacements for geological fieldwork rather virtual spaces between classroom and field in which to train and reinforcement essential skills. Importantly, these virtual landscapes offer accessible parallel provision for students unable to visit, or fully partake in visiting, the field. The project has received positive feedback from both staff and students. Results show students find it easier to focus on learning these basic field skills in a classroom, rather than field setting, and make the same mistakes as when learning in the field, validating the realistic nature of the virtual experience and providing opportunity to learn from these mistakes. The approach also saves time, and therefore resources, in the field as basic skills are already embedded. 70% of students report increased confidence with how to map boundaries and 80% have found the virtual training a useful experience. We are also developing landscapes based on real places with 3D photogrammetric outcrops, and a virtual urban landscape in which Engineering Geology students can conduct a site investigation. This project is a collaboration between the University of Leeds and Leeds College of Art, UK, and all

  1. Visual Field Measurement with Motion Sensitivity Screening Test in ...

    African Journals Online (AJOL)

    Eye disease is a frequent complication of onchocerciasis in countrise where the disease is highly endemic. It has been shown that early ocular lesions which manifest as visual field defects or reduction in visual acuity can be reversed following treatment with ivermectin. At the community level, it is important to detect ...

  2. st Tomosynthesis Plus Full Field Digital Mammography or Full Field Digital Mammography Alone in the Screening Environment

    Directory of Open Access Journals (Sweden)

    Stamatia Destounis

    2014-01-01

    Full Text Available Objectives: Initial review of patients undergoing screening mammography imaged with a combination of digital breast tomosynthesis (DBT plus full field digital mammography (FFDM compared with FFDM alone. Materials and Methods: From June 2011 to December 2011, all patients presenting for routine screening mammography were offered a combination DBT plus FFDM exam. Under institutional review board approval, we reviewed 524 patients who opted for combination DBT plus FFDM and selected a sample group of 524 FFDM screening exams from the same time period for a comparative analysis. The χ2 (Chi-square test was used to compare recall rates, breast density, personal history of breast cancer, and family history of breast cancer between the two groups. Results: Recall rate for FFDM, 11.45%, was significantly higher (P < 0001 than in the combination DBT plus FFDM group (4.20%. The biopsy rate in the FFDM group was 2.29% (12/524, with a cancer detection rate of 0.38% (2/524, or 3.8 per 1000 and positive predictive value (PPV of 16.7% (2/12. The biopsy rate for the DBT plus FFDM group was 1.14% (n = 6/524, with a cancer detection rate 0.57% (n = 3/524, or 5.7 per 1000 and PPV of 50.0% (n = 3/6. Personal history of breast cancer in the FFDM group was significantly lower (P < 0.0001 than in the combination DBT plus FFDM group; 2.5% and 5.7%, respectively. A significant difference in family history of breast cancer (P < 0.0001 was found, with a higher rate in the combination DBT plus FFDM group (36.0% vs. 53.8%. There was a significant difference between the combination DBT plus FFDM group and FFDM alone group, when comparing breast density (P < 0.0147, 61.64% vs. 54.20% dense breasts, respectively with a higher rate of dense breasts in the DBT plus FFDM group. In follow-up, one cancer was detected within one year of normal screening mammogram in the combination DBT plus FFDM group. Conclusion: Our initial experience found the recall rate in the combination DBT

  3. A method for characterizing photon radiation fields

    International Nuclear Information System (INIS)

    Whicker, J.J.; Hsu, H.H.; Hsieh, F.H.; Borak, T.B.

    1999-01-01

    Uncertainty in dosimetric and exposure rate measurements can increase in areas where multi-directional and low-energy photons (< 100 keV) exist because of variations in energy and angular measurement response. Also, accurate measurement of external exposures in spatially non-uniform fields may require multiple dosimetry. Therefore, knowledge of the photon fields in the workplace is required for full understanding of the accuracy of dosimeters and instruments, and for determining the need for multiple dosimeters. This project was designed to develop methods to characterize photon radiation fields in the workplace, and to test the methods in a plutonium facility. The photon field at selected work locations was characterized using TLDs and a collimated NaI(Tl) detector from which spatial variations in photon energy distributions were calculated from measured spectra. Laboratory results showed the accuracy and utility of the method. Field measurement results combined with observed work patterns suggested the following: (1) workers are exposed from all directions, but not isotropically, (2) photon energy distributions were directionally dependent, (3) stuffing nearby gloves into the glovebox reduced exposure rates significantly, (4) dosimeter placement on the front of the chest provided for a reasonable estimate of the average dose equivalent to workers' torsos, (5) justifiable conclusions regarding the need for multiple dosimetry can be made using this quantitative method, and (6) measurements of the exposure rates with ionization chambers pointed with open beta windows toward the glovebox provided the highest measured rates, although absolute accuracy of the field measurements still needs to be assessed

  4. Eigenstates with the auxiliary field method

    Energy Technology Data Exchange (ETDEWEB)

    Semay, Claude [Service de Physique Nucleaire et Subnucleaire, Universite de Mons-UMONS, 20 Place du Parc, 7000 Mons (Belgium); Silvestre-Brac, Bernard, E-mail: claude.semay@umons.ac.b, E-mail: silvestre@lpsc.in2p3.f [LPSC Universite Joseph Fourier, Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Avenue des Martyrs 53, F-38026 Grenoble-Cedex (France)

    2010-07-02

    The auxiliary field method is a powerful technique to obtain approximate closed-form energy formulas for eigenequations in quantum mechanics. Very good results can be obtained for Schroedinger and semirelativistic Hamiltonians with various potentials, even in the case of many-body problems. This method can also provide approximate eigenstates in terms of well-known wavefunctions, for instance harmonic oscillator or hydrogen-like states, but with a characteristic size which depends on quantum numbers. In this paper, we consider two-body Schroedinger equations with linear, logarithmic and exponential potentials and show that analytical approximations of the corresponding eigenstates can be obtained with the auxiliary field method, with very good accuracy in some cases.

  5. Eigenstates with the auxiliary field method

    International Nuclear Information System (INIS)

    Semay, Claude; Silvestre-Brac, Bernard

    2010-01-01

    The auxiliary field method is a powerful technique to obtain approximate closed-form energy formulas for eigenequations in quantum mechanics. Very good results can be obtained for Schroedinger and semirelativistic Hamiltonians with various potentials, even in the case of many-body problems. This method can also provide approximate eigenstates in terms of well-known wavefunctions, for instance harmonic oscillator or hydrogen-like states, but with a characteristic size which depends on quantum numbers. In this paper, we consider two-body Schroedinger equations with linear, logarithmic and exponential potentials and show that analytical approximations of the corresponding eigenstates can be obtained with the auxiliary field method, with very good accuracy in some cases.

  6. Screening of the field of a static charge in an anisotropic magnetized plasma

    International Nuclear Information System (INIS)

    Arsenin, V.V.; Puzitskii, M.L.

    1991-01-01

    The field of a static charge placed in an equilibrium plasma is screened at a distance of the order of the Debye radius. Debye screening occurs both with and without an external magnetic field. This property also persists when the plasma is not an equilibrium plasma but the velocity distribution function of the particles is isotropic (the screening radius in this case contains the characteristic value of the energy instead of the temperature). The situation can change if the distribution is anisotropic. First, the drop in the field can become non-Debye. In particular, in an unmagnetized plasma some distribution functions are characterized by a power-law decrease of the field. Second, a static test charge induces a magnetic as well as an electrostatic field in an anisotropic plasma. In this communication the authors describe the anomalies of screening of the field of a static charge in a magnetized plasma. For definiteness they consider a situation (typical, e.g., of magnetic mirror systems) when the ionic component is anisotropic. The simplifications for the sake of computations are limited to the case of a charge which extends along the magnetic field and only harmonics much longer than the Debye length are significant in the Fourier expansion of the density of this charge in the longitudinal coordinate

  7. Electric Field Quantitative Measurement System and Method

    Science.gov (United States)

    Generazio, Edward R. (Inventor)

    2016-01-01

    A method and system are provided for making a quantitative measurement of an electric field. A plurality of antennas separated from one another by known distances are arrayed in a region that extends in at least one dimension. A voltage difference between at least one selected pair of antennas is measured. Each voltage difference is divided by the known distance associated with the selected pair of antennas corresponding thereto to generate a resulting quantity. The plurality of resulting quantities defined over the region quantitatively describe an electric field therein.

  8. Spectral methods in quantum field theory

    International Nuclear Information System (INIS)

    Graham, Noah; Quandt, Markus; Weigel, Herbert

    2009-01-01

    This concise text introduces techniques from quantum mechanics, especially scattering theory, to compute the effects of an external background on a quantum field in general, and on the properties of the quantum vacuum in particular. This approach can be succesfully used in an increasingly large number of situations, ranging from the study of solitons in field theory and cosmology to the determination of Casimir forces in nano-technology. The method introduced and applied in this book is shown to give an unambiguous connection to perturbation theory, implementing standard renormalization conditions even for non-perturbative backgrounds. It both gives new theoretical insights, for example illuminating longstanding questions regarding Casimir stresses, and also provides an efficient analytic and numerical tool well suited to practical calculations. Last but not least, it elucidates in a concrete context many of the subtleties of quantum field theory, such as divergences, regularization and renormalization, by connecting them to more familiar results in quantum mechanics. While addressed primarily at young researchers entering the field and nonspecialist researchers with backgrounds in theoretical and mathematical physics, introductory chapters on the theoretical aspects of the method make the book self-contained and thus suitable for advanced graduate students. (orig.)

  9. Field demonstration of rapid turnaround, multilevel groundwater screening

    International Nuclear Information System (INIS)

    Tingle, A.R.; Baker, L.; Long, D.D.

    1994-01-01

    A combined technology approach to rapidly characterizing source area and downgradient groundwater associated with a past fuel spill has been field tested. The purpose of this investigation was to determine the presence and extent of fuel-related compounds or indications of their biodegradation in groundwater. The distance from the source area to be investigated was established by calculating the potential extent of a plume based only on groundwater flow velocities. To accomplish this objective, commercially available technologies were combined and used to rapidly assess the source area and downgradient groundwater associated with the fuel discharge. The source of contamination that was investigated overlies glacial sand and gravel outwash deposits. Historical data suggest that from 1955 to 1970 as many as 1 to 6 million pi of aviation gasoline (AVGAS) were god at the study area. Although the remedial investigation (RI) for this study area indicated fuel-related groundwater contamination at the source area, fuel-related contamination was not detected in downgradient monitoring wells. Rapid horizontal groundwater velocities and the 24-year time span from the last reported spill farther suggest that a plume of contaminated groundwater could extend several thousand feet downgradient. The lack of contamination downgradient from the source suggests two possibilities: (1) monitoring wells installed during the RI did not intersect the plume or (2) fuel-related compounds had naturally degraded

  10. Renormalization using the background-field method

    International Nuclear Information System (INIS)

    Ichinose, S.; Omote, M.

    1982-01-01

    Renormalization using the background-field method is examined in detail. The subtraction mechanism of subdivergences is described with reference to multi-loop diagrams and one- and two-loop counter-term formulae are explicitly given. The original one-loop counter-term formula of 't Hooft is thereby improved. The present method of renormalization is far easier to manage than the usual one owing to the fact only gauge-invariant quantities are to be considered when worked in an appropriate gauge. Gravity and Yang-Mills theories are studied as examples. (orig.)

  11. A Desktop Screen Sharing System based on Various Connection Methods

    Science.gov (United States)

    Negishi, Yuya; Kawaguchi, Nobuo

    Recently it became very common to use information devices such as PCs during presentations and discussions. In these situations, a need arises for techniques that allow a smooth switch of presenters without changing cables, or an easy screen sharing in case of remote videoconferences. In this paper, we propose a desktop screen sharing system that can be used for such purposes and situations. For that, we designed an automatic control of connections in the VNC system that can be operated remotely over the network. We also suggested an interface that assigns a role such as “Screen sender" or “Screen receiver" to each terminal. In the proposed system, while sharing a screen between multiple terminals, one can easily display and browse the screen without having to understand how the others are connected. We also implemented a “role card" using contactless IC card, where roles are assigned only by placing the card in the IC reader.

  12. From Classical to High Throughput Screening Methods for Feruloyl Esterases: A Review.

    Science.gov (United States)

    Ramírez-Velasco, Lorena; Armendáriz-Ruiz, Mariana; Rodríguez-González, Jorge Alberto; Müller-Santos, Marcelo; Asaff-Torres, Ali; Mateos-Díaz, Juan Carlos

    2016-01-01

    Feruloyl esterases (FAEs) are a diverse group of hydrolases widely distributed in plants and microorganisms which catalyzes the cleavage and formation of ester bonds between plant cell wall polysaccharides and phenolic acids. FAEs have gained importance in biofuel, medicine and food industries due to their capability of acting on a large range of substrates for cleaving ester bonds and synthesizing highadded value molecules through esterification and transesterification reactions. During the past two decades extensive studies have been carried out on the production, characterization and classification of FAEs, however only a few reports of suitable High Throughput Screening assays for this kind of enzymes have been reported. This review is focused on a concise but complete revision of classical to High Throughput Screening methods for FAEs, highlighting its advantages and disadvantages, and finally suggesting future perspectives for this important research field.

  13. Population-based mammography screening: comparison of screen-film and full-field digital mammography with soft-copy reading--Oslo I study.

    Science.gov (United States)

    Skaane, Per; Young, Kari; Skjennald, Arnulf

    2003-12-01

    To compare screen-film and full-field digital mammography with soft-copy reading in a population-based screening program. Full-field digital and screen-film mammography were performed in 3,683 women aged 50-69 years. Two standard views of each breast were acquired with each modality. Images underwent independent double reading with use of a five-point rating scale for probability of cancer. Recall rates and positive predictive values were calculated. Cancer detection rates determined with both modalities were compared by using the McNemar test for paired proportions. Retrospective side-by-side analysis for conspicuity of cancers was performed by an external independent radiologist group with experience in both modalities. In 3,683 cases, 31 cancers were detected. Screen-film mammography depicted 28 (0.76%) malignancies, and full-field digital mammography depicted 23 (0.62%) malignancies. The difference between cancer detection rates was not significant (P =.23). The recall rate for full-field digital mammography (4.6%; 168 of 3,683 cases) was slightly higher than that for screen-film mammography (3.5%; 128 of 3,683 cases). The positive predictive value based on needle biopsy results was 46% for screen-film mammography and 39% for full-field digital mammography. Side-by-side image comparison for cancer conspicuity led to classification of 19 cancers as equal for probability of malignancy, six cancers as slightly better demonstrated at screen-film mammography, and six cancers as slightly better demonstrated at full-field digital mammography. There was no statistically significant difference in cancer detection rate between screen-film and full-field digital mammography. Cancer conspicuity was equal with both modalities. Full-field digital mammography with soft-copy reading is comparable to screen-film mammography in population-based screening.

  14. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  15. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, Kyung Ha; Hwang, Il Soon; Lee, Na Young; Oh, Young Jin; Kim, Ji Hyun; Park, Jin Ho; Sohn, Chang Ho

    2008-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by direct current potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by ultrasound technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts

  16. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, K.H.; Hwang, I.S.; Lee, N.Y.; Oh, Y.J.; Park, J.H.; Sohn, C.H.

    2007-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted in its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by a Direct Current Potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by Ultrasonic Technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts. (author)

  17. A novel method for screening the glutathione transferase inhibitors

    Directory of Open Access Journals (Sweden)

    Węgrzyn Grzegorz

    2009-03-01

    Full Text Available Abstract Background Glutathione transferases (GSTs belong to the family of Phase II detoxification enzymes. GSTs catalyze the conjugation of glutathione to different endogenous and exogenous electrophilic compounds. Over-expression of GSTs was demonstrated in a number of different human cancer cells. It has been found that the resistance to many anticancer chemotherapeutics is directly correlated with the over-expression of GSTs. Therefore, it appears to be important to find new GST inhibitors to prevent the resistance of cells to anticancer drugs. In order to search for glutathione transferase (GST inhibitors, a novel method was designed. Results Our results showed that two fragments of GST, named F1 peptide (GYWKIKGLV and F2 peptide (KWRNKKFELGLEFPNL, can significantly inhibit the GST activity. When these two fragments were compared with several known potent GST inhibitors, the order of inhibition efficiency (measured in reactions with 2,4-dinitrochlorobenzene (CDNB and glutathione as substrates was determined as follows: tannic acid > cibacron blue > F2 peptide > hematin > F1 peptide > ethacrynic acid. Moreover, the F1 peptide appeared to be a noncompetitive inhibitor of the GST-catalyzed reaction, while the F2 peptide was determined as a competitive inhibitor of this reaction. Conclusion It appears that the F2 peptide can be used as a new potent specific GST inhibitor. It is proposed that the novel method, described in this report, might be useful for screening the inhibitors of not only GST but also other enzymes.

  18. Display methods of electronic patient record screens: patient privacy concerns.

    Science.gov (United States)

    Niimi, Yukari; Ota, Katsumasa

    2013-01-01

    To provide adequate care, medical professionals have to collect not only medical information but also information that may be related to private aspects of the patient's life. With patients' increasing awareness of information privacy, healthcare providers have to pay attention to the patients' right of privacy. This study aimed to clarify the requirements of the display method of electronic patient record (EPR) screens in consideration of both patients' information privacy concerns and health professionals' information needs. For this purpose, semi-structured group interviews were conducted of 78 medical professionals. They pointed out that partial concealment of information to meet patients' requests for privacy could result in challenges in (1) safety in healthcare, (2) information sharing, (3) collaboration, (4) hospital management, and (5) communication. They believed that EPRs should (1) meet the requirements of the therapeutic process, (2) have restricted access, (3) provide convenient access to necessary information, and (4) facilitate interprofessional collaboration. This study provides direction for the development of display methods that balance the sharing of vital information and protection of patient privacy.

  19. [Use of Plusoptix as a screening method for refractive ambliopia].

    Science.gov (United States)

    Bogdănici, T; Tone, Silvia; Miron, Mihaela; Boboc, Mihaela; Bogdănici, Camelia

    2012-01-01

    Highlighting the differences in the objective refraction using the Plusoptix AO9 comparing them with the refraction performed with TOPCON KR-8900 autorefractor. Prospective study for 3 months held in the Ophthalmology Clinic in Iasi, Hospital Sf. Spiridon on a total of 39 children (21 girls and 18 boys) with mean age of 10.61 +/- 5.67 years. Clinical parameters: sex, age, objective refraction obtained with Plusoptix and with autorefractor corrected visual acuity (with different methods depending on each patient age), ortoptic examination (strabic deviation, binocular vision), the presence of symetry/asymetry while measuring with Plusoptix. The results were statistically processed by F-TEST calculating the correlation coefficient, standard deviation, significance level (using the spherical equivalent of the obtained values). Age limits of the studied cases ranged between 2-23 years. Visual acuity of children who had cooperate was between 0.2-1 with correction, achieving best values on right eye than left eye. 8 cases (20.51%) had large differences between measurements made with Plusoptix and autorefractor, half of that (4 cases) had strabismus. Three of these cases were with small hypermetropia and one with small myopia (Plusoptix shows a lower value). In 2 cases occurred higher differences (about 2-2,5D) between the 2 measurements, in patients with average hypermetropia. Plusoptix refraction was not possible at high hypermetropia or high myopia. This type of determining objective refraction using Plusoptix is a useful method of screening for discovery of refractive errors that can cause refractive amblyopia in young children and in those cases with a difficult collaboration. Because there are differences betweeti this 2 methods, for children with refractive errors are recommended further exploration to determine the appropriate optical correction. Plusoptix is a limited method because it cannot detect the exact values in those cases with high hypermetropia or high

  20. Implementation of a DOD ELAP Conforming Quality System at a FUSRAP Site Field Temporary Radiological Screening Laboratory - 13500

    International Nuclear Information System (INIS)

    Winters, M.S.; McElheny, G.; Houston, L.M.; Masset, M.R.; Spector, H.L.

    2013-01-01

    A case study is presented on specific program elements that supported the transition of a temporary field radiological screening lab to an accredited operation capable of meeting client quality objectives for definitive results data. The temporary field lab is located at the Formerly Utilized Sites Remedial Action Program Linde Site in Tonawanda, NY. The site is undergoing remediation under the direction of the United States Army Corps of Engineers - Buffalo District, with Cabrera Services Inc. as the remediation contractor and operator of the on-site lab. Analysis methods employed in the on-site lab include gross counting of alpha and beta particle activity on swipes and air filters and gamma spectroscopy of soils and other solid samples. A discussion of key program elements and lessons learned may help other organizations considering pursuit of accreditation for on-site screening laboratories. (authors)

  1. Paper analytical devices for fast field screening of beta lactam antibiotics and antituberculosis pharmaceuticals.

    Science.gov (United States)

    Weaver, Abigail A; Reiser, Hannah; Barstis, Toni; Benvenuti, Michael; Ghosh, Debarati; Hunckler, Michael; Joy, Brittney; Koenig, Leah; Raddell, Kellie; Lieberman, Marya

    2013-07-02

    Reports of low-quality pharmaceuticals have been on the rise in the past decade, with the greatest prevalence of substandard medicines in developing countries, where lapses in manufacturing quality control or breaches in the supply chain allow substandard medicines to reach the marketplace. Here, we describe inexpensive test cards for fast field screening of pharmaceutical dosage forms containing beta lactam antibiotics or combinations of the four first-line antituberculosis (TB) drugs. The devices detect the active pharmaceutical ingredients (APIs) ampicillin, amoxicillin, rifampicin, isoniazid, ethambutol, and pyrazinamide and also screen for substitute pharmaceuticals, such as acetaminophen and chloroquine that may be found in counterfeit pharmaceuticals. The tests can detect binders and fillers such as chalk, talc, and starch not revealed by traditional chromatographic methods. These paper devices contain 12 lanes, separated by hydrophobic barriers, with different reagents deposited in the lanes. The user rubs some of the solid pharmaceutical across the lanes and dips the edge of the paper into water. As water climbs up the lanes by capillary action, it triggers a library of different chemical tests and a timer to indicate when the tests are completed. The reactions in each lane generate colors to form a "color bar code" which can be analyzed visually by comparison with standard outcomes. Although quantification of the APIs is poor compared with conventional analytical methods, the sensitivity and selectivity for the analytes is high enough to pick out suspicious formulations containing no API or a substitute API as well as formulations containing APIs that have been "cut" with inactive ingredients.

  2. Relativistic mean-field approximation with density-dependent screening meson masses in nuclear matter

    International Nuclear Information System (INIS)

    Sun, Baoxi; Lu, Xiaofu; Shen, Pengnian; Zhao, Enguang

    2003-01-01

    The Debye screening masses of the σ, ω and neutral ρ mesons and the photon are calculated in the relativistic mean-field approximation. As the density of the nucleon increases, all the screening masses of mesons increase. A different result with Brown–Rho scaling is shown, which implies a reduction in the mass of all the mesons in the nuclear matter, except the pion. Replacing the masses of the mesons with their corresponding screening masses in the Walecka-1 model, five saturation properties of the nuclear matter are fixed reasonably, and then a density-dependent relativistic mean-field model is proposed without introducing the nonlinear self-coupling terms of mesons. (author)

  3. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Rapid screening method for plutonium in mixed waste samples

    International Nuclear Information System (INIS)

    Somers, W.; Culp, T.; Miller, R.

    1987-01-01

    A waste stream sampling program was undertaken to determine those waste streams which contained hazardous constituents, and would therefore be regulated as a hazardous waste under the Resource Conservation and Recovery Act. The waste streams also had the potential of containing radioactive material, either plutonium, americium, or depleted uranium. Because of the potential for contamination with radioactive material, a method of rapidly screening the liquid samples for radioactive material was required. A counting technique was devised to count a small aliquot of a sample, determine plutonium concentration, and allow the sample to be shipped the same day they were collected. This technique utilized the low energy photons (x-rays) that accompany α decay. This direct, non-destructive x-ray analysis was applied to quantitatively determine Pu-239 concentrations in industrial samples. Samples contained a Pu-239, Am-241 mixture; the ratio and/or concentrations of these two radionuclides was not constant. A computer program was designed and implemented to calculate Pu-239 activity and concentration (g/ml) using the 59.5 keV Am-241 peak to determine Am-241's contribution to the 17 keV region. Am's contribution was subtracted, yielding net counts in the 17 keV region due to Pu. 2 figs., 1 tab

  5. Establishment of screening method for effective vaccination using radiolabelled probe

    International Nuclear Information System (INIS)

    Nomaguchi, Hiroko; Yogi, Yasuko

    1998-01-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/ + and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, γ-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce γ-IFN in response to IL-12 were extremely limited in the nude mouse. On the contrary, for IL-18, γ-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of γ-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  6. Establishment of screening method for effective vaccination using radiolabelled probe

    Energy Technology Data Exchange (ETDEWEB)

    Nomaguchi, Hiroko; Yogi, Yasuko [National Inst. of Infectious Deseases, Tokyo (Japan)

    1998-02-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/{sup +} and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, {gamma}-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce {gamma}-IFN in response to IL-12 were extremely limited in the nude mouse. On the contray, for IL-18, {gamma}-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of {gamma}-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  7. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  8. Virtual screening methods as tools for drug lead discovery from large chemical libraries.

    Science.gov (United States)

    Ma, X H; Zhu, F; Liu, X; Shi, Z; Zhang, J X; Yang, S Y; Wei, Y Q; Chen, Y Z

    2012-01-01

    Virtual screening methods have been developed and explored as useful tools for searching drug lead compounds from chemical libraries, including large libraries that have become publically available. In this review, we discussed the new developments in exploring virtual screening methods for enhanced performance in searching large chemical libraries, their applications in screening libraries of ~ 1 million or more compounds in the last five years, the difficulties in their applications, and the strategies for further improving these methods.

  9. Evaluation of Screening Methods for the Detection of Urinary Tract ...

    African Journals Online (AJOL)

    2000-05-30

    screening testsfor urinary tract infection was donefrom March 20 to May 30, 2000. A cross sectional study ... the diagnosis of urinary tract infection on the basis of pyuria alone. The minimum number of ..... infection Complicating. Pregnancy J.

  10. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  11. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  12. Comparison of screen-film and full-field digital mammography in Japanese population-based screening

    International Nuclear Information System (INIS)

    Yamada, Takayuki; Saito, Mioko; Ishibashi, Tadashi

    2004-01-01

    The purpose of this study was to investigate how the greater contrast of full-field digital mammography (FFDM) affects the detection of suspicious lesions in Japanese population-based screening. Screen-film mammography (SFM) and FFDM were performed in 480 women aged 50 years or more. A set of mediolateral oblique views was obtained with each modality. All mammograms were independently double-read. The five-scale category assessment and type of finding using the Breast Imaging Reporting and Data System (BIRADS) nomenclature were given. Intraobserver variance, recall rates, and positive predictive value were calculated. The findings between the two modalities were discordant. κ-values for each reader were 0.619 and 0.385, respectively. Almost half of the microcalcifications were called with both modalities. The detection of masses was less concordant between the readers (27%). The masses were detected more frequently with FFDM (73%). Other findings were only detected with one modality. The recall rate was not significantly different (2.9% with SFM vs. 4.2% with FFDM; p=0.253). The positive predictive value was not significantly different (14% with SFM vs. 10% with FFDM; p=0.69), either. Two patients with breast cancer were detected with both modalities. Recall rates and positive predictive value were not significantly different between SFM and FFDM. Cancers were detected with both modalities. (author)

  13. Comparison of three field screening techniques for delineating petroleum hydrocarbon plumes in groundwater at a site in the southern Carson Desert, Nevada

    International Nuclear Information System (INIS)

    Smuin, D.R.

    1993-01-01

    Three types of field screening techniques used in the characterization of potentially contaminated sites at Naval Air Station Fallon, Nevada, are compared. The methods and results for each technique are presented. The three techniques include soil-gas surveys, electromagnetic geophysical surveys, and groundwater test hole screening. Initial screening at the first study site included two soil-gas surveys and electromagnetic geophysical studies. These screening methods identified I areas of contamination; however, results were inconclusive. Therefore groundwater test hole screening was performed. Groundwater screening consisted of auger drilling down to the shallow alluvial aquifer. Groundwater samples were collected from the open drill hole with a bailer. On-site head-space analyses for volatile organic compounds (VOCS) were performed using a portable gas chromatograph (GC). Five areas of floating petroleum hydrocarbon product were identified along with the overall dissolved contaminant plume boundaries. Well placement was re-evaluated, and well sites were relocated based on the screening information. The most effective technique for identification of petroleum hydrocarbon-contaminant plumes was groundwater test hole screening. Groundwater screening was subsequently performed at 19 other sites. A total of 450 test holes were analyzed resulting in the delineation of six plumes

  14. 77 FR 4544 - CPSC Symposium on Phthalates Screening and Testing Methods

    Science.gov (United States)

    2012-01-30

    ... Screening and Testing Methods AGENCY: Consumer Product Safety Commission. ACTION: Notice. SUMMARY: The... symposium on phthalates screening and testing methods. The symposium will be held at the CPSC's National... submit comments, identified by Docket No. CPSC-2012-0008, by any of the following methods: Electronic...

  15. Screening for chloroquine maculopathy in populations with uncertain reliability in outcomes of automatic visual field testing

    NARCIS (Netherlands)

    P. Kunavisarut (Paradee); Chavengsaksongkram, P. (Pimploy); A. Rothová (Aniki); K. Pathanapitoon (Kessara)

    2016-01-01

    textabstractPurpose: The purpose of this study was to compare screening methods for the early detection of maculopathy in patients treated with chloroquine (CQ) or hydroxychloroquine (HCQ) and to identify the risk factors for the development of toxic maculopathy. Methods: We performed a prospective

  16. Surface potential at a ferroelectric grain due to asymmetric screening of depolarization fields

    Energy Technology Data Exchange (ETDEWEB)

    Genenko, Yuri A., E-mail: genenko@mm.tu-darmstadt.de; Hirsch, Ofer [Technische Universität Darmstadt, Darmstadt (Germany); Erhart, Paul [Chalmers University of Technology, Gothenburg (Sweden)

    2014-03-14

    Nonlinear screening of electric depolarization fields, generated by a stripe domain structure in a ferroelectric grain of a polycrystalline material, is studied within a semiconductor model of ferroelectrics. It is shown that the maximum strength of local depolarization fields is rather determined by the electronic band gap than by the spontaneous polarization magnitude. Furthermore, field screening due to electronic band bending and due to presence of intrinsic defects leads to asymmetric space charge regions near the grain boundary, which produce an effective dipole layer at the surface of the grain. This results in the formation of a potential difference between the grain surface and its interior of the order of 1 V, which can be of either sign depending on defect transition levels and concentrations. Exemplary acceptor doping of BaTiO{sub 3} is shown to allow tuning of the said surface potential in the region between 0.1 and 1.3 V.

  17. Fiber-optic surface-enhanced Raman system for field screening of hazardous compounds

    International Nuclear Information System (INIS)

    Ferrell, T.L.; Goudonnet, J.P.; Arakawa, E.T.; Reddick, R.C.; Gammage, R.B.; Haas, J.W.; James, D.R.; Wachter, E.A.

    1988-01-01

    Surface-enhanced Raman scattering permits identification of compounds adsorbed onto a metal microbase that is microlithographically produced with submicron resolution. Less than one percent of a monolayer of a Raman Active target compound offers a high signal-to-noise ratio. By depositing the microbase on the exterior of a fiber optic cable, convenient field screening or monitoring is permitted. By using highly effective microbases, it is possible to reduce laser power requirements sufficiently to allow an economical, but complete, system to be housed in a suitcase. We shall present details of SERS system of this type and shall show data on samples of interest in the screening of hazardous compounds

  18. Barriers to Breast and Cervical Cancer Screening in Singapore: a Mixed Methods Analysis.

    Science.gov (United States)

    Malhotra, Chetna; Bilger, Marcel; Liu, Joy; Finkelstein, Eric

    2016-01-01

    In order to increase breast and cervical cancer screening uptake in Singapore, women's perceived barriers to screening need to be identified and overcome. Using data from both focus groups and surveys, we aimed to assess perceived barriers and motivations for breast and cervical cancer screening. We conducted 8 focus groups with 64 women, using thematic analysis to identify overarching themes related to women's attitudes towards screening. Based on recurring themes from focus groups, several hypotheses regarding potential barriers and motivations to screen were generated and tested through a national survey of 801 women aged 25-64. Focus group participants had misconceptions related to screening, believing that the procedures were painful. Cost was an issue, as well as efficacy and fatalism. By identifying barriers to and motivators for screening through a mixed-method design that has both nuance and external validity, this study offers valuable suggestions to policymakers to improve breast and cervical cancer screening uptake in Singapore.

  19. Development of thermal stress screening method. Application of green function method

    International Nuclear Information System (INIS)

    Furuhashi, Ichiro; Shibamoto, Hiroshi; Kasahara, Naoto

    2004-01-01

    This work was achieved for the development of the screening method of thermal transient stresses in FBR components. We proposed an approximation method for evaluations of thermal stress under variable heat transfer coefficients (non-linear problems) using the Green functions of thermal stresses with constant heat transfer coefficients (linear problems). Detailed thermal stress analyses provided Green functions for a skirt structure and a tube-sheet of Intermediate Heat Exchanger. The upper bound Green functions were obtained by the analyses using those upper bound heat transfer coefficients. The medium and the lower bound Green functions were got by the analyses of those under medium and the lower bound heat transfer coefficients. Conventional evaluations utilized the upper bound Green functions. On the other hand, we proposed a new evaluation method by using the upper bound, medium and the lower bound Green functions. The comparison of above results gave the results as follows. The conventional evaluations were conservative and appropriate for the cases under one fluid thermal transient structure such as the skirt. The conventional evaluations were generally conservative for the complicated structures under two or more fluids thermal transients such as the tube-sheet. But the danger locations could exists for the complicated structures under two or more fluids transients, namely the conventional evaluations were non-conservative. The proposed evaluations gave good estimations for these complicated structures. Though above results, we have made the basic documents of the screening method of thermal transient stresses using the conventional method and the new method. (author)

  20. Assessment of automated disease detection in diabetic retinopathy screening using two-field photography.

    Science.gov (United States)

    Goatman, Keith; Charnley, Amanda; Webster, Laura; Nussey, Stephen

    2011-01-01

    To assess the performance of automated disease detection in diabetic retinopathy screening using two field mydriatic photography. Images from 8,271 sequential patient screening episodes from a South London diabetic retinopathy screening service were processed by the Medalytix iGrading™ automated grading system. For each screening episode macular-centred and disc-centred images of both eyes were acquired and independently graded according to the English national grading scheme. Where discrepancies were found between the automated result and original manual grade, internal and external arbitration was used to determine the final study grades. Two versions of the software were used: one that detected microaneurysms alone, and one that detected blot haemorrhages and exudates in addition to microaneurysms. Results for each version were calculated once using both fields and once using the macula-centred field alone. Of the 8,271 episodes, 346 (4.2%) were considered unassessable. Referable disease was detected in 587 episodes (7.1%). The sensitivity of the automated system for detecting unassessable images ranged from 97.4% to 99.1% depending on configuration. The sensitivity of the automated system for referable episodes ranged from 98.3% to 99.3%. All the episodes that included proliferative or pre-proliferative retinopathy were detected by the automated system regardless of configuration (192/192, 95% confidence interval 98.0% to 100%). If implemented as the first step in grading, the automated system would have reduced the manual grading effort by between 2,183 and 3,147 patient episodes (26.4% to 38.1%). Automated grading can safely reduce the workload of manual grading using two field, mydriatic photography in a routine screening service.

  1. Current and emerging screening methods to identify post-head-emergence frost adaptation in wheat and barley.

    Science.gov (United States)

    Frederiks, T M; Christopher, J T; Harvey, G L; Sutherland, M W; Borrell, A K

    2012-09-01

    Cereal crops can suffer substantial damage if frosts occur at heading. Identification of post-head-emergence frost (PHEF) resistance in cereals poses a number of unique and difficult challenges. Many decades of research have failed to identify genotypes with PHEF resistance that could offer economically significant benefit to growers. Research and breeding gains have been limited by the available screening systems. Using traditional frost screening systems, genotypes that escape frost injury in trials due to spatial temperature differences and/or small differences in phenology can be misidentified as resistant. We believe that by improving techniques to minimize frost escapes, such 'false-positive' results can be confidently identified and eliminated. Artificial freezing chambers or manipulated natural frost treatments offer many potential advantages but are not yet at the stage where they can be reliably used for frost screening in breeding programmes. Here we describe the development of a novel photoperiod gradient method (PGM) that facilitates screening of genotypes of different phenology under natural field frosts at matched developmental stages. By identifying frost escapes and increasing the efficiency of field screening, the PGM ensures that research effort can be focused on finding genotypes with improved PHEF resistance. To maximize the likelihood of identifying PHEF resistance, we propose that the PGM form part of an integrated strategy to (i) source germplasm;(ii) facilitate high throughput screening; and (iii) permit detailed validation. PGM may also be useful in other studies where either a range of developmental stages and/or synchronized development are desired.

  2. Narrow field electromagnetic sensor system and method

    International Nuclear Information System (INIS)

    McEwan, T.E.

    1996-01-01

    A narrow field electromagnetic sensor system and method of sensing a characteristic of an object provide the capability to realize a characteristic of an object such as density, thickness, or presence, for any desired coordinate position on the object. One application is imaging. The sensor can also be used as an obstruction detector or an electronic trip wire with a narrow field without the disadvantages of impaired performance when exposed to dirt, snow, rain, or sunlight. The sensor employs a transmitter for transmitting a sequence of electromagnetic signals in response to a transmit timing signal, a receiver for sampling only the initial direct RF path of the electromagnetic signal while excluding all other electromagnetic signals in response to a receive timing signal, and a signal processor for processing the sampled direct RF path electromagnetic signal and providing an indication of the characteristic of an object. Usually, the electromagnetic signal is a short RF burst and the obstruction must provide a substantially complete eclipse of the direct RF path. By employing time-of-flight techniques, a timing circuit controls the receiver to sample only the initial direct RF path of the electromagnetic signal while not sampling indirect path electromagnetic signals. The sensor system also incorporates circuitry for ultra-wideband spread spectrum operation that reduces interference to and from other RF services while allowing co-location of multiple electronic sensors without the need for frequency assignments. 12 figs

  3. Screen-film mammography versus full-field digital mammography in a population-based screening program: The Sogn and Fjordane study

    International Nuclear Information System (INIS)

    Juel, Inger-Marie; Johannessen, Gunnar; Skaane, Per; Roth Hoff, Solveig; Hofvind, Solveig

    2010-01-01

    Background: Studies comparing analog and digital mammography in breast cancer screening have shown conflicting results. Little is known about the use of digital photon-counting detectors. Purpose: To retrospectively compare performance indicators in screen-film (SFM) and full-field digital mammography (FFDM) using a photon-counting detector in a population-based screening program. Material and Methods: The Norwegian Social Science Data Services approved the study, which was part of the Norwegian Breast Cancer Screening Program. The program invites women aged 50-69 years to two-view mammography biannually. The study period was January 2005 to June 2006 for SFM and August 2006 to December 2007 for FFDM. Independent double reading was performed using a five-point rating scale for probability of cancer. Recalls due to abnormal mammography were retrospectively reviewed by an expert panel. Performance indicators for the two techniques were compared. Attendance rate was 83.6% (7442/8901) for SFM and 82.0% (6932/8451) for FFDM. Results: The recall rate due to abnormal mammography, cancer detection rate and positive predictive value did not differ significantly between SFM and FFDM: recall 2.3% (174/7442) versus 2.4% (168/6932), cancer detection 0.39% (29/7442) versus 0.48% (33/6932), positive predictive value 16.7% (29/174) versus 19.6% (33/168), respectively (P>0.05 for all). The recall rate due to technically inadequate mammograms was 0.3% (19/7442) for SFM and 0.01% (1/6932) for FFDM. In the retrospective review, a significantly higher proportion of calcifications and asymmetric density were categorized as normal or definitively benign in FFDM compared with SFM. The average glandular dose was 2.17 mGy for SFM and 1.25 mGy for FFDM. Conclusion: Performance indicators show that FFDM using photon-counting detector is suitable for breast cancer screening. The lower radiation dose and lower recalls due to technically inadequate mammograms are of importance in mammography

  4. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23)

    DEFF Research Database (Denmark)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe

    2018-01-01

    arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. ANALYSES: The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study......INTRODUCTION: The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could...... vaccination as girls. METHODS: Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme...

  5. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  6. Mathematical methods in geometrization of coal field

    Science.gov (United States)

    Shurygin, D. N.; Kalinchenko, V. M.; Tkachev, V. A.; Tretyak, A. Ya

    2017-10-01

    In the work, the approach to increase overall performance of collieries on the basis of an increase in accuracy of geometrization of coal thicknesses is considered. The sequence of stages of mathematical modelling of spatial placing of indicators of a deposit taking into account allocation of homogeneous sites of thickness and an establishment of quantitative interrelations between mountain-geological indicators of coal layers is offered. As a uniform mathematical method for modelling of various interrelations, it is offered to use a method of the group accounting of arguments (MGUA), one of versions of the regressive analysis. This approach can find application during delimitation between geological homogeneous sites of coal thicknesses in the form of a linear discriminant function. By an example of division into districts of a mine field in the conditions of mine “Sadkinsky” (East Donbass), the use of the complex approach for forecasting of zones of the small amplitude of disturbance of a coal layer on the basis of the discriminant analysis and MGUA is shown.

  7. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  8. Relaxing the electrostatic screening effect by patterning vertically-aligned silicon nanowire arrays into bundles for field emission application

    Energy Technology Data Exchange (ETDEWEB)

    Hung, Yung-Jr, E-mail: yungjrhung@gmail.com [Department of Electronic Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Department of Photonics, National Sun Yat-sen University, No. 70, Lienhai Rd., Kaohsiung 80424, Taiwan, ROC (China); Graduate Institute of Electro-Optical Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Lee, San-Liang [Department of Electronic Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Graduate Institute of Electro-Optical Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Beng, Looi Choon [Faculty of Engineering, Multimedia University, Jalan Multimedia, 63100 Cyberjaya, Selangor (Malaysia); Chang, Hsuan-Chen [Department of Electronic Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Graduate Institute of Electro-Optical Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Huang, Yung-Jui [Graduate Institute of Electro-Optical Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Lee, Kuei-Yi; Huang, Ying-Sheng [Department of Electronic Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China); Graduate Institute of Electro-Optical Engineering, National Taiwan University of Science and Technology, No. 43, Sec. 4, Keelung Rd., Taipei 106, Taiwan, ROC (China)

    2014-04-01

    Top-down fabrication strategies are proposed and demonstrated to realize arrays of vertically-aligned silicon nanowire bundles and bundle arrays of carbon nanotube–silicon nanowire (CNT–SiNW) heterojunctions, aiming for releasing the electrostatic screening effect and improving the field emission characteristics. The trade-off between the reduction in the electrostatic screening effect and the decrease of emission sites leads to an optimal SiNW bundle arrangement which enables the lowest turn-on electric field of 1.4 V/μm and highest emission current density of 191 μA/cm{sup 2} among all testing SiNW samples. Benefiting from the superior thermal and electrical properties of CNTs and the flexible patterning technologies available for SiNWs, bundle arrays of CNT–SiNW heterojunctions show improved and highly-uniform field emission with a lower turn-on electric field of 0.9 V/μm and higher emission current density of 5.86 mA/cm{sup 2}. The application of these materials and their corresponding fabrication approaches is not limited to the field emission but can be used for a variety of emerging fields like nanoelectronics, lithium-ion batteries, and solar cells. - Highlights: • Aligned silicon nanowire (SiNW) bundle arrays are realized with top-down methods. • Growing carbon nanotubes atop SiNW bundle arrays enable uniform field emission. • A turn-on field of 0.9 V/μm and an emission current of > 5 mA/cm{sup 2} are achieved.

  9. Research on atmospheric transmission distortion of Gauss laser using multiple phase screen method

    Science.gov (United States)

    Zhang, Yizhuo; Wang, Qiushi; Gu, Haidong

    2018-02-01

    The laser beam is attenuated, broadened, defocused and may even be deflected from its initial propagation direction as it propagates through the atmosphere. It leads to the decrease of the laser intensity of the receiving surface. Gauss beam is the fundamental components of all possible laser waveforms. Therefore, research on the transmission of the Gauss laser has far-reaching consequences in optical communication, weaponry, target designation, ranging, remote sensing and other applications that require transmission of laser beams through the atmosphere. In this paper, we propose a laboratory simulation method using multi-phase screen to calculate the effects of atmospheric turbulence. Theoretical analysis of Gauss laser transmission in the atmosphere is given. By calculating the propagation of the Gauss beam TEM00, the far field intensity and phase distribution is shown. By the given method, the optical setup is presented and used for optimizing the adaptive optics algorithm.

  10. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  11. MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD

    Science.gov (United States)

    2017-06-01

    MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD ECBC-TR...TITLE AND SUBTITLE Mass Spectrometry Proteomics Method as a Rapid Screening Tool for Bacterial Contamination of Food 5a. CONTRACT NUMBER 5b...the MSPM to correctly classify whether or not food samples were contaminated with Salmonella enterica serotype Newport in this blinded pilot study

  12. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  14. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  15. Staging Henry Fielding: The Author-Narrator in Tom Jones On Screen

    OpenAIRE

    Løfaldli, Eli

    2017-01-01

    As recent adaptation theory has shown, classic-novel adaptation typically sets issues connected to authorship and literal and figurative ownership into play. This key feature of such adaptations is also central to the screen versions of Henry Fielding’s Tom Jones (1749). In much of Fielding’s fiction, the narrator, typically understood as an embodiment of Fielding himself, is a particularly prominent presence. The author-narrator in Tom Jones is no exception: not only is his presence strongly...

  16. Screen film vs full-field digital mammography: image quality, detectability and characterization of lesions

    International Nuclear Information System (INIS)

    Obenauer, S.; Luftner-Nagel, S.; Heyden, D. von; Baum, F.; Grabbe, E.; Munzel, U.

    2002-01-01

    The objective of this study was to compare screen-film mammography (SFM) to full-field digital mammography (FFDM) regarding image quality as well as detectability and characterization of lesions using equivalent images of the same patient acquired with both systems. Two mammography units were used, one with a screen-film system (Senographe DMR) and the other with a digital detector (Senographe 2000D, both GEMS). Screen-film and digital mammograms were performed on 55 patients with cytologically or histologically proven tumors on the same day. Together with these, 75 digital mammograms of patients without tumor and the corresponding previous screen-film mammograms not older than 1.5 years were reviewed by three observers in a random order. Contrast, exposure, and the presence of artifacts were evaluated. Different details, such as the skin, the retromamillary region, and the parenchymal structures, were judged according to a three-point ranking scale. Finally, the detectability of microcalcifications and lesions were compared and correlated to histology. Image contrast was judged to be good in 76%, satisfactory in 20%, and unsatisfactory in 4% of screen-film mammograms. Digital mammograms were judged to be good in 99% and unsatisfactory in 1% of cases. Improper exposure of screen-film system occurred in 18% (10% overexposed and 8% underexposed). Digital mammograms were improperly exposed in 4% of all cases but were of acceptable quality after post-processing. Artifacts, most of them of no significance, were found in 78% of screen-film and in none of the digital mammograms. Different anatomical regions, such as the skin, the retromamillary region, and dense parenchymal areas, were better visualized in digital than in screen-film mammography. All malignant tumors were seen by the three radiologists; however, digital mammograms allowed a better characterization of these lesions to the Breast Imaging Reporting and Data System (BI-RADSZZZ;) categories (FFDM better than

  17. Three screening methods for cognitive dysfunction using the Mini-Mental State Examination and Korean Dementia Screening Questionnaire.

    Science.gov (United States)

    Choi, Seong Hye; Park, Moon Ho

    2016-02-01

    To screen for and determine cognitive dysfunction, cognitive tests and/or informant reports are commonly used. However, these cognitive tests and informant reports are not always available. The present study investigated three screening methods using the Mini-Mental State Examination (MMSE) as the cognitive test, and the Korean dementia screening questionnaire (KDSQ) as the informant report. Participants were recruited from the Korea Clinical Research Center for Dementia of South Korea, and included 2861 patients with Alzheimer's disease (dementia), 3519 patients with mild cognitive impairment and 1375 controls with no cognitive dysfunction. Three screening methods were tested: (i) MMSE alone (MMSE(cut-off) ); (ii) a conventional combination of MMSE and KDSQ (MMSE+KDSQ(cut-off) ); and (iii) a decision tree with MMSE and KDSQ (MMSE+KDSQ(decision tree) ). For discriminating any cognitive dysfunction from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.784). For discriminating dementia from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.899). For discriminating mild cognitive impairment from controls, MMSE(cut-off) had the highest area under the receiver operating characteristic curve (0.683). MMSE+KDSQ(decision tree) showed the highest sensitivity for all discriminations. For overall classification accuracy, MMSE+KDSQ(decision tree) had the highest value (70.0%). These three methods had different advantageous properties for screening and staging cognitive dysfunction. As there might be different availability across clinical settings, these three methods can be selected and used according to situational needs. © 2015 Japan Geriatrics Society.

  18. Field-based evaluations of horizontal flat-plate fish screens, II: Testing of a unique off-stream channel device - The Farmers Screen

    Science.gov (United States)

    Mesa, Matthew G.; Rose, Brien P.; Copeland, Elizabeth S.

    2012-01-01

    Screens are installed at water diversion sites to reduce entrainment of fish. Recently, the Farmers Irrigation District (Oregon) developed a unique flat-plate screen (the “Farmers Screen”) that operates passively and may offer reduced installation and operating costs. To evaluate the effectiveness of this screen on fish, we conducted two separate field experiments. First, juvenile coho salmon Oncorhynchus kisutch were released over a working version of this screen under a range of inflows (0.02–0.42 m3/s) and diversion flows (0.02–0.34 m3/s) at different water depths. Mean approach velocities ranged from 0 to 5 cm/s and sweeping velocities ranged from 36 to 178 cm/s. Water depths over the screen surface ranged from 1 to 25 cm and were directly related to inflow. Passage of fish over the screen under these conditions did not severely injure them or cause delayed mortality, and no fish were observed becoming impinged on the screen surface. Second, juvenile coho salmon and steelhead O. mykiss were released at the upstream end of a 34-m flume and allowed to volitionally move downstream and pass over a 3.5-m section of the Farmers Screen to determine whether fish would refuse to pass over the screen after encountering its leading edge. For coho salmon, 75–95% of the fish passed over the screen within 5 min and 82–98% passed within 20 min, depending on hydraulic conditions. For steelhead, 47–90% of the fish passed over the screen within 5 min and 79–95% passed within 20 min. Our results indicate that when operated within its design criteria, the Farmers Screen provides safe and efficient downstream passage of juvenile salmonids under a variety of hydraulic conditions.

  19. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  20. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  1. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  2. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  3. Efficient Calculation of Near Fields in the FDTD Method

    DEFF Research Database (Denmark)

    Franek, Ondrej

    2011-01-01

    When calculating frequency-domain near fields by the FDTD method, almost 50 % reduction in memory and CPU operations can be achieved if only E-fields are stored during the main time-stepping loop and H-fields computed later. An improved method of obtaining the H-fields from Faraday's Law is prese...

  4. Screening-induced surface polar optical phonon scattering in dual-gated graphene field effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Bo, E-mail: hubo2011@semi.ac.cn

    2015-03-15

    The effect of surface polar optical phonons (SOs) from the dielectric layers on electron mobility in dual-gated graphene field effect transistors (GFETs) is studied theoretically. By taking into account SO scattering of electron as a main scattering mechanism, the electron mobility is calculated by the iterative solution of Boltzmann transport equation. In treating scattering with the SO modes, the dynamic dielectric screening is included and compared to the static dielectric screening and the dielectric screening in the static limit. It is found that the dynamic dielectric screening effect plays an important role in the range of low net carrier density. More importantly, in-plane acoustic phonon scattering and charged impurity scattering are also included in the total mobility for SiO{sub 2}-supported GFETs with various high-κ top-gate dielectric layers considered. The calculated total mobility results suggest both Al{sub 2}O{sub 3} and AlN are the promising candidate dielectric layers for the enhancement in room temperature mobility of graphene in the future.

  5. Appraisal of artificial screening techniques of tomato to accurately reflect field performance of the late blight resistance.

    Directory of Open Access Journals (Sweden)

    Marzena Nowakowska

    Full Text Available Late blight (LB caused by the oomycete Phytophthora infestans continues to thwart global tomato production, while only few resistant cultivars have been introduced locally. In order to gain from the released tomato germplasm with LB resistance, we compared the 5-year field performance of LB resistance in several tomato cultigens, with the results of controlled conditions testing (i.e., detached leaflet/leaf, whole plant. In case of these artificial screening techniques, the effects of plant age and inoculum concentration were additionally considered. In the field trials, LA 1033, L 3707, L 3708 displayed the highest LB resistance, and could be used for cultivar development under Polish conditions. Of the three methods using controlled conditions, the detached leaf and the whole plant tests had the highest correlation with the field experiments. The plant age effect on LB resistance in tomato reported here, irrespective of the cultigen tested or inoculum concentration used, makes it important to standardize the test parameters when screening for resistance. Our results help show why other reports disagree on LB resistance in tomato.

  6. Screening of sunflower cultivars for metal phytoextraction in a contaminated field prior to mutagenesis.

    Science.gov (United States)

    Nehnevajova, Erika; Herzig, Rolf; Federer, Guido; Erismann, Karl-Hans; Schwitzguébel, Jean-Paul

    2005-01-01

    Sunflower can be used for the remediation of metal-contaminated soils. Its high biomass production makes this plant species interestingfor phytoextraction and using sunflower oil for a technical purpose may improve the economic balance of phytoremediation. The aim of the present field study was to screen 15 commercial cultivars of Helianthus annuus L. grown on metal-contaminated soil, to find out the variety with the highest metal extraction, which can be further improved by mutation or in vitro breeding procedures. Two different fertilizers (ammonium sulphate and ammonium nitrate) were also used to enhance the bioavailability of metals in soil Highly significant differences were observed within tested varieties for metal accumulation and extraction efficiency. Furthermore, ammonium nitrate increased cadmium extraction, whereas ammonium sulphate enhanced zinc and lead uptake in most tested cultivars. In this field-based sunflower screening, we found enhanced cumulative Cd, Zn, and Pb extraction efficiency by a factor 4.4 for Salut cultivar. We therefore emphasize that prior to any classical breeding or genetic engineering enhancing metal uptake potential, a careful screening of various genotypes should be done to select the cultivar with the naturally highest metal uptake and to start the genetic improvement with the best available plant material.

  7. Use of passive alpha detectors to screen for uranium contamination in a field at Fernald, Ohio

    International Nuclear Information System (INIS)

    Dudney, C.S.; Meyer, K.E.; Gammage, R.B.; Wheeler, R.V.; Salasky, M.; Kotrappa, P.

    1995-01-01

    This paper reports the results from a field test of newly developed techniques for inexpensive, in situ screening of soil for alpha contamination. Passive alpha detectors that are commercially available for the detection indoor airborne alpha activity (i.e., 222 Rn) have been modified so they can be applied to the detection of alpha contamination on surfaces or in soils. Results reported here are from an intercomparison involving several different techniques with all measurements being made at the same sites in a field near the formerly used uranium processing facility at Fernald, Ohio, during the summer of 1994. The results for two types of passive alpha detector show that the quality of calibration is improved if soils samples are milled to increase homogeneity within the soil matrices. The correlation between laboratory based radiochemical analyses and quick, field-based screening measurements is acceptable and can be improved if the passive devices are left for longer exposure times in the field. The total cost per measurement for either type of passive alpha detector is probably less than $25 and should provide a cost-effective means for site managers to develop the information needed to find areas with remaining alpha contamination so resources can be allocated efficiently

  8. Developing the clinical components of a complex intervention for a glaucoma screening trial: a mixed methods study

    Directory of Open Access Journals (Sweden)

    2011-04-01

    Full Text Available Abstract Background Glaucoma is a leading cause of avoidable blindness worldwide. Open angle glaucoma is the most common type of glaucoma. No randomised controlled trials have been conducted evaluating the effectiveness of glaucoma screening for reducing sight loss. It is unclear what the most appropriate intervention to be evaluated in any glaucoma screening trial would be. The purpose of this study was to develop the clinical components of an intervention for evaluation in a glaucoma (open angle screening trial that would be feasible and acceptable in a UK eye-care service. Methods A mixed-methods study, based on the Medical Research Council (MRC framework for complex interventions, integrating qualitative (semi-structured interviews with 46 UK eye-care providers, policy makers and health service commissioners, and quantitative (economic modelling methods. Interview data were synthesised and used to revise the screening interventions compared within an existing economic model. Results The qualitative data indicated broad based support for a glaucoma screening trial to take place in primary care, using ophthalmic trained technical assistants supported by optometry input. The precise location should be tailored to local circumstances. There was variability in opinion around the choice of screening test and target population. Integrating the interview findings with cost-effectiveness criteria reduced 189 potential components to a two test intervention including either optic nerve photography or screening mode perimetry (a measure of visual field sensitivity with or without tonometry (a measure of intraocular pressure. It would be more cost-effective, and thus acceptable in a policy context, to target screening for open angle glaucoma to those at highest risk but for both practicality and equity arguments the optimal strategy was screening a general population cohort beginning at age forty. Conclusions Interventions for screening for open angle

  9. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  10. PHASE GRADIENT METHOD OF MAGNETIC FIELD MEASUREMENTS IN ELECTRIC VEHICLES

    Directory of Open Access Journals (Sweden)

    N. G. Ptitsyna

    2013-01-01

    Full Text Available Operation of electric and hybrid vehicles demands real time magnetic field control, for instance, for fire and electromagnetic safety. The article deals with a method of magnetic field measurements onboard electric cars taking into account peculiar features of these fields. The method is based on differential methods of measurements, and minimizes the quantity of magnetic sensors.

  11. Time-resolved luminescence screening method for enrofloxacin in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods currently used in the U.S. for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay ...

  12. Comparison of screening methods for anaemia in pregnant women in Awassa, Ethiopia

    NARCIS (Netherlands)

    Gies, S.; Brabin, B. J.; Yassin, M. A.; Cuevas, L. E.

    2003-01-01

    Screening for anaemia in pregnancy is essential for implementing and monitoring effective antenatal programmes. We compared the diagnostic accuracy of invasive and non-invasive screening methods in a cross-sectional survey of 403 pregnant women attending an urban health centre in Awassa, southern

  13. Axial Field Electric Motor and Method

    National Research Council Canada - National Science Library

    Cho, Chahee P

    2007-01-01

    .... A hybrid field, brushless, permanent magnet electric motor utilizing a rotor with two sets of permanent magnets oriented such that the flux produced by the two sets of magnets is perpendicular to each...

  14. On the screening of static electromagnetic fields in hot QED plasmas

    International Nuclear Information System (INIS)

    Blaizot, J.P.

    1995-01-01

    The screening of static magnetic and electric fields was studied in massless quantum electrodynamics (QED) and massless scalar electrodynamics (SQED) at temperature T. Various exact relations for the static polarization tensor are first reviewed, and then verified perturbatively to fifth order (in the coupling) in QED and fourth order in SQED, using different resummation techniques. The magnetic and electric screening masses squared, as defined through the pole of the static propagators, are also calculated to fifth order in QED and fourth order in SQED, and their gauge-independence and renormalisation-group invariance is checked. Finally, arguments are provided for the vanishing of the magnetic mass to all orders in perturbation theory. (author) 26 refs

  15. Magnetic field transfer device and method

    Science.gov (United States)

    Wipf, S.L.

    1990-02-13

    A magnetic field transfer device includes a pair of oppositely wound inner coils which each include at least one winding around an inner coil axis, and an outer coil which includes at least one winding around an outer coil axis. The windings may be formed of superconductors. The axes of the two inner coils are parallel and laterally spaced from each other so that the inner coils are positioned in side-by-side relation. The outer coil is outwardly positioned from the inner coils and rotatable relative to the inner coils about a rotational axis substantially perpendicular to the inner coil axes to generate a hypothetical surface which substantially encloses the inner coils. The outer coil rotates relative to the inner coils between a first position in which the outer coil axis is substantially parallel to the inner coil axes and the outer coil augments the magnetic field formed in one of the inner coils, and a second position 180[degree] from the first position, in which the augmented magnetic field is transferred into the other inner coil and reoriented 180[degree] from the original magnetic field. The magnetic field transfer device allows a magnetic field to be transferred between volumes with negligible work being required to rotate the outer coil with respect to the inner coils. 16 figs.

  16. A screening questionnaire for convulsive seizures: A three-stage field-validation in rural Bolivia.

    Science.gov (United States)

    Giuliano, Loretta; Cicero, Calogero Edoardo; Crespo Gómez, Elizabeth Blanca; Padilla, Sandra; Bruno, Elisa; Camargo, Mario; Marin, Benoit; Sofia, Vito; Preux, Pierre-Marie; Strohmeyer, Marianne; Bartoloni, Alessandro; Nicoletti, Alessandra

    2017-01-01

    Epilepsy is one of the most common neurological diseases in Latin American Countries (LAC) and epilepsy associated with convulsive seizures is the most frequent type. Therefore, the detection of convulsive seizures is a priority, but a validated Spanish-language screening tool to detect convulsive seizures is not available. We performed a field validation to evaluate the accuracy of a Spanish-language questionnaire to detect convulsive seizures in rural Bolivia using a three-stage design. The questionnaire was also administered face-to-face, using a two-stage design, to evaluate the difference in accuracy. The study was carried out in the rural communities of the Gran Chaco region. The questionnaire consists of a single screening question directed toward the householders and a confirmatory section administered face-to-face to the index case. Positive subjects underwent a neurological examination to detect false positive and true positive subjects. To estimate the proportion of false negative, a random sample of about 20% of the screened negative underwent a neurological evaluation. 792 householders have been interviewed representing a population of 3,562 subjects (52.2% men; mean age 24.5 ± 19.7 years). We found a sensitivity of 76.3% (95% CI 59.8-88.6) with a specificity of 99.6% (95% CI 99.4-99.8). The two-stage design showed only a slightly higher sensitivity respect to the three-stage design. Our screening tool shows a good accuracy and can be easily used by trained health workers to quickly screen the population of the rural communities of LAC through the householders using a three-stage design.

  17. Optical method for the screening of doping substances

    Science.gov (United States)

    Lademann, J.; Shevtsova, J.; Patzelt, A.; Richter, H.; Gladkowa, N. D.; Gelikonov, V. M.; Gonchukov, S. A.; Sterry, W.; Blume-Peytavi, U.

    2008-12-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients.

  18. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  19. Method for screening inhibitors of the toxicity of Bacillus anthracis

    Science.gov (United States)

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  20. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  1. Field theoretical methods in chemical physics

    International Nuclear Information System (INIS)

    Paul, R.

    1982-01-01

    Field theory will become an important tool for the chemist, and this book presents a clear and thorough account of the theory itself and its applications for solving a wide variety of chemical problems. The author has brought together the foundations upon which the many and varied applications of field theory have been built, giving more intermediate steps than is usual in the derivations. This makes the book easily accessible to anyone with a background of calculus, statistical thermodynamics and elementary quantum chemistry. (orig./HK)

  2. Electron field emission from screen-printed graphene/DWCNT composite films

    International Nuclear Information System (INIS)

    Xu, Jinzhuo; Pan, Rong; Chen, Yiwei; Piao, Xianqin; Qian, Min; Feng, Tao; Sun, Zhuo

    2013-01-01

    Highlights: ► The field emission performance improved significantly when adding graphene into DWCNTs as the emission material. ► We set up a model of pure DWCNT films and graphene/DWCNT composite films. ► We discussed the contact barrier between emission films and electric substrates by considering the Fermi energies of silver, DWCNT and graphene. - Abstract: The electron field emission properties of graphene/double-walled carbon nanotube (DWCNT) composite films prepared by screen printing have been systematically studied. Comparing with the pure DWCNT films and pure graphene films, a significant enhancement of electron emission performance of the composite films are observed, such as lower turn-on field, higher emission current density, higher field enhancement factor, and long-term stability. The optimized composite films with 20% weight ratio of graphene show the best electron emission performance with a low turn-on field of 0.62 V μm −1 (at 1 μA cm −2 ) and a high field enhancement factor β of 13,000. A model of the graphene/DWCNT composite films is proposed, which indicate that a certain amount of graphene will contribute the electron transmission in the silver substrate/composite films interface and in the interior of composite films, and finally improve the electron emission performance of the graphene/DWCNT composite films.

  3. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman; Ba Alawi, Wail; Afeef, Moataz A.; Essack, Magbubah; Kalnis, Panos; Bajic, Vladimir B.

    2016-01-01

    Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods

  4. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  5. A new screening method for Ganoderma philippii tolerance in ...

    African Journals Online (AJOL)

    Red root rot disease caused by Ganoderma philippii is one of the most economically important diseases of tropical Acacia species. Research on field control of the disease has to date focused on inoculum reduction, silviculture practices and application of biological control agents. Incorporation of tolerant genotypes, a key ...

  6. Variational method for integrating radial gradient field

    Science.gov (United States)

    Legarda-Saenz, Ricardo; Brito-Loeza, Carlos; Rivera, Mariano; Espinosa-Romero, Arturo

    2014-12-01

    We propose a variational method for integrating information obtained from circular fringe pattern. The proposed method is a suitable choice for objects with radial symmetry. First, we analyze the information contained in the fringe pattern captured by the experimental setup and then move to formulate the problem of recovering the wavefront using techniques from calculus of variations. The performance of the method is demonstrated by numerical experiments with both synthetic and real data.

  7. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  8. Quick screening for new flux pinning materials in YBCO films with the combinatorial-PLD method

    International Nuclear Information System (INIS)

    Yoshimura, T.; Ichino, Y.; Yoshida, Y.; Takai, Y.; Kita, R.; Suzuki, K.; Takeuchi, T.

    2011-01-01

    An effective way to improve the superconducting properties in REBa 2 Cu 3 O y (REBCO) films under a magnetic field is to dope artificial pinning centers (APC). The pinning performance depends on the content of the APC materials. Usually, the optimal APC content is explored by preparing films one at a time from the REBCO target using different APC material content, which is an extremely time-consuming process. The combinatorial-PLD (C-PLD) method allowed us to prepare films that continuously changed in composition across a single substrate. In this study, we used the C-PLD method to prepare BaSnO 3 (BSO)-doped YBCO films. The films were deposited on SrTiO 3 substrate using a fourth-harmonic Nd:YAG laser. From the results of the J c -B curves at 77 K and B//c, the film that contained 3.2 vol.% of BSO exhibited the best pinning performance in this study. We showed that the C-PLD method was efficient for quick screening of the optimal APC content with only one deposition. We also used the C-PLD method to explore new APC materials, and proved that it can quickly evaluate the new APC materials Ba 3 Cu 3 In 4 O 12 and BaTbO 3 .

  9. Field-expedient screening and injury risk algorithm categories as predictors of noncontact lower extremity injury.

    Science.gov (United States)

    Lehr, M E; Plisky, P J; Butler, R J; Fink, M L; Kiesel, K B; Underwood, F B

    2013-08-01

    In athletics, efficient screening tools are sought to curb the rising number of noncontact injuries and associated health care costs. The authors hypothesized that an injury prediction algorithm that incorporates movement screening performance, demographic information, and injury history can accurately categorize risk of noncontact lower extremity (LE) injury. One hundred eighty-three collegiate athletes were screened during the preseason. The test scores and demographic information were entered into an injury prediction algorithm that weighted the evidence-based risk factors. Athletes were then prospectively followed for noncontact LE injury. Subsequent analysis collapsed the groupings into two risk categories: Low (normal and slight) and High (moderate and substantial). Using these groups and noncontact LE injuries, relative risk (RR), sensitivity, specificity, and likelihood ratios were calculated. Forty-two subjects sustained a noncontact LE injury over the course of the study. Athletes identified as High Risk (n = 63) were at a greater risk of noncontact LE injury (27/63) during the season [RR: 3.4 95% confidence interval 2.0 to 6.0]. These results suggest that an injury prediction algorithm composed of performance on efficient, low-cost, field-ready tests can help identify individuals at elevated risk of noncontact LE injury. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Method of evaluation of structural (screen) and quantum graininess of X-ray pictures

    Energy Technology Data Exchange (ETDEWEB)

    Gurvich, A M; Shamanov, A A; Erofeeva, N D [Nauchno-Issledovatel' skij Inst. Rentgenologii i Radiologii, Moscow (USSR)

    1979-03-01

    Proposed is a method for quantitative determination of graininess of X-ray pictures (gamma-ray images), the graininess being conditioned by the structure of amplifying screens and quantum fluctuations. The method is based on the determination of threshold brightness at which the picture graininess becomes obvious. It is shown that at low effective quantum energy (Esub(eff.) <= 50 keV) the graininess observed is for the most part structural (screen). Its growth is connected with quantum fluctuations when increasing Esub(eff.) up to 150 keV and using screens with high output values of X-ray luminescence and the coefficient of spectral accordance to the film.

  11. Accurate method of the magnetic field measurement of quadrupole magnets

    International Nuclear Information System (INIS)

    Kumada, M.; Sakai, I.; Someya, H.; Sasaki, H.

    1983-01-01

    We present an accurate method of the magnetic field measurement of the quadrupole magnet. The method of obtaining the information of the field gradient and the effective focussing length is given. A new scheme to obtain the information of the skew field components is also proposed. The relative accuracy of the measurement was 1 x 10 -4 or less. (author)

  12. [Development and application of electroanalytical methods in biomedical fields].

    Science.gov (United States)

    Kusu, Fumiyo

    2015-01-01

    To summarize our electroanalytical research in the biomedical field over the past 43 years, this review describes studies on specular reflection measurement, redox potential determination, amperometric acid sensing, HPLC with electrochemical detection, and potential oscillation across a liquid membrane. The specular reflection method was used for clarifying the adsorption of neurotransmitters and their related drugs onto a gold electrode and the interaction between dental alloys and compound iodine glycerin. A voltammetric screening test using a redox potential for the antioxidative effect of flavonoids was proposed. Amperometric acid sensing based on the measurement of the reduction prepeak current of 2-methyl-1,4-naphthoquinone (VK3) or 3,5-di-tert-buty1-1,2-benzoquinone (DBBQ) was applied to determine acid values of fats and oils, titrable acidity of coffee, and enzyme activity of lipase, free fatty acids (FFAs) in serum, short-chain fatty acids in feces, etc. The electrode reactions of phenothiazines, catechins, and cholesterol were applied to biomedical analysis using HPLC with electrochemical detection. A three-channel electrochemical detection system was utilized for the sensitive determination of redox compounds in Chinese herbal medicines. The behavior of barbituric acid derivatives was examined based on potential oscillation measurements.

  13. Damped time advance methods for particles and EM fields

    International Nuclear Information System (INIS)

    Friedman, A.; Ambrosiano, J.J.; Boyd, J.K.; Brandon, S.T.; Nielsen, D.E. Jr.; Rambo, P.W.

    1990-01-01

    Recent developments in the application of damped time advance methods to plasma simulations include the synthesis of implicit and explicit ''adjustably damped'' second order accurate methods for particle motion and electromagnetic field propagation. This paper discusses this method

  14. Low field pulsed NMR- a mass screening tool in agricultural research

    International Nuclear Information System (INIS)

    Tiwari, P.N.

    1994-01-01

    One of the main requirements in agricultural research is to analyse large number of samples for their one or more chemical constituents and physical properties. In plant breeding programmes and germplasm evaluation, it is necessary that the analysis is fast as many samples are to be analysed. Pulsed nuclear magnetic resonance (NMR) is a potential tool for developing rapid and nondestructive method of analysis. Various applications of low resolution pulsed NMR in agricultural research, which are generally used as screening method are briefly described. 25 refs., 2 figs., 2 tabs

  15. Predictive simulations and optimization of nanowire field-effect PSA sensors including screening

    KAUST Repository

    Baumgartner, Stefan; Heitzinger, Clemens; Vacic, Aleksandar; Reed, Mark A

    2013-01-01

    We apply our self-consistent PDE model for the electrical response of field-effect sensors to the 3D simulation of nanowire PSA (prostate-specific antigen) sensors. The charge concentration in the biofunctionalized boundary layer at the semiconductor-electrolyte interface is calculated using the propka algorithm, and the screening of the biomolecules by the free ions in the liquid is modeled by a sensitivity factor. This comprehensive approach yields excellent agreement with experimental current-voltage characteristics without any fitting parameters. Having verified the numerical model in this manner, we study the sensitivity of nanowire PSA sensors by changing device parameters, making it possible to optimize the devices and revealing the attributes of the optimal field-effect sensor. © 2013 IOP Publishing Ltd.

  16. Predictive simulations and optimization of nanowire field-effect PSA sensors including screening

    KAUST Repository

    Baumgartner, Stefan

    2013-05-03

    We apply our self-consistent PDE model for the electrical response of field-effect sensors to the 3D simulation of nanowire PSA (prostate-specific antigen) sensors. The charge concentration in the biofunctionalized boundary layer at the semiconductor-electrolyte interface is calculated using the propka algorithm, and the screening of the biomolecules by the free ions in the liquid is modeled by a sensitivity factor. This comprehensive approach yields excellent agreement with experimental current-voltage characteristics without any fitting parameters. Having verified the numerical model in this manner, we study the sensitivity of nanowire PSA sensors by changing device parameters, making it possible to optimize the devices and revealing the attributes of the optimal field-effect sensor. © 2013 IOP Publishing Ltd.

  17. Calibration and uncertainty in electromagnetic fields measuring methods

    International Nuclear Information System (INIS)

    Anglesio, L.; Crotti, G.; Borsero, M.; Vizio, G.

    1999-01-01

    Calibration and reliability in electromagnetic field measuring methods are assured by calibration of measuring instruments. In this work are illustrated systems for generation of electromagnetic fields at low and high frequency, calibration standard and accuracy [it

  18. Ultra-wide field imaging system and traditional retinal examinations for screening fundus changes after cataract surgery.

    Science.gov (United States)

    Peng, Jie; Zhang, Qi; Jin, Hai-Ying; Lu, Wu-Yi; Zhao, Pei-Quan

    2016-01-01

    To compare the results of non-mydriatic ultra-wide field imaging system, mydriatic slit-lamp lens (Volk +90 D) and mydriatic Goldmann three-mirror contact lens examinations in screening fundus lesions among patients after cataract surgery. Non-mydriatic images were obtained with an Optomap panoramic 200Tx (Optomap 200Tx) 3d after surgery and graded by a blinded ophthalmologist. A mydriatic slit-lamp lens examination was performed by another blinded retinal specialist on the same day. A third blinded retinal specialist examined patients two weeks after surgery using a Goldmann three-mirror contact lens. In total, 160 patients (184 eyes) were examined, and 66, 69, and 75 cases of retinal lesion(s) were identified using the Optomap 200Tx, slit-lamp lens, and Goldmann three-mirror contact lens, respectively. In 13 cases, fundus changes were sight-threatening. The results obtained by Optomap 200Tx examination and by mydriatic slit-lamp lens examination have good consistency (P=0.375, Kappa=0.942). The mydriatic Goldmann three-mirror lens examination revealed more fundus lesions but are consistent with Optomap 200Tx (P=0.004, Kappa=0.897) and mydriatic slit-lamp lens examination (P=0.031, Kappa=0.932). Early post-operative fundus screening in cataract patients is extremely important and necessary to prevent further vision loss. Wide-field imaging is a feasible and convenient tool for fundus examination that can be used as a primary screening method among patients after cataract surgery.

  19. Development and evaluation of nursing user interface screens using multiple methods.

    Science.gov (United States)

    Hyun, Sookyung; Johnson, Stephen B; Stetson, Peter D; Bakken, Suzanne

    2009-12-01

    Building upon the foundation of the Structured Narrative Electronic Health Record (EHR) model, we applied theory-based (combined Technology Acceptance Model and Task-Technology Fit Model) and user-centered methods to explore nurses' perceptions of functional requirements for an electronic nursing documentation system, design user interface screens reflective of the nurses' perspectives, and assess nurses' perceptions of the usability of the prototype user interface screens. The methods resulted in user interface screens that were perceived to be easy to use, potentially useful, and well-matched to nursing documentation tasks associated with Nursing Admission Assessment, Blood Administration, and Nursing Discharge Summary. The methods applied in this research may serve as a guide for others wishing to implement user-centered processes to develop or extend EHR systems. In addition, some of the insights obtained in this study may be informative to the development of safe and efficient user interface screens for nursing document templates in EHRs.

  20. Dysregulation of microRNAs in colonic field carcinogenesis: implications for screening.

    Directory of Open Access Journals (Sweden)

    Dhananjay P Kunte

    Full Text Available Colorectal cancer (CRC screening tests often have a trade-off between efficacy and patient acceptability/cost. Fecal tests (occult blood, methylation engender excellent patient compliance but lack requisite performance underscoring the need for better population screening tests. We assessed the utility of microRNAs (miRNAs as markers of field carcinogenesis and their potential role for CRC screening using the azoxymethane (AOM-treated rat model. We found that 63 miRNAs were upregulated and miR-122, miR-296-5p and miR-503# were downregulated in the uninvolved colonic mucosa of AOM rats. We monitored the expression of selected miRNAs in colonic biopsies of AOM rats at 16 weeks and correlated it with tumor development. We noted that the tumor bearing rats had significantly greater miRNA modulation compared to those without tumors. The miRNAs showed good diagnostic performance with an area under the receiver operator curve (AUROC of >0.7. We also noted that the miRNA induction in the colonic mucosa was mirrorred in the mucus layer fecal colonocytes isolated from AOM rat stool and the degree of miRNA induction was greater in the tumor bearing rats compared to those without tumors. Lastly, we also noted significant miRNA modulation in the Pirc rats- the genetic model of colon carcinogenesis, both in the uninvolved colonic mucosa and the fecal colonocytes. We thus demonstrate that miRNAs are excellent markers of field carcinogenesis and could accurately predict future neoplasia. Based on our results, we propose an accurate, inexpensive, non-invasive miRNA test for CRC risk stratification based on rectal brushings or from abraded fecal colonocytes.

  1. Mean field methods for cortical network dynamics

    DEFF Research Database (Denmark)

    Hertz, J.; Lerchner, Alexander; Ahmadi, M.

    2004-01-01

    We review the use of mean field theory for describing the dynamics of dense, randomly connected cortical circuits. For a simple network of excitatory and inhibitory leaky integrate- and-fire neurons, we can show how the firing irregularity, as measured by the Fano factor, increases...... with the strength of the synapses in the network and with the value to which the membrane potential is reset after a spike. Generalizing the model to include conductance-based synapses gives insight into the connection between the firing statistics and the high- conductance state observed experimentally in visual...

  2. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  3. Exact mean-field theory of ionic solutions: non-Debye screening

    International Nuclear Information System (INIS)

    Varela, L.M.; Garcia, Manuel; Mosquera, Victor

    2003-01-01

    The main aim of this report is to analyze the equilibrium properties of primitive model (PM) ionic solutions in the formally exact mean-field formalism. Previously, we review the main theoretical and numerical results reported throughout the last century for homogeneous (electrolytes) and inhomogeneous (electric double layer, edl) ionic systems, starting with the classical mean-field theory of electrolytes due to Debye and Hueckel (DH). In this formalism, the effective potential is derived from the Poisson-Boltzmann (PB) equation and its asymptotic behavior analyzed in the classical Debye theory of screening. The thermodynamic properties of electrolyte solutions are briefly reviewed in the DH formalism. The main analytical and numerical extensions of DH formalism are revised, ranging from the earliest extensions that overcome the linearization of the PB equation to the more sophisticated integral equation techniques introduced after the late 1960s. Some Monte Carlo and molecular dynamic simulations are also reviewed. The potential distributions in an inhomogeneous ionic system are studied in the classical PB framework, presenting the classical Gouy-Chapman (GC) theory of the electric double layer (edl) in a brief manner. The mean-field theory is adequately contextualized using field theoretic (FT) results and it is proven that the classical PB theory is recovered at the Gaussian or one-loop level of the exact FT, and a systematic way to obtain the corrections to the DH theory is derived. Particularly, it is proven following Kholodenko and Beyerlein that corrections to DH theory effectively lead to a renormalization of charges and Debye screening length. The main analytical and numerical results for this non-Debye screening length are reviewed, ranging from asymptotic expansions, self-consistent theory, nonlinear DH results and hypernetted chain (HNC) calculations. Finally, we study the exact mean-field theory of ionic solutions, the so-called dressed-ion theory

  4. Interval breast cancer characteristics before, during and after the transition from screen-film to full-field digital screening mammography.

    Science.gov (United States)

    van Bommel, Rob M G; Weber, Roy; Voogd, Adri C; Nederend, Joost; Louwman, Marieke W J; Venderink, Dick; Strobbe, Luc J A; Rutten, Matthieu J C; Plaisier, Menno L; Lohle, Paul N; Hooijen, Marianne J H; Tjan-Heijnen, Vivianne C G; Duijm, Lucien E M

    2017-05-05

    To determine the proportion of "true" interval cancers and tumor characteristics of interval breast cancers prior to, during and after the transition from screen-film mammography screening (SFM) to full-field digital mammography screening (FFDM). We included all women with interval cancers detected between January 2006 and January 2014. Breast imaging reports, biopsy results and breast surgery reports of all women recalled at screening mammography and of all women with interval breast cancers were collected. Two experienced screening radiologists reviewed the diagnostic mammograms, on which the interval cancers were diagnosed, as well as the prior screening mammograms and determined whether or not the interval cancer had been missed on the most recent screening mammogram. If not missed, the cancer was considered an occult ("true") interval cancer. A total of 442 interval cancers had been diagnosed, of which 144 at SFM with a prior SFM (SFM-SFM), 159 at FFDM with a prior SFM (FFDM-SFM) and 139 at FFDM with a prior FFDM (FFDM-FFDM). The transition from SFM to FFDM screening resulted in the diagnosis of more occult ("true") interval cancers at FFDM-SFM than at SFM-SFM (65.4% (104/159) versus 49.3% (71/144), P screened digitally for the second time (57.6% (80/139) at FFDM-FFDM versus 49.3% (71/144) at SFM-SFM). Tumor characteristics were comparable for the three interval cancer cohorts, except of a lower porportion (75.7 and 78.0% versus 67.2% af FFDM-FFDM, P cancers at FFDM with prior FFDM. An increase in the proportion of occult interval cancers is observed during the transition from SFM to FFDM screening mammography. However, this increase seems temporary and is no longer detectable after the second round of digital screening. Tumor characteristics and type of surgery are comparable for interval cancers detected prior to, during and after the transition from SFM to FFDM screening mammography, except of a lower proportion of invasive ductal cancers after the

  5. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  6. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  7. Efficient Training Methods for Conditional Random Fields

    Science.gov (United States)

    2008-02-01

    Learning (ICML), 2007. [63] Bruce G. Lindsay. Composite likelihood methods. Contemporary Mathematics, pages 221–239, 1988. 189 [64] Yan Liu, Jaime ...Conference on Machine Learning (ICML), pages 737–744, 2005. [107] Erik F. Tjong Kim Sang and Sabine Buchholz. Introduction to the CoNLL-2000 shared task

  8. High throughput screening method for identification of new lipofection reagents.

    Science.gov (United States)

    Regelin, A E; Fernholz, E; Krug, H F; Massing, U

    2001-08-01

    Lipofection, the transfer of genetic material into cells by means of cationic lipids, is of growing interest for in vitro and in vivo approaches. In order to identify ideal lipofection reagents in a HTS, we have developed an automated lipofection method for the transfer of reporter genes into cells and for determination of the lipofection results. The method has specifically been designed and optimized for 96-well microtiter plates and can successfully be carried out by a pipetting robot with accessory equipment. It consists of two separate parts: (1) pretransfection (preparation of liposomes, formation of lipoplexes, and lipoplex transfer to the cells) and (2) posttransfection (determination of the reporter enzyme activity and the protein content of the transfected cells). Individual steps of the lipofection method were specifically optimized - for example, lipoplex formation and incubation time as well as cell lysis, cell cultivating, and the reporter gene assay. The HTS method facilitates characterization of the transfection properties (efficiency and cytotoxicity) of large numbers of (cationic) lipids in various adherent cell types.

  9. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  10. SYNTHESIS OF ACTIVE SCREENING SYSTEM OF MAGNETIC FIELD OF HIGH VOLTAGE POWER LINES OF DIFFERENT DESIGN TAKING INTO ACCOUNT SPATIAL AND TEMPORAL DISTRIBUTION OF MAGNETIC FIELD

    Directory of Open Access Journals (Sweden)

    B.I. Kuznetsov

    2017-04-01

    Full Text Available Purpose. Analyze the spatial and temporal distribution of the magnetic field of high voltage power lines with different design allowing and development of recommendations for the design of active screening systems by magnetic field of high voltage power lines. Methodology. Analysis of the spatial and temporal distribution of the magnetic field of high voltage power lines of different design allowing is made on the basis of Maxwell's equations solutions in the quasi-stationary approximation. Determination of the number, configuration, spatial arrangement and the compensation coil currents is formulated in the form of multiobjective optimization problem that is solved by multi-agent multiswarm stochastic optimization based on Pareto optimal solutions. Results of active screening system for the synthesis of various types of transmission lines with different numbers of windings controlled. The possibility of a significant reduction in the level of the flux density of the magnetic field source within a given region of space. Originality. For the first time an analysis of the spatial and temporal distribution of the magnetic field of power lines with different types and based on findings developed recommendations for the design of active screening system by magnetic field of high voltage power lines. Practical value. Practical recommendations on reasonable choice of the number and spatial arrangement of compensating windings of active screening system by magnetic field of high voltage power lines of different design allowing for the spatial and temporal distribution of the magnetic field. Results of active screening system synthesis of the magnetic field of industrial frequency generated by single-circuit 110 kV high voltage power lines with the supports have 330 - 1T «triangle» rotating magnetic field with full polarization in a residential five-storey building, located near the power lines. The system contains three compensating coil and reduces

  11. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  12. Pairing interaction method in crystal field theory

    International Nuclear Information System (INIS)

    Dushin, R.B.

    1989-01-01

    Expressions, permitting to describe matrix elements of secular equation for metal-ligand pairs via parameters of the method of pairing interactions, genealogical coefficients and Clebsch-Gordan coefficients, are given. The expressions are applicable to any level or term of f n and d n configurations matrix elements for the terms of the maximum multiplicity of f n and d n configurations and also for the main levels of f n configurations are tabulated

  13. Pi sampling: a methodical and flexible approach to initial macromolecular crystallization screening

    International Nuclear Information System (INIS)

    Gorrec, Fabrice; Palmer, Colin M.; Lebon, Guillaume; Warne, Tony

    2011-01-01

    Pi sampling, derived from the incomplete factorial approach, is an effort to maximize the diversity of macromolecular crystallization conditions and to facilitate the preparation of 96-condition initial screens. The Pi sampling method is derived from the incomplete factorial approach to macromolecular crystallization screen design. The resulting ‘Pi screens’ have a modular distribution of a given set of up to 36 stock solutions. Maximally diverse conditions can be produced by taking into account the properties of the chemicals used in the formulation and the concentrations of the corresponding solutions. The Pi sampling method has been implemented in a web-based application that generates screen formulations and recipes. It is particularly adapted to screens consisting of 96 different conditions. The flexibility and efficiency of Pi sampling is demonstrated by the crystallization of soluble proteins and of an integral membrane-protein sample

  14. Comparison of different dose calculation methods for irregular photon fields

    International Nuclear Information System (INIS)

    Zakaria, G.A.; Schuette, W.

    2000-01-01

    In this work, 4 calculation methods (Wrede method, Clarskon method of sector integration, beam-zone method of Quast and pencil-beam method of Ahnesjoe) are introduced to calculate point doses in different irregular photon fields. The calculations cover a typical mantle field, an inverted Y-field and different blocked fields for 4 and 10 MV photon energies. The results are compared to those of measurements in a water phantom. The Clarkson and the pencil-beam method have been proved to be the methods of equal standard in relation to accuracy. Both of these methods are being distinguished by minimum deviations and applied in our clinical routine work. The Wrede and beam-zone methods deliver useful results to central beam and yet provide larger deviations in calculating points beyond the central axis. (orig.) [de

  15. Stream temperature investigations: field and analytic methods

    Science.gov (United States)

    Bartholow, J.M.

    1989-01-01

    This document provides guidance to the user of the U.S. Fish and Wildlife Service’s Stream Network Temperature Model (SNTEMP). Planning a temperature study is discussed in terms of understanding the management objectives and ensuring that the questions will be accurately answered with the modeling approach being used. A sensitivity analysis of SNTEMP is presented to illustrate which input variables are most important in predicting stream temperatures. This information helps prioritize data collection activities, highlights the need for quality control, focuses on which parameters can be estimated rather than measured, and offers a broader perspective on management options in terms of knowing where the biggest temperature response will be felt. All of the major input variables for stream geometry, meteorology, and hydrology are discussed in detail. Each variable is defined, with guidance given on how to measure it, what kind of equipment to use, where to obtain it from another agency, and how to calculate it if the data are in a form other than that required by SNTEMP. Examples are presented for the various forms in which water temperature, discharge, and meteorological data are commonly found. Ranges of values for certain input variables that are difficult to measure of estimate are given. Particular attention is given to those variables not commonly understood by field biologists likely to be involved in a stream temperature study. Pertinent literature is cited for each variable, with emphasis on how other people have treated particular problems and on results they have found.

  16. Methods for Factor Screening in Computer Simulation Experiments

    Science.gov (United States)

    1979-03-01

    of the dat-a In a-space, impacto the variable selection problem s ign if Lrast ly. S-arch-type variable selection methods include the all-po"sible...i.iv 41.1 ti * n wt- -iu’pt-v c C it st’vt’re mu It ico11 inear it v is pro-crtnt Lind. , ii;.qt4pai tlv * Iti’lt- c- j c. tic j icivnt, art, verv

  17. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  18. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  19. DEVELOPMENT AND INVESTIGATION OF LAYOUT OF ACTIVE SCREENING SYSTEM OF THE MAGNETIC FIELD GENERATED BY GROUP OF OVERHEAD TRANSMISSION LINES

    Directory of Open Access Journals (Sweden)

    B. I. Kuznetsov

    2018-04-01

    Full Text Available Purpose. Development and field experimental research of layout of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area is given. Methodology. Mathematical model of magnetic field, generated by group of high voltage transmission lines in residential area, based of the experimental values of magnetic field flux density in given points on the basis of optimization problem solving is improved. The objective of the synthesis of the single circuit active screening system is to determine their number, configuration, spatial arrangement, wiring diagrams and compensation cables currents, setting algorithm of the control systems as well as the resulting value of the magnetic flux density at the points of the protected space. Synthesis of the full-scale model of active screening system is reduced to the problem of multiobjective nonlinear programming with constraints in which calculation of the objective functions and constraints are carried out on the basis of the Maxwell equations solutions in the quasi-stationary approximation. The problem is solved by a stochastic multiswarm multi-agent particles optimization. Results. The single-circuit active screening system synthesis results for reduction of a magnetic field generated by group of high voltage transmission lines in residential area is given. Field experimental researches of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area with various control algorithms is given. Originality. For the first time out the development and field experimental studies of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area are carried out. Practical value. Practical recommendations on reasonable choice of the spatial arrangement of compensating cables of single

  20. Gastric Cancer Screening by Combined Determination of Serum Helicobacter pylori Antibody and Pepsinogen Concentrations: ABC Method for Gastric Cancer Screening.

    Science.gov (United States)

    Chen, Xian-Zhe; Huang, Cheng-Zhi; Hu, Wei-Xian; Liu, Ying; Yao, Xue-Qing

    2018-05-20

    Gastroscopy combined with gastric mucosa biopsies is currently regarded as a gold standard for diagnosis of gastric cancer. However, its application is restricted in clinical practice due to its invasive property. A new noninvasive population screening process combining the assay of anti-Helicobacter pylori antibody and serum pepsinogen (PG) (ABC method) is adopted to recognize the high-risk patients for further endoscopy examination, avoiding the unnecessary gastroscopy for most population and saving the cost consumption for mass screening annually. Nevertheless, controversies exist for the grouping of ABC method and the intervals of gastroscopy surveillance for each group. In this review, we summarized these popular concerned topics for providing useful references to the healthcare practitioner in clinical practice. The PubMed databases were systematically searched from the inception dates to November 22, 2017, using the keywords "Helicobacter pylori," "Pepsinogens," and "Stomach Neoplasms." Original articles and reviews on the topics were selected. Anti-H. pylori antibody and serum PG concentration showed significant changes under the different status of H. pylori infection and the progression of atrophic gastritis, which can be used for risk stratification of gastric cancer in clinic. In addition, anti-H. pylori antibody titer can be used for further risk stratification of gastric cancer contributing to determine better endoscopy surveillance interval. The early detection and diagnosis of gastric cancer benefit from the risk stratification, but the cutoff values for H. pylori antibody and serum PG concentration require further modification.

  1. Analyzed method for calculating the distribution of electrostatic field

    International Nuclear Information System (INIS)

    Lai, W.

    1981-01-01

    An analyzed method for calculating the distribution of electrostatic field under any given axial gradient in tandem accelerators is described. This method possesses satisfactory accuracy compared with the results of numerical calculation

  2. Novel method for screening of enteric film coatings properties with magnetic resonance imaging.

    Science.gov (United States)

    Dorożyński, Przemysław; Jamróz, Witold; Niwiński, Krzysztof; Kurek, Mateusz; Węglarz, Władysław P; Jachowicz, Renata; Kulinowski, Piotr

    2013-11-18

    The aim of the study is to present the concept of novel method for fast screening of enteric coating compositions properties without the need of preparation of tablets batches for fluid bed coating. Proposed method involves evaluation of enteric coated model tablets in specially designed testing cell with application of MRI technique. The results obtained in the testing cell were compared with results of dissolution studies of mini-tablets coated in fluid bed apparatus. The method could be useful in early stage of formulation development for screening of film coating properties that will shorten and simplify the development works. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. A virtual screening method for inhibitory peptides of Angiotensin I-converting enzyme.

    Science.gov (United States)

    Wu, Hongxi; Liu, Yalan; Guo, Mingrong; Xie, Jingli; Jiang, XiaMin

    2014-09-01

    Natural small peptides from foods have been proven to be efficient inhibitors of Angiotensin I-converting enzyme (ACE) for the regulation of blood pressure. The traditional ACE inhibitory peptides screening method is both time consuming and money costing, to the contrary, virtual screening method by computation can break these limitations. We establish a virtual screening method to obtain ACE inhibitory peptides with the help of Libdock module of Discovery Studio 3.5 software. A significant relationship between Libdock score and experimental IC(50) was found, Libdock score = 10.063 log(1/IC(50)) + 68.08 (R(2) = 0.62). The credibility of the relationship was confirmed by testing the coincidence of the estimated log(1/IC(50)) and measured log(1/IC(50)) (IC(50) is 50% inhibitory concentration toward ACE, in μmol/L) of 5 synthetic ACE inhibitory peptides, which was virtual hydrolyzed and screened from a kind of seafood, Phascolosoma esculenta. Accordingly, Libdock method is a valid IC(50) estimation tool and virtual screening method for small ACE inhibitory peptides. © 2014 Institute of Food Technologists®

  4. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Directory of Open Access Journals (Sweden)

    Stanistreet Debbi

    2008-01-01

    Full Text Available Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities, calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR of 0.48 (Confidence Interval (CI 0.38 – 0.58; X2: 72.227; p.value X2: 24.236; p.value X2: 286.341; p.value Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities.

  5. A Field Trial of Alternative Targeted Screening Strategies for Chagas Disease in Arequipa, Peru

    Science.gov (United States)

    Hunter, Gabrielle C.; Borrini-Mayorí, Katty; Ancca Juárez, Jenny; Castillo Neyra, Ricardo; Verastegui, Manuela R.; Malaga Chavez, Fernando S.; Cornejo del Carpio, Juan Geny; Córdova Benzaquen, Eleazar; Náquira, César; Gilman, Robert H.; Bern, Caryn; Levy, Michael Z.

    2012-01-01

    Background Chagas disease is endemic in the rural areas of southern Peru and a growing urban problem in the regional capital of Arequipa, population ∼860,000. It is unclear how to implement cost-effective screening programs across a large urban and periurban environment. Methods We compared four alternative screening strategies in 18 periurban communities, testing individuals in houses with 1) infected vectors; 2) high vector densities; 3) low vector densities; and 4) no vectors. Vector data were obtained from routine Ministry of Health insecticide application campaigns. We performed ring case detection (radius of 15 m) around seropositive individuals, and collected data on costs of implementation for each strategy. Results Infection was detected in 21 of 923 (2.28%) participants. Cases had lived more time on average in rural places than non-cases (7.20 years versus 3.31 years, respectively). Significant risk factors on univariate logistic regression for infection were age (OR 1.02; p = 0.041), time lived in a rural location (OR 1.04; p = 0.022), and time lived in an infested area (OR 1.04; p = 0.008). No multivariate model with these variables fit the data better than a simple model including only the time lived in an area with triatomine bugs. There was no significant difference in prevalence across the screening strategies; however a self-assessment of disease risk may have biased participation, inflating prevalence among residents of houses where no infestation was detected. Testing houses with infected-vectors was least expensive. Ring case detection yielded four secondary cases in only one community, possibly due to vector-borne transmission in this community, apparently absent in the others. Conclusions Targeted screening for urban Chagas disease is promising in areas with ongoing vector-borne transmission; however, these pockets of epidemic transmission remain difficult to detect a priori. The flexibility to adapt to the epidemiology that

  6. Field demonstrations of passive detectors for screening of alpha contaminated soils

    International Nuclear Information System (INIS)

    Meyer, K.E.; Gammage, R.B.; Dudney, C.S.

    1994-01-01

    There are numerous sites around the country, DOE and otherwise, that are faced with the daunting task of remediating radiologically contaminated soils and groundwaters. Some of these sites, such as the Nevada Test Site and the Rocky Flats Plant, have contaminants that have been dispersed over wide areas. The costs of the characterization phase alone for such remediation programs can be prohibitive. Therefore there are pressing needs for testing and evaluation of new technologies for screening for radiological contaminants that may offer significant advantages in capital costs, ease of use, sensitivity, ruggedness, and/or reliability. This work reports on laboratory and Field tests of two types of passive alpha detectors, electret ionization chambers (EIC's) and alpha track detectors (ATD's), that have been commercially developed for indoor radon measurements. Previous work documented calibration and measurement protocols developed for these detectors for indoor surface contamination measurements

  7. Field radiometric methods of prospecting and exploration for uranium ores

    International Nuclear Information System (INIS)

    Gorbushina, L.V.; Savenko, E.I.; Serdyukova, A.S.

    1978-01-01

    The textbook includes two main chapters which describe gamma- and emanation field radiometric methods. The textbook is intended for geology and geophysics students having training practice in field radiometric methods and is additional to the course of lectures. The textbook can be used in the''Radiometry'' course which is studied in appropriate geological and technical colleges

  8. LOMEGA: a low frequency, field implicit method for plasma simulation

    International Nuclear Information System (INIS)

    Barnes, D.C.; Kamimura, T.

    1982-04-01

    Field implicit methods for low frequency plasma simulation by the LOMEGA (Low OMEGA) codes are described. These implicit field methods may be combined with particle pushing algorithms using either Lorentz force or guiding center force models to study two-dimensional, magnetized, electrostatic plasmas. Numerical results for ωsub(e)deltat>>1 are described. (author)

  9. The Background-Field Method and Noninvariant Renormalization

    International Nuclear Information System (INIS)

    Avdeev, L.V.; Kazakov, D.I.; Kalmykov, M.Yu.

    1994-01-01

    We investigate the consistency of the background-field formalism when applying various regularizations and renormalization schemes. By an example of a two-dimensional σ model it is demonstrated that the background-field method gives incorrect results when the regularization (and/or renormalization) is noninvariant. In particular, it is found that the cut-off regularization and the differential renormalization belong to this class and are incompatible with the background-field method in theories with nonlinear symmetries. 17 refs

  10. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  11. Microbial screening methods for detection of antibiotic residues in slaughter animals

    NARCIS (Netherlands)

    Pikkemaat, M.G.

    2009-01-01

    Monitoring of food products from animal origin for the presence of antimicrobial residues is preferably done using microbial screening methods because of their high cost-effectiveness. Traditionally applied methods fail to detect the maximum residue limits which were established when EU Council

  12. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    precise magnitude is non-trivial to predict because of the non-local nature of the screening in quasi-2D crystals. Moreover, the effect is not captured by effective single-particle methods such as density functional theory. Here we present an efficient and general method for calculating the band gap...

  13. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  14. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  15. Application of EU guidelines for the validation of screening methods for veterinary drugs

    NARCIS (Netherlands)

    Stolker, A.A.M.

    2012-01-01

    Commission Decision (CD) 2002/657/EC describes detailed rules for method validation within the framework of residue monitoring programmes. The approach described in this CD is based on criteria. For (qualitative) screening methods, the most important criteria is that the CCß has to be below any

  16. Psychophysical Calibration of Mobile Touch-Screens for Vision Testing in the Field

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2015-01-01

    The now ubiquitous nature of touch-screen displays in cell phones and tablet computers makes them an attractive option for vision testing outside of the laboratory or clinic. Accurate measurement of parameters such as contrast sensitivity, however, requires precise control of absolute and relative screen luminances. The nonlinearity of the display response (gamma) can be measured or checked using a minimum motion technique similar to that developed by Anstis and Cavanagh (1983) for the determination of isoluminance. While the relative luminances of the color primaries vary between subjects (due to factors such as individual differences in pre-retinal pigment densities), the gamma nonlinearity can be checked in the lab using a photometer. Here we compare results obtained using the psychophysical method with physical measurements for a number of different devices. In addition, we present a novel physical method using the device's built-in front-facing camera in conjunction with a mirror to jointly calibrate the camera and display. A high degree of consistency between devices is found, but some departures from ideal performance are observed. In spite of this, the effects of calibration errors and display artifacts on estimates of contrast sensitivity are found to be small.

  17. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  18. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  19. Task 1.11 - Spectroscopic field screening of hazardous waste and toxic spills. Semi-annual report, January 1 - June 30, 1995

    International Nuclear Information System (INIS)

    Gristanti, A.A.

    1995-01-01

    Techniques for the field characterization of soil contamination due to spillage of hazardous waste or toxic chemicals are time-consuming and expensive. Thus, more economical, less time-intensive methods are needed to facilitate rapid field screening of contaminated sites. In situ detection of toxic chemicals in soil offers both time and cost advantages for field screening with additional application to real-time site monitoring. Fourier-transform infrared (FT-IR) spectroscopy coupled with evanescent mode fiber-optic sensors has been demonstrated as a means to remotely detect and classify petroleum products in water using mid-infrared (MIR) optical fibers. This work demonstrated that a fiber-optic evanescent field absorbance sensor (EFAS) could be used to classify petroleum contamination into categories such as crude oil, kerosene, No. 2 fuel and residual distillates using the MIR spectral range. The overall objective of this project is to study the feasibility of using an EFAS FT-IR spectroscopic sensor coupled with cone penetrometry as a field screening method. The Fourier transform infrared cone penetrometry method (FT-IR-CPT) will be developed by building on the work cited above. The specific objectives of this project are: design an accessory for use with FT-IR that interfaces the spectrometer to a cone penetrometer; characterize the response of the FT-IR accessory to selected hydrocarbons in a laboratory-simulated field environment; and determine the ability of the FT-IR-CPT instrument to measure hydrocarbon contamination in soil by direct comparison with a reference method to quantify hydrocarbons from the same soil

  20. Method of regulating magnetic field of magnetic pole center

    International Nuclear Information System (INIS)

    Watanabe, Masao; Yamada, Teruo; Kato, Norihiko; Toda, Yojiro; Kaneda, Yasumasa.

    1978-01-01

    Purpose: To provide the subject method comprising using a plurality of magnetic metal pieces having different thicknesses, regulating very easily symmetry of the field of the magnetic pole center depending upon the combination of said metal pieces, thereby obtaining a magnetic field of high precision. Method: The regulation of magnetic field at the central part of the magnetic field is not depending only upon processing of the center plug, axial movement of trim coil and ion source but by providing a magnetic metal piece such as an iron ring, primary higher harmonics of the field at the center of the magnetic field can be regulated simply while the position of the ion source slit is on the equipotential surface in the field. (Yoshihara, H.)

  1. Sensitivity-based virtual fields for the non-linear virtual fields method

    Science.gov (United States)

    Marek, Aleksander; Davis, Frances M.; Pierron, Fabrice

    2017-09-01

    The virtual fields method is an approach to inversely identify material parameters using full-field deformation data. In this manuscript, a new set of automatically-defined virtual fields for non-linear constitutive models has been proposed. These new sensitivity-based virtual fields reduce the influence of noise on the parameter identification. The sensitivity-based virtual fields were applied to a numerical example involving small strain plasticity; however, the general formulation derived for these virtual fields is applicable to any non-linear constitutive model. To quantify the improvement offered by these new virtual fields, they were compared with stiffness-based and manually defined virtual fields. The proposed sensitivity-based virtual fields were consistently able to identify plastic model parameters and outperform the stiffness-based and manually defined virtual fields when the data was corrupted by noise.

  2. Reduction of fields between co-axial cylinders by means of interposed screens; L'abaissement des champs entre cylindres coaxiaux au moyen d'ecrans intercales

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, J; Bruck, H; Prevot, F

    1950-05-01

    The dielectric rigidity of the space between two coaxial cylinders at a given potential can be increased by interposing coaxial cylindrical screens (the method of C. M. Turner, Thesis, Univ. of Wisconsin, 1943). The combination of screens reducing the maximum value of a simple field between two cylinders is calculated as a function of number of screens, their radius, and their potential, and, for a given number of screens, the optimum radii and potentials for maximum field reduction are determined. [French] La rigidite dielectrique de l'espace compris entre deux cylindres coaxiaux, portes a des potentiels donnes, peut etre augmentee en intercalant des ecrans cylindriques coaxiaux (methode de C.M. Turner). En fonction de leur nombre, de leur rayon et de leur potentiel, on calcule de combien ces ecrans permettent de reduire la valeur du champ regnant primitivement entre les deux cylindres, et, pour un nombre d'ecrans donne, on determine les valeurs optima de leur rayon et potentiel, correspondant a la reduction maximum des champs. (auteur)

  3. High-amplitude THz and GHz strain waves, generated by ultrafast screening of piezoelectric fields in InGaN/GaN multiple quantum wells

    DEFF Research Database (Denmark)

    Porte, Henrik; van Capel, P.J.S.; Turchinovich, Dmitry

    2010-01-01

    Screening of large built-in piezoelectric fields in InGaN/GaN quantum wells leads to high-amplitude acoustic emission. We will compare acoustic emission by quantum wells with different thicknesses with photoluminescence; indicating screening.......Screening of large built-in piezoelectric fields in InGaN/GaN quantum wells leads to high-amplitude acoustic emission. We will compare acoustic emission by quantum wells with different thicknesses with photoluminescence; indicating screening....

  4. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  5. Reverse screening methods to search for the protein targets of chemopreventive compounds

    Science.gov (United States)

    Huang, Hongbin; Zhang, Guigui; Zhou, Yuquan; Lin, Chenru; Chen, Suling; Lin, Yutong; Mai, Shangkang; Huang, Zunnan

    2018-05-01

    This article is a systematic review of reverse screening methods used to search for the protein targets of chemopreventive compounds or drugs. Typical chemopreventive compounds include components of traditional Chinese medicine, natural compounds and Food and Drug Administration (FDA)-approved drugs. Such compounds are somewhat selective but are predisposed to bind multiple protein targets distributed throughout diverse signaling pathways in human cells. In contrast to conventional virtual screening, which identifies the ligands of a targeted protein from a compound database, reverse screening is used to identify the potential targets or unintended targets of a given compound from a large number of receptors by examining their known ligands or crystal structures. This method, also known as in silico or computational target fishing, is highly valuable for discovering the target receptors of query molecules from terrestrial or marine natural products, exploring the molecular mechanisms of chemopreventive compounds, finding alternative indications of existing drugs by drug repositioning, and detecting adverse drug reactions and drug toxicity. Reverse screening can be divided into three major groups: shape screening, pharmacophore screening and reverse docking. Several large software packages, such as Schrödinger and Discovery Studio; typical software/network services such as ChemMapper, PharmMapper, idTarget and INVDOCK; and practical databases of known target ligands and receptor crystal structures, such as ChEMBL, BindingDB and the Protein Data Bank (PDB), are available for use in these computational methods. Different programs, online services and databases have different applications and constraints. Here, we conducted a systematic analysis and multilevel classification of the computational programs, online services and compound libraries available for shape screening, pharmacophore screening and reverse docking to enable non-specialist users to quickly learn and

  6. Field Screening of Waterlogging Tolerance in Spring Wheat and Spring Barley

    Directory of Open Access Journals (Sweden)

    Tove Kristina Sundgren

    2018-03-01

    Full Text Available Improved waterlogging tolerance of wheat and barley varieties may alleviate yield constraints caused by heavy or long-lasting precipitation. The waterlogging tolerance of 181 wheat and 210 barley genotypes was investigated in field trials between 2013 and 2014. A subset of wheat genotypes were selected for yield trials in 2015 and 2016. Our aim was to: (1 characterize the waterlogging tolerance of genotypes with importance for Norwegian wheat and barley breeding, and (2 identify which phenotypic traits that most accurately determine the waterlogging tolerance of wheat in our field trials. Waterlogging tolerance was determined by principal component analysis (PCA where best linear unbiased predictors (BLUPs of the traits chlorosis, relative plant height, heading delay, relative spike number, relative biomass and an overall condition score were used as input variables. Six wheat and five barley genotypes were identified as consistently more tolerant in 2013 and 2014. This included the waterlogging tolerant CIMMYT line CETA/Ae. tauschii (895. Chlorosis and the overall condition score were the traits that best explained the yield response of the genotypes selected for the yield trials. Our results show that early stress symptoms did not necessarily reflect the ability to recover post treatment. Thus, records from full crop cycles appear as fundamental when screening populations with unknown tolerance properties.

  7. The Virtual Fields Method Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements

    CERN Document Server

    Pierron, Fabrice

    2012-01-01

    The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is the first book on the Virtual Fields Method (VFM), a technique to identify materials mechanical properties from full-field measurements. Firmly rooted with extensive theoretical description of the method, the book presents numerous examples of application to a wide range of materials (composites, metals, welds, biomaterials) and situations (static, vibration, high strain rate). The authors give a detailed training section with examples of progressive difficulty to lead the reader to program the VFM and include a set of commented Matlab programs as well as GUI Matlab-based software for more general situations. The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is an ideal book for researchers, engineers, and students interested in applying the VFM to new situations motivated by their research.  

  8. Baseline Screening Mammography: Performance of Full-Field Digital Mammography Versus Digital Breast Tomosynthesis.

    Science.gov (United States)

    McDonald, Elizabeth S; McCarthy, Anne Marie; Akhtar, Amana L; Synnestvedt, Marie B; Schnall, Mitchell; Conant, Emily F

    2015-11-01

    Baseline mammography studies have significantly higher recall rates than mammography studies with available comparison examinations. Digital breast tomosynthesis reduces recalls when compared with digital mammographic screening alone, but many sites operate in a hybrid environment. To maximize the effect of screening digital breast tomosynthesis with limited resources, choosing which patient populations will benefit most is critical. This study evaluates digital breast tomosynthesis in the baseline screening population. Outcomes were compared for 10,728 women who underwent digital mammography screening, including 1204 (11.2%) baseline studies, and 15,571 women who underwent digital breast tomosynthesis screening, including 1859 (11.9%) baseline studies. Recall rates, cancer detection rates, and positive predictive values were calculated. Logistic regression estimated the odds ratios of recall for digital mammography versus digital breast tomosynthesis for patients undergoing baseline screening and previously screened patients, adjusted for age, race, and breast density. In the baseline subgroup, recall rates for digital mammography and digital breast tomosynthesis screening were 20.5% and 16.0%, respectively (p = 0.002); digital breast tomosynthesis screening in the baseline subgroup resulted in a 22% reduction in recall compared with digital mammography, or 45 fewer patients recalled per 1000 patients screened. Digital breast tomosynthesis screening in the previously screened patients resulted in recall reduction of 14.3% (p tomosynthesis than from digital mammography alone.

  9. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  10. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  11. A new screening method for amphetamine and methamphetamine using dansyl chloride derivatization and cartridge fluorescence.

    Science.gov (United States)

    Yamada, H; Ikeda-Wada, S; Oguri, K

    1998-07-01

    A new screening method for amphetamines was developed. It consists of derivatization with dansyl chloride, extraction of the derivative using a Sep-Pak C18 or a Bond Elut C18, solid phase extraction columns, and visualization of the fluorescence of the cartridge. A control test using drug-free urine showed no fluorescence. Amphetamine, methamphetamine and the methylenedioxy derivatives exhibited strong fluorescence, while related compounds, such as N-ethylamphetamine and fenetylline, were negative or weakly positive. The disadvantage of the present method is that it is a multi-step procedure and 20-30 min is required for screening. However, since it has a different specificity from the widely used immunochemical technique, it is suggested to be a useful screen for amphetamines.

  12. Two numerical methods for mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2016-01-09

    Here, we consider numerical methods for stationary mean-field games (MFG) and investigate two classes of algorithms. The first one is a gradient flow method based on the variational characterization of certain MFG. The second one uses monotonicity properties of MFG. We illustrate our methods with various examples, including one-dimensional periodic MFG, congestion problems, and higher-dimensional models.

  13. Two numerical methods for mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2016-01-01

    Here, we consider numerical methods for stationary mean-field games (MFG) and investigate two classes of algorithms. The first one is a gradient flow method based on the variational characterization of certain MFG. The second one uses monotonicity properties of MFG. We illustrate our methods with various examples, including one-dimensional periodic MFG, congestion problems, and higher-dimensional models.

  14. Overlay control methodology comparison: field-by-field and high-order methods

    Science.gov (United States)

    Huang, Chun-Yen; Chiu, Chui-Fu; Wu, Wen-Bin; Shih, Chiang-Lin; Huang, Chin-Chou Kevin; Huang, Healthy; Choi, DongSub; Pierson, Bill; Robinson, John C.

    2012-03-01

    Overlay control in advanced integrated circuit (IC) manufacturing is becoming one of the leading lithographic challenges in the 3x and 2x nm process nodes. Production overlay control can no longer meet the stringent emerging requirements based on linear composite wafer and field models with sampling of 10 to 20 fields and 4 to 5 sites per field, which was the industry standard for many years. Methods that have emerged include overlay metrology in many or all fields, including the high order field model method called high order control (HOC), and field by field control (FxFc) methods also called correction per exposure. The HOC and FxFc methods were initially introduced as relatively infrequent scanner qualification activities meant to supplement linear production schemes. More recently, however, it is clear that production control is also requiring intense sampling, similar high order and FxFc methods. The added control benefits of high order and FxFc overlay methods need to be balanced with the increased metrology requirements, however, without putting material at risk. Of critical importance is the proper control of edge fields, which requires intensive sampling in order to minimize signatures. In this study we compare various methods of overlay control including the performance levels that can be achieved.

  15. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  16. Rapid high temperature field test method for evaluation of geothermal calcite scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1982-08-01

    A test method is described which allows the rapid field testing of calcite scale inhibitors in high- temperature geothermal brines. Five commercial formulations, chosen on the basis of laboratory screening tests, were tested in brines with low total dissolved solids at ca 500 F. Four were found to be effective; of these, 2 were found to be capable of removing recently deposited scale. One chemical was tested in the full-flow brine line for 6 wks. It was shown to stop a severe surface scaling problem at the well's control valve, thus proving the viability of the rapid test method. (12 refs.)

  17. Method of using triaxial magnetic fields for making particle structures

    Science.gov (United States)

    Martin, James E.; Anderson, Robert A.; Williamson, Rodney L.

    2005-01-18

    A method of producing three-dimensional particle structures with enhanced magnetic susceptibility in three dimensions by applying a triaxial energetic field to a magnetic particle suspension and subsequently stabilizing said particle structure. Combinations of direct current and alternating current fields in three dimensions produce particle gel structures, honeycomb structures, and foam-like structures.

  18. Measuring methods, registration and signal processing for magnetic field research

    International Nuclear Information System (INIS)

    Nagiello, Z.

    1981-01-01

    Some measuring methods and signal processing systems based on analogue and digital technics, which have been applied in magnetic field research using magnetometers with ferromagnetic transducers, are presented. (author)

  19. Rapid in vivo screening method for the evaluation of new anti ...

    African Journals Online (AJOL)

    Rapid in vivo screening method for the evaluation of new anti helicobacter ... Six to eight week-old mice pre-treated (7 days) with Amoxicillin/Metronidazole (25 ... These findings were used as a mouse model of Helicobacter pylori infection to ...

  20. Development of automatic image analysis methods for high-throughput and high-content screening

    NARCIS (Netherlands)

    Di, Zi

    2013-01-01

    This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

  1. Estimation of effectiveness of interventions for malaria control in pregnancy using the screening method

    NARCIS (Netherlands)

    Msyamboza, K.; Senga, E.; Tetteh-Ashong, E.; Kazembe, P.; Brabin, B. J.

    2007-01-01

    BACKGROUND: The evaluation of the effectiveness of antimalarial drugs and bed net use in pregnant women is an important aspect of monitoring and surveillance of malaria control in pregnancy. In principle the screening method for assessing vaccine efficacy can be applied in non-vaccine settings for

  2. New Method for Solving Inductive Electric Fields in the Ionosphere

    Science.gov (United States)

    Vanhamäki, H.

    2005-12-01

    We present a new method for calculating inductive electric fields in the ionosphere. It is well established that on large scales the ionospheric electric field is a potential field. This is understandable, since the temporal variations of large scale current systems are generally quite slow, in the timescales of several minutes, so inductive effects should be small. However, studies of Alfven wave reflection have indicated that in some situations inductive phenomena could well play a significant role in the reflection process, and thus modify the nature of ionosphere-magnetosphere coupling. The input to our calculation method are the time series of the potential part of the ionospheric electric field together with the Hall and Pedersen conductances. The output is the time series of the induced rotational part of the ionospheric electric field. The calculation method works in the time-domain and can be used with non-uniform, time-dependent conductances. In addition no particular symmetry requirements are imposed on the input potential electric field. The presented method makes use of special non-local vector basis functions called Cartesian Elementary Current Systems (CECS). This vector basis offers a convenient way of representing curl-free and divergence-free parts of 2-dimensional vector fields and makes it possible to solve the induction problem using simple linear algebra. The new calculation method is validated by comparing it with previously published results for Alfven wave reflection from uniformly conducting ionosphere.

  3. A Wide-Field Fluorescence Microscope Extension for Ultrafast Screening of One-Bead One-Compound Libraries Using a Spectral Image Subtraction Approach.

    Science.gov (United States)

    Heusermann, Wolf; Ludin, Beat; Pham, Nhan T; Auer, Manfred; Weidemann, Thomas; Hintersteiner, Martin

    2016-05-09

    The increasing involvement of academic institutions and biotech companies in drug discovery calls for cost-effective methods to identify new bioactive molecules. Affinity-based on-bead screening of combinatorial one-bead one-compound libraries combines a split-mix synthesis design with a simple protein binding assay operating directly at the bead matrix. However, one bottleneck for academic scale on-bead screening is the unavailability of a cheap, automated, and robust screening platform that still provides a quantitative signal related to the amount of target protein binding to individual beads for hit bead ranking. Wide-field fluorescence microscopy has long been considered unsuitable due to significant broad spectrum autofluorescence of the library beads in conjunction with low detection sensitivity. Herein, we demonstrate how such a standard microscope equipped with LED-based excitation and a modern CMOS camera can be successfully used for selecting hit beads. We show that the autofluorescence issue can be overcome by an optical image subtraction approach that yields excellent signal-to-noise ratios for the detection of bead-associated target proteins. A polymer capillary attached to a semiautomated bead-picking device allows the operator to efficiently isolate individual hit beads in less than 20 s. The system can be used for ultrafast screening of >200,000 bead-bound compounds in 1.5 h, thereby making high-throughput screening accessible to a wider group within the scientific community.

  4. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  5. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  6. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  7. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  8. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.

    1992-01-01

    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  9. Field Method for Integrating the First Order Differential Equation

    Institute of Scientific and Technical Information of China (English)

    JIA Li-qun; ZHENG Shi-wang; ZHANG Yao-yu

    2007-01-01

    An important modern method in analytical mechanics for finding the integral, which is called the field-method, is used to research the solution of a differential equation of the first order. First, by introducing an intermediate variable, a more complicated differential equation of the first order can be expressed by two simple differential equations of the first order, then the field-method in analytical mechanics is introduced for solving the two differential equations of the first order. The conclusion shows that the field-method in analytical mechanics can be fully used to find the solutions of a differential equation of the first order, thus a new method for finding the solutions of the first order is provided.

  10. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  11. Staging Henry Fielding: The Author-Narrator in Tom Jones On Screen

    Directory of Open Access Journals (Sweden)

    Eli Løfaldli

    2017-06-01

    Full Text Available As recent adaptation theory has shown, classic-novel adaptation typically sets issues connected to authorship and literal and figurative ownership into play. This key feature of such adaptations is also central to the screen versions of Henry Fielding’s Tom Jones (1749. In much of Fielding’s fiction, the narrator, typically understood as an embodiment of Fielding himself, is a particularly prominent presence. The author-narrator in Tom Jones is no exception: not only is his presence strongly felt throughout the novel, but through a variety of means, ‘The History of Tom Jones, A Foundling’ is also distinctly marked as being under his control and ownership. The two adaptations of Fielding’s novel, a 1963 film and a 1997 television series, both retain the figure of the author-narrator, but differ greatly in their handling of this device and its consequent thematic ramifications. Although the 1963 film de-emphasises Henry Fielding’s status as proprietor of the story, the author-narrator as represented in the film’s voiceover commentary is a figure of authority and authorial control. In contrast, the 1997 adaptation emphasises Fielding’s ownership of the narrative and even includes the author-narrator as a character in the series, but this ownership is undermined by the irreverent treatment to which he is consistently subjected. The representations of Henry Fielding in the form of the author-narrator in both adaptations are not only indicative of shifting conceptions of authorship, but also of the important interplay between authorship, ownership and adaptation more generally.

  12. Study on a noninvasive method for rapid screening Human Serum albumin injectables by Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2017-01-01

    Full Text Available Human serum albumin (HSA injectable product is a severely afflicted area on drug safety due to its high price and restricted supply. Raman spectroscopy performances high specificity on HSA detection and it is even possible to determine HSA injectable products noninvasively. In this study, we developed a noninvasive rapid screening method for of HSA injectable products by using portable Raman spectrometer. Qualitative models were established by using principal component analysis combined with classical least squares (PCA-CLS algorithm, while quantitative model was established by using partial least squares (PLS algorithm. Model transfer in different instruments of both the same and different apparatus modules was further discussed in this paper. A total of 34 HSA injectable samples collected from markets were used for verification. The identification results showed 100% accuracy and the predicted concentrations of those identified as true HSA were consistent with their labeled concentrations. The quantitative results also indicated that model transfer was excellent in the same apparatus modules of Raman spectrometer at all concentration levels, and still good enough in the different apparatus modules although the relative standard deviation (RSD value showed a little increasing trend at low HSA concentration level. In conclusion, the method was proved to be feasible and efficient for screening HSA injections, especially on its screening speed and the consideration of glass containers. Moreover, with inspiring results on the model transfer, the method could be used as a universal screening mean to different Raman instruments.

  13. Force-free magnetic fields - The magneto-frictional method

    Science.gov (United States)

    Yang, W. H.; Sturrock, P. A.; Antiochos, S. K.

    1986-01-01

    The problem under discussion is that of calculating magnetic field configurations in which the Lorentz force j x B is everywhere zero, subject to specified boundary conditions. We choose to represent the magnetic field in terms of Clebsch variables in the form B = grad alpha x grad beta. These variables are constant on any field line so that each field line is labeled by the corresponding values of alpha and beta. When the field is described in this way, the most appropriate choice of boundary conditions is to specify the values of alpha and beta on the bounding surface. We show that such field configurations may be calculated by a magneto-frictional method. We imagine that the field lines move through a stationary medium, and that each element of magnetic field is subject to a frictional force parallel to and opposing the velocity of the field line. This concept leads to an iteration procedure for modifying the variables alpha and beta, that tends asymptotically towards the force-free state. We apply the method first to a simple problem in two rectangular dimensions, and then to a problem of cylindrical symmetry that was previously discussed by Barnes and Sturrock (1972). In one important respect, our new results differ from the earlier results of Barnes and Sturrock, and we conclude that the earlier article was in error.

  14. Environmental Measurement-While-Drilling system for real-time field screening of contaminants

    International Nuclear Information System (INIS)

    Lockwood, G.J.; Normann, R.A.; Bishop, L.B.; Floran, R.J.; Williams, C.V.

    1995-01-01

    Sampling during environmental drilling is essential to fully characterize the spatial distribution and migration of near surface contaminants. However, the analysis of these samples is not only expensive, but can take weeks or months when sent to an off-site laboratory. In contrast, measurement-while-drilling (MWD) screening capability could save money and valuable time by quickly distinguishing between contaminated and uncontaminated areas. Real-time measurements provided by a MVM system would enable on-the-spot decisions to be made regarding sampling strategies, enhance worker safety, and provide the added flexibility of being able to ''steer'' the drill bit in or out hazardous zones. During measurement-while-drilling, down-hole sensors are located behind the drill bit and linked by a rapid data transmission system to a computer at the surface. As drilling proceeds, data are collected on the nature and extent of the subsurface contamination in real-time. The down-hole sensor is a Geiger-Mueller tube (GMT) gamma radiation detector. In addition to the GMT signal, the MWD system monitors these required down-hole voltages and two temperatures associated with the detector assembly. The Gamma Ray Detection System (GRDS) and electronics package are discussed in as well as the results of the field test. Finally, our conclusions and discussion of future work are presented

  15. Inexpensive and fast pathogenic bacteria screening using field-effect transistors.

    Science.gov (United States)

    Formisano, Nello; Bhalla, Nikhil; Heeran, Mel; Reyes Martinez, Juana; Sarkar, Amrita; Laabei, Maisem; Jolly, Pawan; Bowen, Chris R; Taylor, John T; Flitsch, Sabine; Estrela, Pedro

    2016-11-15

    While pathogenic bacteria contribute to a large number of globally important diseases and infections, current clinical diagnosis is based on processes that often involve culturing which can be time-consuming. Therefore, innovative, simple, rapid and low-cost solutions to effectively reduce the burden of bacterial infections are urgently needed. Here we demonstrate a label-free sensor for fast bacterial detection based on metal-oxide-semiconductor field-effect transistors (MOSFETs). The electric charge of bacteria binding to the glycosylated gates of a MOSFET enables quantification in a straightforward manner. We show that the limit of quantitation is 1.9×10(5) CFU/mL with this simple device, which is more than 10,000-times lower than is achieved with electrochemical impedance spectroscopy (EIS) and matrix-assisted laser desorption ionisation time-of-flight mass spectrometry (MALDI-ToF) on the same modified surfaces. Moreover, the measurements are extremely fast and the sensor can be mass produced at trivial cost as a tool for initial screening of pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Screening, sensitivity, and uncertainty for the CREAM method of Human Reliability Analysis

    International Nuclear Information System (INIS)

    Bedford, Tim; Bayley, Clare; Revie, Matthew

    2013-01-01

    This paper reports a sensitivity analysis of the Cognitive Reliability and Error Analysis Method for Human Reliability Analysis. We consider three different aspects: the difference between the outputs of the Basic and Extended methods, on the same HRA scenario; the variability in outputs through the choices made for common performance conditions (CPCs); and the variability in outputs through the assignment of choices for cognitive function failures (CFFs). We discuss the problem of interpreting categories when applying the method, compare its quantitative structure to that of first generation methods and discuss also how dependence is modelled with the approach. We show that the control mode intervals used in the Basic method are too narrow to be consistent with the Extended method. This motivates a new screening method that gives improved accuracy with respect to the Basic method, in the sense that (on average) halves the uncertainty associated with the Basic method. We make some observations on the design of a screening method that are generally applicable in Risk Analysis. Finally, we propose a new method of combining CPC weights with nominal probabilities so that the calculated probabilities are always in range (i.e. between 0 and 1), while satisfying sensible properties that are consistent with the overall CREAM method

  17. Development of methods for screening pesticide residues in plant matrices in Ghana

    International Nuclear Information System (INIS)

    Lowor, Samuel Tetteh

    1999-12-01

    TLC has been used in combination with micro-extraction and clean-up methods to provide an alternative cost effective analytical procedure for screening pesticide residues in plant matrices. Thirty-five (35) agrochemicals, which are used in priority crops in Ghana, were used in this study. Ethylacetate extraction in the presence of anhydrous sodium sulphate, followed by gel permeation chromatographic clean up and additional purification on silica gel cartridges provided clean extracts enabling the application of 300mg sample equivalent on the TLC plates. Detection method involving the use of O-tolidine was found to be suitable for general screening of residues, having medium sensitivity for several compounds. The method involving the use of silver nitrate was the only one found to be most suitable for detecting the organo chlorine pesticides. Lindane was the most sensitive to this reagent and had a Minimum Detectable Quantity (MDQ) value of 5ng/5 uL. This method was suitable for use on only alumina plates and detection was also possible even under sunlight. The enzyme inhibition methods were very sensitive to the carbamate and phosphoric acid type insecticides with MDQ values between 0.2 and 2000ng. Other detection methods involving p-nitrobenzene, p-dimethylaminobenzaldehyde and photosynthesis inhibition were also tried and discussed. The database developed has been successfully used for screening and semiquantitative determination of some ranges of pesticide residue in soil and plant matrices. (au)

  18. Comparison of electric field exposure measurement methods under power lines

    International Nuclear Information System (INIS)

    Korpinen, L.; Kuisti, H.; Tarao, H.; Paeaekkoenen, R.; Elovaara, J.

    2014-01-01

    The object of the study was to investigate extremely low frequency (ELF) electric field exposure measurement methods under power lines. The authors compared two different methods under power lines: in Method A, the sensor was placed on a tripod; and Method B required the measurer to hold the meter horizontally so that the distance from him/her was at least 1.5 m. The study includes 20 measurements in three places under 400 kV power lines. The authors used two commercial three-axis meters, EFA-3 and EFA-300. In statistical analyses, they did not find significant differences between Methods A and B. However, in the future, it is important to take into account that measurement methods can, in some cases, influence ELF electric field measurement results, and it is important to report the methods used so that it is possible to repeat the measurements. (authors)

  19. Computer-aided detection of masses in full-field digital mammography using screen-film mammograms for training

    International Nuclear Information System (INIS)

    Kallenberg, Michiel; Karssemeijer, Nico

    2008-01-01

    It would be of great value when available databases of screen-film mammography (SFM) images can be used to train full-field digital mammography (FFDM) computer-aided detection (CAD) systems, as compilation of new databases is costly. In this paper, we investigate this possibility. Firstly, we develop a method that converts an FFDM image into an SFM-like representation. In this conversion method, we establish a relation between exposure and optical density by simulation of an automatic exposure control unit. Secondly, we investigate the effects of using the SFM images as training samples compared to training with FFDM images. Our FFDM database consisted of 266 cases, of which 102 were biopsy-proven malignant masses and 164 normals. The images were acquired with systems of two different manufacturers. We found that, when we trained our FFDM CAD system with a small number of images, training with FFDM images, using a five-fold crossvalidation procedure, outperformed training with SFM images. However, when the full SFM database, consisting of 348 abnormal cases (including 204 priors) and 810 normal cases, was used for training, SFM training outperformed FFDMA training. These results show that an existing CAD system for detection of masses in SFM can be used for FFDM images without retraining.

  20. Cost and effectiveness comparison of two methods for screening potential blood donors for anaemia in Vietnam.

    Science.gov (United States)

    Tyrrell, A; Worrall, E; Que, T N; Bates, I

    2011-06-01

    To compare the cost and effectiveness of Copper Sulphate (CS) and HemoCue (HC) methods for screening blood donors for anaemia. Robust information from developing countries about cost and effectiveness of anaemia screening methods for blood donors is scarce. In such countries there are widespread shortages of blood, so the most cost-effective method should maximise blood supply without compromising donor safety. Economic data (e.g. staff time, equipment and buildings) were collected from direct observation of procedures and purchase data from Hanoi's Central Blood Bank administrative department. A framework for comparing the cost and effectiveness of anaemia screening methods was developed and a cost per effective (i.e. usable and accurate) test was generated for each method. Samples from 100 potential donors from the Hanoi Central Blood Bank (static) and 198 from two mobile units were tested. The mean probability of an ineffective anaemia test was 0·1 (0·05-0·2). The average cost of an HC test was $0·75 (static $0·61 and mobile $0·89) and a CS test was $0·31 (static $0·17 and mobile $0·45). The difference between static and mobile units was predominantly due to transport costs; the difference between the two methods was predominantly due to the HC microcuvettes. In this setting the CS yields greater value for money than the HC method for screening blood donors. The relative cost and effectiveness of CS and HC may be different in places with higher staff turnover, lower test accuracy, higher anaemia prevalence or lower workload than in Vietnam. © 2010 Liverpool School of Tropical Medicine. Transfusion Medicine © 2010 British Blood Transfusion Society.

  1. Nontargeted Screening Method for Illegal Additives Based on Ultrahigh-Performance Liquid Chromatography-High-Resolution Mass Spectrometry.

    Science.gov (United States)

    Fu, Yanqing; Zhou, Zhihui; Kong, Hongwei; Lu, Xin; Zhao, Xinjie; Chen, Yihui; Chen, Jia; Wu, Zeming; Xu, Zhiliang; Zhao, Chunxia; Xu, Guowang

    2016-09-06

    Identification of illegal additives in complex matrixes is important in the food safety field. In this study a nontargeted screening strategy was developed to find illegal additives based on ultrahigh-performance liquid chromatography-high-resolution mass spectrometry (UHPLC-HRMS). First, an analytical method for possible illegal additives in complex matrixes was established including fast sample pretreatment, accurate UHPLC separation, and HRMS detection. Second, efficient data processing and differential analysis workflow were suggested and applied to find potential risk compounds. Third, structure elucidation of risk compounds was performed by (1) searching online databases [Metlin and the Human Metabolome Database (HMDB)] and an in-house database which was established at the above-defined conditions of UHPLC-HRMS analysis and contains information on retention time, mass spectra (MS), and tandem mass spectra (MS/MS) of 475 illegal additives, (2) analyzing fragment ions, and (3) referring to fragmentation rules. Fish was taken as an example to show the usefulness of the nontargeted screening strategy, and six additives were found in suspected fish samples. Quantitative analysis was further carried out to determine the contents of these compounds. The satisfactory application of this strategy in fish samples means that it can also be used in the screening of illegal additives in other kinds of food samples.

  2. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  3. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  4. Wave field restoration using three-dimensional Fourier filtering method.

    Science.gov (United States)

    Kawasaki, T; Takai, Y; Ikuta, T; Shimizu, R

    2001-11-01

    A wave field restoration method in transmission electron microscopy (TEM) was mathematically derived based on a three-dimensional (3D) image formation theory. Wave field restoration using this method together with spherical aberration correction was experimentally confirmed in through-focus images of amorphous tungsten thin film, and the resolution of the reconstructed phase image was successfully improved from the Scherzer resolution limit to the information limit. In an application of this method to a crystalline sample, the surface structure of Au(110) was observed in a profile-imaging mode. The processed phase image showed quantitatively the atomic relaxation of the topmost layer.

  5. Extensions of the auxiliary field method to solve Schroedinger equations

    International Nuclear Information System (INIS)

    Silvestre-Brac, Bernard; Semay, Claude; Buisseret, Fabien

    2008-01-01

    It has recently been shown that the auxiliary field method is an interesting tool to compute approximate analytical solutions of the Schroedinger equation. This technique can generate the spectrum associated with an arbitrary potential V(r) starting from the analytically known spectrum of a particular potential P(r). In the present work, general important properties of the auxiliary field method are proved, such as scaling laws and independence of the results on the choice of P(r). The method is extended in order to find accurate analytical energy formulae for radial potentials of the form aP(r) + V(r), and several explicit examples are studied. Connections existing between the perturbation theory and the auxiliary field method are also discussed

  6. Extensions of the auxiliary field method to solve Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Silvestre-Brac, Bernard [LPSC Universite Joseph Fourier, Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Avenue des Martyrs 53, F-38026 Grenoble-Cedex (France); Semay, Claude; Buisseret, Fabien [Groupe de Physique Nucleaire Theorique, Universite de Mons-Hainaut, Academie universitaire Wallonie-Bruxelles, Place du Parc 20, B-7000 Mons (Belgium)], E-mail: silvestre@lpsc.in2p3.fr, E-mail: claude.semay@umh.ac.be, E-mail: fabien.buisseret@umh.ac.be

    2008-10-24

    It has recently been shown that the auxiliary field method is an interesting tool to compute approximate analytical solutions of the Schroedinger equation. This technique can generate the spectrum associated with an arbitrary potential V(r) starting from the analytically known spectrum of a particular potential P(r). In the present work, general important properties of the auxiliary field method are proved, such as scaling laws and independence of the results on the choice of P(r). The method is extended in order to find accurate analytical energy formulae for radial potentials of the form aP(r) + V(r), and several explicit examples are studied. Connections existing between the perturbation theory and the auxiliary field method are also discussed.

  7. Sheet metals characterization using the virtual fields method

    Science.gov (United States)

    Marek, Aleksander; Davis, Frances M.; Pierron, Fabrice

    2018-05-01

    In this work, a characterisation method involving a deep-notched specimen subjected to a tensile loading is introduced. This specimen leads to heterogeneous states of stress and strain, the latter being measured using a stereo DIC system (MatchID). This heterogeneity enables the identification of multiple material parameters in a single test. In order to identify material parameters from the DIC data, an inverse method called the Virtual Fields Method is employed. The method combined with recently developed sensitivity-based virtual fields allows to optimally locate areas in the test where information about each material parameter is encoded, improving accuracy of the identification over the traditional user-defined virtual fields. It is shown that a single test performed at 45° to the rolling direction is sufficient to obtain all anisotropic plastic parameters, thus reducing experimental effort involved in characterisation. The paper presents the methodology and some numerical validation.

  8. Environmental Measurement While Drilling System for Real-Time Field Screening of Contaminants

    International Nuclear Information System (INIS)

    Lockwood, G.J.; Normann, R.A.; Williams, C.V.

    1999-01-01

    Sampling during environmental drilling is essential to fully characterize the spatial distribution and migration of subsurface contaminants. However, analysis of the samples is expensive and time-consuming: off-site laboratory analysis can take weeks or months. Real-time information on environmental conditions, drill bit location and temperature during drilling is valuable in many environmental restoration operations. This type of information can be used to provide field screening data and improved efficiency of site characterization activities. The Environmental Measurement-While-Drilling (EMWD) System represents an innovative blending of new and existing technology in order to obtain real-time data during drilling. The system consists of two subsystems. The down-hole subsystem (at the drill bit) consists of sensors, a power supply, a signal conditioning and transmitter board, and a radio-frequency (RF) coaxial cable. The up-hole subsystem consists of a battery pack/coil, pickup coil, receiver, and personal computer. The system is compatible with fluid miser drill pipe, a directional drilling technique that uses minimal drilling fluids and generates little to no secondary waste. In EMWD, downhole sensors are located behind the drill bit and linked by a high-speed data transmission system to a computer at the surface. Sandia-developed Windowstrademark-based software is used for data display and storage. As drilling is conducted, data is collected on the nature and extent of contamination, enabling on-the-spot decisions regarding drilling and sampling strategies. Initially, the downhole sensor consisted of a simple gamma radiation detector, a Geiger-Mueller tube (GMT). The design includes data assurance techniques to increase safety by reducing the probability of giving a safe indication when an unsafe condition exists. The EMWD system has been improved by the integration of a Gamma Ray Spectrometer (GRS) in place of the GMT. The GRS consists of a sodium iodide

  9. Accuracy limits of the equivalent field method for irregular photon fields

    International Nuclear Information System (INIS)

    Sanz, Dario Esteban

    2002-01-01

    A mathematical approach is developed to evaluate the accuracy of the equivalent field method using basic clinical photon beam data. This paper presents an analytical calculation of dose errors arising when field equivalencies, calculated at a certain reference depth, are translated to other depths. The phantom scatter summation is expressed as a Riemann-Stieltjes integral and two categories of irregular fields are introduced: uniform and multiform. It is shown that multiform fields produce errors whose magnitudes are nearly twice those corresponding to uniform fields in extreme situations. For uniform field shapes, the maximum, local, relative dose errors, when the equivalencies are calculated at 10 cm depth on the central axis and translated to a depth of 30 cm, are 3.8% and 8.8% for 6 MV and cobalt-60 photon beams, respectively. In terms of maximum dose those errors are within 1-2%. This supports the conclusion that the equivalencies between rectangular fields, which are examples of uniform fields, are applicable to dose ratio functions irrespective of beam energy. However, the magnitude of such errors could be of importance when assessing the exit dose for in vivo monitoring. This work provides a better understanding of the influence of the irregular field shapes on the accuracy of the equivalent field method. (author)

  10. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  11. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  12. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening......CT seems superior to US concerning sensitivity, and is able to detect aneurysmal lesions not detectable with US. Finally, the prevalence of AAA in Denmark seems to remain relatively high, in this small pilot study group....

  13. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  14. A regularization method for extrapolation of solar potential magnetic fields

    Science.gov (United States)

    Gary, G. A.; Musielak, Z. E.

    1992-01-01

    The mathematical basis of a Tikhonov regularization method for extrapolating the chromospheric-coronal magnetic field using photospheric vector magnetograms is discussed. The basic techniques show that the Cauchy initial value problem can be formulated for potential magnetic fields. The potential field analysis considers a set of linear, elliptic partial differential equations. It is found that, by introducing an appropriate smoothing of the initial data of the Cauchy potential problem, an approximate Fourier integral solution is found, and an upper bound to the error in the solution is derived. This specific regularization technique, which is a function of magnetograph measurement sensitivities, provides a method to extrapolate the potential magnetic field above an active region into the chromosphere and low corona.

  15. Interferometric methods for mapping static electric and magnetic fields

    DEFF Research Database (Denmark)

    Pozzi, Giulio; Beleggia, Marco; Kasama, Takeshi

    2014-01-01

    The mapping of static electric and magnetic fields using electron probes with a resolution and sensitivity that are sufficient to reveal nanoscale features in materials requires the use of phase-sensitive methods such as the shadow technique, coherent Foucault imaging and the Transport of Intensi......) the model-independent determination of the locations and magnitudes of field sources (electric charges and magnetic dipoles) directly from electron holographic data.......The mapping of static electric and magnetic fields using electron probes with a resolution and sensitivity that are sufficient to reveal nanoscale features in materials requires the use of phase-sensitive methods such as the shadow technique, coherent Foucault imaging and the Transport of Intensity...... on theoretical models that form the basis of the quantitative interpretation of electron holographic data. We review the application of electron holography to a variety of samples (including electric fields associated with p–n junctions in semiconductors, quantized magnetic flux in superconductors...

  16. Screening of a new cadmium hyperaccumulator, Galinsoga parviflora, from winter farmland weeds using the artificially high soil cadmium concentration method.

    Science.gov (United States)

    Lin, Lijin; Jin, Qian; Liu, Yingjie; Ning, Bo; Liao, Ming'an; Luo, Li

    2014-11-01

    A new method, the artificially high soil cadmium (Cd) concentration method, was used to screen for Cd hyperaccumulators among winter farmland weeds. Galinsoga parviflora was the most promising remedial plant among 5 Cd accumulators or hyperaccumulators. In Cd concentration gradient experiments, as soil Cd concentration increased, root and shoot biomass decreased, and their Cd contents increased. In additional concentration gradient experiments, superoxide dismutase and peroxidase activities increased with soil Cd concentrations up to 75 mg kg(-1) , while expression of their isoenzymes strengthened. Catalase (CAT) activity declined and CAT isoenzyme expression weakened at soil Cd concentrations less than 50 mg kg(-1) . The maxima of Cd contents in shoots and roots were 137.63 mg kg(-1) and 105.70 mg kg(-1) , respectively, at 100 mg kg(-1) Cd in soil. The root and shoot bioconcentration factors exceeded 1.0, as did the translocation factor. In a field experiment, total extraction of Cd by shoots was 1.35 mg m(-2) to 1.43 mg m(-2) at soil Cd levels of 2.04 mg kg(-1) to 2.89 mg kg(-1) . Therefore, the artificially high soil Cd concentration method was effective for screening Cd hyperaccumulators. Galinsoga parviflora is a Cd hyperaccumulator that could be used to efficiently remediate Cd-contaminated farmland soil. © 2014 SETAC.

  17. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  18. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  19. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    International Nuclear Information System (INIS)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-01-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  20. Lattice field theories: non-perturbative methods of analysis

    International Nuclear Information System (INIS)

    Weinstein, M.

    1978-01-01

    A lecture is given on the possible extraction of interesting physical information from quantum field theories by studying their semiclassical versions. From the beginning the problem of solving for the spectrum states of any given continuum quantum field theory is considered as a giant Schroedinger problem, and then some nonperturbative methods for diagonalizing the Hamiltonian of the theory are explained without recourse to semiclassical approximations. The notion of a lattice appears as an artifice to handle the problems associated with the familiar infrared and ultraviolet divergences of continuum quantum field theory and in fact for all but gauge theories. 18 references

  1. Multigrid methods for the computation of propagators in gauge fields

    International Nuclear Information System (INIS)

    Kalkreuter, T.

    1992-11-01

    In the present work generalizations of multigrid methods for propagators in gauge fields are investigated. We discuss proper averaging operations for bosons and for staggered fermions. An efficient algorithm for computing C numerically is presented. The averaging kernels C can be used not only in deterministic multigrid computations, but also in multigrid Monte Carlo simulations, and for the definition of block spins and blocked gauge fields in Monte Carlo renormalization group studies of gauge theories. Actual numerical computations of kernels and propagators are performed in compact four-dimensional SU(2) gauge fields. (orig./HSI)

  2. Perspective: Ab initio force field methods derived from quantum mechanics

    Science.gov (United States)

    Xu, Peng; Guidez, Emilie B.; Bertoni, Colleen; Gordon, Mark S.

    2018-03-01

    It is often desirable to accurately and efficiently model the behavior of large molecular systems in the condensed phase (thousands to tens of thousands of atoms) over long time scales (from nanoseconds to milliseconds). In these cases, ab initio methods are difficult due to the increasing computational cost with the number of electrons. A more computationally attractive alternative is to perform the simulations at the atomic level using a parameterized function to model the electronic energy. Many empirical force fields have been developed for this purpose. However, the functions that are used to model interatomic and intermolecular interactions contain many fitted parameters obtained from selected model systems, and such classical force fields cannot properly simulate important electronic effects. Furthermore, while such force fields are computationally affordable, they are not reliable when applied to systems that differ significantly from those used in their parameterization. They also cannot provide the information necessary to analyze the interactions that occur in the system, making the systematic improvement of the functional forms that are used difficult. Ab initio force field methods aim to combine the merits of both types of methods. The ideal ab initio force fields are built on first principles and require no fitted parameters. Ab initio force field methods surveyed in this perspective are based on fragmentation approaches and intermolecular perturbation theory. This perspective summarizes their theoretical foundation, key components in their formulation, and discusses key aspects of these methods such as accuracy and formal computational cost. The ab initio force fields considered here were developed for different targets, and this perspective also aims to provide a balanced presentation of their strengths and shortcomings. Finally, this perspective suggests some future directions for this actively developing area.

  3. HIGH THROUGHPUT SCREENING METHOD AND APPARATUS FOR ANALYSING INTERACTIONS BETWEEN SURFACES WITH DIFFERENT TOPOGRAPHY AND THE ENVIRONMENT

    NARCIS (Netherlands)

    de Boer, Jan; van Blitterswijk, Clemens; Unadkat, H.V.; Stamatialis, Dimitrios; Papenburg, B.J.; Wessling, Matthias

    2009-01-01

    The invention is directed to a high throughput screening method for analysing and interaction between a surface of a material and an environment. The screening method of the invention comprises: providing a micro-array comprising said material and having a multitude of units at least part of which

  4. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  5. Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection.

    Science.gov (United States)

    Nzelu, Chukwunonso O; Gomez, Eduardo A; Cáceres, Abraham G; Sakurai, Tatsuya; Martini-Robles, Luiggi; Uezato, Hiroshi; Mimori, Tatsuyuki; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo

    2014-04-01

    Entomological monitoring of Leishmania infection in leishmaniasis endemic areas offers epidemiologic advantages for predicting the risk and expansion of the disease, as well as evaluation of the effectiveness of control programs. In this study, we developed a highly sensitive loop-mediated isothermal amplification (LAMP) method for the mass screening of sand flies for Leishmania infection based on the 18S rRNA gene. The LAMP technique could detect 0.01 parasites, which was more sensitive than classical PCR. The method was robust and could amplify the target DNA within 1h from a crude sand fly template without DNA purification. Amplicon detection could be accomplished by the newly developed colorimetric malachite green (MG)--mediated naked eye visualization. Pre-addition of MG to the LAMP reaction solution did not inhibit amplification efficiency. The field applicability of the colorimetric MG-based LAMP assay was demonstrated with 397 field-caught samples from the endemic areas of Ecuador and eight positive sand flies were detected. The robustness, superior sensitivity, and ability to produce better visual discriminatory reaction products than existing LAMP fluorescence and turbidity assays indicated the field potential usefulness of this new method for surveillance and epidemiological studies of leishmaniasis in developing countries. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. A novel two-step method for screening shade tolerant mutant plants via dwarfism

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-10-01

    Full Text Available When subjected to shade, plants undergo rapid shoot elongation, which often makes them more prone to disease and mechanical damage. Shade-tolerant plants can be difficult to breed; however, they offer a substantial benefit over other varieties in low-light areas. Although perennial ryegrass (Lolium perenne L. is a popular species of turf grasses because of their good appearance and fast establishment, the plant normally does not perform well under shade conditions. It has been reported that, in turfgrass, induced dwarfism can enhance shade tolerance. Here we describe a two-step procedure for isolating shade tolerant mutants of perennial ryegrass by first screening for dominant dwarf mutants, and then screening dwarf plants for shade tolerance. The two-step screening process to isolate shade tolerant mutants can be done efficiently with limited space at early seedling stages, which enables quick and efficient isolation of shade tolerant mutants, and thus facilitates development of shade tolerant new cultivars of turfgrasses. Using the method, we isolated 136 dwarf mutants from 300,000 mutagenized seeds, with 65 being shade tolerant (0.022%. When screened directly for shade tolerance, we recovered only four mutants from a population of 150,000 (0.003% mutagenized seeds. One shade tolerant mutant, shadow-1, was characterized in detail. In addition to dwarfism, shadow-1 and its sexual progeny displayed high degrees of tolerance to both natural and artificial shade. We showed that endogenous gibberellin (GA content in shadow-1 was higher than wild-type controls, and shadow-1 was also partially GA insensitive. Our novel, simple and effective two-step screening method should be applicable to breeding shade tolerant cultivars of turfgrasses, ground covers, and other economically important crop plants that can be used under canopies of existing vegetation to increase productivity per unit area of land.

  7. Using stable isotopes to monitor forms of sulfur during desulfurization processes: A quick screening method

    Science.gov (United States)

    Liu, Chao-Li; Hackley, Keith C.; Coleman, D.D.; Kruse, C.W.

    1987-01-01

    A method using stable isotope ratio analysis to monitor the reactivity of sulfur forms in coal during thermal and chemical desulfurization processes has been developed at the Illinois State Geological Survey. The method is based upon the fact that a significant difference exists in some coals between the 34S/32S ratios of the pyritic and organic sulfur. A screening method for determining the suitability of coal samples for use in isotope ratio analysis is described. Making these special coals available from coal sample programs would assist research groups in sorting out the complex sulfur chemistry which accompanies thermal and chemical processing of high sulfur coals. ?? 1987.

  8. Ultra-high-throughput screening method for the directed evolution of glucose oxidase.

    Science.gov (United States)

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer

    2014-03-20

    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Methods for efficient high-throughput screening of protein expression in recombinant Pichia pastoris strains.

    Science.gov (United States)

    Camattari, Andrea; Weinhandl, Katrin; Gudiminchi, Rama K

    2014-01-01

    The methylotrophic yeast Pichia pastoris is becoming one of the favorite industrial workhorses for protein expression. Due to the widespread use of integration vectors, which generates significant clonal variability, screening methods allowing assaying hundreds of individual clones are of particular importance. Here we describe methods to detect and analyze protein expression, developed in a 96-well format for high-throughput screening of recombinant P. pastoris strains. The chapter covers essentially three common scenarios: (1) an enzymatic assay for proteins expressed in the cell cytoplasm, requiring cell lysis; (2) a whole-cell assay for a fungal cytochrome P450; and (3) a nonenzymatic assay for detection and quantification of tagged protein secreted into the supernatant.

  10. A method of measuring and correcting tilt of anti - vibration wind turbines based on screening algorithm

    Science.gov (United States)

    Xiao, Zhongxiu

    2018-04-01

    A Method of Measuring and Correcting Tilt of Anti - vibration Wind Turbines Based on Screening Algorithm is proposed in this paper. First of all, we design a device which the core is the acceleration sensor ADXL203, the inclination is measured by installing it on the tower of the wind turbine as well as the engine room. Next using the Kalman filter algorithm to filter effectively by establishing a state space model for signal and noise. Then we use matlab for simulation. Considering the impact of the tower and nacelle vibration on the collected data, the original data and the filtering data are classified and stored by the Screening algorithm, then filter the filtering data to make the output data more accurate. Finally, we eliminate installation errors by using algorithm to achieve the tilt correction. The device based on this method has high precision, low cost and anti-vibration advantages. It has a wide range of application and promotion value.

  11. Application of NMR Screening Methods with 19F Detection to Fluorinated Compounds Bound to Proteins

    Directory of Open Access Journals (Sweden)

    Kazuo Furihata

    2017-12-01

    Full Text Available The combinational use of one-dimensional (1D NMR-based screening techniques with 1H and 19F detections were applied to a human serum albumin–diflunisal complex. Since most NMR screening methods observe 1H spectra, the overlapped 1H signals were unavailable in the binding epitope mapping. However, the NMR experiments with 19F detection can be used as an effective complementary method. For the purpose of identifying the 1H and 19F binding epitopes of diflunisal, this paper carries out a combinatorial analysis using 1H{1H} and 19F{1H} saturation transfer difference experiments. The differences of the 1H-inversion recovery rates with and without target irradiation are also analyzed for a comprehensive interpretation of binding epitope mapping.

  12. Use of the blue cotton screen method with endoscopy to detect occult esophageal foreign bodies.

    Science.gov (United States)

    Xia, Yan; Zhang, Fan; Xu, Hong; Xu, Weiran

    2017-12-01

    More than 20,000 cases of upper gastrointestinal foreign bodies (FBs) have been reported in the last 5 years in China. Early detection and treatment is vital in these patients. Differential diagnosis of esophageal injury and occult esophageal foreign bodies is challenging, particularly in the case of non-radio-opaque foreign bodies. A diagnostic technique with high accuracy and low risk is needed for clinical practice. We describe successful use of the "blue cotton screen method" to detect esophageal foreign bodies in 2 patients. The advantages and disadvantages of various diagnostic modalities in the management of patients with foreign body ingestion are presented. This technique is safer and more effective than traditional methods for foreign body impaction in the esophageal cavity. It could be applied for screening and in the differential diagnosis of esophageal injury and FBs in the esophageal lumen.

  13. A study on asymptomatic bacteriuria in pregnancy: prevalence, etiology and comparison of screening methods

    OpenAIRE

    Kheya Mukherjee; Saroj Golia; Vasudha CL; Babita; Debojyoti Bhattacharjee; Goutam Chakroborti

    2014-01-01

    Background: Asymptomatic bacteriuria is common in women with prevalence of 4-7% in pregnancy. The traditional reference test for bacteriuria is quantitative culture of urine which is relatively expensive time consuming and laborious. The aim of this study was to know the prevalence of asymptomatic bacteriuria in pregnancy, to identify pathogens and their antibiotic susceptibility patterns and to device a single or combined rapid screening method as an acceptable alternative to urine culture. ...

  14. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  15. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment.

    Science.gov (United States)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. Copyright © 2015

  16. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  17. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  18. Comparing the visualization of microcalcifications with direct magnification in digital full-field mammography vs. film-screen mammography

    International Nuclear Information System (INIS)

    Diekmann, F.; Diekmann, S.; Rogalla, P.; Hamm, B.; Bick, U.; Blohmer, J.U.; Winzer, K.J.

    2002-01-01

    Purpose: To evaluate the conspicuity of microcalcifications in magnified mammographic views of preparations obtained with full field digital mammography (FFDM), film-screen mammography (FSM), and the DIMA technique. Material and Methods: Twelve preparations were examined by FFDM and FSM using 1.8 x magnification and DIMA using 7 x magnification. Parameter settings were identical for all three techniques. The number of visible microcalcifications was then determined for each modality by three radiologists. As far as possible, all preparations were X-rayed at 22 kV and 10 mAS. Results: Altogether 9705 calcifications were counted (DIMA: 1609/1542/1534; FFDM: 1020/753/881; FSM: 901/643/822). The total number of microcalcifications identified with the DIMA technique was 4685 as compared to 2654 with FFDM and 2366 with FSM. The calcifications counted with FFDM and FSM thus corresponded to 56.6% and 50.5%, respectively, of those identified with DIMA. The differences between the groups were statistically significant (F-Test, p [de

  19. Comparison of different screening methods for blood pressure disorders in children and adolescents

    Directory of Open Access Journals (Sweden)

    Felipe Alves Mourato

    2015-06-01

    Full Text Available OBJECTIVE: To compare different methods of screening for blood pressure disorders in children and adolescents. METHOD: A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. RESULTS: The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. CONCLUSION: Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables.

  20. Improvement of vector compensation method for vehicle magnetic distortion field

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Hongfeng, E-mail: panghongfeng@126.com; Zhang, Qi; Li, Ji; Luo, Shitu; Chen, Dixiang; Pan, Mengchun; Luo, Feilu

    2014-03-15

    Magnetic distortions such as eddy-current field and low frequency magnetic field have not been considered in vector compensation methods. A new compensation method is proposed to suppress these magnetic distortions and improve compensation performance, in which the magnetic distortions related to measurement vectors and time are considered. The experimental system mainly consists of a three-axis fluxgate magnetometer (DM-050), an underwater vehicle and a proton magnetometer, in which the scalar value of magnetic field is obtained with the proton magnetometer and considered to be the true value. Comparing with traditional compensation methods, experimental results show that the magnetic distortions can be further reduced by two times. After compensation, error intensity and RMS error are reduced from 11684.013 nT and 7794.604 nT to 16.219 nT and 5.907 nT respectively. It suggests an effective way to improve the compensation performance of magnetic distortions. - Highlights: • A new vector compensation method is proposed for vehicle magnetic distortion. • The proposed model not only includes magnetometer error but also considers magnetic distortion. • Compensation parameters are computed directly by solving nonlinear equations. • Compared with traditional methods, the proposed method is not related with rotation angle rate. • Error intensity and RMS error can be reduced to 1/2 of the error with traditional methods.

  1. Improvement of vector compensation method for vehicle magnetic distortion field

    International Nuclear Information System (INIS)

    Pang, Hongfeng; Zhang, Qi; Li, Ji; Luo, Shitu; Chen, Dixiang; Pan, Mengchun; Luo, Feilu

    2014-01-01

    Magnetic distortions such as eddy-current field and low frequency magnetic field have not been considered in vector compensation methods. A new compensation method is proposed to suppress these magnetic distortions and improve compensation performance, in which the magnetic distortions related to measurement vectors and time are considered. The experimental system mainly consists of a three-axis fluxgate magnetometer (DM-050), an underwater vehicle and a proton magnetometer, in which the scalar value of magnetic field is obtained with the proton magnetometer and considered to be the true value. Comparing with traditional compensation methods, experimental results show that the magnetic distortions can be further reduced by two times. After compensation, error intensity and RMS error are reduced from 11684.013 nT and 7794.604 nT to 16.219 nT and 5.907 nT respectively. It suggests an effective way to improve the compensation performance of magnetic distortions. - Highlights: • A new vector compensation method is proposed for vehicle magnetic distortion. • The proposed model not only includes magnetometer error but also considers magnetic distortion. • Compensation parameters are computed directly by solving nonlinear equations. • Compared with traditional methods, the proposed method is not related with rotation angle rate. • Error intensity and RMS error can be reduced to 1/2 of the error with traditional methods

  2. Multigrid Methods for the Computation of Propagators in Gauge Fields

    Science.gov (United States)

    Kalkreuter, Thomas

    Multigrid methods were invented for the solution of discretized partial differential equations in order to overcome the slowness of traditional algorithms by updates on various length scales. In the present work generalizations of multigrid methods for propagators in gauge fields are investigated. Gauge fields are incorporated in algorithms in a covariant way. The kernel C of the restriction operator which averages from one grid to the next coarser grid is defined by projection on the ground-state of a local Hamiltonian. The idea behind this definition is that the appropriate notion of smoothness depends on the dynamics. The ground-state projection choice of C can be used in arbitrary dimension and for arbitrary gauge group. We discuss proper averaging operations for bosons and for staggered fermions. The kernels C can also be used in multigrid Monte Carlo simulations, and for the definition of block spins and blocked gauge fields in Monte Carlo renormalization group studies. Actual numerical computations are performed in four-dimensional SU(2) gauge fields. We prove that our proposals for block spins are “good”, using renormalization group arguments. A central result is that the multigrid method works in arbitrarily disordered gauge fields, in principle. It is proved that computations of propagators in gauge fields without critical slowing down are possible when one uses an ideal interpolation kernel. Unfortunately, the idealized algorithm is not practical, but it was important to answer questions of principle. Practical methods are able to outperform the conjugate gradient algorithm in case of bosons. The case of staggered fermions is harder. Multigrid methods give considerable speed-ups compared to conventional relaxation algorithms, but on lattices up to 184 conjugate gradient is superior.

  3. Comparison of three noninvasive methods for hemoglobin screening of blood donors.

    Science.gov (United States)

    Ardin, Sergey; Störmer, Melanie; Radojska, Stela; Oustianskaia, Larissa; Hahn, Moritz; Gathof, Birgit S

    2015-02-01

    To prevent phlebotomy of anemic individuals and to ensure hemoglobin (Hb) content of the blood units, Hb screening of blood donors before donation is essential. Hb values are mostly evaluated by measurement of capillary blood obtained from fingerstick. Rapid noninvasive methods have recently become available and may be preferred by donors and staff. The aim of this study was to evaluate for the first time all different noninvasive methods for Hb screening. Blood donors were screened for Hb levels in three different trials using three different noninvasive methods (Haemospect [MBR Optical Systems GmbH & Co. KG], NBM 200 [LMB Technology GmbH], Pronto-7 [Masimo Europe Ltd]) in comparison to the established fingerstick method (CompoLab Hb [Fresenius Kabi GmbH]) and to levels obtained from venous samples on a cell counter (Sysmex [Sysmex Europe GmbH]) as reference. The usability of the noninvasive methods was assessed with an especially developed survey. Technical failures occurred by using the Pronto-7 due to nail polish, skin color, or ambient light. The NBM 200 also showed a high sensitivity to ambient light and noticeably lower Hb levels for women than obtained from the Sysmex. The statistical analysis showed the following bias and standard deviation of differences of all methods in comparison to the venous results: Haemospect, -0.22 ± 1.24; NBM, 200 -0.12 ± 1.14; Pronto-7, -0.50 ± 0.99; and CompoLab Hb, -0.53 ± 0.81. Noninvasive Hb tests represent an attractive alternative by eliminating pain and reducing risks of blood contamination. The main problem for generating reliable results seems to be preanalytical variability in sampling. Despite the sensitivity to environmental stress, all methods are suitable for Hb measurement. © 2014 AABB.

  4. New numerical methods for quantum field theories on the continuum

    Energy Technology Data Exchange (ETDEWEB)

    Emirdag, P.; Easter, R.; Guralnik, G.S.; Hahn, S.C

    2000-03-01

    The Source Galerkin Method is a new numerical technique that is being developed to solve Quantum Field Theories on the continuum. It is not based on Monte Carlo techniques and has a measure to evaluate relative errors. It promises to increase the accuracy and speed of calculations, and takes full advantage of symmetries of the theory. The application of this method to the non-linear {sigma} model is outlined.

  5. A novel background field removal method for MRI using projection onto dipole fields (PDF).

    Science.gov (United States)

    Liu, Tian; Khalidov, Ildar; de Rochefort, Ludovic; Spincemaille, Pascal; Liu, Jing; Tsiouris, A John; Wang, Yi

    2011-11-01

    For optimal image quality in susceptibility-weighted imaging and accurate quantification of susceptibility, it is necessary to isolate the local field generated by local magnetic sources (such as iron) from the background field that arises from imperfect shimming and variations in magnetic susceptibility of surrounding tissues (including air). Previous background removal techniques have limited effectiveness depending on the accuracy of model assumptions or information input. In this article, we report an observation that the magnetic field for a dipole outside a given region of interest (ROI) is approximately orthogonal to the magnetic field of a dipole inside the ROI. Accordingly, we propose a nonparametric background field removal technique based on projection onto dipole fields (PDF). In this PDF technique, the background field inside an ROI is decomposed into a field originating from dipoles outside the ROI using the projection theorem in Hilbert space. This novel PDF background removal technique was validated on a numerical simulation and a phantom experiment and was applied in human brain imaging, demonstrating substantial improvement in background field removal compared with the commonly used high-pass filtering method. Copyright © 2011 John Wiley & Sons, Ltd.

  6. Field Science Ethnography: Methods For Systematic Observation on an Expedition

    Science.gov (United States)

    Clancey, William J.; Clancy, Daniel (Technical Monitor)

    2001-01-01

    The Haughton-Mars expedition is a multidisciplinary project, exploring an impact crater in an extreme environment to determine how people might live and work on Mars. The expedition seeks to understand and field test Mars facilities, crew roles, operations, and computer tools. I combine an ethnographic approach to establish a baseline understanding of how scientists prefer to live and work when relatively unemcumbered, with a participatory design approach of experimenting with procedures and tools in the context of use. This paper focuses on field methods for systematically recording and analyzing the expedition's activities. Systematic photography and time-lapse video are combined with concept mapping to organize and present information. This hybrid approach is generally applicable to the study of modern field expeditions having a dozen or more multidisciplinary participants, spread over a large terrain during multiple field seasons.

  7. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  8. The diagnostic accuracy of single- and five-field fundus photography in diabetic retinopathy screening by primary care physicians.

    Science.gov (United States)

    Srihatrai, Parinya; Hlowchitsieng, Thanita

    2018-01-01

    The aim is to evaluate the diagnostic accuracy of digital fundus photography in diabetic retinopathy (DR) screening at a single university hospital. This was a cross-sectional hospital-based study. One hundred and ninety-eight diabetic patients were recruited for comprehensive eye examination by two ophthalmologists. Five-field fundus photographs were taken with a digital, nonmydriatic fundus camera, and trained primary care physicians then graded the severity of DR present by single-field 45° and five-field fundus photography. Sensitivity and specificity of DR grading were reported using the findings from the ophthalmologists' examinations as a gold standard. When fundus photographs of the participants' 363 eyes were analyzed for the presence of DR, there was substantial agreement between the two primary care physicians, κ = 0.6226 for single-field and 0.6939 for five-field photograph interpretation. The sensitivity and specificity of DR detection with single-field photographs were 70.7% (95% Confidence interval [CI]; 60.2%-79.7%) and 99.3% (95% CI; 97.4%-99.9%), respectively. Sensitivity and specificity for five-field photographs were 84.5% (95% CI; 75.8%-91.1%) and 98.6% (95% CI; 96.5%-99.6%), respectively. The receiver operating characteristic was 0.85 (0.80-0.90) for single-field photographs and 0.92 (0.88-0.95) for five-field photographs. The sensitivity and specificity of fundus photographs for DR detection by primary care physicians were acceptable. Single- and five-field digital fundus photography each represent a convenient screening tool with acceptable accuracy.

  9. Mathematical methods of many-body quantum field theory

    CERN Document Server

    Lehmann, Detlef

    2004-01-01

    Mathematical Methods of Many-Body Quantum Field Theory offers a comprehensive, mathematically rigorous treatment of many-body physics. It develops the mathematical tools for describing quantum many-body systems and applies them to the many-electron system. These tools include the formalism of second quantization, field theoretical perturbation theory, functional integral methods, bosonic and fermionic, and estimation and summation techniques for Feynman diagrams. Among the physical effects discussed in this context are BCS superconductivity, s-wave and higher l-wave, and the fractional quantum Hall effect. While the presentation is mathematically rigorous, the author does not focus solely on precise definitions and proofs, but also shows how to actually perform the computations.Presenting many recent advances and clarifying difficult concepts, this book provides the background, results, and detail needed to further explore the issue of when the standard approximation schemes in this field actually work and wh...

  10. Advances in computational methods for Quantum Field Theory calculations

    NARCIS (Netherlands)

    Ruijl, B.J.G.

    2017-01-01

    In this work we describe three methods to improve the performance of Quantum Field Theory calculations. First, we simplify large expressions to speed up numerical integrations. Second, we design Forcer, a program for the reduction of four-loop massless propagator integrals. Third, we extend the R*

  11. The Diagonal Compression Field Method using Circular Fans

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2006-01-01

    is a modification of the traditional method, the modification consisting of the introduction of circular fan stress fields. To ensure proper behaviour for the service load the -value ( = cot, where  is the angle relative to the beam axis of the uniaxial concrete compression) chosen should not be too large...

  12. Field test of a new Australian method of rangeland monitoring

    Science.gov (United States)

    Suzanne Mayne; Neil West

    2001-01-01

    Managers need more efficient means of monitoring changes on the lands they manage. Accordingly, a new Australian approach was field tested and compared to the Daubenmire method of assessing plant cover, litter, and bare soil. The study area was a 2 mile wide by 30.15 mile long strip, mostly covered by salt desert shrub ecosystem types, centered along the SE boundary of...

  13. Three-dimensional wake field analysis by boundary element method

    International Nuclear Information System (INIS)

    Miyata, K.

    1987-01-01

    A computer code HERTPIA was developed for the calculation of electromagnetic wake fields excited by charged particles travelling through arbitrarily shaped accelerating cavities. This code solves transient wave problems for a Hertz vector. The numerical analysis is based on the boundary element method. This program is validated by comparing its results with analytical solutions in a pill-box cavity

  14. General Anisotropy Identification of Paperboard with Virtual Fields Method

    Science.gov (United States)

    J.M. Considine; F. Pierron; K.T. Turner; D.W. Vahey

    2014-01-01

    This work extends previous efforts in plate bending of Virtual Fields Method (VFM) parameter identification to include a general 2-D anisotropicmaterial. Such an extension was needed for instances in which material principal directions are unknown or when specimen orientation is not aligned with material principal directions. A new fixture with a multiaxial force...

  15. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Benchmarking Data Sets for the Evaluation of Virtual Ligand Screening Methods: Review and Perspectives.

    Science.gov (United States)

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2015-07-27

    Virtual screening methods are commonly used nowadays in drug discovery processes. However, to ensure their reliability, they have to be carefully evaluated. The evaluation of these methods is often realized in a retrospective way, notably by studying the enrichment of benchmarking data sets. To this purpose, numerous benchmarking data sets were developed over the years, and the resulting improvements led to the availability of high quality benchmarking data sets. However, some points still have to be considered in the selection of the active compounds, decoys, and protein structures to obtain optimal benchmarking data sets.

  17. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher......The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...

  18. Comparison of different screening methods for blood pressure disorders in children and adolescents.

    Science.gov (United States)

    Mourato, Felipe Alves; Lima Filho, José Luiz; Mattos, Sandra da Silva

    2015-01-01

    To compare different methods of screening for blood pressure disorders in children and adolescents. A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  19. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  20. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  1. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  2. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  3. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome.

    Science.gov (United States)

    Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

    2016-01-01

    Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have.

  4. Do recommended doses of glyphosate-based herbicides affect soil invertebrates? Field and laboratory screening tests to risk assessment.

    Science.gov (United States)

    Niemeyer, Júlia Carina; de Santo, Fernanda Benedet; Guerra, Naiara; Ricardo Filho, Altair Maçaneiro; Pech, Tatiani Maria

    2018-05-01

    Despite glyphosate-based herbicides are widely used in agriculture, forestry and gardens, little is known about its effects on non-target organisms. The present work evaluated the ecotoxicity of four formulated products (Roundup ® Original, Trop ® , Zapp ® Qi 620 and Crucial ® ) on soil invertebrates. Screening ecotoxicity tests were carried out with soil and oat straw collected in a field experiment, besides laboratory-spiked soils. Screening tests included avoidance behaviour of earthworms (Eisenia andrei), collembolans (Folsomia candida) and isopods (Porcellio dilatatus) in single and multispecies tests; reproduction of collembolans (F. candida), and bait lamina in field. Non-avoidance behaviour was observed in standard tests (earthworms) in soil, neither in multispecies tests (earthworm + isopods) using oat straw, while for collembolans it occurred for the product Zapp ® Qi 620 even at the recommended dose. Reproduction of F. candida was not impaired even at high doses in laboratory-spiked soils. Feeding activity on bait lamina test was impaired in treatment corresponding to the red label product, Crucial ® . Results showed the relevance of bait lamina test on screening the impact of herbicides in the field. The findings highlight the importance of considering different formulations for the same active ingredient in risk assessment of pesticides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23): a study protocol.

    Science.gov (United States)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe; Christensen, Jette; Johansen, Tonje; Hariri, Jalil; Christiansen, Sanne; Rygaard, Carsten; Lynge, Elsebeth

    2018-05-26

    The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could therefore be offered less intensive screening. Primary HPV testing is more sensitive than cytology, allowing for a longer screening interval. The aim of Trial23 is to investigate if primary HPV testing with cytology triage of HPV positive samples is a reasonable screening scheme for women offered HPV vaccination as girls. Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study including intention-to-treat and per-protocol analyses. The potential effect of primary HPV screening with a 6-year interval will be calculated from the observed data. The study protocol has been submitted to the ethical committee and deemed a method study. All women are screened according to routine guidelines. The study will contribute new evidence on the future screening of HPV vaccinated birth cohorts of women. All results will be published in open-access journal. NCT03049553; Pre-results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Determination of the optimal method for the field-in-field technique in breast tangential radiotherapy

    International Nuclear Information System (INIS)

    Tanaka, Hidekazu; Hayashi, Shinya; Hoshi, Hiroaki

    2014-01-01

    Several studies have reported the usefulness of the field-in-field (FIF) technique in breast radiotherapy. However, the methods for the FIF technique used in these studies vary. These methods were classified into three categories. We simulated a radiotherapy plan with each method and analyzed the outcomes. In the first method, a pair of subfields was added to each main field: the single pair of subfields method (SSM). In the second method, three pairs of subfields were added to each main field: the multiple pairs of subfields method (MSM). In the third method, subfields were alternately added: the alternate subfields method (ASM). A total of 51 patients were enrolled in this study. The maximum dose to the planning target volume (PTV) (Dmax) and the volumes of the PTV receiving 100% of the prescription dose (V100%) were calculated. The thickness of the breast between the chest wall and skin surface was measured, and patients were divided into two groups according to the median. In the overall series, the average V100% with ASM (60.3%) was significantly higher than with SSM (52.6%) and MSM (48.7%). In the thin breast group as well, the average V100% with ASM (57.3%) and SSM (54.2%) was significantly higher than that with MSM (43.3%). In the thick breast group, the average V100% with ASM (63.4%) was significantly higher than that with SSM (51.0%) and MSM (54.4%). ASM resulted in better dose distribution, regardless of the breast size. Moreover, planning for ASM required a relatively short time. ASM was considered the most preferred method. (author)

  7. Four Methods for LIDAR Retrieval of Microscale Wind Fields

    Directory of Open Access Journals (Sweden)

    Thomas Naini

    2012-08-01

    Full Text Available This paper evaluates four wind retrieval methods for micro-scale meteorology applications with volume and time resolution in the order of 30m3 and 5 s. Wind field vectors are estimated using sequential time-lapse volume images of aerosol density fluctuations. Suitably designed mono-static scanning backscatter LIDAR systems, which are sensitive to atmospheric density aerosol fluctuations, are expected to be ideal for this purpose. An important application is wind farm siting and evaluation. In this case, it is necessary to look at the complicated region between the earth’s surface and the boundary layer, where wind can be turbulent and fractal scaling from millimeter to kilometer. The methods are demonstrated using first a simple randomized moving hard target, and then with a physics based stochastic space-time dynamic turbulence model. In the latter case the actual vector wind field is known, allowing complete space-time error analysis. Two of the methods, the semblance method and the spatio-temporal method, are found to be most suitable for wind field estimation.

  8. Multiresolution and Explicit Methods for Vector Field Analysis and Visualization

    Science.gov (United States)

    Nielson, Gregory M.

    1997-01-01

    This is a request for a second renewal (3d year of funding) of a research project on the topic of multiresolution and explicit methods for vector field analysis and visualization. In this report, we describe the progress made on this research project during the second year and give a statement of the planned research for the third year. There are two aspects to this research project. The first is concerned with the development of techniques for computing tangent curves for use in visualizing flow fields. The second aspect of the research project is concerned with the development of multiresolution methods for curvilinear grids and their use as tools for visualization, analysis and archiving of flow data. We report on our work on the development of numerical methods for tangent curve computation first.

  9. The Diagonal Compression Field Method using Circular Fans

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2005-01-01

    This paper presents a new design method, which is a modification of the diagonal compression field method, the modification consisting of the introduction of circular fan stress fields. The traditional method does not allow changes of the concrete compression direction throughout a given beam...... if equilibrium is strictly required. This is conservative, since it is not possible fully to utilize the concrete strength in regions with low shear stresses. The larger inclination (the smaller -value) of the uniaxial concrete stress the more transverse shear reinforcement is needed; hence it would be optimal...... if the -value for a given beam could be set to a low value in regions with high shear stresses and thereafter increased in regions with low shear stresses. Thus the shear reinforcement would be reduced and the concrete strength would be utilized in a better way. In the paper it is shown how circular fan stress...

  10. Survey of South African fruit juices using a fast screening HILIC-MS method.

    Science.gov (United States)

    Stander, Marietjie A; Kühn, Wernich; Hiten, Nicholas F

    2013-01-01

    Adulteration of fruit juices--by the addition of sugar or other less expensive fruit juices as well as preservatives, artificial sweeteners and colours--was tested for by using a developed screening method. The method employs hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) using electrospray ionisation in the negative mode and ultraviolet light detection. Different fruit juices can be differentiated by the content of marker compounds like sorbitol, certain phenolic molecules and their saccharide profile. This method was used to test 46 fruit juice samples from the retail market as well as 12 control samples. The study focused on the main types of fruit juices consumed on the South African market including apple, orange, grape and blends of these juices with other fruits like mango, pear and guava. Overall, the 46 samples tested mostly agreed with label claims. One grape juice sample was adulterated, probably with apple juice. Natamycin above the legal limits was found in two samples. In addition, two samples contained natamycin and one sample benzoate without it being indicated on the label. The method is well suited as a quick screening method for fruit juice adulteration and if used routinely would reduce fruit juice adulteration without the cost of the current array of tests needed for authenticity testing.

  11. Screening of groundwater remedial alternatives for brownfield sites: a comprehensive method integrated MCDA with numerical simulation.

    Science.gov (United States)

    Li, Wei; Zhang, Min; Wang, Mingyu; Han, Zhantao; Liu, Jiankai; Chen, Zhezhou; Liu, Bo; Yan, Yan; Liu, Zhu

    2018-06-01

    Brownfield sites pollution and remediation is an urgent environmental issue worldwide. The screening and assessment of remedial alternatives is especially complex owing to its multiple criteria that involves technique, economy, and policy. To help the decision-makers selecting the remedial alternatives efficiently, the criteria framework conducted by the U.S. EPA is improved and a comprehensive method that integrates multiple criteria decision analysis (MCDA) with numerical simulation is conducted in this paper. The criteria framework is modified and classified into three categories: qualitative, semi-quantitative, and quantitative criteria, MCDA method, AHP-PROMETHEE (analytical hierarchy process-preference ranking organization method for enrichment evaluation) is used to determine the priority ranking of the remedial alternatives and the solute transport simulation is conducted to assess the remedial efficiency. A case study was present to demonstrate the screening method in a brownfield site in Cangzhou, northern China. The results show that the systematic method provides a reliable way to quantify the priority of the remedial alternatives.

  12. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  13. A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

    Science.gov (United States)

    Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

    2017-08-28

    Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

  14. Method for solving quantum field theory in the Heisenberg picture

    International Nuclear Information System (INIS)

    Nakanishi, Noboru

    2004-01-01

    This paper is a review of the method for solving quantum field theory in the Heisenberg picture, developed by Abe and Nakanishi since 1991. Starting from field equations and canonical (anti) commutation relations, one sets up a (q-number) Cauchy problem for the totality of d-dimensional (anti) commutators between the fundamental fields, where d is the number of spacetime dimensions. Solving this Cauchy problem, one obtains the operator solution of the theory. Then one calculates all multiple commutators. A representation of the operator solution is obtained by constructing the set of all Wightman functions for the fundamental fields; the truncated Wightman functions are constructed so as to be consistent with all vacuum expectation values of the multiple commutators mentioned above and with the energy-positivity condition. By applying the method described above, exact solutions to various 2-dimensional gauge-theory and quantum-gravity models are found explicitly. The validity of these solutions is confirmed by comparing them with the conventional perturbation-theoretical results. However, a new anomalous feature, called the ''field-equation anomaly'', is often found to appear, and its perturbation-theoretical counterpart, unnoticed previously, is discussed. The conventional notion of an anomaly with respect to symmetry is reconsidered on the basis of the field-equation anomaly, and the derivation of the critical dimension in the BRS-formulated bosonic string theory is criticized. The method outlined above is applied to more realistic theories by expanding everything in powers of the relevant parameter, but this expansion is not equivalent to the conventional perturbative expansion. The new expansion is BRS-invariant at each order, in contrast to that in the conventional perturbation theory. Higher-order calculations are generally extremely laborious to perform explicitly. (author)

  15. Effective-field renormalization-group method for Ising systems

    Science.gov (United States)

    Fittipaldi, I. P.; De Albuquerque, D. F.

    1992-02-01

    A new applicable effective-field renormalization-group (ERFG) scheme for computing critical properties of Ising spins systems is proposed and used to study the phase diagrams of a quenched bond-mixed spin Ising model on square and Kagomé lattices. The present EFRG approach yields results which improves substantially on those obtained from standard mean-field renormalization-group (MFRG) method. In particular, it is shown that the EFRG scheme correctly distinguishes the geometry of the lattice structure even when working with the smallest possible clusters, namely N'=1 and N=2.

  16. Combining Pathway Identification and Breast Cancer Survival Prediction via Screening-Network Methods

    Directory of Open Access Journals (Sweden)

    Antonella Iuliano

    2018-06-01

    Full Text Available Breast cancer is one of the most common invasive tumors causing high mortality among women. It is characterized by high heterogeneity regarding its biological and clinical characteristics. Several high-throughput assays have been used to collect genome-wide information for many patients in large collaborative studies. This knowledge has improved our understanding of its biology and led to new methods of diagnosing and treating the disease. In particular, system biology has become a valid approach to obtain better insights into breast cancer biological mechanisms. A crucial component of current research lies in identifying novel biomarkers that can be predictive for breast cancer patient prognosis on the basis of the molecular signature of the tumor sample. However, the high dimension and low sample size of data greatly increase the difficulty of cancer survival analysis demanding for the development of ad-hoc statistical methods. In this work, we propose novel screening-network methods that predict patient survival outcome by screening key survival-related genes and we assess the capability of the proposed approaches using METABRIC dataset. In particular, we first identify a subset of genes by using variable screening techniques on gene expression data. Then, we perform Cox regression analysis by incorporating network information associated with the selected subset of genes. The novelty of this work consists in the improved prediction of survival responses due to the different types of screenings (i.e., a biomedical-driven, data-driven and a combination of the two before building the network-penalized model. Indeed, the combination of the two screening approaches allows us to use the available biological knowledge on breast cancer and complement it with additional information emerging from the data used for the analysis. Moreover, we also illustrate how to extend the proposed approaches to integrate an additional omic layer, such as copy number

  17. Development of a first-principles code based on the screened KKR method for large super-cells

    International Nuclear Information System (INIS)

    Doi, S; Ogura, M; Akai, H

    2013-01-01

    The procedures of performing first-principles electronic structure calculation using the Korringa-Kohn-Rostoker (KKR) and the screened KKR methods are reviewed with an emphasis put on their numerical efficiency. It is shown that an iterative matrix inversion combined with a suitable preconditioning greatly improves the computational time of screened KKR method. The method is well parallelized and also has an O(N) scaling property

  18. A Modeling Study of the Spatial Structure of Electric Fields Generated by Electrified Clouds with Screening Layers

    Science.gov (United States)

    Biagi, C. J.; Cummins, K. L.

    2015-12-01

    The growing possibility of inexpensive airborne observations of electric fields using one or more small UAVs increases the importance of understanding what can be determined about cloud electrification and associated electric fields outside cloud boundaries. If important information can be inferred from carefully selected flight paths outside of a cloud, then the aircraft and its instrumentation will be much cheaper to develop and much safer to operate. These facts have led us to revisit this long-standing topic using quasi-static, finite-element modeling inside and outside arbitrarily shaped clouds with a variety of internal charge distributions. In particular, we examine the effect of screening layers on electric fields outside of electrified clouds by comparing modeling results for charged clouds having electrical conductivities that are both equal to and lower than the surrounding clear air. The comparisons indicate that the spatial structure of the electric field is approximately the same regardless of the difference in the conductivities between the cloud and clear air and the formation of a screening layer, even for altitude-dependent electrical conductivities. This result is consistent with the numerical modeling results reported by Driscoll et al [1992]. The similarity of the spatial structure of the electric field outside of clouds with and without a screening layer suggests that "bulk" properties related to cloud electrification might be determined using measurements of the electric field at multiple locations in space outside the cloud, particularly at altitude. Finally, for this somewhat simplified model, the reduction in electric field magnitude outside the cloud due to the presence of a screening layer exhibits a simple dependence on the difference in conductivity between the cloud and clear air. These results are particularly relevant for studying clouds that are not producing lightning, such as developing thunderstorms and decaying anvils

  19. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  20. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  1. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  2. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  3. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  4. Process system and method for fabricating submicron field emission cathodes

    Science.gov (United States)

    Jankowski, Alan F.; Hayes, Jeffrey P.

    1998-01-01

    A process method and system for making field emission cathodes exists. The deposition source divergence is controlled to produce field emission cathodes with height-to-base aspect ratios that are uniform over large substrate surface areas while using very short source-to-substrate distances. The rate of hole closure is controlled from the cone source. The substrate surface is coated in well defined increments. The deposition source is apertured to coat pixel areas on the substrate. The entire substrate is coated using a manipulator to incrementally move the whole substrate surface past the deposition source. Either collimated sputtering or evaporative deposition sources can be used. The position of the aperture and its size and shape are used to control the field emission cathode size and shape.

  5. High prevalence of bacteriuria in pregnancy and its screening methods in north India.

    Science.gov (United States)

    Bandyopadhyay, Sutapa; Thakur, J S; Ray, Pallab; Kumar, Rajesh

    2005-05-01

    The study aims at finding out the prevalence of bacteruria in pregnancy in an urban setting and ascertaining methods to screen them in primary care clinics. A total of 1 61 pregnant ladies visiting a primary care clinic were screened for bacteriuria based on the symptomatology. Urine culture was done to know the prevalence of bacteriuria. Sensitivities and specificities were calculated for each symptom and risk assessment. A score card was developed based on combination of positive risk assessment and constellation of symptoms. Prevalence of symptomatic and asymptomatic bacteriuria was found to be 19.87% and 4.34% respectively. Prevalence of bacteriuria was significantly high among those who had intercourse more frequently and those with less water intake. Those with a score of more than or equal to 4, as per score card were 60% more likely to suffer from bacteriuria. When combined with microscopic examination for leucocytes on positively screened, the positive predictive value was found to be 89%. It is concluded that prevalence of symptomatic bacteriuria is common among pregnant women. Syndromic management of cases on the basis of score card is helpful in resource constraint areas. This may be combined with microscopic examination of urine to entail rational use of antibiotics.

  6. Methods for studying plasma charge transport across a magnetic field

    International Nuclear Information System (INIS)

    Popovich, A.S.

    1978-01-01

    A comparative analysis of experimental methods for the diffusion transfer of plasma charged particles accross the magnetic field at the study of its confinement effectiveness, instability effect is carried out. Considered are the methods based on the analysis of particle balance in the charge and possibilities of diffusion coefficient determination according to measuring parameters of density gradient and particle flow on the wall, rate of plasma decay after switching off ionization source radial profile of plasma density outside the active region of stationary charge. Much attension is payed to the research methods of diffusion transfer, connected with the study of propagation of periodic and aperiodic density perturbation in a plasma. Analysed is the Golubev and Granovsky method of diffusion waves and its different modifications, phase analysis method of ''test charges'' movement, as well as different modifications of correlation methods. Considered are physical preconditions of the latter and criticized is unilateral interpretation of correlation measurings, carried out in a number of works. The analysis of study possibilities of independent (non-ambipolar) diffusion of electrons and ions in a plasma in the magnetic field is executed

  7. Trojan Horse Method: a useful tool for electron screening effect investigation

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R.G.; Spitaleri, C.; Cherubini, S.; La Cognata, M.; Lamia, L.; Romano, S.; Sergi, M.L. [Laboratori Nazionali del Sud-INFN and DMFCI Universita di Catania, Catania (Italy); Tumino, A. [Universita Kore, Enna (Italy); Li, C.; Wen, Q.; Zhou, S. [Department of Nuclear Physics, CIAE, Beijing (China); Burjan, V.; Kroha, V.; Mrazek, J. [Cyclotron Institute, Academy of Science, Rez, Czech Rep. (Czech Republic); Carlin, N.; Gimenez del Santo, M.; Szanto de Toledo, A. [Departamento de Fisica, Universidad de Sao Paulo (Brazil); Kubono, S.; Wakabayashi, T.; Yamaguchi, H. [CNS, University of Tokyo, Wako (Japan)

    2010-03-01

    Direct measurements in the last decades have highlighted a new problem related to the lowering of the Coulomb barrier between the interacting nuclei due to the presence of the 'electron screening' in the laboratory measurements. It was systematically observed that the presence of the electronic cloud around the interacting ions in measurements of nuclear reactions cross sections at astrophysical energies gives rise to an enhancement of the astrophysical S(E)-factor as lower and lower energies are explored [H. Assenbaum, K. Langanke, C. Rolfs, Z. Phys. 327 (1987) 461]. Moreover, at present such an effect is not well understood as the value of the potential for screening extracted from these measurements is higher than the upper limit of theoretical predictions (adiabatic limit). On the other hand, the electron screening potential in laboratory measurement is different from that occurring in stellar plasmas thus the quantity of interest in astrophysics is the so-called 'bare nucleus cross section'. This quantity can only be extrapolated in direct measurements. These are the reasons that led to a considerable growth on interest in indirect measurement techniques and in particular the Trojan Horse Method (THM) [G. Baur, Phys. Lett. B 178, (1986) 135; S. Cherubini et al. Ap. J. 457, (1996) 855] Results concerning the bare nucleus cross sections measurements will be shown in several cases of astrophysical interest. In those cases the screening potential evaluated by means of the THM will be compared with the adiabatic limit and results arising from extrapolation in direct measurements.

  8. The reduced basis method for the electric field integral equation

    International Nuclear Information System (INIS)

    Fares, M.; Hesthaven, J.S.; Maday, Y.; Stamm, B.

    2011-01-01

    We introduce the reduced basis method (RBM) as an efficient tool for parametrized scattering problems in computational electromagnetics for problems where field solutions are computed using a standard Boundary Element Method (BEM) for the parametrized electric field integral equation (EFIE). This combination enables an algorithmic cooperation which results in a two step procedure. The first step consists of a computationally intense assembling of the reduced basis, that needs to be effected only once. In the second step, we compute output functionals of the solution, such as the Radar Cross Section (RCS), independently of the dimension of the discretization space, for many different parameter values in a many-query context at very little cost. Parameters include the wavenumber, the angle of the incident plane wave and its polarization.

  9. A geologic approach to field methods in fluvial geomorphology

    Science.gov (United States)

    Fitzpatrick, Faith A.; Thornbush, Mary J; Allen, Casey D; Fitzpatrick, Faith A.

    2014-01-01

    A geologic approach to field methods in fluvial geomorphology is useful for understanding causes and consequences of past, present, and possible future perturbations in river behavior and floodplain dynamics. Field methods include characterizing river planform and morphology changes and floodplain sedimentary sequences over long periods of time along a longitudinal river continuum. Techniques include topographic and bathymetric surveying of fluvial landforms in valley bottoms and describing floodplain sedimentary sequences through coring, trenching, and examining pits and exposures. Historical sediment budgets that include floodplain sedimentary records can characterize past and present sources and sinks of sediment along a longitudinal river continuum. Describing paleochannels and floodplain vertical accretion deposits, estimating long-term sedimentation rates, and constructing historical sediment budgets can assist in management of aquatic resources, habitat, sedimentation, and flooding issues.

  10. Modeling Enzymatic Transition States by Force Field Methods

    DEFF Research Database (Denmark)

    Hansen, Mikkel Bo; Jensen, Hans Jørgen Aagaard; Jensen, Frank

    2009-01-01

    The SEAM method, which models a transition structure as a minimum on the seam of two diabatic surfaces represented by force field functions, has been used to generate 20 transition structures for the decarboxylation of orotidine by the orotidine-5'-monophosphate decarboxylase enzyme. The dependence...... of the TS geometry on the flexibility of the system has been probed by fixing layers of atoms around the active site and using increasingly larger nonbonded cutoffs. The variability over the 20 structures is found to decrease as the system is made more flexible. Relative energies have been calculated...... by various electronic structure methods, where part of the enzyme is represented by a force field description and the effects of the solvent are represented by a continuum model. The relative energies vary by several hundreds of kJ/mol between the transition structures, and tests showed that a large part...

  11. Method for imaging with low frequency electromagnetic fields

    Science.gov (United States)

    Lee, Ki H.; Xie, Gan Q.

    1994-01-01

    A method for imaging with low frequency electromagnetic fields, and for interpreting the electromagnetic data using ray tomography, in order to determine the earth conductivity with high accuracy and resolution. The imaging method includes the steps of placing one or more transmitters, at various positions in a plurality of transmitter holes, and placing a plurality of receivers in a plurality of receiver holes. The transmitters generate electromagnetic signals which diffuse through a medium, such as earth, toward the receivers. The measured diffusion field data H is then transformed into wavefield data U. The traveltimes corresponding to the wavefield data U, are then obtained, by charting the wavefield data U, using a different regularization parameter .alpha. for each transform. The desired property of the medium, such as conductivity, is then derived from the velocity, which in turn is constructed from the wavefield data U using ray tomography.

  12. Multi-phase-field method for surface tension induced elasticity

    Science.gov (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah

    2018-01-01

    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  13. Non invasive diagnostic methods for better screening of peripheral arterial disease.

    Science.gov (United States)

    Nirala, Neelamshobha; Periyasamy, R; Kumar, Awanish

    2018-05-16

    Peripheral arterial disease (PAD) is a common circulatory problem in which narrowed arteries reduce blood flow to extremities usually legs. It does not receive enough blood flow to keep up with demand. This causes symptoms, most notably leg pain while walking which is known as claudication. It is a common manifestation of type II Diabetes, but the relationship between other vascular diseases and lower limb (LL)-PAD has been poorly understood and investigated. When assessing a patient with clinically LLPAD, two questions are in order to establish a diagnosis: one is non-invasive testing and other is invasive. Invasive methods are painful and get so bad that some people need to have a leg surgery. People with Diabetes are at increased risk for amputation and it is used only when the damage is very severe. Diagnosis of LLPAD begins with a physical examination, patient history, certain questionnaire and non invasive mode of diagnosis is started for the screening of patients. Clinicians check for weak pulses in the legs and then decide for further diagnosis. Paper discusses the prevalence of LLPAD worldwide and in India along with the clinical effectiveness and limitations of these methods in case of Diabetes. The focus of this review is to discuss only those non invasive methods which are widely used for screening of LLPAD like Ankle brachial index (ABI), Toe brachial Index (TBI), and use of photoplethysmogram (PPG) specially in case of Diabetic patients. Also, this paper gives an overview of the work done using ABI, TBI, and PPG for detection of LLPAD. These tests are not painful and could be performed in a cost-effective manner to avoid delays in screening/diagnosis and also reduce costs. Copyright © 2018. Published by Elsevier Inc.

  14. The virtual fields method applied to spalling tests on concrete

    Directory of Open Access Journals (Sweden)

    Forquin P.

    2012-08-01

    Full Text Available For one decade spalling techniques based on the use of a metallic Hopkinson bar put in contact with a concrete sample have been widely employed to characterize the dynamic tensile strength of concrete at strain-rates ranging from a few tens to two hundreds of s−1. However, the processing method mainly based on the use of the velocity profile measured on the rear free surface of the sample (Novikov formula remains quite basic and an identification of the whole softening behaviour of the concrete is out of reach. In the present paper a new processing method is proposed based on the use of the Virtual Fields Method (VFM. First, a digital high speed camera is used to record the pictures of a grid glued on the specimen. Next, full-field measurements are used to obtain the axial displacement field at the surface of the specimen. Finally, a specific virtual field has been defined in the VFM equation to use the acceleration map as an alternative ‘load cell’. This method applied to three spalling tests allowed to identify Young’s modulus during the test. It was shown that this modulus is constant during the initial compressive part of the test and decreases in the tensile part when micro-damage exists. It was also shown that in such a simple inertial test, it was possible to reconstruct average axial stress profiles using only the acceleration data. Then, it was possible to construct local stress-strain curves and derive a tensile strength value.

  15. Method of a covering space in quantum field theory

    International Nuclear Information System (INIS)

    Serebryanyj, E.M.

    1982-01-01

    To construct the Green function of the Laplace operator in the domain M bounded by conducting surfaces the generalized method of images is used. It is based on replacement of the domain M by its discrete bundle and that is why the term ''method of covering space'' is used. Continuing one of the coordinates to imaginary values the euclidean Green function is transformed into the causal one. This allows one to compute vacuum stress-energy tensor of the scalar massless field if the vacuum is stable [ru

  16. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  17. Gravimetric screening method for fungal decay of paper: inoculation with Trametes versicolor.

    Science.gov (United States)

    Råberg, Ulrika; Hafrén, Jonas

    2009-10-01

    The European standard test EN 113 for fungal degradation of solid wood has been adapted for degradation of paper by white rot fungus (Trametes versicolor). Fungal degradation of paper sheets may potentially be used for screening different wood preservatives on paper instead of solid wood. The paper samples showed higher relative mass losses compared to wood, and samples pretreated with boric acid, copper sulfate and polymerized linseed oil were successfully tested for biodegradation using the paper sheet method. The results on paper degradation were compared with wood, both as wood blocks (according to standard test) and wood cut in sections forming layered structures mimicking paper layers.

  18. The validity of ultrasonographic scanning as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Vammen, Sten; Juul, Søren

    1999-01-01

    the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs.......the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs....

  19. Investigation of drag effect using the field signature method

    International Nuclear Information System (INIS)

    Wan, Zhengjun; Liao, Junbi; Tian, Gui Yun; Cheng, Liang

    2011-01-01

    The potential drop (PD) method is an established non-destructive evaluation (NDE) technique. The monitoring of internal corrosion, erosion and cracks in piping systems, based on electrical field mapping or direct current potential drop array, is also known as the field signature method (FSM). The FSM has been applied in the field of submarine pipe monitoring and land-based oil and gas transmission pipes and containers. In the experimental studies, to detect and calculate the degree of pipe corrosion, the FSM analyses the relationships between the electrical resistance and pipe thickness using an electrode matrix. The relevant drag effect or trans-resistance will cause a large margin of error in the application of resistance arrays. It is the first time that the drag effect in the paper is investigated and analysed in resistance networks with the help of the FSM. Subsequently, a method to calculate the drag factors and eliminate its errors is proposed and presented. Theoretical analysis, simulation and experimental results show that the measurement accuracy can be improved by eliminating the errors caused by the drag effect

  20. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  1. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  2. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  3. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    Science.gov (United States)

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  4. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  5. Validity of a method for the self-screening of cardiovascular risk

    Directory of Open Access Journals (Sweden)

    Barroso M

    2018-05-01

    Full Text Available María Barroso,1–3 Silvia Pérez-Fernández,1,4 M Mar Vila,1,4,5 M Dolors Zomeño,6,7 Ruth Martí-Lluch,8 Ferran Cordon,9 Rafel Ramos,8,10,11 Roberto Elosua,1,4 Irene R Degano,1,4 Montse Fitó,5,12 Carmen Cabezas,13 Gemma Salvador,13 Conxa Castell,13 María Grau1,4,14 1Cardiovascular Epidemiology and Genetics Research Group, IMIM-Hospital del Mar Research Institute, 2Centre d’Atenció Primària La Marina, Direcció d’Atenció Primària Barcelona, Institut Català de la Salut, 3Department of Pediatrics, Obstetrics, Gynecology and Preventive Medicine, School of Medicine, Autonomous University of Barcelona, 4Consortium for Biomedical Research in Cardiovascular Disease (CIBERCV, 5Department of Mathematics and Computer Science, University of Barcelona, 6Cardiovascular Risk and Nutrition, IMIM-Hospital del Mar Research Institute, 7School of Health Sciences, Blanquerna-Ramon Llull University, Barcelona, Spain; 8Unitat de Suport a la Recerca de Girona, Institut Universitari d’Investigació en Atenció Primària Jordi Gol, 9Centre d’Atenció Primària Montilivi, Direcció d’Atenció Primària Girona, Institut Català de la Salut, 10Department of Medical Sciences, School of Medicine, University of Girona, 11Girona Biomedical Research Institute, Girona, Spain; 12Consortium for Biomedical Research in Obesity and Nutrition (CIBEROBN, 13Catalan Agency of Public Health, 14Department of Medicine, University of Barcelona, Barcelona, Spain Background: The validity of a cardiovascular risk self-screening method was assessed. The results obtained for self-measurement of blood pressure, a point-of-care system’s assessment of lipid profile and glycated hemoglobin, and a self-administered questionnaire (sex, age, diabetes, tobacco consumption were compared with the standard screening (gold standard conducted by a health professional. Methods: Crossover clinical trial on a population-based sample from Girona (north-eastern Spain, aged 35–74, with no

  6. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  7. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  8. Field Sample Preparation Method Development for Isotope Ratio Mass Spectrometry

    International Nuclear Information System (INIS)

    Leibman, C.; Weisbrod, K.; Yoshida, T.

    2015-01-01

    Non-proliferation and International Security (NA-241) established a working group of researchers from Los Alamos National Laboratory (LANL), Pacific Northwest National Laboratory (PNNL) and Savannah River National Laboratory (SRNL) to evaluate the utilization of in-field mass spectrometry for safeguards applications. The survey of commercial off-the-shelf (COTS) mass spectrometers (MS) revealed no instrumentation existed capable of meeting all the potential safeguards requirements for performance, portability, and ease of use. Additionally, fieldable instruments are unlikely to meet the International Target Values (ITVs) for accuracy and precision for isotope ratio measurements achieved with laboratory methods. The major gaps identified for in-field actinide isotope ratio analysis were in the areas of: 1. sample preparation and/or sample introduction, 2. size reduction of mass analyzers and ionization sources, 3. system automation, and 4. decreased system cost. Development work in 2 through 4, numerated above continues, in the private and public sector. LANL is focusing on developing sample preparation/sample introduction methods for use with the different sample types anticipated for safeguard applications. Addressing sample handling and sample preparation methods for MS analysis will enable use of new MS instrumentation as it becomes commercially available. As one example, we have developed a rapid, sample preparation method for dissolution of uranium and plutonium oxides using ammonium bifluoride (ABF). ABF is a significantly safer and faster alternative to digestion with boiling combinations of highly concentrated mineral acids. Actinides digested with ABF yield fluorides, which can then be analyzed directly or chemically converted and separated using established column chromatography techniques as needed prior to isotope analysis. The reagent volumes and the sample processing steps associated with ABF sample digestion lend themselves to automation and field

  9. A rapid screening-level method to optimize location of infiltration ponds.

    Science.gov (United States)

    Fennemore, G G; Davis, A; Goss, L; Warrick, A W

    2001-01-01

    A rapid-screening technique was developed to identify lithologies that best disperse artificial recharge via surface infiltration and minimize effects on ground water chemistry. The technique prospectively evaluates basin infiltration rates and water chemistry influences by integrating geotechnical, hydraulic, and water quality data with column test data and numerical modeling. The technique was validated using field data collected from surface infiltration basins designed to recharge ground water pumped from the Pipeline pit gold mine in Nevada. Observed recharge rates at these infiltration sites correlated most significantly with depth to groundwater, with basins in coarse-grained lithologies performing better (0.45 to 0.85 m/day) than those with fine-grained layers ( 2000 mg/L) than coarse-grained soils (infiltration basins for a variety of lithologies. Sites for infiltration basins can be rapidly screened to include areas with greatest depth to groundwater and in coarsest alluvial sediments, and impact to ground water chemistry can be reliably predicted using computer modeling and column test results.

  10. Grassmann phase space methods for fermions. II. Field theory

    Energy Technology Data Exchange (ETDEWEB)

    Dalton, B.J., E-mail: bdalton@swin.edu.au [Centre for Quantum and Optical Science, Swinburne University of Technology, Melbourne, Victoria 3122 (Australia); Jeffers, J. [Department of Physics, University of Strathclyde, Glasgow G4ONG (United Kingdom); Barnett, S.M. [School of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ (United Kingdom)

    2017-02-15

    In both quantum optics and cold atom physics, the behaviour of bosonic photons and atoms is often treated using phase space methods, where mode annihilation and creation operators are represented by c-number phase space variables, with the density operator equivalent to a distribution function of these variables. The anti-commutation rules for fermion annihilation, creation operators suggests the possibility of using anti-commuting Grassmann variables to represent these operators. However, in spite of the seminal work by Cahill and Glauber and a few applications, the use of Grassmann phase space methods in quantum-atom optics to treat fermionic systems is rather rare, though fermion coherent states using Grassmann variables are widely used in particle physics. This paper presents a phase space theory for fermion systems based on distribution functionals, which replace the density operator and involve Grassmann fields representing anti-commuting fermion field annihilation, creation operators. It is an extension of a previous phase space theory paper for fermions (Paper I) based on separate modes, in which the density operator is replaced by a distribution function depending on Grassmann phase space variables which represent the mode annihilation and creation operators. This further development of the theory is important for the situation when large numbers of fermions are involved, resulting in too many modes to treat separately. Here Grassmann fields, distribution functionals, functional Fokker–Planck equations and Ito stochastic field equations are involved. Typical applications to a trapped Fermi gas of interacting spin 1/2 fermionic atoms and to multi-component Fermi gases with non-zero range interactions are presented, showing that the Ito stochastic field equations are local in these cases. For the spin 1/2 case we also show how simple solutions can be obtained both for the untrapped case and for an optical lattice trapping potential.

  11. Grassmann phase space methods for fermions. II. Field theory

    International Nuclear Information System (INIS)

    Dalton, B.J.; Jeffers, J.; Barnett, S.M.

    2017-01-01

    In both quantum optics and cold atom physics, the behaviour of bosonic photons and atoms is often treated using phase space methods, where mode annihilation and creation operators are represented by c-number phase space variables, with the density operator equivalent to a distribution function of these variables. The anti-commutation rules for fermion annihilation, creation operators suggests the possibility of using anti-commuting Grassmann variables to represent these operators. However, in spite of the seminal work by Cahill and Glauber and a few applications, the use of Grassmann phase space methods in quantum-atom optics to treat fermionic systems is rather rare, though fermion coherent states using Grassmann variables are widely used in particle physics. This paper presents a phase space theory for fermion systems based on distribution functionals, which replace the density operator and involve Grassmann fields representing anti-commuting fermion field annihilation, creation operators. It is an extension of a previous phase space theory paper for fermions (Paper I) based on separate modes, in which the density operator is replaced by a distribution function depending on Grassmann phase space variables which represent the mode annihilation and creation operators. This further development of the theory is important for the situation when large numbers of fermions are involved, resulting in too many modes to treat separately. Here Grassmann fields, distribution functionals, functional Fokker–Planck equations and Ito stochastic field equations are involved. Typical applications to a trapped Fermi gas of interacting spin 1/2 fermionic atoms and to multi-component Fermi gases with non-zero range interactions are presented, showing that the Ito stochastic field equations are local in these cases. For the spin 1/2 case we also show how simple solutions can be obtained both for the untrapped case and for an optical lattice trapping potential.

  12. The experimental field work as practical learning method

    Directory of Open Access Journals (Sweden)

    Nicolás Fernández Losa

    2014-11-01

    Full Text Available This paper describes a teaching experience about experimental field work as practical learning method implemented in the subject of Organizational Behaviour. With this teaching experience we pretend to change the practical training, as well as in its evaluation process, in order to favour the development of transversal skills of students. For this purpose, the use of a practice plan, tackled through an experimental field work and carried out with the collaboration of a business organization within a work team (as organic unity of learning, arises as an alternative to the traditional method of practical teachings and allows the approach of business reality into the classroom, as well as actively promote the use of transversal skills. In particular, we develop the experience in three phases. Initially, the students, after forming a working group and define a field work project, should get the collaboration of a nearby business organization in which to obtain data on one or more functional areas of organizational behaviour. Subsequently, students carry out the field work with the realization of the scheduled visits and elaboration of a memory to establish a diagnosis of the strategy followed by the company in these functional areas in order to propose and justify alternative actions that improve existing ones. Finally, teachers assess the different field work memories and their public presentations according to evaluation rubrics, which try to objectify and unify to the maximum the evaluation criteria and serve to guide the learning process of students. The results of implementation of this teaching experience, measured through a Likert questionnaire, are very satisfactory for students.

  13. Screening of willow species for resistance to heavy metals: comparison of performance in a hydroponics system and field trials.

    Science.gov (United States)

    Watson, C; Pulford, I D; Riddell-Black, D

    2003-01-01

    The aim of this study was to ascertain whether metal resistance in willow (Salix) clones grown in a hydroponics screening test correlated with data from the same clones grown independently in a field trial. If so, results from a short-term, glasshouse-based system could be extrapolated to the field, allowing rapid identification of willows suitable for planting in metal-contaminated substrates without necessitating longterm field trials. Principal Components Analysis was used to show groups of clones and to assess the relative importance of the parameters measured in both the hydroponics system and the field; including plant response factors such as increase in stem height, as well as metal concentrations in plant tissues. The clones tested fell into two distinct groups. Salix viminalis clones and the basket willow Black Maul (S. triandra) were less resistant to elevated concentrations of heavy metals than a group of hardier clones, including S. burjatica 'Germany,' S.x dasyclados, S. candida and S. spaethii. The more resistant clones produced more biomass in the glasshouse and field, and had higher metal concentrations in the wood. The less resistant clones had greater concentrations of Cu and Ni in the bark, and produced less biomass in the glasshouse and field. Significant relationships were found between the response of the same clones grown the in short-term glasshouse hydroponics system and in the field.

  14. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  15. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  16. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  17. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Gourgari E

    2016-08-01

    Full Text Available Evgenia Gourgari,1 Elias Spanakis,2 Adrian Sandra Dobs3 1Division of Pediatric Endocrinology, Georgetown University School of Medicine, Washington, DC, 2Division of Endocrinology, University of Maryland School of Medicine, 3Department of Endocrinology, Johns Hopkins University School of Medicine, Baltimore, MD, USA Abstract: Polycystic ovary syndrome (PCOS is a syndrome associated with insulin resistance (IR, obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have. Keywords: IR, OGTT, obesity, hyperandrogenism, anovulation, BMI, insulin resistance, PCOS

  18. Rapid, high-temperature, field test method for evaluation of geothermal calcium carbonate scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1986-09-01

    A new test method is described that allows the rapid field testing of calcium carbonate scale inhibitors at 500/sup 0/F (260/sup 0/C). The method evolved from use of a full-flow test loop on a well with a mass flow rate of about 1 x 10/sup 6/ lbm/hr (126 kg/s). It is a simple, effective way to evaluate the effectiveness of inhibitors under field conditions. Five commercial formulations were chosen for field evaluation on the basis of nonflowing, laboratory screening tests at 500/sup 0/F (260/sup 0/C). Four of these formulations from different suppliers controlled calcium carbonate scale deposition as measured by the test method. Two of these could dislodge recently deposited scale that had not age-hardened. Performance-profile diagrams, which were measured for these four effective inhibitors, show the concentration interrelationship between brine calcium and inhibitor concentrations at which the formulations will and will not stop scale formation in the test apparatus. With these diagrams, one formulation was chosen for testing on the full-flow brine line. The composition was tested for 6 weeks and showed a dramatic decrease in the scaling occurring at the flow-control valve. This scaling was about to force a shutdown of a major, long-term flow test being done for reservoir economic evaluations. The inhibitor stopped the scaling, and the test was performed without interruption.

  19. Further Validation of a Rapid Screening Semiquantitative Thin-Layer Chromatographic Method for Marketed Antimalarial Medicines for Adoption in Malawi

    Directory of Open Access Journals (Sweden)

    Dorcas Osei-Safo

    2018-01-01

    Full Text Available A recently developed semiquantitative thin-layer chromatographic (SQ-TLC assay has been employed in postmarketing surveillance of antimalarial medicines used in Malawi prior to HPLC assay. Both methods gave analogous results in a significant majority of the samples, with a good correlation (r = 0.9012 for the active pharmaceutical ingredients of the dosage forms assayed. Artemether-containing medicines had the highest percentage (92.67% of samples with comparable results for both assays. The lowest percentage (66.67% was observed in artesunate-containing medicines. The SQ-TLC method was validated for specificity, accuracy, precision, linearity, and stability according to the International Conference on Harmonisation guidelines, with the results falling within acceptable limits. For specificity, retention factor values of the test samples and reference standards were comparable, while accuracy and precision of 91.1 ± 5.7% were obtained for all samples. The method was linear in the range 1.0–2.0 µg/spot with a correlation coefficient of r = 0.9783. Stability tests also fell within acceptable limits. In this study, we present the validation of the SQ-TLC method and propose its adoption as a rapid screening tool for field estimation of the quality of antimalarial and other essential medicines in Malawi and other parts of the developing world prior to a more accurate HPLC assay.

  20. Field Methods for the Study of Slope and Fluvial Processes

    Science.gov (United States)

    Leopold, Luna Bergere; Leopold, Luna Bergere

    1967-01-01

    In Belgium during the summer of 1966 the Commission on Slopes and the Commission on Applied Geomorphology of the International Geographical Union sponsored a joint symposium, with field excursions, and meetings of the two commissions. As a result of the conference and associated discussions, the participants expressed the view that it would be a contribution to scientific work relating to the subject area if the Commission on Applied Geomorphology could prepare a small manual describling the methods of field investigation being used by research scientists throughout the world in the study of various aspects of &lope development and fluvial processes. The Commission then assumed this responsibility and asked as many persons as were known to be. working on this subject to contribute whatever they wished in the way of descriptions of methods being employed.The purpose of the present manual is to show the variety of study methods now in use, to describe from the experience gained the limitations and advantages of different techniques, and to give pertinent detail which might be useful to other investigators. Some details that would be useful to know are not included in scientific publications, but in a manual on methods the details of how best t6 use a method has a place. Various persons have learned certain things which cannot be done, as well as some methods that are successful. It is our hope that comparison of methods tried will give the reader suggestions as to how a particular method might best be applied to his own circumstance.The manual does not purport to include methods used by all workers. In particular, it does not interfere with a more systematic treatment of the subject (1) or with various papers already published in the present journal. In fact we are sure that there are pertinent research methods that we do not know of and the Commission would be glad to receive additions and other ideas from those who find they have something to contribute. Also, the

  1. Hamiltonian lattice field theory: Computer calculations using variational methods

    International Nuclear Information System (INIS)

    Zako, R.L.

    1991-01-01

    I develop a variational method for systematic numerical computation of physical quantities -- bound state energies and scattering amplitudes -- in quantum field theory. An infinite-volume, continuum theory is approximated by a theory on a finite spatial lattice, which is amenable to numerical computation. I present an algorithm for computing approximate energy eigenvalues and eigenstates in the lattice theory and for bounding the resulting errors. I also show how to select basis states and choose variational parameters in order to minimize errors. The algorithm is based on the Rayleigh-Ritz principle and Kato's generalizations of Temple's formula. The algorithm could be adapted to systems such as atoms and molecules. I show how to compute Green's functions from energy eigenvalues and eigenstates in the lattice theory, and relate these to physical (renormalized) coupling constants, bound state energies and Green's functions. Thus one can compute approximate physical quantities in a lattice theory that approximates a quantum field theory with specified physical coupling constants. I discuss the errors in both approximations. In principle, the errors can be made arbitrarily small by increasing the size of the lattice, decreasing the lattice spacing and computing sufficiently long. Unfortunately, I do not understand the infinite-volume and continuum limits well enough to quantify errors due to the lattice approximation. Thus the method is currently incomplete. I apply the method to real scalar field theories using a Fock basis of free particle states. All needed quantities can be calculated efficiently with this basis. The generalization to more complicated theories is straightforward. I describe a computer implementation of the method and present numerical results for simple quantum mechanical systems

  2. Hamiltonian lattice field theory: Computer calculations using variational methods

    International Nuclear Information System (INIS)

    Zako, R.L.

    1991-01-01

    A variational method is developed for systematic numerical computation of physical quantities-bound state energies and scattering amplitudes-in quantum field theory. An infinite-volume, continuum theory is approximated by a theory on a finite spatial lattice, which is amenable to numerical computation. An algorithm is presented for computing approximate energy eigenvalues and eigenstates in the lattice theory and for bounding the resulting errors. It is shown how to select basis states and choose variational parameters in order to minimize errors. The algorithm is based on the Rayleigh-Ritz principle and Kato's generalizations of Temple's formula. The algorithm could be adapted to systems such as atoms and molecules. It is shown how to compute Green's functions from energy eigenvalues and eigenstates in the lattice theory, and relate these to physical (renormalized) coupling constants, bound state energies and Green's functions. Thus one can compute approximate physical quantities in a lattice theory that approximates a quantum field theory with specified physical coupling constants. The author discusses the errors in both approximations. In principle, the errors can be made arbitrarily small by increasing the size of the lattice, decreasing the lattice spacing and computing sufficiently long. Unfortunately, the author does not understand the infinite-volume and continuum limits well enough to quantify errors due to the lattice approximation. Thus the method is currently incomplete. The method is applied to real scalar field theories using a Fock basis of free particle states. All needed quantities can be calculated efficiently with this basis. The generalization to more complicated theories is straightforward. The author describes a computer implementation of the method and present numerical results for simple quantum mechanical systems

  3. Development of Efficient Screening Methods for Resistant Cucumber Plants to Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Sung Min Hwang

    2014-06-01

    Full Text Available Root-knot nematodes represent a significant problem in cucumber, causing reduction in yield and quality. To develop screening methods for resistance of cucumber to root-knot nematode Meloidogyne incognita, development of root-knot nematode of four cucumber cultivars (‘Dragonsamchuk’, ‘Asiastrike’, ‘Nebakja’ and ‘Hanelbakdadaki’ according to several conditions such as inoculum concentration, plant growth stage and transplanting period was investigated by the number of galls and egg masses produced in each seedling 45 days after inoculation. There was no difference in galls and egg masses according to the tested condition except for inoculum concentration. Reproduction of the nematode on all the tested cultivars according to inoculum concentration increased in a dose-dependent manner. On the basis of the result, the optimum conditions for root-knot development on the cultivars is to transplant period of 1 week, inoculum concentration of 5,000 eggs/plant and plant growth stage of 3-week-old in a greenhouse (25 ± 5°C. In addition, under optimum conditions, resistance of 45 commercial cucumber cultivars was evaluated. One rootstock cultivar, Union was moderately resistant to the root-knot nematode. However, no significant difference was in the resistance of the others cultivar. According to the result, we suggest an efficient screening method for new resistant cucumber to the root-knot nematode, M. incognita.

  4. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  5. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    International Nuclear Information System (INIS)

    Naz, U.; Hanif, S.

    2014-01-01

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  6. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  7. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  8. Local Field Response Method Phenomenologically Introducing Spin Correlations

    Science.gov (United States)

    Tomaru, Tatsuya

    2018-03-01

    The local field response (LFR) method is a way of searching for the ground state in a similar manner to quantum annealing. However, the LFR method operates on a classical machine, and quantum effects are introduced through a priori information and through phenomenological means reflecting the states during the computations. The LFR method has been treated with a one-body approximation, and therefore, the effect of entanglement has not been sufficiently taken into account. In this report, spin correlations are phenomenologically introduced as one of the effects of entanglement, by which multiple tunneling at anticrossing points is taken into account. As a result, the accuracy of solutions for a 128-bit system increases by 31% compared with that without spin correlations.

  9. A field trial of alternative targeted screening strategies for Chagas disease in Arequipa, Peru.

    Directory of Open Access Journals (Sweden)

    Gabrielle C Hunter

    2012-01-01

    Full Text Available Chagas disease is endemic in the rural areas of southern Peru and a growing urban problem in the regional capital of Arequipa, population ∼860,000. It is unclear how to implement cost-effective screening programs across a large urban and periurban environment.We compared four alternative screening strategies in 18 periurban communities, testing individuals in houses with 1 infected vectors; 2 high vector densities; 3 low vector densities; and 4 no vectors. Vector data were obtained from routine Ministry of Health insecticide application campaigns. We performed ring case detection (radius of 15 m around seropositive individuals, and collected data on costs of implementation for each strategy.Infection was detected in 21 of 923 (2.28% participants. Cases had lived more time on average in rural places than non-cases (7.20 years versus 3.31 years, respectively. Significant risk factors on univariate logistic regression for infection were age (OR 1.02; p = 0.041, time lived in a rural location (OR 1.04; p = 0.022, and time lived in an infested area (OR 1.04; p = 0.008. No multivariate model with these variables fit the data better than a simple model including only the time lived in an area with triatomine bugs. There was no significant difference in prevalence across the screening strategies; however a self-assessment of disease risk may have biased participation, inflating prevalence among residents of houses where no infestation was detected. Testing houses with infected-vectors was least expensive. Ring case detection yielded four secondary cases in only one community, possibly due to vector-borne transmission in this community, apparently absent in the others.Targeted screening for urban Chagas disease is promising in areas with ongoing vector-borne transmission; however, these pockets of epidemic transmission remain difficult to detect a priori. The flexibility to adapt to the epidemiology that emerges during screening is key to

  10. Probabilistic methods in the field of reactor safety in Germany

    Energy Technology Data Exchange (ETDEWEB)

    Birkhofer, A [Technische Univ. Muenchen (Germany, F.R.). Lehrstuhl fuer Reaktordynamik und Reaktorsicherheit

    1979-01-01

    The present status and future prospects in Germany of reliability, as well as risk analysis, in the field of reactor safety are examined. The development of analytical methods with respect to the available data base is reviewed with consideration of the roles of reliability codes, component data, common mode failures, human influence, structural analysis and process computers. Some examples of the application of probability assessments are discussed and the extension of reliability analysis beyond the loss-of-coolant accident is considered. In the case of risk analysis, the object is to determine not only the probability of failure of systems but also the probability and extent of possible consequences. Some risk studies under investigation in Germany and the methodology of risk analysis are discussed. Reliability and risk analysis are involved to an increasing extent in safety research and licensing procedures and their influence in other fields such as the public perception of risk is also discussed.

  11. Precise magnetostatic field using the finite element method

    International Nuclear Information System (INIS)

    Nascimento, Francisco Rogerio Teixeira do

    2013-01-01

    The main objective of this work is to simulate electromagnetic fields using the Finite Element Method. Even in the easiest case of electrostatic and magnetostatic numerical simulation some problems appear when the nodal finite element is used. It is difficult to model vector fields with scalar functions mainly in non-homogeneous materials. With the aim to solve these problems two types of techniques are tried: the adaptive remeshing using nodal elements and the edge finite element that ensure the continuity of tangential components. Some numerical analysis of simple electromagnetic problems with homogeneous and non-homogeneous materials are performed using first, the adaptive remeshing based in various error indicators and second, the numerical solution of waveguides using edge finite element. (author)

  12. Magnetic field adjustment structure and method for a tapered wiggler

    Science.gov (United States)

    Halbach, Klaus

    1988-01-01

    An improved method and structure is disclosed for adjusting the magnetic field generated by a group of electromagnet poles spaced along the path of a charged particle beam to compensate for energy losses in the charged particles which comprises providing more than one winding on at least some of the electromagnet poles; connecting one respective winding on each of several consecutive adjacent electromagnet poles to a first power supply, and the other respective winding on the electromagnet pole to a different power supply in staggered order; and independently adjusting one power supply to independently vary the current in one winding on each electromagnet pole in a group whereby the magnetic field strength of each of a group of electromagnet poles may be changed in smaller increments.

  13. METHOD AND APPARATUS FOR TRAPPING IONS IN A MAGNETIC FIELD

    Science.gov (United States)

    Luce, J.S.

    1962-04-17

    A method and apparatus are described for trapping ions within an evacuated container and within a magnetic field utilizing dissociation and/or ionization of molecular ions to form atomic ions and energetic neutral particles. The atomic ions are magnetically trapped as a result of a change of charge-to- mass ratio. The molecular ions are injected into the container and into the path of an energetic carbon arc discharge which dissociates and/or ionizes a portion of the molecular ions into atomic ions and energetic neutrals. The resulting atomic ions are trapped by the magnetic field to form a circulating beam of atomic ions, and the energetic neutrals pass out of the system and may be utilized in a particle accelerator. (AEC)

  14. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  15. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  16. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  17. Evaluation of Dried Urine Spot Method to Screen Cotinine among Tobacco Dependents: An Exploratory Study.

    Science.gov (United States)

    Jain, Raka; Quraishi, Rizwana; Verma, Arpita

    2017-01-01

    Assessment of cotinine, a metabolite of nicotine in body fluids, is an important approach for validating the self-report among tobacco users. Adaptation of assays on dried urine spots (DUSs) has advantages of ease of collection, transportation, minimal invasiveness, and requirement of small volume. The aim of the present study was to develop an efficient method for testing cotinine in DUSs and evaluating its clinical applicability. This involved optimization of conditions for detection, recovery, and stability of cotinine from dried urine, spotted on filter paper. Enzyme-linked immunosorbent assay was used for screening, whereas confirmation was done by gas chromatography. For clinical applicability, urine samples of tobacco users were tested. Water was found to be a suitable extracting solvent as compared to carbonate-bicarbonate buffer (pH 9.2) and saline. Screening was achieved by two punches taken from a 20 μl (diameter 1.3 cm) spotted urine samples, and confirmation was achieved by five complete circles each of 20 μl sample volume. The recovery was found to be 97% in water. Limit of detection for the method was found to be 100 ng/ml. No signs of significant degradation were found under all storage conditions. All the urine samples of tobacco users were found to be positive by a conventional method as well as DUSs, and the method proved to be efficient. DUS samples are a useful alternative for biological monitoring of recent nicotine use, especially in developing countries where sample logistics could be an important concern.

  18. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  19. Accounting for biotic spatial variability in fields: Case of resistance screening against sunflower Verticillium wilt.

    Science.gov (United States)

    Missonnier, Hélène; Jacques, Alban; Bang, JiSu; Daydé, Jean; Mirleau-Thebaud, Virginie

    2017-01-01

    In breeding for disease resistance, the magnitude of the genetic response is difficult to appreciate because of environmental stresses that interact with the plant genotype. We discuss herein the fundamental problems in breeding for disease resistance with the aim being to better understand the interactions between plant, pathogen, and spatial patterns. The goal of this study is to fine tune breeding decisions by incorporating spatial patterns of such biotic factors into the definition of disease-occurrence probability. We use a preexisting statistics method based on geostatistics for a descriptive analysis of biotic factors for trial quality control. The plant-population structure used for spatial-pattern analysis consists of two F1-hybrid cultivars, defined as symptomatic and asymptomatic controls with respect to the studied pathogen. The controls are inserted at specific locations to establish a grid arrangement over the field that include the F1-hybrid cultivars under evaluation. We characterize the spatial structure of the pathogen population and of the general plant environment-with undetermined but present abiotic constraints-not by using direct notation such as flower time or rainfall but by using plant behavior (i.e., leaf symptom severity, indirect notation). The analysis indicates areas with higher or lower risk of disease and reveals a correlation between the symptomatic control and the effective level of disease for sunflowers. This result suggests that the pathogen and/or abiotic components are major factors in determining the probability that a plant develops the disease, which could lead to a misinterpretation of plant resistance.

  20. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  1. A field method for monitoring thoron-daughter working level

    International Nuclear Information System (INIS)

    Khan, A.H.; Dhandayatham, R.; Raghavayya, M.; Nambiar, P.P.V.J.

    1975-01-01

    The concept of working level, generally used for radon daughters, has been extended to the daughter products of thoron. Accordingly, thorondaughter working level (TWL) has been defined as the alpha energy released from the ultimate decay of 100 pCi/1 each of the short-lived decay products of thoron. In order to facilitate the evaluation of inhalation hazard in thorium handling areas, a simple field method has been suggested to measure the thoron-daughter working level. A comparison of the potential alpha energies from radon-daughters and that from thoron-daughter is included. (K.B.)

  2. Algebraic methods in statistical mechanics and quantum field theory

    CERN Document Server

    Emch, Dr Gérard G

    2009-01-01

    This systematic algebraic approach concerns problems involving a large number of degrees of freedom. It extends the traditional formalism of quantum mechanics, and it eliminates conceptual and mathematical difficulties common to the development of statistical mechanics and quantum field theory. Further, the approach is linked to research in applied and pure mathematics, offering a reflection of the interplay between formulation of physical motivations and self-contained descriptions of the mathematical methods.The four-part treatment begins with a survey of algebraic approaches to certain phys

  3. Field method for detemining thorium-230 in soils

    International Nuclear Information System (INIS)

    Dechant, G.

    1989-05-01

    The US Department of Energy (DOE) Office of Remedial Action and Waste Technology established the Technical Measurements Center at the DOE Grand Junction, Colorado, Projects Office to develop and/or recommend measurement methods for use in support of its remedial action programs. This report describes a field method for the determination of Th-230 in soils for remedial action projects. The method involves a cold acid digestion, organic extraction, and precipitation of Th-230 for counting by alpha spectrometry. An internal Th-228 spike is added early in the method to eliminate the need to determine losses through the separation steps. A step-by-step procedure is included in the report. The method requires a small portable or mobile laboratory equipped with electrical power and ventilation. All additional equipment is commercially available and no special equipment is required. Chemical wastes for each analysis are stored for appropriate disposal off site. A chemist or chemical technician can complete 15--30 analyses per day depending primarily on the number of alpha spectrometers available. 8 refs., 2 figs., 7 tabs

  4. Path planning in uncertain flow fields using ensemble method

    KAUST Repository

    Wang, Tong

    2016-08-20

    An ensemble-based approach is developed to conduct optimal path planning in unsteady ocean currents under uncertainty. We focus our attention on two-dimensional steady and unsteady uncertain flows, and adopt a sampling methodology that is well suited to operational forecasts, where an ensemble of deterministic predictions is used to model and quantify uncertainty. In an operational setting, much about dynamics, topography, and forcing of the ocean environment is uncertain. To address this uncertainty, the flow field is parametrized using a finite number of independent canonical random variables with known densities, and the ensemble is generated by sampling these variables. For each of the resulting realizations of the uncertain current field, we predict the path that minimizes the travel time by solving a boundary value problem (BVP), based on the Pontryagin maximum principle. A family of backward-in-time trajectories starting at the end position is used to generate suitable initial values for the BVP solver. This allows us to examine and analyze the performance of the sampling strategy and to develop insight into extensions dealing with general circulation ocean models. In particular, the ensemble method enables us to perform a statistical analysis of travel times and consequently develop a path planning approach that accounts for these statistics. The proposed methodology is tested for a number of scenarios. We first validate our algorithms by reproducing simple canonical solutions, and then demonstrate our approach in more complex flow fields, including idealized, steady and unsteady double-gyre flows.

  5. Scattering in an intense radiation field: Time-independent methods

    International Nuclear Information System (INIS)

    Rosenberg, L.

    1977-01-01

    The standard time-independent formulation of nonrelativistic scattering theory is here extended to take into account the presence of an intense external radiation field. In the case of scattering by a static potential the extension is accomplished by the introduction of asymptotic states and intermediate-state propagators which account for the absorption and induced emission of photons by the projectile as it propagates through the field. Self-energy contributions to the propagator are included by a systematic summation of forward-scattering terms. The self-energy analysis is summarized in the form of a modified perturbation expansion of the type introduced by Watson some time ago in the context of nuclear-scattering theory. This expansion, which has a simple continued-fraction structure in the case of a single-mode field, provides a generally applicable successive approximation procedure for the propagator and the asymptotic states. The problem of scattering by a composite target is formulated using the effective-potential method. The modified perturbation expansion which accounts for self-energy effects is applicable here as well. A discussion of a coupled two-state model is included to summarize and clarify the calculational procedures

  6. Novel method for detecting weak magnetic fields at low frequencies

    Science.gov (United States)

    González-Martínez, S.; Castillo-Torres, J.; Mendoza-Santos, J. C.; Zamorano-Ulloa, R.

    2005-06-01

    A low-level-intensity magnetic field detection system has been designed and developed based on the amplification-selection process of signals. This configuration is also very sensitive to magnetic field changes produced by harmonic-like electrical currents transported in finite-length wires. Experimental and theoretical results of magnetic fields detection as low as 10-9T at 120Hz are also presented with an accuracy of around 13%. The assembled equipment is designed to measure an electromotive force induced in a free-magnetic-core coil in order to recover signals which are previously selected, despite the fact that their intensities are much lower than the environment electromagnetic radiation. The prototype has a signal-to-noise ratio of 60dB. This system also presents the advantage for using it as a portable unit of measurement. The concept and prototype may be applied, for example, as a nondestructive method to analyze any corrosion formation in metallic oil pipelines which are subjected to cathodic protection.

  7. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  8. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  9. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  10. Fields Institute International Symposium on Asymptotic Methods in Stochastics

    CERN Document Server

    Kulik, Rafal; Haye, Mohamedou; Szyszkowicz, Barbara; Zhao, Yiqiang

    2015-01-01

    This book contains articles arising from a conference in honour of mathematician-statistician Miklόs Csörgő on the occasion of his 80th birthday, held in Ottawa in July 2012. It comprises research papers and overview articles, which provide a substantial glimpse of the history and state-of-the-art of the field of asymptotic methods in probability and statistics, written by leading experts. The volume consists of twenty articles on topics on limit theorems for self-normalized processes, planar processes, the central limit theorem and laws of large numbers, change-point problems, short and long range dependent time series, applied probability and stochastic processes, and the theory and methods of statistics. It also includes Csörgő’s list of publications during more than 50 years, since 1962.

  11. Screening for microplastics in sediment, water, marine invertebrates and fish: method development and microplastic accumulation

    NARCIS (Netherlands)

    Karlsson, Therese; Vethaak, A.D.; Carney Almroth, Bethany; Ariese, Freek; van Velzen, M.J.M.; Hassellöv, Martin; Leslie, H.A.

    2017-01-01

    Measurements of microplastics in biota and abiotic matrices are key elements of exposure and risk assessments for this emerging environmental pollutant. We investigated the abundance of microplastics in field-collected biota, sediment and water. An improved sediment extraction method, based on

  12. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  13. Benchmarking Methods and Data Sets for Ligand Enrichment Assessment in Virtual Screening

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2014-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. “analogue bias”, “artificial enrichment” and “false negative”. In addition, we introduced our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylase (HDAC) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The Leave-One-Out Cross-Validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased in terms of property matching, ROC curves and AUCs. PMID:25481478

  14. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  16. A cost-effective screening method for pesticide residue analysis in fruits, vegetables, and cereal grains.

    Science.gov (United States)

    Ambrus, A; Füzesi, I; Susán, M; Dobi, D; Lantos, J; Zakar, F; Korsós, I; Oláh, J; Beke, B B; Katavics, L

    2005-01-01

    This paper reports the results of studies performed to investigate the potential of applying thin layer chromatography (TLC) detection in combination with selected extraction and cleanup methods, for providing an alternative cost-effective analytical procedure for screening and confirmation of pesticide residues in plant commodities. The extraction was carried out with ethyl acetate and an on-line extraction method applying an acetone-dichloromethane mixture. The extracts were cleaned up with SX-3 gel, an adsorbent mixture of active carbon, magnesia, and diatomaceous earth, and on silica micro cartridges. The Rf values of 118 pesticides were tested in eleven elution systems with UV, and eight biotest methods and chemical detection reagents. Cabbage, green peas, orange, and tomatoes were selected as representative sample matrices for fruits and vegetables, while maize, rice, and wheat represented cereal grains. As an internal quality control measure, marker compounds were applied on each plate to verify the proper elution and detection conditions. The Rf values varied in the different elution systems. The best separation (widest Rf range) was achieved with silica gel (SG)--ethyl acetate (0.05-0.7), SG--benzene, (0.02-0.7) and reverse phase RP-18 F-254S layer with acetone: methanol: water/30:30:30 (v/v) (0.1-0.8). The relative standard deviation of Rf values (CV(Rf)) within laboratory reproducibility was generally less than 20%, except below 0.2 Rf, where the CVRf rapidly increased with decreasing Rf values. The fungi spore inhibition, chloroplast inhibition, and enzyme inhibition were found most suitable for detection of pesticides primarily for confirming their identity or screening for known substances. Their use for determination of pesticide residues in samples of unknown origin is not recommended.

  17. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  18. A computerised screening for visual field defects in brain injury patients

    DEFF Research Database (Denmark)

    Nordfang, Maria; Uhre, Valdemar H.B.; Robotham, Ro Julia

    The c-VFT is a computer program written in open source Python using Psychopy and can be installed without a license. The program tests 48 points in the visual field, covering the visual field from 1 degree to 10 degrees in each hemifield. A colour change detection task controls fixation. Several...... parameters like the number of stimulus repetitions, the colour of stimuli and background, and the orientation of the layout can be individually set. The c-VFT probes all four quadrants and probes along the horizontal midline, making it particularly sensitive for visual field deficits that affect reading...

  19. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  20. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  1. Importance of the Debye screening length on nanowire field effect transistor sensors.

    Science.gov (United States)

    Stern, Eric; Wagner, Robin; Sigworth, Fred J; Breaker, Ronald; Fahmy, Tarek M; Reed, Mark A

    2007-11-01

    Nanowire field effect transistors (NW-FETs) can serve as ultrasensitive detectors for label-free reagents. The NW-FET sensing mechanism assumes a controlled modification in the local channel electric field created by the binding of charged molecules to the nanowire surface. Careful control of the solution Debye length is critical for unambiguous selective detection of macromolecules. Here we show the appropriate conditions under which the selective binding of macromolecules is accurately sensed with NW-FET sensors.

  2. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Avonto, Cristina; Chittiboyina, Amar G. [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Rua, Diego [The Center for Food Safety and Applied Nutrition, US Food and Drug Administration, College Park, MD 20740 (United States); Khan, Ikhlas A., E-mail: ikhan@olemiss.edu [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Division of Pharmacognosy, Department of BioMolecular Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States)

    2015-12-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  3. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    International Nuclear Information System (INIS)

    Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego; Khan, Ikhlas A.

    2015-01-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  4. A New Method for Coronal Magnetic Field Reconstruction

    Science.gov (United States)

    Yi, Sibaek; Choe, Gwang-Son; Cho, Kyung-Suk; Kim, Kap-Sung

    2017-08-01

    A precise way of coronal magnetic field reconstruction (extrapolation) is an indispensable tool for understanding of various solar activities. A variety of reconstruction codes have been developed so far and are available to researchers nowadays, but they more or less bear this and that shortcoming. In this paper, a new efficient method for coronal magnetic field reconstruction is presented. The method imposes only the normal components of magnetic field and current density at the bottom boundary to avoid the overspecification of the reconstruction problem, and employs vector potentials to guarantee the divergence-freeness. In our method, the normal component of current density is imposed, not by adjusting the tangential components of A, but by adjusting its normal component. This allows us to avoid a possible numerical instability that on and off arises in codes using A. In real reconstruction problems, the information for the lateral and top boundaries is absent. The arbitrariness of the boundary conditions imposed there as well as various preprocessing brings about the diversity of resulting solutions. We impose the source surface condition at the top boundary to accommodate flux imbalance, which always shows up in magnetograms. To enhance the convergence rate, we equip our code with a gradient-method type accelerator. Our code is tested on two analytical force-free solutions. When the solution is given only at the bottom boundary, our result surpasses competitors in most figures of merits devised by Schrijver et al. (2006). We have also applied our code to a real active region NOAA 11974, in which two M-class flares and a halo CME took place. The EUV observation shows a sudden appearance of an erupting loop before the first flare. Our numerical solutions show that two entwining flux tubes exist before the flare and their shackling is released after the CME with one of them opened up. We suggest that the erupting loop is created by magnetic reconnection between

  5. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    Science.gov (United States)

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  6. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A

    Directory of Open Access Journals (Sweden)

    Lin Wu

    2017-01-01

    Full Text Available Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21 and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris. Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C, induction time (4 h, 5 h, 6 h and 7 h and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L. The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very

  7. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  8. Establishment of cocrystal cocktail grinding method for rational screening of pharmaceutical cocrystals.

    Science.gov (United States)

    Yamamoto, Katsuhiko; Tsutsumi, Shunichirou; Ikeda, Yukihiro

    2012-11-01

    Cocrystals (CCs) used in the pharmaceutical industry are defined as complex crystals formed by reaction between an API and a cocrystal former (CCF); unlike salts, CCs do not show proton transfer. Recently, pharmaceutical CCs have been used to improve the drug-likeness of APIs, such as solubility and stability. Grinding is more effective for CC synthesis than crystallization from solution because in the former case, the API can predominantly interact with the CCF without being affected by solvents. However, this method is tedious because the API is ground with only one CCF at a time. We developed a cocktail cocrystal grinding (CCG) method, in which a mixture of CCFs having the same functional group was used. No false negatives/positives were observed in CCG when carbamazepine was used as the model compound. This method could be used to obtain CCs of piroxicam and spironolactone. False negatives were observed for only one compound from among three model compounds, indicating that CCG facilitates efficient CC detection and that it has higher throughput than does the conventional method. Further, CCG is fast and suitable for rational CC screening, and it helps identify the partial structure of CCFs that forms synthons with an API. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Gas evolution as a rapid screening method for detection of irradiated foods

    International Nuclear Information System (INIS)

    Roberts, P.B.; Chambers, D.M.; Brailsford, G.W.

    1996-01-01

    A number of detection methods for irradiated foods are in advanced state of development. No single method is likely to be universally applicable but a battery of tests such as thermoluminescence, electron spin resonance and analysis of lipid radiolytic products may soon be available for most foods and technical uses of irradiation. Most of these proposed tests require relatively sophisticated equipment or technical skills and are often time consuming and costly. There would be value in relatively simple tests which could be used as a rapid screening system or confirmatory method. The literature on the use of radiolytic gases as a detection method is limited and this paper extends the above studies. In particular, it extends the work to frozen shellfish, for which irradiation has been used as a commercial decontaminant technique for many years, and considers the effect of storage temperature. Work on poultry is also reported as a cross-reference to earlier work and because irradiated poultry has recently been released into the US retail trade. (author)

  10. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  11. Infrared thermography based on artificial intelligence as a screening method for carpal tunnel syndrome diagnosis.

    Science.gov (United States)

    Jesensek Papez, B; Palfy, M; Mertik, M; Turk, Z

    2009-01-01

    This study further evaluated a computer-based infrared thermography (IRT) system, which employs artificial neural networks for the diagnosis of carpal tunnel syndrome (CTS) using a large database of 502 thermal images of the dorsal and palmar side of 132 healthy and 119 pathological hands. It confirmed the hypothesis that the dorsal side of the hand is of greater importance than the palmar side when diagnosing CTS thermographically. Using this method it was possible correctly to classify 72.2% of all hands (healthy and pathological) based on dorsal images and > 80% of hands when only severely affected and healthy hands were considered. Compared with the gold standard electromyographic diagnosis of CTS, IRT cannot be recommended as an adequate diagnostic tool when exact severity level diagnosis is required, however we conclude that IRT could be used as a screening tool for severe cases in populations with high ergonomic risk factors of CTS.

  12. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  13. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  14. Noninvasive Assessment of Excessive Erythrocytosis as a Screening Method for Chronic Mountain Sickness at High Altitude.

    Science.gov (United States)

    Vyas, Kaetan J; Danz, David; Gilman, Robert H; Wise, Robert A; León-Velarde, Fabiola; Miranda, J Jaime; Checkley, William

    2015-06-01

    Vyas, Kaetan J., David Danz, Robert H. Gilman, Robert A. Wise, Fabiola León-Velarde, J. Jaime Miranda, and William Checkley. Noninvasive assessment of excessive erythrocytosis as a screening method for chronic mountain sickness at high altitude. High Alt Med Biol 16:162-168, 2015.--Globally, over 140 million people are at risk of developing chronic mountain sickness, a common maladaptation to life at high altitude (>2500 meters above sea level). The diagnosis is contingent upon the identification of excessive erythrocytosis (EE). Current best practices to identify EE require a venous blood draw, which is cumbersome for large-scale surveillance. We evaluated two point-of-care biomarkers to screen for EE: noninvasive spot-check tests of total hemoglobin and oxyhemoglobin saturation (Pronto-7, Masimo Corporation). We conducted paired evaluations of total serum hemoglobin from a venous blood draw and noninvasive, spot-check testing of total hemoglobin and oxyhemoglobin saturation with the Pronto-7 in 382 adults aged ≥35 years living in Puno, Peru (3825 meters above sea level). We used the Bland-Altman method to measure agreement between the noninvasive hemoglobin assessment and the gold standard lab hemoglobin analyzer. Mean age was 58.8 years and 47% were male. The Pronto-7 test was unsuccessful in 21 (5%) participants. Limits of agreement between total hemoglobin measured via venous blood draw and the noninvasive, spot-check test ranged from -2.8 g/dL (95% CI -3.0 to -2.5) to 2.5 g/dL (95% CI 2.2 to 2.7), with a bias of -0.2 g/dL (95% CI -0.3 to -0.02) for the difference between total hemoglobin and noninvasive hemoglobin concentrations. Overall, the noninvasive spot-check test of total hemoglobin had a better area under the receiver operating characteristic curve compared to oxyhemoglobin saturation for the identification of EE as measured by a gold standard laboratory hemoglobin analyzer (0.96 vs. 0.82; p<0.001). Best cut-off values to screen for EE with

  15. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  16. A Simple Surface-Enhanced Raman Spectroscopic Method for on-Site Screening of Tetracycline Residue in Whole Milk

    Directory of Open Access Journals (Sweden)

    Sagar Dhakal

    2018-02-01

    Full Text Available Therapeutic and subtherapeutic use of veterinary drugs has increased the risk of residue contamination in animal food products. Antibiotics such as tetracycline are used for mastitis treatment of lactating cows. Milk expressed from treated cows before the withdrawal period has elapsed may contain tetracycline residue. This study developed a simple surface-enhanced Raman spectroscopic (SERS method for on-site screening of tetracycline residue in milk and water. Six batches of silver colloid nanoparticles were prepared for surface enhancement measurement. Milk-tetracycline and water-tetracycline solutions were prepared at seven concentration levels (1000, 500, 100, 10, 1, 0.1, and 0.01 ppm and spiked with silver colloid nanoparticles. A 785 nm Raman spectroscopic system was used for spectral measurement. Tetracycline vibrational modes were observed at 1285, 1317 and 1632 cm−1 in water-tetracycline solutions and 1322 and 1621 cm−1 (shifted from 1317 and 1632 cm−1, respectively in milk-tetracycline solutions. Tetracycline residue concentration as low as 0.01 ppm was detected in both the solutions. The peak intensities at 1285 and 1322 cm−1 were used to estimate the tetracycline concentrations in water and milk with correlation coefficients of 0.92 for water and 0.88 for milk. Results indicate that this SERS method is a potential tool that can be used on-site at field production for qualitative and quantitative detection of tetracycline residues.

  17. A Simple Surface-Enhanced Raman Spectroscopic Method for on-Site Screening of Tetracycline Residue in Whole Milk.

    Science.gov (United States)

    Dhakal, Sagar; Chao, Kuanglin; Huang, Qing; Kim, Moon; Schmidt, Walter; Qin, Jianwei; Broadhurst, C Leigh

    2018-02-01

    Therapeutic and subtherapeutic use of veterinary drugs has increased the risk of residue contamination in animal food products. Antibiotics such as tetracycline are used for mastitis treatment of lactating cows. Milk expressed from treated cows before the withdrawal period has elapsed may contain tetracycline residue. This study developed a simple surface-enhanced Raman spectroscopic (SERS) method for on-site screening of tetracycline residue in milk and water. Six batches of silver colloid nanoparticles were prepared for surface enhancement measurement. Milk-tetracycline and water-tetracycline solutions were prepared at seven concentration levels (1000, 500, 100, 10, 1, 0.1, and 0.01 ppm) and spiked with silver colloid nanoparticles. A 785 nm Raman spectroscopic system was used for spectral measurement. Tetracycline vibrational modes were observed at 1285, 1317 and 1632 cm -1 in water-tetracycline solutions and 1322 and 1621 cm -1 (shifted from 1317 and 1632 cm -1 , respectively) in milk-tetracycline solutions. Tetracycline residue concentration as low as 0.01 ppm was detected in both the solutions. The peak intensities at 1285 and 1322 cm -1 were used to estimate the tetracycline concentrations in water and milk with correlation coefficients of 0.92 for water and 0.88 for milk. Results indicate that this SERS method is a potential tool that can be used on-site at field production for qualitative and quantitative detection of tetracycline residues.

  18. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  19. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  20. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  1. Screening possible solid electrolytes by calculating the conduction pathways using Bond Valence method

    Science.gov (United States)

    Gao, Jian; Chu, Geng; He, Meng; Zhang, Shu; Xiao, RuiJuan; Li, Hong; Chen, LiQuan

    2014-08-01

    Inorganic solid electrolytes have distinguished advantages in terms of safety and stability, and are promising to substitute for conventional organic liquid electrolytes. However, low ionic conductivity of typical candidates is the key problem. As connective diffusion path is the prerequisite for high performance, we screen for possible solid electrolytes from the 2004 International Centre for Diffraction Data (ICDD) database by calculating conduction pathways using Bond Valence (BV) method. There are 109846 inorganic crystals in the 2004 ICDD database, and 5295 of them contain lithium. Except for those with toxic, radioactive, rare, or variable valence elements, 1380 materials are candidates for solid electrolytes. The rationality of the BV method is approved by comparing the existing solid electrolytes' conduction pathways we had calculated with those from experiments or first principle calculations. The implication for doping and substitution, two important ways to improve the conductivity, is also discussed. Among them Li2CO3 is selected for a detailed comparison, and the pathway is reproduced well with that based on the density functional studies. To reveal the correlation between connectivity of pathways and conductivity, α/ γ-LiAlO2 and Li2CO3 are investigated by the impedance spectrum as an example, and many experimental and theoretical studies are in process to indicate the relationship between property and structure. The BV method can calculate one material within a few minutes, providing an efficient way to lock onto targets from abundant data, and to investigate the structure-property relationship systematically.

  2. Screening of alternative methods for the disposal of low-level radioactive wastes

    International Nuclear Information System (INIS)

    Macbeth, P.J.; Thamer, B.J.; Christensen, D.E.; Wehmann, G.

    1978-10-01

    A systematic method for categorizing these disposal alternatives which provides assurance that no viable alternatives are overlooked is reported. Alternatives are categorized by (1) the general media in which disposal occurs, (2) by whether the disposal method can be considered as dispersal, containment or elimination of the wastes, and (3) by the applicability of the disposal method to the possible physical waste forms. A literature survey was performed and pertinent references listed for the various alternatives discussed. A bibliography is given which provides coverage of published information on low-level radioactive waste management options. The extensive list of disposal alternatives identified was screened and the most viable choices were selected for further evaluation. A Technical Advisory Panel met and reviewed the results. Suggestions from that meeting and other comments are discussed. The most viable options selected for further evaluation are: (1) improving present shallow land burial practices; (2) deeper depth burial; (3) disposal in cavities; (4) disposal in exposed or buried structures; and (5) ocean disposal. 42 references

  3. Screening natural antioxidants in peanut shell using DPPH-HPLC-DAD-TOF/MS methods.

    Science.gov (United States)

    Qiu, Jiying; Chen, Leilei; Zhu, Qingjun; Wang, Daijie; Wang, Wenliang; Sun, Xin; Liu, Xiaoyong; Du, Fangling

    2012-12-15

    Peanut shell, a byproduct in oil production, is rich in natural antioxidants. Here, a rapid and efficient method using DPPH-HPLC-DAD-TOF/MS was used for the first time to screen antioxidants in peanut shell. The method is based on the hypothesis that upon reaction with 1, 1-diphenyl-2-picrylhydrazyl (DPPH), the peak areas of compounds with potential antioxidant activities in the HPLC chromatogram will be significantly reduced or disappeared, and the identity confirmation could be achieved by HPLC-DAD-TOF/MS technique. With this method, three compounds possessing potential antioxidant activities were found abundantly in the methanolic extract of peanut shell. They were identified as 5,7-dihydroxychromone, eriodictyol, and luteolin. The contents of these compounds were 0.59, 0.92, and 2.36 mg/g, respectively, and luteolin possessed the strongest radical scavenging capacity. DPPH-HPLC-DAD-TOF/MS assay facilitated rapid identification and determination of natural antioxidants in peanut shell, which may be helpful for value-added utilization of peanut processing byproducts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  5. Confidence from uncertainty - A multi-target drug screening method from robust control theory

    Directory of Open Access Journals (Sweden)

    Petzold Linda R

    2010-11-01

    Full Text Available Abstract Background Robustness is a recognized feature of biological systems that evolved as a defence to environmental variability. Complex diseases such as diabetes, cancer, bacterial and viral infections, exploit the same mechanisms that allow for robust behaviour in healthy conditions to ensure their own continuance. Single drug therapies, while generally potent regulators of their specific protein/gene targets, often fail to counter the robustness of the disease in question. Multi-drug therapies offer a powerful means to restore disrupted biological networks, by targeting the subsystem of interest while preventing the diseased network from reconciling through available, redundant mechanisms. Modelling techniques are needed to manage the high number of combinatorial possibilities arising in multi-drug therapeutic design, and identify synergistic targets that are robust to system uncertainty. Results We present the application of a method from robust control theory, Structured Singular Value or μ- analysis, to identify highly effective multi-drug therapies by using robustness in the face of uncertainty as a new means of target discrimination. We illustrate the method by means of a case study of a negative feedback network motif subject to parametric uncertainty. Conclusions The paper contributes to the development of effective methods for drug screening in the context of network modelling affected by parametric uncertainty. The results have wide applicability for the analysis of different sources of uncertainty like noise experienced in the data, neglected dynamics, or intrinsic biological variability.

  6. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  7. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  8. Bootstrapping conformal field theories with the extremal functional method.

    Science.gov (United States)

    El-Showk, Sheer; Paulos, Miguel F

    2013-12-13

    The existence of a positive linear functional acting on the space of (differences between) conformal blocks has been shown to rule out regions in the parameter space of conformal field theories (CFTs). We argue that at the boundary of the allowed region the extremal functional contains, in principle, enough information to determine the dimensions and operator product expansion (OPE) coefficients of an infinite number of operators appearing in the correlator under analysis. Based on this idea we develop the extremal functional method (EFM), a numerical procedure for deriving the spectrum and OPE coefficients of CFTs lying on the boundary (of solution space). We test the EFM by using it to rederive the low lying spectrum and OPE coefficients of the two-dimensional Ising model based solely on the dimension of a single scalar quasiprimary--no Virasoro algebra required. Our work serves as a benchmark for applications to more interesting, less known CFTs in the near future.

  9. Screening effects in a polyelectrolyte brush: self-consistent-field theory

    NARCIS (Netherlands)

    Zhulina, E.B.; Klein Wolterink, J.; Borisov, O.V.

    2000-01-01

    We have developed an analytical self-consistent-field (SCF) theory describing conformations of weakly charged polyelectrolyte chains tethered to the solid-liquid interface and immersed in a solution of low molecular weight salt. Depending on the density of grafting of the polyelectrolytes to the

  10. Screening and selection of most potent diazotrophic cyanobacterial isolate exhibiting natural tolerance to rice field herbicides for exploitation as biofertilizer.

    Science.gov (United States)

    Singh, Surendra; Datta, Pallavi

    2006-01-01

    Periodic applications of heavy dosages of herbicides in modern rice-agriculture are a necessary evil for obtaining high crop productivity. Such herbicides are not only detrimental to weeds but biofertilizer strains of diazotrophic cyanobacteria also. It is therefore, essential to screen and select such biofertilizer strains of diazotrophic cyanobacteria exhibiting natural tolerance to common rice-field herbicides that can be further improved by mutational techniques to make biofertilizer technology a viable one. Therefore, efforts have been made to screen five dominant diazotrophic cyanobacterial forms e.g. filamentous heterocystous Nostoc punctiforme , Nostoc calcicola , Anabaena variabilis and unicellular Gloeocapsa sp. and Aphanocapsa sp. along with standard laboratory strain Nostoc muscorum ISU against increasing concentrations (0-100 mg l(-1) of four commercial grade common rice-field herbicides i.e. Arozin, Butachlor, Alachlor and 2,4-D under diazotrophic growth conditions. The lethal and IGC(50) concentrations for all four herbicides tested were found highest for A. variabilis as compared to other test cyanobacteria. The lowest reduction in chlorophyll a content, photosynthetic oxygen evolution, and N(2)-fixation was found in A. variabilis as compared to other rice field isolates and standard laboratory strain N. muscorum ISU. On the basis of prolong survival potential and lowest reductions in vital metabolic activities tested at IGC(50) concentration of four herbicides, it is concluded that A. variabilis is the most potent and promising cyanobacterial isolate as compared with other forms. This could be further improved by mutational techniques for exploitation as most potential and viable biofertilizer strain.

  11. Method and apparatus for measuring weak magnetic fields

    DEFF Research Database (Denmark)

    1995-01-01

    When measuring weak magnetic fields, a container containing a medium, such as a solution containing a stable radical, is placed in a polarising magnetic field, which is essentially at right angles to the field to be measured. The polarising field is interrupted rapidly, the interruption being...

  12. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  13. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  14. Screening for Microalbuminuria in the early detection of diabetic nephropathy: A cheap and simple method

    Directory of Open Access Journals (Sweden)

    "Larijani B

    2002-06-01

    Full Text Available Prompt detection of renal involvement through evaluation of microalbuminuria can both reduce mortality in diabetic patients and significantly reduce the cost of managing these patients. To this end, Micral test strips have been used as a screeing tool in this group of patients though not yet in our country. The present study aimed to evaluate this test and to abtain a simpler and less expensive method of screening for microlbuminuria. In this study, 200 type 1 and type 2 diabetic patients referred to the Endocrine & Metabolims Research Center of the Tehran university of medical Sciences were evaluated for microabluminuria. Entry criteria consisted of a history of recognized diabetes longer than or equal to 5 years. Exclusion criteria included development of urinary tract infection, pyrexia, and a history of uncontrolled hypertension. Every patient first completed a data questionnaire and then provided a first-void urine sample, which was tested for microalbuminuria with a urinary protein test strip (an Iranian-made Uri-Yab and a German-made BM-test-GP strip and the sulphasalicylic acid chemical method. Negative samples were tested further using Micral test strips (based on gold-lable immunochromatograpy and the microalbumin measurement kit manufactured by Dako. Germany (based on turbidometry using a Hitachi autoanalyser. 126 women and 74 men were recruited into the study. The average age of the sample was 40.7 years (range=16 to 63 years; 17 patients had IDDM and 173, NIDDM. Average duration of recognized diabetes was 8.75 years. Based on results obtained using chemical analysis and foreign-made tests strips, 46 patients (23% had macroalbuminuria, though the detection rate using Iranian-made test strips was 18 percent (36 patients. A further 16.2 percent of patients had microalbuminuria, with an average urinary albumin excertion of 28.7 mg per liter. Compared with colorimetric methos, the Micral test yieled a sensitivity of 93% and a specificity

  15. Low field orientation magnetic separation methods for magnetotactic bacteria

    International Nuclear Information System (INIS)

    Moeschler, F.D.

    1999-01-01

    Microbial biomineralisation of iron often results in a biomass that is magnetic and can be separated from water systems by the application of a magnetic field. Magnetotactic bacteria form magnetic membrane bound crystals within their structure, generally of magnetite. In nature, this enables magnetotactic bacteria to orientate themselves with respect to the local geomagnetic field. The bacteria then migrate with flagellar driven motion towards their preferred environment. This property has been harnessed to produce a process in which metal loaded magnetotactic bacteria can be recovered from a waste stream. This process is known as orientation magnetic separation. Several methods exist which permit the unique magnetic properties of individual magnetotactic bacteria to be studied, such as U-turn analysis, transmission electron microscopy and single wire cell studies. In this work an extension of U-turn analysis was developed. The bacteria were rendered non-motile by the addition of specific metal ions and the resulting 'flip time' which occurs during a field reversal enabled the magnetic moment of individual bacteria to be determined. This method proved to be much faster and more accurate than previous methods. For a successful process to be developed, large scale culturing of magnetotactic bacteria is required Experiments showed that culture vessel geometry was an important factor for high-density growth. Despite intensive studies reproducible culturing at volumes exceeding one litre was not achieved. This work showed that numerous metal ions rendered magnetotactic bacteria non-motile at concentrations below 10 ppm. Sequential adaptation raised typical levels to in excess of 100 ppm for a number of ions. such as zinc and tin. However, specific ions. such as copper or nickel, remained motility inhibiting at lower concentrations. To achieve separation using orientation magnetic separation, motile, field susceptible MTB are required. Despite successful adaptation, the

  16. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    OpenAIRE

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning ...

  17. How to benchmark methods for structure-based virtual screening of large compound libraries.

    Science.gov (United States)

    Christofferson, Andrew J; Huang, Niu

    2012-01-01

    Structure-based virtual screening is a useful computational technique for ligand discovery. To systematically evaluate different docking approaches, it is important to have a consistent benchmarking protocol that is both relevant and unbiased. Here, we describe the designing of a benchmarking data set for docking screen assessment, a standard docking screening process, and the analysis and presentation of the enrichment of annotated ligands among a background decoy database.

  18. Selected Tools and Methods from Quality Management Field

    Directory of Open Access Journals (Sweden)

    Kateřina BRODECKÁ

    2009-06-01

    Full Text Available Following paper describes selected tools and methods from Quality management field and their practical applications on defined examples. Solved examples were elaborated in the form of electronic support. This in detail elaborated electronic support provides students opportunity to thoroughly practice specific issues, help them to prepare for exams and consequently will lead to education improvement. Especially students of combined study form will appreciate this support. The paper specifies project objectives, subjects that will be covered by mentioned support, target groups, structure and the way of elaboration of electronic exercise book in view. The emphasis is not only on manual solution of selected examples that may help students to understand the principles and relationships, but also on solving and results interpreting of selected examples using software support. Statistic software Statgraphics Plus v 5.0 is used while working support, because it is free to use for all students of the faculty. Exemplary example from the subject Basic Statistical Methods of Quality Management is also part of this paper.

  19. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  20. Field screening of experimental corn hybrids and inbred lines for multiple ear-feeding insect resistance.

    Science.gov (United States)

    Ni, Xinzhi; Xu, Wenwei; Krakowsky, Matthew D; Buntin, G David; Brown, Steve L; Lee, R Dewey; Coy, Anton E

    2007-10-01

    Identifying and using native insect resistance genes is the core of integrated pest management. In this study, 10 experimental corn, Zea mays L., hybrids and 10 inbred lines were screened for resistance to major ear-feeding insects in the southeastern Coastal Plain region of the United States during 2004 and 2005. Ear-feeding insect damage was assessed at harvest by visual damage rating for the corn earworm, Helicoverpa zea (Boddie), and by the percentage of kernels damaged by the maize weevil, Sitophilus zeamais Motschulsky, and stink bugs [combination of Euschistus servus (Say) and southern green stink bug, Nezara viridula (L.)]. Among the eight inbred lines and two control populations examined, C3S1B73-5b was resistant to corn earworm, maize weevil, and stink bugs. In contrast, C3S1B73-4 was resistant to corn earworm and stink bugs, but not to maize weevil. In a similar manner, the corn hybrid S1W*CML343 was resistant to all three ear-feeding insects, whereas hybrid C3S1B73-3*Tx205 was resistant to corn earworm and maize weevil in both growing seasons, but susceptible to stink bugs in 2005. The silk-feeding bioassay showed that corn earworm developed better on corn silk than did fall armyworm. Among all phenotypic traits examined (i.e., corn ear size, husk extension, and husk tightness), only corn ear size was negatively correlated to corn earworm damage in the inbred lines examined, whereas only husk extension (i.e., coverage) was negatively correlated to both corn earworm and maize weevil damage on the experimental hybrids examined. Such information could be used to establish a baseline for developing agronomically elite corn germplasm that confers multiple ear-feeding insect resistance.

  1. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  2. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  3. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  4. A rapid sample screening method for authenticity control of whiskey using capillary electrophoresis with online preconcentration.

    Science.gov (United States)

    Heller, Melina; Vitali, Luciano; Oliveira, Marcone Augusto Leal; Costa, Ana Carolina O; Micke, Gustavo Amadeu

    2011-07-13

    The present study aimed to develop a methodology using capillary electrophoresis for the determination of sinapaldehyde, syringaldehyde, coniferaldehyde, and vanillin in whiskey samples. The main objective was to obtain a screening method to differentiate authentic samples from seized samples suspected of being false using the phenolic aldehydes as chemical markers. The optimized background electrolyte was composed of 20 mmol L(-1) sodium tetraborate with 10% MeOH at pH 9.3. The study examined two kinds of sample stacking, using a long-end injection mode: normal sample stacking (NSM) and sample stacking with matrix removal (SWMR). In SWMR, the optimized injection time of the samples was 42 s (SWMR42); at this time, no matrix effects were observed. Values of r were >0.99 for the both methods. The LOD and LOQ were better than 100 and 330 mg mL(-1) for NSM and better than 22 and 73 mg L(-1) for SWMR. The CE-UV reliability in the aldehyde analysis in the real sample was compared statistically with LC-MS/MS methodology, and no significant differences were found, with a 95% confidence interval between the methodologies.

  5. Screening and comparison of remedial alternatives for the South Field and flyash piles at the Fernald site

    International Nuclear Information System (INIS)

    Bumb, A.C.; Jones, G.N.

    1996-05-01

    The South Field, the Inactive Flyash Pile, and the Active Flyash Pile are in close proximity to each other and are part of Operable Unit 2 (OU2) at the Fernald Environmental Management Project (FEMP). The baseline risk assessment indicated that the exposure pathways which pose the most significant risk are external radiation from radionuclides in surface soils and use of uranium contaminated groundwater. This paper presents screening and comparison of various remedial alternatives considered to mitigate risks from the groundwater pathway. Eight remedial alternatives were developed which consisted of consolidation and capping, excavation and off-site disposal with or without treatment, excavation and on-site disposal with or without treatment and combinations of these. Risk-based source (soil) preliminary remediation levels (PRLs) and waste acceptance criteria (WACs) were developed for consolidation and capping, excavation, and on-site disposal cell. The PRLs and WACs were developed using an integrated modeling tool consisting of an infiltration model, a surface water model, a vadose zone model, and a three-dimensional contaminant migration model in saturated media. The PRLs and WACs were then used to determine need for soil treatment, determine excavation volumes, and screen remedial alternatives. The selected remedial alternative consisted of excavation and on-site disposal with off-site disposal of the fraction exceeding the WAC

  6. Follow-up and Final Results of the Oslo I Study Comparing Screen-Film Mammography and Full-field Digital Mammography with Soft-Copy Reading

    International Nuclear Information System (INIS)

    Skaane, P.; Skjennald, A.; Young, K.

    2005-01-01

    Purpose: To compare cancer detection rates of screen-film (SFM) and full-field digital mammography (FFDM) with soft-copy reading in a screening program including the initial positive scores for interval cancers and cancers in the subsequent screening round, and to analyze the false-negative FFDM interpretations. Material and Methods: Using a paired study design, 3683 women underwent SFM and FFDM in a population-based screening program. Two standard views of each breast were acquired. The images were interpreted without previous films for comparison. Independent double reading using a 5-point rating scale for probability of cancer was used for each modality. An examination was defined as positive if at least one of the two independent readers scored 2 or higher on the 5-point rating scale. SFM-positive cases were discussed in a SFM consensus meeting and FFDM-positive cases in a separate FFDM consensus meeting before recall. The study population was followed for more than 2 years so that interval cancers and screen-detected cancers in the subsequent screening round could be included. Cancer detection rates were compared using the McNemar test for paired proportions. The kappa statistic and Wilcoxon signed-rank test for matched pairs were used for comparing rating scores. The reading time was recorded for all FFDM interpretations. Results: A total of 31 cancers (detection rate 0.84%) were diagnosed initially, of which SFM detected 28 and FFDM 23 (McNemar test P 0.23, discordant pair 8 and 3). Two cancers with a positive score at initial SFM reading and three with a positive score at initial FFDM reading were dismissed at SFM and FFDM consensus meetings, respectively. The difference in cancer detection after recall (discordant pair 11 and 5) was not significant (McNemar test, P = 0.21). Of the 10 interval cancers and 16 screen-detected cancers in the subsequent round, 3 had true-positive SFM scores while 4 had true-positive FFDM scores in the initial reading session. A

  7. Follow-up and Final Results of the Oslo I Study Comparing Screen-Film Mammography and Full-field Digital Mammography with Soft-Copy Reading

    Energy Technology Data Exchange (ETDEWEB)

    Skaane, P.; Skjennald, A.; Young, K. [Ullevaal Univ. Hospital, Oslo (Norway). Dept. of Radiology] [and others

    2005-11-01

    Purpose: To compare cancer detection rates of screen-film (SFM) and full-field digital mammography (FFDM) with soft-copy reading in a screening program including the initial positive scores for interval cancers and cancers in the subsequent screening round, and to analyze the false-negative FFDM interpretations. Material and Methods: Using a paired study design, 3683 women underwent SFM and FFDM in a population-based screening program. Two standard views of each breast were acquired. The images were interpreted without previous films for comparison. Independent double reading using a 5-point rating scale for probability of cancer was used for each modality. An examination was defined as positive if at least one of the two independent readers scored 2 or higher on the 5-point rating scale. SFM-positive cases were discussed in a SFM consensus meeting and FFDM-positive cases in a separate FFDM consensus meeting before recall. The study population was followed for more than 2 years so that interval cancers and screen-detected cancers in the subsequent screening round could be included. Cancer detection rates were compared using the McNemar test for paired proportions. The kappa statistic and Wilcoxon signed-rank test for matched pairs were used for comparing rating scores. The reading time was recorded for all FFDM interpretations. Results: A total of 31 cancers (detection rate 0.84%) were diagnosed initially, of which SFM detected 28 and FFDM 23 (McNemar test P 0.23, discordant pair 8 and 3). Two cancers with a positive score at initial SFM reading and three with a positive score at initial FFDM reading were dismissed at SFM and FFDM consensus meetings, respectively. The difference in cancer detection after recall (discordant pair 11 and 5) was not significant (McNemar test, P = 0.21). Of the 10 interval cancers and 16 screen-detected cancers in the subsequent round, 3 had true-positive SFM scores while 4 had true-positive FFDM scores in the initial reading session. A

  8. Spatial screening methods for evaluating environmental contaminant hazards and exposure vulnerability

    Science.gov (United States)

    Jones, D. K.

    2016-12-01

    Human and biotic communities are becoming increasingly vulnerable to sea-level rise and severe storms due to climate change. These events enhance the dispersion and concentration of natural and anthropogenic chemicals and pathogenic microorganisms, which could adversely impact the health and resilience of coastal communities and ecosystems in coming years. The U.S. Geological Survey (USGS) has developed spatial screening methods to identify and map contaminant sources and potential exposure pathways for human and ecological receptors. These methods have been applied within the northeastern U.S. to document contaminants of emerging concern, highlight vulnerable communities, and prioritize locations for future sampling campaigns. Integration of this information provides a means to better assess the baseline status of a complex system and the significance of changes in contaminant hazards due to storm-induced (episodic) and sea-level rise (incremental) disturbances. This presentation will provide an overview of a decision support tool developed by the USGS to document contaminants in the environment relative to key receptor populations and historic storm vulnerabilities. The support tool is designed to accommodate a broad array of geologic, land-use, and climatic variables and utilizes public, nationally available data sources to define contaminant sources and storm vulnerabilities. By employing a flexible and adaptable strategy built upon publicly available data, the method can readily be applied to other site selection or landscape evaluation efforts. Examples will be presented including the Sediment-bound Contaminant Resiliency and Response pilot study (see http://toxics.usgs.gov/scorr/), and investigations of endocrine disruption in the Chesapeake Bay. Key limitations and future applications will be discussed in addition to ongoing method developments to accommodate non-coastal disaster scenarios and more refined contaminant definitions.

  9. Expanding sexually transmitted infection screening among women and men engaging in transactional sex: the feasibility of field-based self-collection.

    Science.gov (United States)

    Roth, A M; Rosenberger, J G; Reece, M; Van Der Pol, B

    2013-04-01

    Routine screening is a key component of sexually transmitted infection (STI) prevention and control; however, traditional programmes often fail to effectively reach men and women in hidden communities. To reduce prevalence, we must understand the programmatic features that would encourage utilization of services among asymptomatic individuals. Using incentivized snowball sampling, 44 women and men recently engaging in transactional sex were recruited (24 women, 20 men); median age 37 years. Respondents were offered the opportunity to collect genital, oropharyngeal and rectal samples for STI testing and completed a face-to-face interview about their experience with self-obtained sampling. Interviews were analysed using qualitative methods. Participants were unaware of potential risk for STI, but found self-sampling in non-clinical settings to be acceptable and preferable to clinic-based testing. All participants collected genital specimens; 96% and 4% collected oropharyngeal and rectal specimens, respectively. The burden of disease in this population was high: 38% tested positive for at least one STI. We detected multiple concomitant infections. Incorporating field collection of self-obtained samples into STI control programmes may increase utilization among high-risk populations unlikely to access clinic-based services. High infection rates indicate that individuals engaging in transactional sex would benefit from, and be responsive to, community-based self-sampling for STI screening.

  10. Method for increasing the resistance of a plant or a part thereof to a pathogen, method for screening the resistance of a plant or part thereof to a pathogen, and use thereof

    OpenAIRE

    Wit, de, P.; Stergiopoulos, I.; Kema, G.H.J.

    2011-01-01

    (EN)The present invention relates to the field of plant biotechnology. More in particular, the present invention relates to methods for increasing the resistance of a plant or part thereof that is susceptible to infection with a pathogen comprising an ortholog of the Avr4 protein of Cladosporium fulvum, wherein said plant is not a tomato or tobacco plant. The invention also relates to methods for screening the resistance of a plant or a part thereof to at least one pathogen, wherein said path...

  11. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  12. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  13. Evaluation of different field methods for measuring soil water infiltration

    Science.gov (United States)

    Pla-Sentís, Ildefonso; Fonseca, Francisco

    2010-05-01

    Soil infiltrability, together with rainfall characteristics, is the most important hydrological parameter for the evaluation and diagnosis of the soil water balance and soil moisture regime. Those balances and regimes are the main regulating factors of the on site water supply to plants and other soil organisms and of other important processes like runoff, surface and mass erosion, drainage, etc, affecting sedimentation, flooding, soil and water pollution, water supply for different purposes (population, agriculture, industries, hydroelectricity), etc. Therefore the direct measurement of water infiltration rates or its indirect deduction from other soil characteristics or properties has become indispensable for the evaluation and modelling of the previously mentioned processes. Indirect deductions from other soil characteristics measured under laboratory conditions in the same soils, or in other soils, through the so called "pedo-transfer" functions, have demonstrated to be of limited value in most of the cases. Direct "in situ" field evaluations have to be preferred in any case. In this contribution we present the results of past experiences in the measurement of soil water infiltration rates in many different soils and land conditions, and their use for deducing soil water balances under variable climates. There are also presented and discussed recent results obtained in comparing different methods, using double and single ring infiltrometers, rainfall simulators, and disc permeameters, of different sizes, in soils with very contrasting surface and profile characteristics and conditions, including stony soils and very sloping lands. It is concluded that there are not methods universally applicable to any soil and land condition, and that in many cases the results are significantly influenced by the way we use a particular method or instrument, and by the alterations in the soil conditions by the land management, but also due to the manipulation of the surface

  14. Teaching a Student to Read through a Screen: Using SKYPE to Facilitate a Field Experience

    Science.gov (United States)

    Gunther, Jeanne

    2016-01-01

    The Distance Clinical Connecting Candidates and Children (DC4) is an innovative new model for providing a clinical experience in a reading methods course. Pre-service teachers used this model to implement assessments and lessons via SKYPE with local elementary students. I designed this model to provide a clinical experience when faced with…

  15. Proposal of a simple screening method for a rapid preliminary evaluation of ''heavy metals'' mobility in soils of contaminated sites

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Valentina; Chiusolo, Francesca; Cremisini, Carlo [ENEA - Italian Agency for New Technologies, Energy and Environment, Rome (Italy). Section PROTCHIM

    2010-09-15

    Risks associated to ''heavy metals'' (HM) soil contamination depend not only on their total content but, mostly, on their mobility. Many extraction procedures have been developed to evaluate HM mobility in contaminated soils, but they are generally time consuming (especially the sequential extraction procedures (SEPs)) and consequently applicable on a limited number of samples. For this reason, a simple screening method, applicable even ''in field'', has been proposed in order to obtain a rapid evaluation of HM mobility in polluted soils, mainly focused on the fraction associated to Fe and Mn oxide/hydroxides. A buffer solution of trisodium citrate and hydroxylamine hydrochloride was used as extractant for a single-step leaching test. The choice of this buffered solution was strictly related to the possibility of directly determining, via titration with dithizone (DZ), the content of Zn, Cu, Pb and Cd, which are among the most representative contaminants in highly mineralised soils. Moreover, the extraction solution is similar, aside from for the pH value, which is the one used in the BCR SEP second step. The analysis of bivalents ions through DZ titration was exploited in order to further simplify and quicken the whole procedure. The proposed method generically measures, in few minutes, the concentration of total extractable ''heavy metals'' expressed as molL{sup -1} without distinguishing between elements. The proposed screening method has been developed and applied on soil samples collected from rural, urban and mining areas, representing different situation of soil contamination. Results were compared with data obtained from the BCR procedure. The screening method demonstrated to be a reliable tool for a rapid evaluation of metals mobility. Therefore, it could be very useful, even ''in field'', both to guide the sampling activity on site and to monitor the efficacy of the subsequent

  16. Electric field control methods for foil coils in high-voltage linear actuators

    NARCIS (Netherlands)

    Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.

    2015-01-01

    This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate

  17. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  18. Electrodeless plasma acceleration system using rotating magnetic field method

    Directory of Open Access Journals (Sweden)

    T. Furukawa

    2017-11-01

    Full Text Available We have proposed Rotating Magnetic Field (RMF acceleration method as one of electrodeless plasma accelerations. In our experimental scheme, plasma generated by an rf (radio frequency antenna, is accelerated by RMF antennas, which consist of two-pair, opposed, facing coils, and these antennas are outside of a discharge tube. Therefore, there is no wear of electrodes, degrading the propulsion performance. Here, we will introduce our RMF acceleration system developed, including the experimental device, e.g., external antennas, a tapered quartz tube, a vacuum chamber, external magnets, and a pumping system. In addition, we can change RMF operation parameters (RMF applied current IRMF and RMF current phase difference ϕ, focusing on RMF current frequency fRMF by adjusting matching conditions of RMF, and investigate the dependencies on plasma parameters (electron density ne and ion velocity vi; e.g., higher increases of ne and vi (∼360 % and 55 %, respectively than previous experimental results were obtained by decreasing fRMF from 5 MHz to 0.7 MHz, whose RMF penetration condition was better according to Milroy’s expression. Moreover, time-varying component of RMF has been measured directly to survey the penetration condition experimentally.

  19. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug