WorldWideScience

Sample records for field screening methods

  1. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  2. Development of colorimetric field screening methods for munitions compounds in soil

    Science.gov (United States)

    Jenkins, Thomas F.; Walsh, Marianne E.; Schumacher, Patricia W.; Thorne, Philip G.

    1995-10-01

    Simple colorimetric tests have been developed to screen for the presence of TNT, TNB, DNT, DNB, tetryl, RDX, HMX, nitroglycerine (NG), PETN, nitrocellulose (NC), nitroguanidine (NQ), picric acid and ammonium picrate in soil. Soils are extracted by manual shaking with acetone. For the nitroaromatics, the extracts are reacted with potassium hydroxide and sodium sulfite to form their colored Janowsky complexes. For RDX, HMX, NG, PETN, NC and NQ, extracts are passed through an anion exchange resin to remove nitrate, and then acidified with acetic acid; the nitramines and nitrate esters are reduced with zinc to form nitrous acid. The nitrous acid is detected by the Griess reaction using a Hach Nitriver 3 powder pillow, which produces a highly colored azo dye. Detection of these analytes can be obtained visually and concentrations estimated from absorbance measurements at 540 nm for TNT, TNB and tetryl, 570 nm for DNTs and DNB, and at 510 nm for RDX, HMX, NG, PETN, NC and NQ. For picric acid/ammonium picrate, the acetone extract is passed through a basic ion-exchange column that retains picrate ion. The column is rinsed with methanol to elute interferences, and the picrate is desorbed with acetone containing several drops of sulfuric acid. The extract is diluted with deionized water, and the concentration of picrate is obtained from the absorbance at 400 nm. Detection limits are about 1 (mu) g/g for all analytes except NG, NC and NQ, which are slightly higher. Results from field screening at a number of sites have been correlated with laboratory analyses for TNT and RDX. The results indicate that the field screening methods do not suffer from false negatives and the rate of false positives is low. Concentration estimates from field screening compared favorably with results from the standard laboratory methods.

  3. Ion mobility spectrometry (IMS) field screening methods and analysis of explosives in contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Avolio, J.; DeBono, R.; Radwanski, P. [Barringer Instruments Inc., New Providence, NJ (United States)

    1995-12-31

    The rapid on-site and lab analysis of soil samples contaminated with DNT, TNT, and RDX is explored with IMS detection and various sample preparation methods. Field screening for explosives is presently time consuming and generates considerable amounts of additional chemical wastes. The field method is also limited in the number of different explosives that can be analyzed. The use of a Barringer Instruments IONSCAN IMS system, which is comprised of a thermal desorption sample introduction system directly plumbed to the IMS reaction region and drift tube assembly permits novel methods of sample prep and sample introduction to be employed. Direct sampling, sample salvation, and sample extraction are all investigated and reported. Benefits of utilizing an IONSCAN in the analysis of soil samples is the ability to simultaneously analyze up to 18 analytes in each sample in 4.8 seconds! Therefore it is feasible to analyze for degradation products as well as the target parent explosive compounds. 10 PPM or better limits of detection are achieved with this methodology and an IONSCAN for DNT, TNT, and RDX. Based on these preliminary results this work is being continued in both the lab and on-site with soil and water samples.

  4. Cost comparison of laboratory methods and four field screening technologies for uranium-contaminated soil

    International Nuclear Information System (INIS)

    Douthat, D.M.; Armstrong, A.Q.

    1994-01-01

    To address the problem of characterizing uranium-contaminated surface soil at federal facilities, the Department of Energy has the development of four uranium field screening technologies, under the direction of the Uranium-in-Soils Integrated Demonstration (USID) Program. These four technologies include: a long-range alpha detector a beta scintillation detector, an in situ gamma detector, and a mobile laser ablation-inductively coupled plasma/atomic emission spectrometry (LA-ICP/AES) laboratory. As part of the performance assessment for these field screening technologies, cost estimates for the development and operation of each technology were created. A cost study was conducted to compare three of the USID field screening technologies to the use of traditional field surveying equipment to adequately characterize surface soils of a one-acre site. The results indicate that the use of traditional equipment costs more than the in situ gamma detector, but less than the beta scintillation detector and LRAD. The use of traditional field surveying equipment results in cost savings of 4% and 34% over the use of the beta scintillation and LRAD technologies, respectively. A study of single-point surface soil sampling and laboratory analysis costs was also conducted. Operational costs of the mobile LA-ICP/AES laboratory were compared with operational costs of traditional sampling and analysis, which consists of collecting soil samples and conducting analysis in a radiochemical laboratory. The cost study indicates that the use of the mobile LA-ICP/AES laboratory results in cost savings of 23% and 40% over traditional field sampling and laboratory analysis conducted by characterization groups at two DOE facilities

  5. A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

    Directory of Open Access Journals (Sweden)

    Xiling Zou

    Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

  6. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in the field in barley.

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Rengasamy, Pichu; McDonald, Glenn K

    2012-06-01

    Success in breeding crops for yield and other quantitative traits depends on the use of methods to evaluate genotypes accurately under field conditions. Although many screening criteria have been suggested to distinguish between genotypes for their salt tolerance under controlled environmental conditions, there is a need to test these criteria in the field. In this study, the salt tolerance, ion concentrations, and accumulation of compatible solutes of genotypes of barley with a range of putative salt tolerance were investigated using three growing conditions (hydroponics, soil in pots, and natural saline field). Initially, 60 genotypes of barley were screened for their salt tolerance and uptake of Na(+), Cl(-), and K(+) at 150 mM NaCl and, based on this, a subset of 15 genotypes was selected for testing in pots and in the field. Expression of salt tolerance in saline solution culture was not a reliable indicator of the differences in salt tolerance between barley plants that were evident in saline soil-based comparisons. Significant correlations were observed in the rankings of genotypes on the basis of their grain yield production at a moderately saline field site and their relative shoot growth in pots at EC(e) 7.2 [Spearman's rank correlation (rs)=0.79] and EC(e) 15.3 (rs=0.82) and the crucial parameter of leaf Na(+) (rs=0.72) and Cl(-) (rs=0.82) concentrations at EC(e) 7.2 dS m(-1). This work has established screening procedures that correlated well with grain yield at sites with moderate levels of soil salinity. This study also showed that both salt exclusion and osmotic tolerance are involved in salt tolerance and that the relative importance of these traits may differ with the severity of the salt stress. In soil, ion exclusion tended to be more important at low to moderate levels of stress but osmotic stress became more important at higher stress levels. Salt exclusion coupled with a synthesis of organic solutes were shown to be important components of

  7. A comparison of hydroponic and soil-based screening methods to identify salt tolerance in the field in barley

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Rengasamy, Pichu; McDonald, Glenn K.

    2012-01-01

    Success in breeding crops for yield and other quantitative traits depends on the use of methods to evaluate genotypes accurately under field conditions. Although many screening criteria have been suggested to distinguish between genotypes for their salt tolerance under controlled environmental conditions, there is a need to test these criteria in the field. In this study, the salt tolerance, ion concentrations, and accumulation of compatible solutes of genotypes of barley with a range of putative salt tolerance were investigated using three growing conditions (hydroponics, soil in pots, and natural saline field). Initially, 60 genotypes of barley were screened for their salt tolerance and uptake of Na+, Cl–, and K+ at 150 mM NaCl and, based on this, a subset of 15 genotypes was selected for testing in pots and in the field. Expression of salt tolerance in saline solution culture was not a reliable indicator of the differences in salt tolerance between barley plants that were evident in saline soil-based comparisons. Significant correlations were observed in the rankings of genotypes on the basis of their grain yield production at a moderately saline field site and their relative shoot growth in pots at ECe 7.2 [Spearman’s rank correlation (rs)=0.79] and ECe 15.3 (rs=0.82) and the crucial parameter of leaf Na+ (rs=0.72) and Cl– (rs=0.82) concentrations at ECe 7.2 dS m−1. This work has established screening procedures that correlated well with grain yield at sites with moderate levels of soil salinity. This study also showed that both salt exclusion and osmotic tolerance are involved in salt tolerance and that the relative importance of these traits may differ with the severity of the salt stress. In soil, ion exclusion tended to be more important at low to moderate levels of stress but osmotic stress became more important at higher stress levels. Salt exclusion coupled with a synthesis of organic solutes were shown to be important components of salt

  8. A field screening method using earthworms (Eisenia foetida andrei) to evaluate contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Wilborn, D.C.; Bollman, M.A.; Gillett, C.S.; Ott, S.L.; Linder, G.L. [Takena Ecological Services, Inc., Corvallis, OR (United States)

    1997-09-01

    An on-site biological assessment for soil toxicity was performed using a lumbricid earthworm, Eisenia foetida andrei, at the Milltown Reservoir Superfund Site on the Clark Fork River near Missoula, MT. The assessment provided an opportunity to evaluate test containers and methodologies. Sixty-four field test stations, each consisting of three test containers of site soil, a control container of artificial soil, and a container to house soil moisture and temperature recording devices, were used. Laboratory tests were conducted on soil samples from selected field stations. The test containers were constructed from sections of polyvinyl chloride pipe and were found to be suitable in preventing escape of test organisms and damage by animals. The site soils had levels of arsenic, lead, cadmium, copper, and zinc higher than those in surrounding watersheds. Combined mortality for exposure to the site soil was similar in both the laboratory and field tests. Combined sublethal responses to the site soil were also similar in both laboratory and field tests. Artificial soil controls in both field and laboratory tests resulted in combined mortality rates of 1% or less. The methodologies employed proved successful in maintaining an adequate soil moisture level and allowed for measurement of soil temperature.

  9. Field screening for hexavalent chromium in soil: A fast-turnaround field method based on water extraction

    International Nuclear Information System (INIS)

    McCain, R.G.; Baechler, M.A.

    1994-01-01

    Sodium dichromate has been identified as a contaminant of concern at several waste sites on the Hanford Site. Although chromium standards for soil are typically stated in terms of total chrome, much of the toxicity and carcinogenicity are attributed to the hexavalent state, which typically exists as a relatively mobile anion. Investigation and removal of crushed drums potentially containing residual sodium dichromate required a field test for hexavalent chromium to support characterization and remediation activities. Previous experience with a commercially available field test kit had been unsuccessful. This stimulated an effort to determine potential sources of error in the field test and led to a number of modifications that significantly improved the reliability of the test

  10. Allergic sensitization: screening methods

    DEFF Research Database (Denmark)

    Ladics, Gregory S.; Fry, Jeremy; Goodman, Richard

    2014-01-01

    potential of a novel protein. However, they would be extremely useful in the discovery and research phases of understanding the mechanisms of food allergy development, and may prove fruitful to provide information regarding potential allergenicity risk assessment of future products on a case by case basis......Experimental in silico, in vitro, and rodent models for screening and predicting protein sensitizing potential are discussed, including whether there is evidence of new sensitizations and allergies since the introduction of genetically modified crops in 1996, the importance of linear versus...... conformational epitopes, and protein families that become allergens. Some common challenges for predicting protein sensitization are addressed: (a) exposure routes; (b) frequency and dose of exposure; (c) dose-response relationships; (d) role of digestion, food processing, and the food matrix; (e) role...

  11. FIELD SCREENING FOR HALOGENATED VOLATILE ORGANIC COMPOUNDS

    Energy Technology Data Exchange (ETDEWEB)

    John F. Schabron; Joseph F. Rovani Jr.; Theresa M. Bomstad

    2002-06-01

    Western Research Institute (WRI) initiated exploratory work towards the development of new field screening methodology and a test kit to measure halogenated volatile organic compounds (VOCs) in the field. Heated diode and corona discharge sensors are commonly used to detect leaks of refrigerants from air conditioners, freezers, and refrigerators. They are both selective to the presence of carbon-halogen bonds. Commercially available heated diode and corona discharge leak detectors were procured and evaluated for halogenated VOC response. The units were modified to provide a digital readout of signal related to VOC concentration. Sensor response was evaluated with carbon tetrachloride and tetrachloroethylene (perchloroethylene, PCE), which represent halogenated VOCs with and without double bonds. The response characteristics were determined for the VOCs directly in headspace in Tedlar bag containers. Quantitation limits in air were estimated. Potential interferences from volatile hydrocarbons, such as toluene and heptane, were evaluated. The effect of humidity was studied also. The performance of the new devices was evaluated in the laboratory by spiking soil samples and monitoring headspace for halogenated VOCs. A draft concept of the steps for a new analytical method was outlined. The results of the first year effort show that both devices show potential utility for future analytical method development work towards the goal of developing a portable test kit for screening halogenated VOCs in the field.

  12. Walkthrough screening evaluation field guide

    International Nuclear Information System (INIS)

    Eder, S.J.; Eli, M.W.; Salmon, M.W.

    1993-11-01

    The US Department of Energy (DOE) has a large inventory of existing facilities. Many of these facilities were not designed and constructed to current natural phenomena hazard (NPH) criteria. The NPH events include earthquakes, extreme winds and tornadoes, and floods. DOE Order 5480.28 establishes policy and requirements for NPH mitigation for DOE facilities. DOE is conducting a multiyear project to develop evaluation guidelines for assessing the condition and determining the need for upgrades at DOE facilities. One element of the NPH evaluation guidelines' development involves the existing systems and components at DOE facilities. This effort is described in detail in a cited reference. In the interim period prior to availability of the final guidelines, DOE facilities are encouraged to implement an NPH walk through screening evaluation process by which systems and components that need attention can be rapidly identified. Guidelines for conducting the walk through screening evaluations are contained herein. The result of the NPH walk through screening evaluation should be a prioritized list of systems and components that need further action. Simple and inexpensive fixes for items identified in the walk through as marginal or inadequate should be implemented without further study. By implementing an NPH walk through screening evaluation, DOE facilities may realize significant reduction in risk from NPH in the short term

  13. Methods for Screening Live Cells.

    Science.gov (United States)

    Gordeev, A A; Chetverin, A B

    2018-01-01

    Cell screening or, in other words, identification of cells with certain properties is now increasingly used in scientific and medical research, e.g., in diagnostics, drug testing, and production of cell clones with desired characteristics. In this review, we discuss existing methods of cell screening and their classification according to the cell presentation format. We describe the principles of the one-dimensional and two-dimensional formats and compare the main advantages and drawbacks of these formats. The first part describes the methods based on the 2D-format of cell presentation, when cells are immobilized in the same plane by various techniques. The second part describes the methods of the 1D-screening, when cells are aligned in a line in a stream of fluid and scanned one-by-one while passing through a detector. The final part of the review describes the method of high-performance cell analysis based on the merged gel technique. This technique combines the advantages of both 1D and 2D formats and, according to the authors, might become an effective alternative to many modern methods of cell screening.

  14. Screening vector field modifications of general relativity

    International Nuclear Information System (INIS)

    Beltrán Jiménez, Jose; Delvas Fróes, André Luís; Mota, David F.

    2013-01-01

    A screening mechanism for conformal vector–tensor modifications of general relativity is proposed. The conformal factor depends on the norm of the vector field and makes the field to vanish in high dense regions, whereas drives it to a non-null value in low density environments. Such process occurs due to a spontaneous symmetry breaking mechanism and gives rise to both the screening of fifth forces as well as Lorentz violations. The cosmology and local constraints are also computed

  15. Research and Development of Hazardous/Toxic Waste Analytical Screening Procedures. Available Field Methods for Rapid Screening of Hazardous Waste Materials at Waste Sites (Class A Poisons).

    Science.gov (United States)

    1982-01-01

    Tolerances & exemptions for postharvest use on crops. Phosphine from fumigation with aluminum phosphide : barley 0.14 mg/m 3 ; corn 0.14 m3. popcorn grain 9.14...Pesticide tolerance established under Food Additives Amendment of 1958. As fumigant when derived from aluminum phosphide , in or on animal feeds...reaction of aluminum phosphide with water vapor in surrounding air. Bag method: powdered aluminum phosphide packed in moisture permeable paper

  16. FIELD SCREENING FOR HALOGENATED VOLATILE ORGANIC COMPOUNDS

    Energy Technology Data Exchange (ETDEWEB)

    John F. Schabron; Joseph F. Rovani, Jr.; Theresa M. Bomstad

    2003-07-01

    Western Research Institute (WRI) is continuing work toward the development of new screening methodology and a test kit to measure halogenated volatile organic compounds (VOCs) in the field. Heated diode and corona discharge sensors are commonly used to detect leaks of refrigerants from air conditioners, freezers, and refrigerators. They are both selective to the presence of halogens. In prior work, the devices were tested for response to carbon tetrachloride, heptane, toluene, and water vapors. In the current work, sensor response was evaluated with sixteen halogenated VOCs relative to carbon tetrachloride. The results show that the response of the various chlorinated VOCs is within an order of magnitude of the response to carbon tetrachloride for each of the sensors. Thus, for field screening a single response factor can be used. Both types of leak detectors are being further modified to provide an on-board LCD signal readout, which is related to VOC concentration. The units will be fully portable and will operate with 115-V line or battery power. Signal background, noise level, and response data on the Bacharach heated diode detector and the TIF corona discharge detector show that when the response curves are plotted against the log of concentration, the plot is linear to the upper limit for the particular unit, with some curvature at lower levels. When response is plotted directly against concentration, the response is linear at the low end and is curved at the high end. The dynamic ranges for carbon tetrachloride of the two devices from the lower detection limit (S/N=2) to signal saturation are 4-850 vapor parts per million (vppm) for the corona discharge unit and 0.01-70 vppm for the heated diode unit. Additional circuit modifications are being made to lower the detection limit and increase the dynamic response range of the corona discharge unit. The results indicate that both devices show potential utility for future analytical method development work toward

  17. Diffraction method for recording optical wave fields

    Science.gov (United States)

    Stukachev, S. E.; Kozhevatov, I. E.

    2011-09-01

    We propose a method for recording an optical wave field that is based on diffraction of the optical wave field by two screens that are complementary to each other. We show that the new method ensures the measurement of the phase of the wave field with a high accuracy and spatial resolution. An optical scheme for implementing the diffraction method and an algorithm for reconstructing the phase of the wave field from the measurement data are developed. We perform a computer simulation of the experiment on recording the optical wave field based on the method proposed.

  18. Variational methods for field theories

    International Nuclear Information System (INIS)

    Ben-Menahem, S.

    1986-09-01

    Four field theory models are studied: Periodic Quantum Electrodynamics (PQED) in (2 + 1) dimensions, free scalar field theory in (1 + 1) dimensions, the Quantum XY model in (1 + 1) dimensions, and the (1 + 1) dimensional Ising model in a transverse magnetic field. The last three parts deal exclusively with variational methods; the PQED part involves mainly the path-integral approach. The PQED calculation results in a better understanding of the connection between electric confinement through monopole screening, and confinement through tunneling between degenerate vacua. This includes a better quantitative agreement for the string tensions in the two approaches. Free field theory is used as a laboratory for a new variational blocking-truncation approximation, in which the high-frequency modes in a block are truncated to wave functions that depend on the slower background modes (Boron-Oppenheimer approximation). This ''adiabatic truncation'' method gives very accurate results for ground-state energy density and correlation functions. Various adiabatic schemes, with one variable kept per site and then two variables per site, are used. For the XY model, several trial wave functions for the ground state are explored, with an emphasis on the periodic Gaussian. A connection is established with the vortex Coulomb gas of the Euclidean path integral approach. The approximations used are taken from the realms of statistical mechanics (mean field approximation, transfer-matrix methods) and of quantum mechanics (iterative blocking schemes). In developing blocking schemes based on continuous variables, problems due to the periodicity of the model were solved. Our results exhibit an order-disorder phase transition. The transfer-matrix method is used to find a good (non-blocking) trial ground state for the Ising model in a transverse magnetic field in (1 + 1) dimensions

  19. Variational methods for field theories

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Menahem, S.

    1986-09-01

    Four field theory models are studied: Periodic Quantum Electrodynamics (PQED) in (2 + 1) dimensions, free scalar field theory in (1 + 1) dimensions, the Quantum XY model in (1 + 1) dimensions, and the (1 + 1) dimensional Ising model in a transverse magnetic field. The last three parts deal exclusively with variational methods; the PQED part involves mainly the path-integral approach. The PQED calculation results in a better understanding of the connection between electric confinement through monopole screening, and confinement through tunneling between degenerate vacua. This includes a better quantitative agreement for the string tensions in the two approaches. Free field theory is used as a laboratory for a new variational blocking-truncation approximation, in which the high-frequency modes in a block are truncated to wave functions that depend on the slower background modes (Boron-Oppenheimer approximation). This ''adiabatic truncation'' method gives very accurate results for ground-state energy density and correlation functions. Various adiabatic schemes, with one variable kept per site and then two variables per site, are used. For the XY model, several trial wave functions for the ground state are explored, with an emphasis on the periodic Gaussian. A connection is established with the vortex Coulomb gas of the Euclidean path integral approach. The approximations used are taken from the realms of statistical mechanics (mean field approximation, transfer-matrix methods) and of quantum mechanics (iterative blocking schemes). In developing blocking schemes based on continuous variables, problems due to the periodicity of the model were solved. Our results exhibit an order-disorder phase transition. The transfer-matrix method is used to find a good (non-blocking) trial ground state for the Ising model in a transverse magnetic field in (1 + 1) dimensions.

  20. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  1. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  2. LANL seismic screening method for existing buildings

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O. [and others

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method.

  3. Luminescence and fluorometric sensors for environmental field screening

    Energy Technology Data Exchange (ETDEWEB)

    Eastwood, D. [Lockheed Environmental Systems and Technologies Company, Las Vegas, NV (United States)

    1994-12-31

    Several state-of-the-art luminescence (UV-vis fluorescence or phosphorescence) techniques have been studied for environmental field screening applications leading to qualitative (fingerprinting) or quantitative analytical methods for soil or water. A variety of pollutants were analyzed including petroleum oils, fuels and creosotes, polyaromatic hydrocarbons (PAHS), PCBs and pesticides, heavy metals and uranium. A field portable spectrofluorometer developed by ORNL (T. Vo-Dinh and J.P. Alarie), ideal for PAH monitoring, was evaluated using both synchronous and emission techniques. The latest innovative approaches for synchronous and other fluorescence spectroscopic techniques continue to be studied. Feasibility studies were performed for possible substrates and coatings for solid states sensors. Several fluorometric sensors for metals, uranium and other pollutants are currently being developed in collaboration with colleagues at universities and national laboratories and the general approaches will be discussed.

  4. Mechanical behaviour of vacuum chambers and beam screens under quench conditions in dipole and quadrupole fields

    CERN Document Server

    Rathjen, C

    2002-01-01

    A method based on analytical formulas is described to calculate bending moments, stresses, and deformations of vacuum chambers and beam screens in dipole and in quadrupole fields during a magnet quench. Solutions are given for circular and racetrack shaped structures. Without the need of time consuming calculations the solutions enable a quick design and verification of vacuum chambers and beam screens.

  5. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  6. Microfluidic Screening of Electric Fields for Electroporation

    Science.gov (United States)

    Garcia, Paulo A.; Ge, Zhifei; Moran, Jeffrey L.; Buie, Cullen R.

    2016-02-01

    Electroporation is commonly used to deliver molecules such as drugs, proteins, and/or DNA into cells, but the mechanism remains poorly understood. In this work a rapid microfluidic assay was developed to determine the critical electric field threshold required for inducing bacterial electroporation. The microfluidic device was designed to have a bilaterally converging channel to amplify the electric field to magnitudes sufficient to induce electroporation. The bacterial cells are introduced into the channel in the presence of SYTOX®, which fluorescently labels cells with compromised membranes. Upon delivery of an electric pulse, the cells fluoresce due to transmembrane influx of SYTOX® after disruption of the cell membranes. We calculate the critical electric field by capturing the location within the channel of the increase in fluorescence intensity after electroporation. Bacterial strains with industrial and therapeutic relevance such as Escherichia coli BL21 (3.65 ± 0.09 kV/cm), Corynebacterium glutamicum (5.20 ± 0.20 kV/cm), and Mycobacterium smegmatis (5.56 ± 0.08 kV/cm) have been successfully characterized. Determining the critical electric field for electroporation facilitates the development of electroporation protocols that minimize Joule heating and maximize cell viability. This assay will ultimately enable the genetic transformation of bacteria and archaea considered intractable and difficult-to-transfect, while facilitating fundamental genetic studies on numerous diverse microbes.

  7. The Plastic Tension Field Method

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2005-01-01

    . The emphasis is attached to the presentation of a design method based on the diagonal tension field theory. Also, how to determine the load-carrying capacity of a given steel plate girder with transverse web stiffeners, is briefly presented. The load-carrying capacity may be predicted by applying both...... method. The method is based on the theory of plasticity and is analogous to the so-called diagonal compression field method developed for reinforced concrete beams with transverse stirrups, which is adopted in the common European concrete code (Eurocode 2). Many other theories have been developed......, but the method presented differs from these theories by incorporating the strength of the transverse stiffeners and by the assumption that the tensile bands may pass the transverse stiffeners, which often is observed in tests. Other methods have only dealt with a single web field between two stiffeners...

  8. Effect of critical field on screened dielectric breakdown growth

    International Nuclear Information System (INIS)

    Wang Wei.

    1993-10-01

    In this paper we have shown that due to a critical field, the patterns growing in the screened Laplacian field will be affected. When the critical field is zero, there is a transition from a dense growing to single branch of aggregate. At a higher critical field, the pattern shows a spiky-type aggregate, and for a small critical field the transition is cut. For an intermediate critical field, the result shows that below the transition, there no dense structure. (author). 9 refs, 2 figs

  9. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  10. Screening of Geomechanical Risks for Malaysian Development Field

    Directory of Open Access Journals (Sweden)

    Syed Najmuddin Syed Muhammad Syafiq

    2017-01-01

    Full Text Available Deeper drilling and exploitation of difficult reservoir is the new trend in oil and gas industry. Geomechanics study has, therefore, become a new requirement particularly for oil and gas field development. However, a complete geomechanics study is limited with the number of experts, time consuming and not a straightforward task. Therefore, there is an urgent need of a quick geomechanics screening criterion to be used as a standard guideline to evaluate the high level geomechanical risks and suitable analysis can be recommended for the identified development fields. The aim of this paper is to propose a screening criterion for geomechanical risks study based on four key parameters, drilling, depletion, injection and storage and sand production. The screening approach is designed based on Risk Assessment Matrix (RAM risk screening where the likelihood is based on a set of scores developed to specific questions. The consequence for each failure scenarios is assessed based on educated estimation of the impact towards people, asset, environment and reputation. Recommendations for geomechanical study are made based on the severity of each failure category on the RAM risk matrix. Fourteen development fields in offshore Peninsular Malaysia, offshore Sarawak and offshore Sabah are selected for the assessment. Based on results, fields in offshore Sarawak and Sabah have higher potential for geomechacnical issues mainly because of their geological settings and formation characteristics. A set of geomechanical study is proposed for each individual field for prudent management of potential geomechanics risk associated with the depletion and EOR injection scheme planned for the fields.

  11. Analytically approximate screened calculations of atomic-field pair production cross sections

    International Nuclear Information System (INIS)

    Dugne, J.J.

    1976-01-01

    A new method is described to obtain analytically approximate screened cross sections of atomic-field pair production. The Thomas-Fermi-Csavinszky potential model is expanded at the first order and put in the place of the point Coulomb potential in the Dirac equation. That method can be very useful to calculate approximate screened cross sections for the intermediate photon energy range (5m 0 c 2 to about 50m 0 c 2 ) where numerically exact screened cross sections are needing a prohibitive computer time and when the form factor approach based on Born approximation is not always valid. (Auth.)

  12. Subtask 1.11 - Spectroscopic field screening of hazardous waste and toxic spills. Final report

    International Nuclear Information System (INIS)

    Grisanti, A.A.

    1997-10-01

    Techniques for the field characterization of soil contamination due to spillage of hazardous waste or toxic chemicals are time-consuming and expensive. Thus more economical, less time-intensive methods are needed to facilitate rapid field screening of contaminated sites. The overall objective of this project is to study the feasibility of using an evanescent field absorbance sensor Fourier transform infrared spectroscopic sensor coupled with cone penetrometry as a field screening method. The specific objectives of this project are as follows: design an accessory for use with FT-IR that interfaces the spectrometer to a cone penetrometer; characterize the response of the FT-IR accessory to selected hydrocarbons in a laboratory-simulated field environment; and determine the ability of the FT-IR-CPT instrument to measure hydrocarbon contamination in soil by direct comparison with a reference method (e.g., Soxhlet extraction followed by gas chromatography) to quantify hydrocarbons from the same soil

  13. Development of Visual Field Screening Procedures: A Case Study of the Octopus Perimeter.

    Science.gov (United States)

    Turpin, Andrew; Myers, Jonathan S; McKendrick, Allison M

    2016-05-01

    We develop a methodology for designing perimetric screening procedures, using Octopus perimeters as a case study. The process has three stages: analytically determining specificity and number of presentations required for different multisampling suprathreshold schemes at a single location of the visual field, ranking visual field locations by their positive predictive value (PPV) for glaucoma, and determining a pass/fail criteria for the test. For the case study the Octopus G-program visual field test pattern is used, and a dataset of 385 glaucoma and 86 normal patients. Using a 1-of-3 sampling strategy at a level equal to the 95 percentile of normal observers gave the most robust specificity under the influences of false-negative responses using an average of 1.5 presentations per location. The PPV analysis gave 19 locations that completely classified our glaucomatous data. A further 9 points were added to screen for nonglaucomatous loss. The final stage found that insisting that 3 locations are missed for the screening to fail gave a simulated specificity and sensitivity of approximately 95% for unreliable responders. Our method gives a principled approach to choosing between the many parameters of a visual field screening procedure. We have developed a procedure for the Octopus that should terminate in less than 1 minute for normal observers with high specificity and sensitivity to glaucoma. Visual field screening is used in community settings and eye care practice. This study provides a principled approach to the development of such screening procedures and details a new procedure.

  14. Overview of DOE's field screening technology development activities

    International Nuclear Information System (INIS)

    Frank, C.W.; Anderson, T.D.; Cooley, C.R.; Hain, K.E.; Lien, S.C.T.; Erickson, M.D.

    1991-01-01

    The Department of Energy (DOE) has recently created the Office of Environmental Restoration and Waste Management, into which it consolidated those activities. Within this new organization, the Office of Technology Development (OTD) is responsible for research, development, demonstration, testing, and evaluation (RDDT ampersand E) activities aimed at meeting DOE cleanup goals, while minimizing cost and risk. Site characterization using traditional drilling, sampling, and analytical methods comprises a significant part of the environmental restoration efforts in terms of both cost and time to accomplish. It can also be invasive and create additional pathways for spread of contaminants. Consequently, DOE is focusing on site characterization as one of the areas in which significant technological advances are possible which will decrease cost, reduce risk, and shorten schedules for achieving restoration goals. DOE is investing considerably in R ampersand D and demonstration activities which will improve the abilities to screen chemical, radiological, and physical parameters in the field. This paper presents an overview of the program objectives and status and reviews some of the projects which are currently underway in the area. 1 ref

  15. Discretized screening to apply EOR process in Western field, Venezuela

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez, E.; Rodriguez, T.; Gonzalez, O. [PDVSA Petroleos de Venezuela SA, Caracas (Venezuela, Bolivarian Republic of). INTEVEP; Lara, V. [PDVSA Petroleos de Venezuela SA, Caracas (Venezuela, Bolivarian Republic of). CVP

    2009-07-01

    Increases in oil recovery factors through enhanced oil recovery (EOR) technologies has become an important issue in the petroleum industry because of depleting reserves of conventional fossil fuels and the low low mobility of extra heavy oils. Methodologies with different approaches have been developed to define the most suitable technology in specific reservoirs. The purpose of this paper was to determine which EOR technologies were the most appropriate for the entire Urdaneta reservoir in Venezuela, and to determine where the technologies could be applied in terms of reservoir volume. Specifically, the paper described the discretized screening methodology and showed an example of its application in the Urdaneta field. The processing of the static model of this field was described, since this is an input requirement for the EOR screening methodology. Screening results were also analysed and shown as color codes maps. The EOR screening methodology demonstrates that it is possible to evaluate the reservoir using very detailed input information. 4 refs., 3 tabs., 10 figs.

  16. Semiclassical methods in field theories

    International Nuclear Information System (INIS)

    Ventura, I.

    1978-10-01

    A new scheme is proposed for semi-classical quantization in field theory - the expansion about the charge (EAC) - which is developed within the canonical formalism. This method is suitable for quantizing theories that are invariant under global gauge transformations. It is used in the treatment of the non relativistic logarithmic theory that was proposed by Bialynicki-Birula and Mycielski - a theory we can formulate in any number of spatial dimensions. The non linear Schroedinger equation is also quantized by means of the EAC. The classical logarithmic theories - both, the non relativistic and the relativistic one - are studied in detail. It is shown that the Bohr-Sommerfeld quantization rule(BSQR) in field theory is, in many cases, equivalent to charge quantization. This rule is then applied to the massive Thirring Model and the logarithmic theories. The BSQR can be see as a simplified and non local version of the EAC [pt

  17. Diagnostic performance of screening methods for urinary ...

    African Journals Online (AJOL)

    Screening for urinary schistosomiasis has been conducted using various indirect diagnostic tests such as interview technique for unqualified haematuria, terminal haematuria and dysuria, visual examination of urine specimen for macrohaematuria, chemical reagent strip technique for microhaematuria and proteinuria, and.

  18. Development of Visual Field Screening Procedures: A Case Study of the Octopus Perimeter

    OpenAIRE

    Turpin, Andrew; Myers, Jonathan S.; McKendrick, Allison M.

    2016-01-01

    Purpose We develop a methodology for designing perimetric screening procedures, using Octopus perimeters as a case study. Methods The process has three stages: analytically determining specificity and number of presentations required for different multisampling suprathreshold schemes at a single location of the visual field, ranking visual field locations by their positive predictive value (PPV) for glaucoma, and determining a pass/fail criteria for the test. For the case study the Octopus G-...

  19. Methods for Similarity-based Virtual Screening

    Directory of Open Access Journals (Sweden)

    Thomas Greve Kristensen

    2013-02-01

    Full Text Available Developing new medical drugs is expensive. Among the first steps is a screening process, in which molecules in existing chemical libraries are tested for activity against a given target. This requires a lot of resources and manpower. Therefore it has become common to perform a virtual screening, where computers are used for predicting the activity of very large libraries of molecules, to identify the most promising leads for further laboratory experiments. Since computer simulations generally require fewer resources than physical experimentation this can lower the cost of medical and biological research significantly. In this paper we review practically fast algorithms for screening databases of molecules in order to find molecules that are sufficiently similar to a query molecule.

  20. METHODS FOR SIMILARITY-BASED VIRTUAL SCREENING

    Directory of Open Access Journals (Sweden)

    Thomas G. Kristensen

    2013-02-01

    Full Text Available Developing new medical drugs is expensive. Among the first steps is a screening process, in which molecules in existing chemical libraries are tested for activity against a given target. This requires a lot of resources and manpower. Therefore it has become common to perform a virtual screening, where computers are used for predicting the activity of very large libraries of molecules, to identify the most promising leads for further laboratory experiments. Since computer simulations generally require fewer resources than physical experimentation this can lower the cost of medical and biological research significantly. In this paper we review practically fast algorithms for screening databases of molecules in order to find molecules that are sufficiently similar to a query molecule.

  1. Local electric field screening in bi-layer graphene devices

    Directory of Open Access Journals (Sweden)

    Vishal ePanchal

    2014-02-01

    Full Text Available We present experimental studies of both local and macroscopic electrical effects in uniform single- (1LG and bi-layer graphene (2LG devices as well as in devices with non-uniform graphene coverage, under ambient conditions. DC transport measurements on sub-micron scale Hall bar devices were used to show a linear rise in carrier density with increasing amounts of 2LG coverage. Electrical scanning gate microscopy was used to locally top gate uniform and non-uniform devices in order to observe the effect of local electrical gating. We experimentally show a significant level of electric field screening by 2LG. We demonstrate that SGM technique is an extremely useful research tool for studies of local screening effects, which provides a complementary view on phenomena that are usually considered only within a macroscopic experimental scheme.

  2. Qualitative vs. quantitative data: Controls on the accuracy of PID field screening in petroleum contamination assessment applications

    International Nuclear Information System (INIS)

    Luessen, M.J.; Allex, M.K.; Holzel, F.R.

    1995-01-01

    The use of photoionization detectors (PIDs) for field screening of soils for volatile organic contaminants has become a standard industry practice. PID screening data is generally utilized as a qualitative basis for selection of samples for laboratory analysis to quantify concentrations of specific contaminants of concern. Both qualitative field screening data and quantitative laboratory analytical data were reviewed for more than 100 hydrogeologic assessment sites in Ohio to evaluate controls on the effectiveness of field screening data. Assessment data evaluated was limited to sites at which the suspected contaminant source was a gasoline underground storage tanks system. In each case, a 10.0 eV (or greater) PID calibrated for benzene was used to screen soils which were analyzed for benzene, toluene, ethylbenzene and xylene (BTEX) by SW 846 method 8020. Controls on field screening which were evaluated for each site included (1) soil classification, (2) soil moisture, (3) weather conditions, (4) background levels, (5) equipment quality, (6) screening methodology, and (7) laboratory QA/QC. Statistical data analysis predictably indicated a general overestimate of total BTEX levels based on field screening (gasoline is approximately 25 weight percent BTEX). However, data locally indicated cases of both significant (i.e., more than an order of magnitude difference) over- and under-estimation of actual BTEX concentrations (i.e., quantitative laboratory data) by field screening data

  3. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  4. SECURE personnel screening system: field trials and new developments

    Science.gov (United States)

    Smith, Steven W.

    1997-01-01

    Many different techniques have been investigated for detecting weapons, explosives, and contraband concealed under a person's clothing. Most of these are based on imaging the concealed object by using some sort of penetrating radiation, such as microwaves, ultrasound or electromagnetic fields.In spite of this effort by dozens of research groups, the only technique that has resulted in a commercially viable product is back-scatter x-ray imaging, as embodied in the SECURE 1000 personnel screening systems. The SECURE technology uses radiation levels that are insignificant compared to natural background values, being viewed as 'trivial' and 'completely insignificant' under established radiation safety standards. In the five years since the SECURE 1000 was developed, more than a dozen field trials and initial placements have been completed. This paper describes both the capabilities and limitations of the technology in these real-world applications.

  5. Screening for diabetes mellitus in dental practices: a field trial.

    Science.gov (United States)

    Genco, Robert J; Schifferle, Robert E; Dunford, Robert G; Falkner, Karen L; Hsu, William C; Balukjian, James

    2014-01-01

    In this field trial, the authors assess the feasibility of screening for diabetes and prediabetes in dental practices and in a community health center. Dental patients 45 years and older who were not aware of their diabetic status underwent evaluation for diabetes risk with an American Diabetes Association Diabetes Risk Test and with hemoglobin (Hb) A1c measurement. Participants with an HbA1c level of 5.7 percent or greater were referred to their physicians for diagnosis. Of the 1,022 patients screened, 416 (40.7 percent) had an HbA1c blood level of 5.7 percent or greater and were referred for diagnosis. The HbA1c and the American Diabetes Association Diabetes Risk Test were correlated (P dental offices. The diagnoses were diabetes (12.3 percent of patients), high risk of developing diabetes (that is, prediabetes) (23.3 percent) and no diabetes (64.4 percent). The study results show that screening for prediabetes and diabetes is feasible in a dental office, with acceptance by the dentist and dental office staff members, patients' physicians and patients. Patients from the community health center demonstrated good compliance with referrals to physicians; however, compliance was poor among those in the private dental offices. Screening for diabetes and prediabetes in the dental office may provide an important benefit to patients and encourage interprofessional collaboration to achieve a chronic care model in which health care professionals work together to care for a panel of patients.

  6. Efficient Training Methods for Conditional Random Fields

    National Research Council Canada - National Science Library

    Sutton, Charles A

    2008-01-01

    .... In this thesis, I investigate efficient training methods for conditional random fields with complex graphical structure, focusing on local methods which avoid propagating information globally along the graph...

  7. Apparatuses and methods for generating electric fields

    Science.gov (United States)

    Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L

    2013-08-06

    Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.

  8. Field-screening calculations for superconducting tokamak magnets

    International Nuclear Information System (INIS)

    Turner, L.R.; Wang, S.T.; Kim, S.H.

    1978-01-01

    If the polodial-field (PF) coils of a tokamak reactor are placed outside the toroidal-field (TF) coils, the TF coils will be subject to a large (several kilogauss) pulsing field from the PF coils. AC losses in the TF coils would be unacceptably large unless the TF coils were wound of an ac type conductor. Such conductors are typically complicated, expensive, and mechanically weak. Alternatively, each TF coil can be shielded against the pulsed field by surrounding it with a shield of high purity aluminum. The aluminum has a skin depth of 3.1 cm at 18 K and 2.0 cm at 4.2 K, for a fundamental frequency of one pulse per 75 sec, so that a 5 cm thick or 4 cm thick shield should be adequate at these temperatures, respectively. In calculating the eddy current heating of the shield, each Fourier component is considered separately, and the parallel and perpendicular components of field are considered separately. For each component, integration around the TF coil is approximated numerically; then the results are summed. The shield temperature of 18 K was chosen by weighing the resistivity of the aluminum against the efficiency of the refrigeration; in cooling below 18 K, the decreased resistivity of the aluminum is more than offset by the poorer efficiency of refrigeration. Over the inner leg of the TF coils, where space does not permit a separate 18 K cryostat, the shield operates at the same temperature as the TF coil, 4.2 K. Of the several development problems of the aluminum shield, the most severe is probably protecting it from radiation, which would raise its resistivity and impair its screening. Passive superconducting coils are considered as an alternative to the aluminum shield, but they would require even more development work than the aluminum. They might prove especially convenient on the inner legs of the TF coils, where space and radiation effects are most difficult for the aluminum shield. (author)

  9. Queensland Lung Cancer Screening Study: rationale, design and methods.

    Science.gov (United States)

    Marshall, H M; Bowman, R V; Crossin, J; Lau, M A; Slaughter, R E; Passmore, L H; McCaul, E M; Courtney, D A; Windsor, M N; Yang, I A; Smith, I R; Keir, B J; Hayes, T J; Redmond, S J; Zimmerman, P V; Fong, K M

    2013-02-01

    Lung cancer is the leading cause of cancer-related mortality in Australia. Screening using low-dose computed tomography (LDCT) can reduce lung cancer mortality. The feasibility of screening in Australia is unknown. This paper describes the rationale, design and methods of the Queensland Lung Cancer Screening Study. The aim of the study is to describe the methodology for a feasibility study of lung cancer screening by LDCT in Australia. The Queensland Lung Cancer Screening Study is an ongoing, prospective observational study of screening by LDCT at a single tertiary institution. Healthy volunteers at high risk of lung cancer (age 60-74 years; smoking history ≥30 pack years, current or quit within 15 years; forced expiratory volume in 1s ≥50% predicted) are recruited from the general public through newspaper advertisement and press release. Participants receive a LDCT scan of the chest at baseline, year 1 and year 2 using a multidetector helical computed tomography scanner and are followed up for a total of 5 years. Feasibility of screening will be assessed by cancer detection rates, lung nodule prevalence, optimal management strategies for lung nodules, economic costs, healthcare utilisation and participant quality of life. Studying LDCT screening in the Australian setting will help us understand how differences in populations, background diseases and healthcare structures modulate screening effectiveness. This information, together with results from overseas randomised studies, will inform and facilitate local policymaking. © 2012 The Authors; Internal Medicine Journal © 2012 Royal Australasian College of Physicians.

  10. Comparison of domestic violence screening methods: a pilot study.

    Science.gov (United States)

    Furbee, P M; Sikora, R; Williams, J M; Derk, S J

    1998-04-01

    Previous studies have indicated a number of barriers to screening for domestic violence (DV) in an emergency department setting. These barriers result in inconsistencies which determine who is screened as well as the content and quality of the information obtained, and if uncontrolled they are likely to affect measurements of DV incidence in ED populations. The objectives of this project were to design a screening tool that circumvented these barriers and sources of error; to assess whether such an alternative method of screening for DV was acceptable to our patients; and to determine whether the alternative and traditional methods of screening for DV would yield comparable results. Our hypotheses were that the alternative screening tool would be acceptable to our patients and that no significant differences would be found between the two methods. The study took place in a rural, university-affiliated ED with approximately 36,000 annual patient visits. The study population consisted of 186 women older than 18 years of age who were treated by one designated physician. Approximately half of these subjects were screened for DV in a face-to-face interview. The other half listened to a tape-recorded questionnaire and recorded their responses on a coded answer sheet. There were 175 completed screenings. The average age of all respondents was 34 years, and 90 (51%) indicated a cumulative lifetime experience of DV of some sort. Overall, 3% of the respondents indicated they were in the ED for injuries received as a result of DV. No significant differences were found between the two methods of screening for DV on any measurement, including refusals. No problems hearing the tape or understanding the instructions were reported. These results indicate that the alternative method of employing a recorded questionnaire was no less effective than the best efforts of a designated and conscientious physician. As a means of quickly assessing the prevalence of DV in an ED setting, we

  11. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... the municipality of Copenhagen in 1991, in the county of Fyn in 1993 and in the municipality of Frederiksberg in 1994, although reduced mortality in randomised controlled trials does not necessarily mean that screening also works in routine health care. In the rest of Denmark mammography screening was introdueed...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  12. NUMERICAL SIMULATION OF MAGNETIC FIELD STRUCTURE IN CYLINDRICAL FILM SCREEN

    Directory of Open Access Journals (Sweden)

    G. F. Gromyko

    2016-01-01

    Full Text Available A numerical method for solving the boundary value problem for a nonlinear magnetostatic equation describing the external magnetostatic field penetration through the cylindrical film coating is developed. A mathematical model of the shielding problem based on the use of the boundary conditions of the third kind on the film surface is studied. The nonlinear dependence of the film magnetic permeability on magnetic field conforms with experimental data. The distribution of the magnetic field strength in the film layer and the magnetic permeability of the film material depending on the magnitude of the external magnetic field strength are investigated numerically.

  13. Thermography is not a feasible method for breast cancer screening.

    Science.gov (United States)

    Brkljacić, Boris; Miletić, Damir; Sardanelli, Francesco

    2013-06-01

    Breast cancer is a common malignancy causing high mortality in women especially in developed countries. Due to the contribution of mammographic screening and improvements in therapy, the mortality rate from breast cancer has decreased considerably. An imaging-based early detection of breast cancer improves the treatment outcome. Mammography is generally established not only as diagnostic but also as screening tool, while breast ultrasound plays a major role in the diagnostic setting in distinguishing solid lesions from cysts and in guiding tissue sampling. Several indications are established for contrast-enhanced magnetic resonance imaging. Thermography was not validated as a screening tool and the only study performed long ago for evaluating this technology in the screening setting demonstrated very poor results. The conclusion that thermography might be feasible for screening cannot be derived from studies with small sample size, unclear selection of patients, and in which mammography and thermography were not blindly compared as screening modalities. Thermography can not be used to aspirate, biopsy or localize lesions preoperatively since no method so far was described to accurately transpose the thermographic location of the lesion to the mammogram or ultrasound and to surgical specimen. Thermography cannot be proclaimed as a screening method, without any evidence whatsoever.

  14. Screened precession method for area detectors.

    Science.gov (United States)

    Edwards, S L; Nielsen, C; Xuong, N H

    1988-04-01

    A method is presented in which the features of a Buerger-type mechanical precession camera can be simulated using an electronic area detector and a three-circle automated goniostat. The resulting display as viewed on a video monitor is very much like a conventional precession photograph. The detector is stationary which causes a distortion that is negligible for precession angles less than 10 degrees. The virtue of this new method is that a precession image may be collected very fast and the intensities of the reflections when displayed are already digitized. The usefulness of these features is presented through two familiar tasks: the determination of a new protein crystal space group and the evaluation of a heavy-atom derivative.

  15. PHYSICAL FIELDS OF CIRCULAR CYLINDRICAL PIEZOCERAMIC RECEIVER IN PRESENCE OF A FLAT ACOUSTIC SOFT SCREEN

    Directory of Open Access Journals (Sweden)

    A. V. Derepa

    2017-01-01

    Full Text Available System in the form of a circular cylindrical piezoceramic transducer near a flat acoustic screen was analyzed. The aim of the work was to solve the problem of receiving plane sound waves by «cylindrical piezoceramic transducer – flat acoustically soft screen» system.Considered system was characterized by a violation of the radial symmetry of the radiation load of the transducer while maintaining the radial symmetry of the electric load. At the same time, the energy perceived by the system under consideration is distributed between all modes of oscillation of the transducer, while the conversion of mechanical energy into electric is realized only at zero mole of oscillations.Special attention was paid to the method of coupled fields in multiply connected domains using the imaging method. The design model of the «transducer–creen» system was formulated taking into account the interaction of acoustic, mechanical and electric fields in the process of energy conversion, the interaction of a cylindrical transducer with a flat screen and the interaction of a converter with elastic media outside and inside it. The physical fields of the system under consideration were determined by following solutions: the wave equation; equations of motion of thin piezoceramic cylindrical shells in displacements; equations of stimulated electrostatics for piezoceramics for given boundary conditions, conditions for coupling fields at interfaces and electrical conditions.A general conclusion was made concerning solving of an infinite system of linear algebraic equations with respect to the unknown coefficients of the expansion of the fields. As an example of the application of the obtained relations, a calculation was made and an analysis of the dependences of the electric fields of the system under consideration for various parameters of its construction on the direction of arrival on the plane wave system was conducted.

  16. Octonionic methods in field theory

    International Nuclear Information System (INIS)

    Duendarer, A.R.

    1987-01-01

    Some applications of octonion algebra and octonionic analysis to group theory and higher dimensional field theories are presented. To this end an eight dimensional covariant treatment of the octonion algebra is needed. The existing formulations which are covariant only in seven dimensions are reviewed. In this work the eight dimensional formulation is developed through the introduction of fourth rank tensors f abcd and f' abcd in eight dimensions that generalize the octonionic structure constants. The seven octonion units e α are generalized to an 8-vector e a and two second rank tensors e ab and e' ab . Higher rank tensors associated with e α are also introduced. Chirality and duality properties of the structure tensors, f,f' and the octonionic tensors e a , e ab , etc. are discussed and various new identities relating these quantities are derived. New vector products for two, three and four octonions are introduced and their duality properties with respect to the eight-dimensional Levi-Civita tensor as well as their orthogonality properties are studied

  17. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  18. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  19. A new method for the calculation of Sommerfeld screening ...

    Indian Academy of Sciences (India)

    A new method for the calculation of Sommerfeld screening parameter 1 in x-ray spectra. U D Misra S Chaturvedi. Research Articles ... earlier by Gokhale and Misra. The method brings out the constancy of 1(23)-1(1) in a natural way and may thus be regarded as providing theoretical explanation of the Hertz law.

  20. Screening for diabetic retinopathy in rural area using single-field, digital fundus images.

    Science.gov (United States)

    Ruamviboonsuk, Paisan; Wongcumchang, Nattapon; Surawongsin, Pattamaporn; Panyawatananukul, Ekchai; Tiensuwan, Montip

    2005-02-01

    To evaluate the practicability of using single-field, 2.3 million-pixel, digital fundus images for screening of diabetic retinopathy in rural areas. All diabetic patients who regularly attended the diabetic clinic at Kabcheang Community Hospital, located at 15 kilometers from the Thailand-Cambodia border, were appointed to the hospital for a 3-day diabetic retinopathy screening programme. The fundi of all patients were captured in single-field, 45 degrees, 2.3 million-pixel images using nonmydriatic digital fundus camera and then sent to a reading center in Bangkok. The fundi were also examined through dilated pupils by a retinal specialist at this hospital. The grading of diabetic retinopathy from two methods was compared for an exact agreement. The average duration of single digital fundus image capture was 2 minutes. The average file size of each image was 750 kilobytes. The average duration of single image transmission to a reading center in Bangkok via satellite was 3 minutes; via a conventional telephone line was 8 minutes. Of all 150 patients, 130 were assessed for an agreement between dilated fundus examination and digital fundus images in diagnosis of diabetic retinopathy. The exact agreement was 0.87, the weighted kappa statistics was 0.74. The sensitivity of digital fundus images in detecting diabetic retinopathy was 80%, the specificity was 96%. For diabetic macular edema the exact agreement was 0.97, the weighted kappa was 0.43, the sensitivity was 43%, and the specificity was 100%. The image capture of the nonmydriatic digital fundus camera is suitable for screening of diabetic retinopathy and single-field digital fundus images are potentially acceptable tools for the screening. The real-time image transmission via telephone lines to remote reading center, however, may not be practical for routine diabetic retinopathy screening in rural areas.

  1. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  2. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  3. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    INTRODUCTION: Denmark has had an organized screening programme for cervical cancer since the 1960s. In spite of this, almost 150 Danish women die from the disease each year. There are currently two different methods for preparation of cervical samples: conventional Papanicolaou smear and liquid......-based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...

  4. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  5. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-26

    Apr 26, 2012 ... antibacterial agents by avoiding pure cultures as the first stage to increase screening efficiency. MATERIALS AND METHODS. Preparing mixed culture plates. Soil samples were collected from different locations covered with plant litter in the south of China, and all of these locations are common places, so ...

  6. A direct and sensitive method for screening fructooligosaccharides ...

    African Journals Online (AJOL)

    A direct and sensitive method for screening fructooligosaccharides-digesting microorganisms useful in food and health science. ... Short-chain fructooligosaccharides (FOS) stimulate selectively the growth and activity of microorganisms in the colon providing positive health effects and well-being in humans and animals.

  7. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  8. A comparison of the accuracy of film-screen mammography, full-field digital mammography, and digital breast tomosynthesis

    International Nuclear Information System (INIS)

    Michell, M.J.; Iqbal, A.; Wasan, R.K.; Evans, D.R.; Peacock, C.; Lawinski, C.P.; Douiri, A.; Wilson, R.; Whelehan, P.

    2012-01-01

    Aim: To measure the change in diagnostic accuracy of conventional film-screen mammography and full-field digital mammography (FFDM) with the addition of digital breast tomosynthesis (DBT) in women recalled for assessment following routine screening. Materials and methods: Ethics approval for the study was granted. Women recalled for assessment following routine screening with screen-film mammography were invited to participate. Participants underwent bilateral, two-view FFDM and two-view DBT. Readers scored each lesion separately for probability of malignancy on screen-film mammography, FFDM, and then DBT. The scores were compared with the presence or absence of malignancy based on the final histopathology outcome. Results: Seven hundred and thirty-eight women participated (93.2% recruitment rate). Following assessment 204 (26.8%) were diagnosed as malignant (147 invasive and 57 in-situ tumours), 286 (37.68%) as benign, and 269 (35.4%) as normal. The diagnostic accuracy was evaluated by using receiving operating characteristic (ROC) and measurement of area under the curve (AUC). The AUC values demonstrated a significant (p = 0.0001) improvement in the diagnostic accuracy with the addition of DBT combined with FFDM and film-screen mammography (AUC = 0.9671) when compared to FFDM plus film-screen mammography (AUC = 0.8949) and film-screen mammography alone (AUC = 0.7882). The effect was significantly greater for soft-tissue lesions [AUC was 0.9905 with the addition of DBT and AUC was 0.9201 for FFDM with film-screen mammography combined (p = 0.0001)] compared to microcalcification [with the addition of DBT (AUC = 0.7920) and for FFDM with film-screen mammography combined (AUC = 0.7843; p = 0.3182)]. Conclusion: The addition of DBT increases the accuracy of mammography compared to FFDM and film-screen mammography combined and film-screen mammography alone in the assessment of screen-detected soft-tissue mammographic abnormalities.

  9. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  10. Historic Methods for Capturing Magnetic Field Images

    Science.gov (United States)

    Kwan, Alistair

    2016-01-01

    I investigated two late 19th-century methods for capturing magnetic field images from iron filings for historical insight into the pedagogy of hands-on physics education methods, and to flesh out teaching and learning practicalities tacit in the historical record. Both methods offer opportunities for close sensory engagement in data-collection…

  11. Computational methods for reversed-field equilibrium

    International Nuclear Information System (INIS)

    Boyd, J.K.; Auerbach, S.P.; Willmann, P.A.; Berk, H.L.; McNamara, B.

    1980-01-01

    Investigating the temporal evolution of reversed-field equilibrium caused by transport processes requires the solution of the Grad-Shafranov equation and computation of field-line-averaged quantities. The technique for field-line averaging and the computation of the Grad-Shafranov equation are presented. Application of Green's function to specify the Grad-Shafranov equation boundary condition is discussed. Hill's vortex formulas used to verify certain computations are detailed. Use of computer software to implement computational methods is described

  12. [Methods to increase participation in cancer screening programmes].

    Science.gov (United States)

    Giorgi Rossi, Paolo; Camilloni, Laura; Cogo, Carla; Federici, Antonio; Ferroni, Eliana; Furnari, Giacomo; Giordano, Livia; Grazzini, Grazia; Iossa, Anna; Jimenez, Beatriz; Palazzi, Mauro; Palazzo, Fabio; Spadea, Teresa; Senore, Carlo; Borgia, Piero; Guasticchi, Gabriella

    2012-01-01

    to synthesize scientific evidences about methods to increase cervical, breast and colorectal cancer screening participation. a multidisciplinary working group has been set up to define the scope of the report and to conduct the evaluation. The scope and the final evaluation have been submitted to a stakeholder committee, including the Ministry of Health, the National Screening Observatory, regional screening program coordinators, scientific societies, and Lega Italiana Lotta ai Tumori, for comments and integrations. A systematic review of the principal biomedical and social literature databases was conducted to identify experimental and observational studies, updating the existing review by Jepson and coll. (Health Technol Assess. 2000;4(14):i-vii, 1-133). 5900 have been identified, 900 relevant for the topic.Among those, 148 reported quantitative information on intervention efficacy, other 90 came from the previous review. Organised screening programmes, based on invitation letter or on GP involvement,were consistently effective in increasing participation compared to spontaneous screening. Interventions are classified according to their target: individual, community, test simplification, health operators, health service organization. The report presents meta-analyses on efficacy, analyses of cost-effectiveness, impact on organisation and social inequality, and ethical and legal issues, of all the intervention reported in the literature. there are several interventions consistently effective in any context, some of them have minimal impact on costs and health service resources.

  13. Electromagnetic field computation by network methods

    CERN Document Server

    Felsen, Leopold B; Russer, Peter

    2009-01-01

    This monograph proposes a systematic and rigorous treatment of electromagnetic field representations in complex structures. The book presents new strong models by combining important computational methods. This is the last book of the late Leopold Felsen.

  14. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  15. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  16. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Geostatistical methods applied to field model residuals

    DEFF Research Database (Denmark)

    Maule, Fox; Mosegaard, K.; Olsen, Nils

    consists of measurement errors and unmodelled signal), and is typically assumed to be uncorrelated and Gaussian distributed. We have applied geostatistical methods to analyse the residuals of the Oersted(09d/04) field model [http://www.dsri.dk/Oersted/Field_models/IGRF_2005_candidates/], which is based......The geomagnetic field varies on a variety of time- and length scales, which are only rudimentary considered in most present field models. The part of the observed field that can not be explained by a given model, the model residuals, is often considered as an estimate of the data uncertainty (which...... on 5 years of Ørsted and CHAMP data, and includes secular variation and acceleration, as well as low-degree external (magnetospheric) and induced fields. The analysis is done in order to find the statistical behaviour of the space-time structure of the residuals, as a proxy for the data covariances...

  18. Three-dimensional computer visualization of field screening information: Examples and applications

    Energy Technology Data Exchange (ETDEWEB)

    Baker, L.A. [Automated Sciences Group, Oliver Springs, TN (United States); Hammons, W. [Analysas Corp., Oak Ridge, TN (United States)

    1995-12-31

    The first step in conducting environmental investigations is the development of a conceptual model of the area to be investigated, including the probable distribution of contaminants. Sampling locations are based on this conceptual model. Field screening techniques allow the investigator to confirm or revise the conceptual model as the investigation is being conducted and provides the investigator with real-time information about groundwater contamination at discrete depth intervals. This information enhances accurate well screen placement and optimization of subsequent well locations. The obvious benefits of field screening are reducing the time and cost associated with field investigations and defining the nature and extent of contamination in one field effort. Groundwater field screening techniques also provide a profusion of information that is essential in interpreting contaminant fate and transport, selecting remedial alternatives, and designing remediation systems. This paper will give an overview of the screened hollow-stem auger field screening technique and its application in conducting groundwater investigations at a major National Priorities List (NPL) site. The three-dimensional visualization of the field screening information collected will be discussed and applications of the three-dimensional modeling will be presented to discuss the points mentioned above. Future applications of three-dimensional modeling will be examined.

  19. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  20. The sensitivity and specificity of one field non-mydriatic digital fundus photography for DR screening

    Directory of Open Access Journals (Sweden)

    Bin-Bin Li

    2013-07-01

    Full Text Available AIM:To evaluate the sensitivity and specificity of one-field non-mydriatic digital fundus photography and direct ophthalmoscopy for diabetic retinopathy(DRscreening, compared with fundus fluorescein angiography( FFA .METHODS:All 93 patients of type 1 or 2 diabetic who have underwent one-field non-mydriatic digital fundus photography, and direct ophthalmoscopy with dilation of their pupils, and FFA by ophthalmologists. The sensitivity and specificity of one-field non-mydriatic digital fundus photography and direct ophthalmoscopy were calculated respectively, compared with FFA.RESULTS: The sensitivity and specificity of one-field non-mydriatic digital fundus photography for detection of any DR were 80.4% and 94.7%; The sensitivity and specificity of direct ophthalmoscopy for detection of any DR were 64.2% and 84.2%; After the standard for referable DR being lowered down to the moderate non-proliferative diabetic retinopathy(M-NPDR, the sensitivity and specificity of non-mydriatic digital fundus photography for detection were 88.9% and 98.4%, the sensitivity and specificity of direct ophthalmoscopy for detection were 71.5% and 96.7%.CONCLUSION: One-field non-mydriatic digital fundus photography is an effective method for DR screening.

  1. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  2. Modified methods of stellar magnetic field measurements

    Science.gov (United States)

    Kholtygin, A. F.

    2014-12-01

    The standard methods of the magnetic field measurement, based on an analysis of the relation between the Stokes V-parameter and the first derivative of the total line profile intensity, were modified by applying a linear integral operator \\hat{L} to both sides of this relation. As the operator \\hat{L}, the operator of the wavelet transform with DOG-wavelets is used. The key advantage of the proposed method is an effective suppression of the noise contribution to the line profile and the Stokes parameter V. The efficiency of the method has been studied using model line profiles with various noise contributions. To test the proposed method, the spectropolarimetric observations of the A0 star α2 CVn, the Of?p star HD 148937, and the A0 supergiant HD 92207 were used. The longitudinal magnetic field strengths calculated by our method appeared to be in good agreement with those determined by other methods.

  3. Studies Comparing Screen-Film Mammography and Full-Field Digital Mammography in Breast Cancer Screening: Updated Review

    International Nuclear Information System (INIS)

    Skaane, P.

    2009-01-01

    Full-field digital mammography (FFDM) has several potential benefits as compared with screen-film mammography (SFM) in mammography screening. Digital technology also opens for implementation of advanced applications, including computer-aided detection (CAD) and tomosynthesis. Phantom studies and experimental clinical studies have shown that FFDM is equal or slightly superior to SFM for detection and characterization of mammographic abnormalities. Despite obvious advantages, the conversion to digital mammography has been slower than anticipated, and not only due to higher costs. Until very recently, some countries did not even permit the use of digital mammography in breast cancer screening. The reason for this reluctant attitude was concern about lower spatial resolution and about using soft-copy reading. Furthermore, there was a lack of data supporting improved diagnostic accuracy using FFDM in a screening setting, since two pioneer trials both showed nonsignificantly lower cancer detection rate at FFDM. The 10 studies comparing FFDM and SFM in mammography screening published so far have shown divergent and rather conflicting results. Nevertheless, there is a rapid conversion to digital mammography in breast cancer screening in many western countries. The aim of this article is to give an updated review of these studies, discuss the conflicting findings, and draw some conclusions from the results

  4. Analyzing slug tests in wells screened across the watertable: A field assessment

    Science.gov (United States)

    Stanford, K.L.; McElwee, C.D.

    2000-01-01

    The slug test is the most widely used technique for the in situ estimation of hydraulic conductivity in confined and unconfined formations. Currently, there are no generally accepted methods in the groundwater literature for the analysis of response data from slug tests performed in wells screened across the watertable. A field study was undertaken in an attempt to develop a set of practical guidelines for tests conducted in such wells. Three wells, screened within unconsolidated material exhibiting a range of hydraulic conductivities (.05-30.0 m/day), were installed to depths of up to 9 m (30 ft) in Kansas River alluvium that ranges in thickness from 15 m to 21 m (50 ft to 70 ft) near Lawrence, Kansas. Intensive well-development efforts removed any drilling debris that could interfere with well-formation hydraulics. Once the wells were developed properly, a series of slug tests was performed at each well. The tests were designed to assess the role of the unsaturated zone and the appropriateness of assuming a fixed hydraulic head upper boundary. The results of this investigation can be summarized as follows: (1) the sufficiency of well development should be based on repeat slug tests and not the clarity of pumped water; (2) the effective screen radius for best model analysis should be based on a mass balance and not nominal screen dimensions; (3) the watertable can be represented as a constant head boundary and flow in the unsaturated zone can be ignored in most situations; (4) conventional techniques for the analysis of slug-test data seem to be reasonable for slug tests conducted in wells screened across the watertable, when used with the appropriate effective screen radius and normalized head range; and (5) fluctuations in the watertable elevation through time can be exploited to obtain some insight into the nature of vertical variation in hydraulic conductivity at a well. The results of this investigation indicate that multiple slug tests should be performed at

  5. The Investigation of Screening of Chromoelectric and Chromomagnetic Fields in QGP in Noncovariant Gauges

    International Nuclear Information System (INIS)

    Veliev, E.S.

    2004-01-01

    According to Thermal Quantum Chromodynamics (TQCD) hadron matter may be exist in different phase states, in particular, in the form of quark-gluon plasma (QGP). The aim of the present work is to investigate the screening of chromoelectric and chromomagnetic fields in QGP in temporal gauge. In temporal gauge gluon propagator has the unphysical poles. Hence, in the gluon self energy diagram calculations the singularities appear. In order to remove these singularities we used Leibbrandt-Mandelstam prescription. We obtained that chromoelectric fields are screened, but chromomagnetic fields are not screened. In coordinate space, the screening of chromoelectric fields reduces the range of gauge interactions. In momentum space, it contributes to regulate the infrared behavior of the various n-point Green functions. Also, it is shown that the obtained results are gauge invariant

  6. A method for characterizing photon radiation fields

    International Nuclear Information System (INIS)

    Whicker, J.J.; Hsu, H.H.; Hsieh, F.H.; Borak, T.B.

    1999-01-01

    Uncertainty in dosimetric and exposure rate measurements can increase in areas where multi-directional and low-energy photons (< 100 keV) exist because of variations in energy and angular measurement response. Also, accurate measurement of external exposures in spatially non-uniform fields may require multiple dosimetry. Therefore, knowledge of the photon fields in the workplace is required for full understanding of the accuracy of dosimeters and instruments, and for determining the need for multiple dosimeters. This project was designed to develop methods to characterize photon radiation fields in the workplace, and to test the methods in a plutonium facility. The photon field at selected work locations was characterized using TLDs and a collimated NaI(Tl) detector from which spatial variations in photon energy distributions were calculated from measured spectra. Laboratory results showed the accuracy and utility of the method. Field measurement results combined with observed work patterns suggested the following: (1) workers are exposed from all directions, but not isotropically, (2) photon energy distributions were directionally dependent, (3) stuffing nearby gloves into the glovebox reduced exposure rates significantly, (4) dosimeter placement on the front of the chest provided for a reasonable estimate of the average dose equivalent to workers' torsos, (5) justifiable conclusions regarding the need for multiple dosimetry can be made using this quantitative method, and (6) measurements of the exposure rates with ionization chambers pointed with open beta windows toward the glovebox provided the highest measured rates, although absolute accuracy of the field measurements still needs to be assessed

  7. Potential screening and early diagnosis method for cancer: Tongue diagnosis

    Science.gov (United States)

    HAN, SHUWEN; YANG, XI; QI, QUAN; PAN, YUEFEN; CHEN, YONGCHAO; SHEN, JUNJUN; LIAO, HAIHONG; JI, ZHAONING

    2016-01-01

    Tongue diagnosis, as a unique method of traditional Chinese medicine (TCM), was used to discriminate physiological functions and pathological conditions by observing the changes of the tongue and tongue coating. The aims of the present study were to explore a potential screening and early diagnosis method of cancer through evaluating the differences of the images of tongue and tongue coating and the microbiome on the tongue coating. The DS01-B tongue diagnostic information acquisition system was used to photograph and analyze the tongue and tongue coating. The next-generation sequencing technology was used to determine the V2-V4 hypervariable regions of 16S rDNA to investigate the microbiome on the tongue coating. Bioinformatics and statistical methods were used to analyze the microbial community structure and diversity. Comparing with the healthy people, the number of mirror-like tongue, thick tongue coating and the moisture of tongue were increased in cancers. The dominant color of the tongue in the healthy people was reddish while it was purple in the cancers. The relative abundance of Neisseria, Haemophilus, Fusobacterium and Porphyromonas in the healthy people were higher than that in the cancers. We also found 6 kinds of special microorganisms at species level in cancers. The study suggested that tongue diagnosis may provide potential screening and early diagnosis method for cancer. PMID:27035407

  8. A Quantum-Based Similarity Method in Virtual Screening

    Directory of Open Access Journals (Sweden)

    Mohammed Mumtaz Al-Dabbagh

    2015-10-01

    Full Text Available One of the most widely-used techniques for ligand-based virtual screening is similarity searching. This study adopted the concepts of quantum mechanics to present as state-of-the-art similarity method of molecules inspired from quantum theory. The representation of molecular compounds in mathematical quantum space plays a vital role in the development of quantum-based similarity approach. One of the key concepts of quantum theory is the use of complex numbers. Hence, this study proposed three various techniques to embed and to re-represent the molecular compounds to correspond with complex numbers format. The quantum-based similarity method that developed in this study depending on complex pure Hilbert space of molecules called Standard Quantum-Based (SQB. The recall of retrieved active molecules were at top 1% and top 5%, and significant test is used to evaluate our proposed methods. The MDL drug data report (MDDR, maximum unbiased validation (MUV and Directory of Useful Decoys (DUD data sets were used for experiments and were represented by 2D fingerprints. Simulated virtual screening experiment show that the effectiveness of SQB method was significantly increased due to the role of representational power of molecular compounds in complex numbers forms compared to Tanimoto benchmark similarity measure.

  9. New Methods of Magnetic Field Measurements

    Science.gov (United States)

    Kholtygin, A. F.

    2015-04-01

    The standard methods of magnetic field measurements, based on the relation between the Stokes V parameter and the first derivative of the line profile intensity were modified by applying a linear integral transform to both sides of this relation. We used the wavelet integral transform with the DOG wavelets. The key advantage of the proposed method is the effective suppression of the noise contribution both to the line profile and the Stokes V parameter. To test the proposed method, spectropolarimetric observations of the young O star θ1 Ori C were used. We also demonstrate that the smoothed Time Variation Spectra (smTVS) can be used as a tool for detecting the local stellar magnetic fields.

  10. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  11. Method for rapid screening of pesticide mineralization in soil.

    Science.gov (United States)

    Rasmussen, Jim; Jensen, Pia Haugaard; Holm, Peter E; Jacobsen, Ole Stig

    2004-05-01

    A method has been developed for the analysis of (14)CO(2) evolution from the mineralization of (14)C-labelled organic compounds in soil samples. The new method is less space demanding and substantially cuts down laborious manual work compared to the traditional incubation bottle method used. Furthermore, the use of scintillation cocktail is largely reduced with the new method. In the new method, (14)CO(2) is trapped in filter paper held in the lid of a 20 ml glass vial by surface tension. The trapping solution used is Ca(OH)(2), which fixates CO(2) in the filter paper and the analysis of trapped (14)CO(2) is done using the Cyclone trade mark Storage Phosphor system. The lids are placed in a 32 well holder and exposed to a phosphor screen prior to scanning in a Cyclone trade mark scanner. The new filter method has been tested and compared to results obtained using the traditional method. The results show good agreement but due to a smaller capacity for CO(2) with the filter method compared to the traditional method, the interval between sampling has to be shorter using the filter method when the CO(2) development is high. The detection limits for the filter method is higher compared to the traditional method. With the filter method, the level of radioactivity has to exceed 300 dpm before detection is possible, while the same limit for the traditional method is around 30 dpm. On the other hand, the gas trapping faster and the efficiency is higher with the filter method.

  12. Validation of screening method for determination of methyltestosterone in fish

    Directory of Open Access Journals (Sweden)

    Stojkovski Velimir

    2013-07-01

    Full Text Available Anabolic androgenic steroids are synthetic derivatives of testosterone, which is the primary male sex hormone. These anabolic agents are used to increase the weight gain, to improve the food efficiency, storing proteins and to decrease fatness. However, depending on the use of anabolic agent in animal feed, anabolic residues that may occur in meat and meat products present risks to human health. The aim of this study was the validation of screening ELISA method for determination of methyltestoterone anabolic steroid in fish. The validation process was carried out according to Commission Decision 2002/657/EC criteria. The detection limit for methyltestosterone was 140.95 ng/kg and the detection capability was 564.43 ng/kg. The overall recoveries and the coefficients of variation (CV were in the range of 82.4%-97.4% and 1.5%-6.9%, respectively, a working range between 50 to 4050 ng/kg, and the regression equation of the final inhibition curve was: y= -0,1741x + 1,5082, R2 = 0.9927. Because of the good recovery and precision, and satisfactory detection capability, this method is applicable in official control laboratories as a rapid screening method for determination of methyltestosterone in fish.

  13. Teaching Basic Field Skills Using Screen-Based Virtual Reality Landscapes

    Science.gov (United States)

    Houghton, J.; Robinson, A.; Gordon, C.; Lloyd, G. E. E.; Morgan, D. J.

    2016-12-01

    We are using screen-based virtual reality landscapes, created using the Unity 3D game engine, to augment the training geoscience students receive in preparing for fieldwork. Students explore these landscapes as they would real ones, interacting with virtual outcrops to collect data, determine location, and map the geology. Skills for conducting field geological surveys - collecting, plotting and interpreting data; time management and decision making - are introduced interactively and intuitively. As with real landscapes, the virtual landscapes are open-ended terrains with embedded data. This means the game does not structure student interaction with the information as it is through experience the student learns the best methods to work successfully and efficiently. These virtual landscapes are not replacements for geological fieldwork rather virtual spaces between classroom and field in which to train and reinforcement essential skills. Importantly, these virtual landscapes offer accessible parallel provision for students unable to visit, or fully partake in visiting, the field. The project has received positive feedback from both staff and students. Results show students find it easier to focus on learning these basic field skills in a classroom, rather than field setting, and make the same mistakes as when learning in the field, validating the realistic nature of the virtual experience and providing opportunity to learn from these mistakes. The approach also saves time, and therefore resources, in the field as basic skills are already embedded. 70% of students report increased confidence with how to map boundaries and 80% have found the virtual training a useful experience. We are also developing landscapes based on real places with 3D photogrammetric outcrops, and a virtual urban landscape in which Engineering Geology students can conduct a site investigation. This project is a collaboration between the University of Leeds and Leeds College of Art, UK, and all

  14. Sub-tesla-field magnetization of vibrated magnetic nanoreagents for screening tumor markers

    Science.gov (United States)

    Chieh, Jen-Jie; Huang, Kai-Wen; Shi, Jin-Cheng

    2015-02-01

    Magnetic nanoreagents (MNRs), consisting of liquid solutions and magnetic nanoparticles (MNPs) coated with bioprobes, have been widely used in biomedical disciplines. For in vitro tests of serum biomarkers, numerous MNR-based magnetic immunoassay methods or schemes have been developed; however, their applications are limited. In this study, a vibrating sample magnetometer (VSM) was used for screening tumor biomarkers based on the same MNRs as those used in other immunoassay methods. The examination mechanism is that examined tumor biomarkers are typically conjugated to the bioprobes coated on MNPs to form magnetic clusters. Consequently, the sub-Tesla-field magnetization (Msub-T) of MNRs, including magnetic clusters, exceeds that of MNRs containing only separate MNPs. For human serum samples, proteins other than the targeted biomarkers induce the formation of magnetic clusters with increased Msub-T because of weak nonspecific binding. In this study, this interference problem was suppressed by the vibration condition in the VSM and analysis. Based on a referenced Msub-T,0 value defined by the average Msub-T value of a normal person's serum samples, including general proteins and few tumor biomarkers, the difference ΔMsub-T between the measured Msub-T and the reference Msub-T,0 determined the expression of only target tumor biomarkers in the tested serum samples. By using common MNRs with an alpha-fetoprotein-antibody coating, this study demonstrated that a current VSM can perform clinical screening of hepatocellular carcinoma.

  15. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  16. Screening current induced magnetic field in REBCO superconducting coil wound by using split wire having intermittent inner split

    Science.gov (United States)

    Matsuda, Tetsuro; Jin, Xinzhe; Okamura, Tetsuji

    2017-09-01

    REBCO-coated conductor having a high critical current is promising for applications in next generation apparatuses such as ultra-high field NMR, high-resolution MRI, and high-precision accelerator. However, it has an important challenge for application in NMR and MRI, due to the single core in REBCO superconducting layer. The single core induces a large screening current-induced magnetic field (screening current field), and it influences the controlling of center field in NMR/MRI magnet. To reduce the screening current field, we have recently developed a split wire having multi-core structure by inner split method (electrical separation by bending stress, ESBS). In experiment, short samples with linear inner split by a large bending stress of 80 N were prepared and tested. However, to fabricate a long length wire with good quality, it is better to use a smaller bending stress. In this study, a low-bending-stress inner split method is used to fabricate superconducting tapes with longitudinal split in their superconducting layer. The fabrication and experimental assessments for the wire and coil are carried out.

  17. Visual field measurement with motion sensitivity screening test

    African Journals Online (AJOL)

    Eye disease is a frequent complication of onchocerciasis in countries where the diseasc is highly endemic. It has been shown that early ocular lesions which manifest as visual field defects or reduction in visual acuity can be reversed following treatment with ivermectin. At the community level, it is important to detect.

  18. Visual Field Measurement with Motion Sensitivity Screening Test in ...

    African Journals Online (AJOL)

    Eye disease is a frequent complication of onchocerciasis in countrise where the disease is highly endemic. It has been shown that early ocular lesions which manifest as visual field defects or reduction in visual acuity can be reversed following treatment with ivermectin. At the community level, it is important to detect ...

  19. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  20. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    To provide a systematic overview of the various tools available to screen for post-stroke visual impairment. A review of the literature was conducted including randomised controlled trials, controlled trials, cohort studies, observational studies, systematic reviews and retrospective medical note reviews. All languages were included and translation was obtained. Participants included adults ≥18 years old diagnosed with a visual impairment as a direct cause of a stroke. We searched a broad range of scholarly online resources and hand-searched articles registers of published, unpublished and on-going trials. Search terms included a variety of MESH terms and alternatives in relation to stroke and visual conditions. Study selection was performed by two authors independently. The quality of the evidence and risk of bias were assessed using the STROBE, GRACE and PRISMA statements. A total of 25 articles (n = 2924) were included in this review. Articles appraised reported on tools screening solely for visual impairments or for general post-stroke disabilities inclusive of vision. The majority of identified tools screen for visual perception including visual neglect (VN), with few screening for visual acuity (VA), visual field (VF) loss or ocular motility (OM) defects. Six articles reported on nine screening tools which combined visual screening assessment alongside screening for general stroke disabilities. Of these, three included screening for VA; three screened for VF loss; three screened for OM defects and all screened for VN. Two tools screened for all visual impairments. A further 19 articles were found which reported on individual vision screening tests in stroke populations; two for VF loss; 11 for VN and six for other visual perceptual defects. Most tools cannot accurately account for those with aphasia or communicative deficits, which are common problems following a stroke. There is currently no standardised visual screening tool which can accurately

  1. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  2. Renormalization using the background-field method

    International Nuclear Information System (INIS)

    Ichinose, S.; Omote, M.

    1982-01-01

    Renormalization using the background-field method is examined in detail. The subtraction mechanism of subdivergences is described with reference to multi-loop diagrams and one- and two-loop counter-term formulae are explicitly given. The original one-loop counter-term formula of 't Hooft is thereby improved. The present method of renormalization is far easier to manage than the usual one owing to the fact only gauge-invariant quantities are to be considered when worked in an appropriate gauge. Gravity and Yang-Mills theories are studied as examples. (orig.)

  3. Field demonstration of rapid turnaround, multilevel groundwater screening

    International Nuclear Information System (INIS)

    Tingle, A.R.; Baker, L.; Long, D.D.

    1994-01-01

    A combined technology approach to rapidly characterizing source area and downgradient groundwater associated with a past fuel spill has been field tested. The purpose of this investigation was to determine the presence and extent of fuel-related compounds or indications of their biodegradation in groundwater. The distance from the source area to be investigated was established by calculating the potential extent of a plume based only on groundwater flow velocities. To accomplish this objective, commercially available technologies were combined and used to rapidly assess the source area and downgradient groundwater associated with the fuel discharge. The source of contamination that was investigated overlies glacial sand and gravel outwash deposits. Historical data suggest that from 1955 to 1970 as many as 1 to 6 million pi of aviation gasoline (AVGAS) were god at the study area. Although the remedial investigation (RI) for this study area indicated fuel-related groundwater contamination at the source area, fuel-related contamination was not detected in downgradient monitoring wells. Rapid horizontal groundwater velocities and the 24-year time span from the last reported spill farther suggest that a plume of contaminated groundwater could extend several thousand feet downgradient. The lack of contamination downgradient from the source suggests two possibilities: (1) monitoring wells installed during the RI did not intersect the plume or (2) fuel-related compounds had naturally degraded

  4. Research on testing instrument and method for correction of the uniformity of image intensifier fluorescence screen brightness

    Science.gov (United States)

    Qiu, YaFeng; Chang, BenKang; Qian, YunSheng; Fu, RongGuo

    2011-09-01

    To test the parameters of image intensifier screen is the precondition for researching and developing the third generation image intensifier. The picture of brightness uniformity of tested fluorescence screen shows bright in middle and dark at edge. It is not so direct to evaluate the performance of fluorescence screen. We analyze the energy and density distribution of the electrons, After correction, the image in computer is very uniform. So the uniformity of fluorescence screen brightness can be judged directly. It also shows the correction method is reasonable and close to ideal image. When the uniformity of image intensifier fluorescence screen brightness is corrected, the testing instrument is developed. In a vacuum environment of better than 1×10-4Pa, area source electron gun emits electrons. Going through the electric field to be accelerated, the high speed electrons bombard the screen and the screen luminize. By using testing equipment such as imaging luminance meter, fast storage photometer, optical power meter, current meter and photosensitive detectors, the screen brightness, the uniformity, light-emitting efficiency and afterglow can be tested respectively. System performance are explained. Testing method is established; Test results are given.

  5. Implementation of a DOD ELAP Conforming Quality System at a FUSRAP Site Field Temporary Radiological Screening Laboratory - 13500

    International Nuclear Information System (INIS)

    Winters, M.S.; McElheny, G.; Houston, L.M.; Masset, M.R.; Spector, H.L.

    2013-01-01

    A case study is presented on specific program elements that supported the transition of a temporary field radiological screening lab to an accredited operation capable of meeting client quality objectives for definitive results data. The temporary field lab is located at the Formerly Utilized Sites Remedial Action Program Linde Site in Tonawanda, NY. The site is undergoing remediation under the direction of the United States Army Corps of Engineers - Buffalo District, with Cabrera Services Inc. as the remediation contractor and operator of the on-site lab. Analysis methods employed in the on-site lab include gross counting of alpha and beta particle activity on swipes and air filters and gamma spectroscopy of soils and other solid samples. A discussion of key program elements and lessons learned may help other organizations considering pursuit of accreditation for on-site screening laboratories. (authors)

  6. A Method for Universal Screening of Elementary School Students: Development of the Social Challenges Screening Questionnaire

    Science.gov (United States)

    Smith, Christopher J.; Pollard, Elena; Stein, Alexander J.; Ober-Reynolds, Sharman; Kirwan, Janet; Malligo, Amanda; Matthews, Nicole L.; Openden, Daniel; Melmed, Raun D.

    2015-01-01

    Schools regularly screen students for hearing and vision impairments because they present impediments to academic progress. For the same reason, schools should consider adding a universal screening for social challenges, which may also impede the learning process. This study reports on the development of the Social Challenges Screening…

  7. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  8. The effect of Ar neutral beam treatment of screen-printed carbon nanotubes for enhanced field emission

    International Nuclear Information System (INIS)

    Kyung, Se Jin; Park, Jae Beom; Park, Byung Jae; Min, Kyung Seok; Lee, June Hee; Yeom, Geun Young; Shin, Yong Sook; Park, Chong Yun

    2007-01-01

    This study examined the effectiveness of an Ar neutral beam as a surface treatment for improving the field emission properties of screen-printed carbon nanotubes (CNTs). A short period of the neutral beam treatment on tape-activated CNTs enhanced the emission properties of the CNTs, showing a decrease in the turn-on field and an increase in the number of emission sites. The neutral beam treatment appeared to render the CNT surfaces more actively by exposing more CNTs from the CNT paste without cutting or kinking the already exposed long CNT emitters. The treated CNTs emitted more electrons than the CNTs treated using other methods. When the field emission properties were measured after the neutral beam treatment, the turn-on field decreased from 1.65 to 0.60 V/μm and the emission field at 1 mA/cm 2 decreased from 3.10 to 2.41 V/μm. After the neutral beam treatment for 10 s, there was an improvement in the stability of the emission current at a constant electric field. It is expected that the neutral beam treatment introduced in this study will provide an easy way of improving the emission intensity and stability of screen-printed CNT emitters

  9. Screening for diabetic retinopathy using new mydriasis-free, full-field flicker ERG recording device

    Science.gov (United States)

    Fukuo, Motonobu; Kondo, Mineo; Hirose, Akira; Fukushima, Harumi; Ikesugi, Kengo; Sugimoto, Masahiko; Kato, Kumiko; Uchigata, Yasuko; Kitano, Shigehiko

    2016-01-01

    Diabetic retinopathy (DR) is a leading cause of blindness among working-age adults. Therefore, it is important to detect DR accurately during mass screening. The purpose of this study was to determine whether a small, hand-held, mydriasis-free, full-field flicker electroretinographic (ERGs) device called RETeval can be used to screen for DR. To accomplish this, we recorded full-field flicker ERGs with this device from 48 normal eyes and 118 eyes with different severities of DR in patients with diabetes mellitus (DM). This system delivered a constant flash retinal luminance by adjusting the flash luminance that compensated for changes in the pupil size. Our results showed that there were significant correlations between the severity of DR and the implicit times (P flicker ERGs recorded by the small, mydryasis-free ERG system can be used as an adjunctive tool to screen for DR. PMID:27824158

  10. Narrow field electromagnetic sensor system and method

    International Nuclear Information System (INIS)

    McEwan, T.E.

    1996-01-01

    A narrow field electromagnetic sensor system and method of sensing a characteristic of an object provide the capability to realize a characteristic of an object such as density, thickness, or presence, for any desired coordinate position on the object. One application is imaging. The sensor can also be used as an obstruction detector or an electronic trip wire with a narrow field without the disadvantages of impaired performance when exposed to dirt, snow, rain, or sunlight. The sensor employs a transmitter for transmitting a sequence of electromagnetic signals in response to a transmit timing signal, a receiver for sampling only the initial direct RF path of the electromagnetic signal while excluding all other electromagnetic signals in response to a receive timing signal, and a signal processor for processing the sampled direct RF path electromagnetic signal and providing an indication of the characteristic of an object. Usually, the electromagnetic signal is a short RF burst and the obstruction must provide a substantially complete eclipse of the direct RF path. By employing time-of-flight techniques, a timing circuit controls the receiver to sample only the initial direct RF path of the electromagnetic signal while not sampling indirect path electromagnetic signals. The sensor system also incorporates circuitry for ultra-wideband spread spectrum operation that reduces interference to and from other RF services while allowing co-location of multiple electronic sensors without the need for frequency assignments. 12 figs

  11. Narrow field electromagnetic sensor system and method

    Science.gov (United States)

    McEwan, Thomas E.

    1996-01-01

    A narrow field electromagnetic sensor system and method of sensing a characteristic of an object provide the capability to realize a characteristic of an object such as density, thickness, or presence, for any desired coordinate position on the object. One application is imaging. The sensor can also be used as an obstruction detector or an electronic trip wire with a narrow field without the disadvantages of impaired performance when exposed to dirt, snow, rain, or sunlight. The sensor employs a transmitter for transmitting a sequence of electromagnetic signals in response to a transmit timing signal, a receiver for sampling only the initial direct RF path of the electromagnetic signal while excluding all other electromagnetic signals in response to a receive timing signal, and a signal processor for processing the sampled direct RF path electromagnetic signal and providing an indication of the characteristic of an object. Usually, the electromagnetic signal is a short RF burst and the obstruction must provide a substantially complete eclipse of the direct RF path. By employing time-of-flight techniques, a timing circuit controls the receiver to sample only the initial direct RF path of the electromagnetic signal while not sampling indirect path electromagnetic signals. The sensor system also incorporates circuitry for ultra-wideband spread spectrum operation that reduces interference to and from other RF services while allowing co-location of multiple electronic sensors without the need for frequency assignments.

  12. Improving Superconducting Resonators in Magnetic Fields by Reduced Field Focussing and Engineered Flux Screening

    Science.gov (United States)

    Bothner, D.; Wiedmaier, D.; Ferdinand, B.; Kleiner, R.; Koelle, D.

    2017-09-01

    We experimentally investigate superconducting coplanar waveguide resonators in external magnetic fields and present two strategies to reduce field-induced dissipation channels and resonance frequency shifts. One of our approaches is to significantly reduce the superconducting ground-plane areas, which leads to reduced magnetic-field focussing and thus to lower effective magnetic fields inside the waveguide cavity. By this measure, the field-induced losses can be reduced by more than one order of magnitude in mT out-of-plane magnetic fields. When these resonators are additionally coupled inductively instead of capacitively to the microwave feed lines, an intrinsic closed superconducting loop is effectively shielding the heart of the resonator from magnetic fields by means of flux conservation. In total, we achieve a reduction of the field-induced resonance frequency shift by up to 2 orders of magnitude. We combine systematic parameter variations on the experimental side with numerical magnetic-field calculations to explain the effects of our approaches and to support our conclusions. The presented results are relevant for all areas, where high-performance superconducting resonators need to be operated in magnetic fields, e.g., for quantum hybrid devices with superconducting circuits or electron spin resonance detectors based on coplanar waveguide cavities.

  13. Mathematical methods in geometrization of coal field

    Science.gov (United States)

    Shurygin, D. N.; Kalinchenko, V. M.; Tkachev, V. A.; Tretyak, A. Ya

    2017-10-01

    In the work, the approach to increase overall performance of collieries on the basis of an increase in accuracy of geometrization of coal thicknesses is considered. The sequence of stages of mathematical modelling of spatial placing of indicators of a deposit taking into account allocation of homogeneous sites of thickness and an establishment of quantitative interrelations between mountain-geological indicators of coal layers is offered. As a uniform mathematical method for modelling of various interrelations, it is offered to use a method of the group accounting of arguments (MGUA), one of versions of the regressive analysis. This approach can find application during delimitation between geological homogeneous sites of coal thicknesses in the form of a linear discriminant function. By an example of division into districts of a mine field in the conditions of mine “Sadkinsky” (East Donbass), the use of the complex approach for forecasting of zones of the small amplitude of disturbance of a coal layer on the basis of the discriminant analysis and MGUA is shown.

  14. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Thermography--a feasible method for screening breast cancer?

    Science.gov (United States)

    Kolarić, Darko; Herceg, Zeljko; Nola, Iskra Alexandra; Ramljak, Vesna; Kulis, Tomislav; Holjevac, Jadranka Katancić; Deutsch, Judith A; Antonini, Svetlana

    2013-06-01

    Potential use of thermography for more effective detection of breast carcinoma was evaluated on 26 patients scheduled for breast carcinoma surgery. Ultrasonographic scan, mammography and thermography were performed at the University Hospital for Tumors. Thermographic imaging was performed using a new generation of digital thermal cameras with high sensitivity and resolution (ThermoTracer TH7102WL, NEC). Five images for each patient were recorded: front, right semi-oblique, right oblique, left- semi oblique and left oblique. While mammography detected 31 changes in 26 patients, thermography was more sensitive and detected 6 more changes in the same patients. All 37 changes were subjected to the cytological analysis and it was found that 16 of samples were malignant, 8 were suspected malignant and 11 were benign with atypia or proliferation while only 2 samples had benign findings. The pathohistological method (PHD) recorded 75.75% malignant changes within the total number of samples. Statistical analysis of the data has shown a probability of a correct mammographic finding in 85% of the cases (sensitivity of 85%, specificity of 84%) and a probability of a correct thermographic finding in 92% of the cases (sensitivity of 100%, specificity of 79%). As breast cancer remains the most prevalent cancer in women and thermography exhibited superior sensitivity, we believe that thermography should immediately find its place in the screening programs for early detection of breast carcinoma, in order to reduce the sufferings from this devastating disease.

  16. Performance comparison of full-field digital mammography to screen-film mammography in clinical practice

    International Nuclear Information System (INIS)

    Berns, Eric A.; Hendrick, R. Edward; Cutter, Gary R.

    2002-01-01

    Results of acceptance testing 18 full-field digital mammography systems for clinical use and of conducting annual physics surveys of 38 screen-film mammography systems were compared in terms of exposure times, mean glandular breast doses, and image quality. These evaluations were made using the same test tools on all systems, with emphasis on assessing automatic exposure control performance and image quality on both digital and screen-film systems using clinical techniques. Survey results indicated that digital mammography systems performed similarly to screen-film systems in terms of exposure times and mean glandular doses for thin to intermediate breasts, but that digital mammography systems selected shorter exposure times and lower mean glandular doses for thicker breasts. For all breast thicknesses, digital mammography systems yielded mean contrast-detail scores higher than those for screen-film systems. For all breast thicknesses, the 18 digital mammography systems demonstrated less variance in terms of exposure times, mean glandular doses, and contrast-detail scores than did the 38 screen-film systems tested. These results indicate that the clinical use of digital mammography may generally improve image quality for equal or lower breast doses, while providing tighter control on exposures and image quality than screen-film mammography

  17. Comparison of three field screening techniques for delineating petroleum hydrocarbon plumes in groundwater at a site in the southern Carson Desert, Nevada

    International Nuclear Information System (INIS)

    Smuin, D.R.

    1993-01-01

    Three types of field screening techniques used in the characterization of potentially contaminated sites at Naval Air Station Fallon, Nevada, are compared. The methods and results for each technique are presented. The three techniques include soil-gas surveys, electromagnetic geophysical surveys, and groundwater test hole screening. Initial screening at the first study site included two soil-gas surveys and electromagnetic geophysical studies. These screening methods identified I areas of contamination; however, results were inconclusive. Therefore groundwater test hole screening was performed. Groundwater screening consisted of auger drilling down to the shallow alluvial aquifer. Groundwater samples were collected from the open drill hole with a bailer. On-site head-space analyses for volatile organic compounds (VOCS) were performed using a portable gas chromatograph (GC). Five areas of floating petroleum hydrocarbon product were identified along with the overall dissolved contaminant plume boundaries. Well placement was re-evaluated, and well sites were relocated based on the screening information. The most effective technique for identification of petroleum hydrocarbon-contaminant plumes was groundwater test hole screening. Groundwater screening was subsequently performed at 19 other sites. A total of 450 test holes were analyzed resulting in the delineation of six plumes

  18. Screening-engineered Field-effect Photovoltaics and Synthesis, Characterization, and Applications of Carbon-based and Related Nanomaterials

    Science.gov (United States)

    Regan, William Raymond

    Carbon nanomaterials, and especially graphene (a 2D carbon allotrope), possess unique electronic, optical, and mechanical properties and allow access to both new physical phenomena and reinventions of familiar technologies. In the first part of this thesis (chapter 2), the low carrier density and high conductivity of graphene are used to repurpose the electric field effect (used for many decades in transistors) into a universally-applicable doping method for electrically-contacted semiconductors. This method, referred to as "screening-engineered field-effect photovoltaics" as the electric field doping is enabled by a carefully-designed poorly-screening electrode (e.g. graphene), is shown to open up many new low-cost and abundant semiconductors for use in high efficiency solar cells. We extend this method beyond ultrathin materials such as graphene and show that 1D nanowire electrodes made of any material also allow penetration of applied electric fields. The next part of this thesis (chapter 3) focuses on the fundamental properties of graphene -- its structure, synthesis, characterization, and manipulation -- and on using graphene as a building block for other nanostructures: grafold, graphene sandwiches and veils, and graphritos. In chapter 4, various graphene electronics are constructed and tested. Graphene field-effect transistors (FETs) and p-n junctions are fabricated to study the influence of the substrate on graphene carrier mobility and doping. Graphene nanoribbons and grafold FETs are made to investigate the effects of additional confinement on electronic transport. Chapter 5 summarizes synthesis methods and additional experiments with other nanomaterials, including dichalcogenides and chalcogenides (magnesium diboride, gallium selenide, and tin sulfide), carbon nanomaterials (carbon nanotubes and graphene), and copper oxide. Additional measurement and fabrication methods are discussed in appendix A.

  19. Fiber-optic surface-enhanced Raman system for field screening of hazardous compounds

    International Nuclear Information System (INIS)

    Ferrell, T.L.; Goudonnet, J.P.; Arakawa, E.T.; Reddick, R.C.; Gammage, R.B.; Haas, J.W.; James, D.R.; Wachter, E.A.

    1988-01-01

    Surface-enhanced Raman scattering permits identification of compounds adsorbed onto a metal microbase that is microlithographically produced with submicron resolution. Less than one percent of a monolayer of a Raman Active target compound offers a high signal-to-noise ratio. By depositing the microbase on the exterior of a fiber optic cable, convenient field screening or monitoring is permitted. By using highly effective microbases, it is possible to reduce laser power requirements sufficiently to allow an economical, but complete, system to be housed in a suitcase. We shall present details of SERS system of this type and shall show data on samples of interest in the screening of hazardous compounds

  20. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  1. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  2. Assessment of automated disease detection in diabetic retinopathy screening using two-field photography.

    Directory of Open Access Journals (Sweden)

    Keith Goatman

    Full Text Available To assess the performance of automated disease detection in diabetic retinopathy screening using two field mydriatic photography.Images from 8,271 sequential patient screening episodes from a South London diabetic retinopathy screening service were processed by the Medalytix iGrading™ automated grading system. For each screening episode macular-centred and disc-centred images of both eyes were acquired and independently graded according to the English national grading scheme. Where discrepancies were found between the automated result and original manual grade, internal and external arbitration was used to determine the final study grades. Two versions of the software were used: one that detected microaneurysms alone, and one that detected blot haemorrhages and exudates in addition to microaneurysms. Results for each version were calculated once using both fields and once using the macula-centred field alone.Of the 8,271 episodes, 346 (4.2% were considered unassessable. Referable disease was detected in 587 episodes (7.1%. The sensitivity of the automated system for detecting unassessable images ranged from 97.4% to 99.1% depending on configuration. The sensitivity of the automated system for referable episodes ranged from 98.3% to 99.3%. All the episodes that included proliferative or pre-proliferative retinopathy were detected by the automated system regardless of configuration (192/192, 95% confidence interval 98.0% to 100%. If implemented as the first step in grading, the automated system would have reduced the manual grading effort by between 2,183 and 3,147 patient episodes (26.4% to 38.1%.Automated grading can safely reduce the workload of manual grading using two field, mydriatic photography in a routine screening service.

  3. SQM studied in the Field Correlator Method

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, F.I.M., E-mail: flavio@on.br [Observatorio Nacional, MCTI, Rua Gal. Jose Cristino 77, 20921-400 Rio de Janeiro, RJ (Brazil)

    2013-01-02

    By using the recent nonperturbative equation of state of the quark-gluon plasma derived in the formalism of the Field Correlator Method, we investigate the bulk properties of the strange quark matter in {beta}-equilibrium and with charge neutrality at T=p=0. The results show that the stability of strange quark matter with respect to {sup 56}Fe is strongly dependent on the model parameters, namely, the gluon condensate G{sub 2} and the qq{sup Macron} interaction potential V{sub 1}. A remarkable result is that the width of the stability window decreases as V{sub 1} increases, being maximum at V{sub 1}=0 and nearly zero at V{sub 1}=0.5 GeV. For V{sub 1} in the range 0 Less-Than-Or-Slanted-Equal-To V{sub 1} Less-Than-Or-Slanted-Equal-To 0.5 GeV, all values of G{sub 2} are lower than 0.006-0.007 GeV{sup 4} obtained from comparison with lattice data at T{sub c}({mu}=0){approx}170 MeV. Our results do not favor the possibilities for the existence of (either nonnegative or negative) absolutely stable strange quark matter.

  4. Efficient Calculation of Near Fields in the FDTD Method

    DEFF Research Database (Denmark)

    Franek, Ondrej

    2011-01-01

    When calculating frequency-domain near fields by the FDTD method, almost 50 % reduction in memory and CPU operations can be achieved if only E-fields are stored during the main time-stepping loop and H-fields computed later. An improved method of obtaining the H-fields from Faraday's Law...

  5. A computerised screening for visual field defects in brain injury patients

    DEFF Research Database (Denmark)

    Nordfang, Maria; Uhre, Valdemar H.B.; Robotham, Ro Julia

    parameters like the number of stimulus repetitions, the colour of stimuli and background, and the orientation of the layout can be individually set. The c-VFT probes all four quadrants and probes along the horizontal midline, making it particularly sensitive for visual field deficits that affect reading...... The c-VFT is a computer program written in open source Python using Psychopy and can be installed without a license. The program tests 48 points in the visual field, covering the visual field from 1 degree to 10 degrees in each hemifield. A colour change detection task controls fixation. Several...... Preliminary analyses indicate that the c-VFT is a sensitive screening tool for visual field defects (anopias) that can be used in neuropsychological practice when other measures of visual field defects are lacking. It should, however, not be considered a diagnostic tool. Assessment can be performed quickly...

  6. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  7. PHASE GRADIENT METHOD OF MAGNETIC FIELD MEASUREMENTS IN ELECTRIC VEHICLES

    Directory of Open Access Journals (Sweden)

    N. G. Ptitsyna

    2013-01-01

    Full Text Available Operation of electric and hybrid vehicles demands real time magnetic field control, for instance, for fire and electromagnetic safety. The article deals with a method of magnetic field measurements onboard electric cars taking into account peculiar features of these fields. The method is based on differential methods of measurements, and minimizes the quantity of magnetic sensors.

  8. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  9. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  10. Axial Field Electric Motor and Method

    National Research Council Canada - National Science Library

    Cho, Chahee P

    2007-01-01

    .... A hybrid field, brushless, permanent magnet electric motor utilizing a rotor with two sets of permanent magnets oriented such that the flux produced by the two sets of magnets is perpendicular to each...

  11. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    Since high-throughput screening (HTS) that selects antibacterial agents according to targets in vitro rather than whole-cell have not proven effective in the discovery of new antibiotics; new approaches for discovering the next generation of antibiotics are urgently needed. Filamentous fungi are an important source for many ...

  12. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  13. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  14. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  15. Improvement of field emission from screen-printed carbon nanotubes by He/(N2,Ar) atmospheric pressure plasma treatment

    International Nuclear Information System (INIS)

    Kyung, S. J.; Park, J. B.; Lee, J. H.; Yeom, G. Y.

    2006-01-01

    A screen-printed carbon nanotube (CNT) paste for applications to field emission emitters was treated with He, He/Ar, and He/N 2 atmospheric pressure plasmas. The effect of the different plasma treatments on the field emission characteristics of the screen-printed CNTs was investigated. The atmospheric pressure plasma applied to the screen-printed CNT paste for 10 s resulted in a reduction in the turn-on electric field. In particular, the application of a He/N 2 plasma treatment decreased the turn-on electric field from 3.13 to 1.29 V/μm and increased the field enhancement factor from 737 to 2775 after the treatment. These results suggest that an adequate atmospheric pressure plasma treatment of screen-printed CNTs can be effective in enhancing the field emission properties

  16. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  17. Mean field methods for cortical network dynamics

    DEFF Research Database (Denmark)

    Hertz, J.; Lerchner, Alexander; Ahmadi, M.

    2004-01-01

    We review the use of mean field theory for describing the dynamics of dense, randomly connected cortical circuits. For a simple network of excitatory and inhibitory leaky integrate- and-fire neurons, we can show how the firing irregularity, as measured by the Fano factor, increases with the stren......We review the use of mean field theory for describing the dynamics of dense, randomly connected cortical circuits. For a simple network of excitatory and inhibitory leaky integrate- and-fire neurons, we can show how the firing irregularity, as measured by the Fano factor, increases...

  18. Field-based evaluations of horizontal flat-plate fish screens, II: Testing of a unique off-stream channel device - The Farmers Screen

    Science.gov (United States)

    Mesa, Matthew G.; Rose, Brien P.; Copeland, Elizabeth S.

    2012-01-01

    Screens are installed at water diversion sites to reduce entrainment of fish. Recently, the Farmers Irrigation District (Oregon) developed a unique flat-plate screen (the “Farmers Screen”) that operates passively and may offer reduced installation and operating costs. To evaluate the effectiveness of this screen on fish, we conducted two separate field experiments. First, juvenile coho salmon Oncorhynchus kisutch were released over a working version of this screen under a range of inflows (0.02–0.42 m3/s) and diversion flows (0.02–0.34 m3/s) at different water depths. Mean approach velocities ranged from 0 to 5 cm/s and sweeping velocities ranged from 36 to 178 cm/s. Water depths over the screen surface ranged from 1 to 25 cm and were directly related to inflow. Passage of fish over the screen under these conditions did not severely injure them or cause delayed mortality, and no fish were observed becoming impinged on the screen surface. Second, juvenile coho salmon and steelhead O. mykiss were released at the upstream end of a 34-m flume and allowed to volitionally move downstream and pass over a 3.5-m section of the Farmers Screen to determine whether fish would refuse to pass over the screen after encountering its leading edge. For coho salmon, 75–95% of the fish passed over the screen within 5 min and 82–98% passed within 20 min, depending on hydraulic conditions. For steelhead, 47–90% of the fish passed over the screen within 5 min and 79–95% passed within 20 min. Our results indicate that when operated within its design criteria, the Farmers Screen provides safe and efficient downstream passage of juvenile salmonids under a variety of hydraulic conditions.

  19. A random plasma glucose method for screening for gestational diabetes.

    Science.gov (United States)

    Maheshwari, J R; Mataliya, M V

    1989-01-01

    Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG). RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated with RPG level. Thirty-six cases of gestational diabetes were picked up. The pick up rate is significantly higher as compared to that which would have been detected utilising conventional screening criteria.

  20. A random plasma glucose method for screening for gestational diabetes.

    Directory of Open Access Journals (Sweden)

    Maheshwari J

    1989-01-01

    Full Text Available Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG. RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated with RPG level. Thirty-six cases of gestational diabetes were picked up. The pick up rate is significantly higher as compared to that which would have been detected utilising conventional screening criteria.

  1. A new method for accurate estimation of velocity field statistics

    NARCIS (Netherlands)

    Bernardeau, F; vandeWeygaert, R

    1996-01-01

    We introduce two new methods to obtain reliable velocity field statistics from N-body simulations, or indeed from any general density and velocity fluctuation field sampled by discrete points, These methods, the Voronoi tessellation method and Delaunay tessellation method, are based on the use of

  2. A random plasma glucose method for screening for gestational diabetes.

    OpenAIRE

    Maheshwari J; Mataliya M

    1989-01-01

    Low renal threshold for glucose during pregnancy renders glycosuria less specific for the diagnosis of gestational diabetes. Screening for gestational diabetes was done by utilising random plasma glucose (RPG). RPG was done at the first antenatal visit. In 12,623 patients who registered for antenatal care at the N.W.M. Hospital, 1371 patients had a RPG more than 100 mg%. An oral glucose tolerance test was advised in these patients. The pick-up rate of gestational diabetes correlated wi...

  3. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  4. Appraisal of artificial screening techniques of tomato to accurately reflect field performance of the late blight resistance.

    Science.gov (United States)

    Nowakowska, Marzena; Nowicki, Marcin; Kłosińska, Urszula; Maciorowski, Robert; Kozik, Elżbieta U

    2014-01-01

    Late blight (LB) caused by the oomycete Phytophthora infestans continues to thwart global tomato production, while only few resistant cultivars have been introduced locally. In order to gain from the released tomato germplasm with LB resistance, we compared the 5-year field performance of LB resistance in several tomato cultigens, with the results of controlled conditions testing (i.e., detached leaflet/leaf, whole plant). In case of these artificial screening techniques, the effects of plant age and inoculum concentration were additionally considered. In the field trials, LA 1033, L 3707, L 3708 displayed the highest LB resistance, and could be used for cultivar development under Polish conditions. Of the three methods using controlled conditions, the detached leaf and the whole plant tests had the highest correlation with the field experiments. The plant age effect on LB resistance in tomato reported here, irrespective of the cultigen tested or inoculum concentration used, makes it important to standardize the test parameters when screening for resistance. Our results help show why other reports disagree on LB resistance in tomato.

  5. Appraisal of artificial screening techniques of tomato to accurately reflect field performance of the late blight resistance.

    Directory of Open Access Journals (Sweden)

    Marzena Nowakowska

    Full Text Available Late blight (LB caused by the oomycete Phytophthora infestans continues to thwart global tomato production, while only few resistant cultivars have been introduced locally. In order to gain from the released tomato germplasm with LB resistance, we compared the 5-year field performance of LB resistance in several tomato cultigens, with the results of controlled conditions testing (i.e., detached leaflet/leaf, whole plant. In case of these artificial screening techniques, the effects of plant age and inoculum concentration were additionally considered. In the field trials, LA 1033, L 3707, L 3708 displayed the highest LB resistance, and could be used for cultivar development under Polish conditions. Of the three methods using controlled conditions, the detached leaf and the whole plant tests had the highest correlation with the field experiments. The plant age effect on LB resistance in tomato reported here, irrespective of the cultigen tested or inoculum concentration used, makes it important to standardize the test parameters when screening for resistance. Our results help show why other reports disagree on LB resistance in tomato.

  6. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  7. Accurate method of the magnetic field measurement of quadrupole magnets

    International Nuclear Information System (INIS)

    Kumada, M.; Sakai, I.; Someya, H.; Sasaki, H.

    1983-01-01

    We present an accurate method of the magnetic field measurement of the quadrupole magnet. The method of obtaining the information of the field gradient and the effective focussing length is given. A new scheme to obtain the information of the skew field components is also proposed. The relative accuracy of the measurement was 1 x 10 -4 or less. (author)

  8. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  9. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  10. Damped time advance methods for particles and EM fields

    International Nuclear Information System (INIS)

    Friedman, A.; Ambrosiano, J.J.; Boyd, J.K.; Brandon, S.T.; Nielsen, D.E. Jr.; Rambo, P.W.

    1990-01-01

    Recent developments in the application of damped time advance methods to plasma simulations include the synthesis of implicit and explicit ''adjustably damped'' second order accurate methods for particle motion and electromagnetic field propagation. This paper discusses this method

  11. Calibration and uncertainty in electromagnetic fields measuring methods

    International Nuclear Information System (INIS)

    Anglesio, L.; Crotti, G.; Borsero, M.; Vizio, G.

    1999-01-01

    Calibration and reliability in electromagnetic field measuring methods are assured by calibration of measuring instruments. In this work are illustrated systems for generation of electromagnetic fields at low and high frequency, calibration standard and accuracy [it

  12. Application Of Active Screen Method For Ion Nitriding Efficiency Improvement

    Directory of Open Access Journals (Sweden)

    Ogórek M.

    2015-06-01

    Full Text Available Paper presents the research of austenitic steel AISI 304 after ion nitriding at 400°C and at t =4h, for the two different variants of samples distribution in the working plasma reactive chamber tube. In order to assess the effectiveness of ion nitriding variants emission spectroscopy – GDOES, surface hardness tests, microstructure research (LM of nitrided layers were made. It has been found that the use of active screens increases the surface layer thickness and depth of nitrogen diffusion into austenitic steel 304.

  13. A screening questionnaire for convulsive seizures: A three-stage field-validation in rural Bolivia.

    Science.gov (United States)

    Giuliano, Loretta; Cicero, Calogero Edoardo; Crespo Gómez, Elizabeth Blanca; Padilla, Sandra; Bruno, Elisa; Camargo, Mario; Marin, Benoit; Sofia, Vito; Preux, Pierre-Marie; Strohmeyer, Marianne; Bartoloni, Alessandro; Nicoletti, Alessandra

    2017-01-01

    Epilepsy is one of the most common neurological diseases in Latin American Countries (LAC) and epilepsy associated with convulsive seizures is the most frequent type. Therefore, the detection of convulsive seizures is a priority, but a validated Spanish-language screening tool to detect convulsive seizures is not available. We performed a field validation to evaluate the accuracy of a Spanish-language questionnaire to detect convulsive seizures in rural Bolivia using a three-stage design. The questionnaire was also administered face-to-face, using a two-stage design, to evaluate the difference in accuracy. The study was carried out in the rural communities of the Gran Chaco region. The questionnaire consists of a single screening question directed toward the householders and a confirmatory section administered face-to-face to the index case. Positive subjects underwent a neurological examination to detect false positive and true positive subjects. To estimate the proportion of false negative, a random sample of about 20% of the screened negative underwent a neurological evaluation. 792 householders have been interviewed representing a population of 3,562 subjects (52.2% men; mean age 24.5 ± 19.7 years). We found a sensitivity of 76.3% (95% CI 59.8-88.6) with a specificity of 99.6% (95% CI 99.4-99.8). The two-stage design showed only a slightly higher sensitivity respect to the three-stage design. Our screening tool shows a good accuracy and can be easily used by trained health workers to quickly screen the population of the rural communities of LAC through the householders using a three-stage design.

  14. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  15. A new microbial screening method for the detection of antimicrobial residues in slaughter animals: The Nouws antibiotic test (NAT-screening)

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Oostra-van Dijk, S.; Schouten, J.; Rapallini, M.; Egmond, van H.J.

    2008-01-01

    An improved microbial method for the screening of antimicrobial residues in slaughter animals has been developed. The Nouws antibiotic test (NAT-screening) is based on the analysis of renal pelvis fluid and comprises five test plates enabling group specific identification. The NAT-screening combines

  16. A comparison of protein kinases inhibitor screening methods using both enzymatic activity and binding affinity determination

    DEFF Research Database (Denmark)

    Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan

    2014-01-01

    Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening...

  17. Nouws antibiotics test: Validation of a post-screening method for antibiotic residues in kidney

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Oostra-van Dijk, S.; Schouten, J.; Rapallini, M.; Kortenhoeven, L.; Egmond, van H.J.

    2009-01-01

    Anticipating the rise in ‘suspect’ samples caused by the introduction of a more sensitive screening test for the presence of antibiotic residues in slaughter animals, an additional microbial post-screening method was developed. The test comprises four antibiotic group specific test plates, optimized

  18. Terbium-sensitized luminescence screening method for fluoroquinolones in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods commonly used for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay was developed...

  19. Electron field emission from screen-printed graphene/DWCNT composite films

    International Nuclear Information System (INIS)

    Xu, Jinzhuo; Pan, Rong; Chen, Yiwei; Piao, Xianqin; Qian, Min; Feng, Tao; Sun, Zhuo

    2013-01-01

    Highlights: ► The field emission performance improved significantly when adding graphene into DWCNTs as the emission material. ► We set up a model of pure DWCNT films and graphene/DWCNT composite films. ► We discussed the contact barrier between emission films and electric substrates by considering the Fermi energies of silver, DWCNT and graphene. - Abstract: The electron field emission properties of graphene/double-walled carbon nanotube (DWCNT) composite films prepared by screen printing have been systematically studied. Comparing with the pure DWCNT films and pure graphene films, a significant enhancement of electron emission performance of the composite films are observed, such as lower turn-on field, higher emission current density, higher field enhancement factor, and long-term stability. The optimized composite films with 20% weight ratio of graphene show the best electron emission performance with a low turn-on field of 0.62 V μm −1 (at 1 μA cm −2 ) and a high field enhancement factor β of 13,000. A model of the graphene/DWCNT composite films is proposed, which indicate that a certain amount of graphene will contribute the electron transmission in the silver substrate/composite films interface and in the interior of composite films, and finally improve the electron emission performance of the graphene/DWCNT composite films.

  20. Machine learning improves the precision and robustness of high-content screens: using nonlinear multiparametric methods to analyze screening results.

    Science.gov (United States)

    Horvath, Peter; Wild, Thomas; Kutay, Ulrike; Csucs, Gabor

    2011-10-01

    Imaging-based high-content screens often rely on single cell-based evaluation of phenotypes in large data sets of microscopic images. Traditionally, these screens are analyzed by extracting a few image-related parameters and use their ratios (linear single or multiparametric separation) to classify the cells into various phenotypic classes. In this study, the authors show how machine learning-based classification of individual cells outperforms those classical ratio-based techniques. Using fluorescent intensity and morphological and texture features, they evaluated how the performance of data analysis increases with increasing feature numbers. Their findings are based on a case study involving an siRNA screen monitoring nucleoplasmic and nucleolar accumulation of a fluorescently tagged reporter protein. For the analysis, they developed a complete analysis workflow incorporating image segmentation, feature extraction, cell classification, hit detection, and visualization of the results. For the classification task, the authors have established a new graphical framework, the Advanced Cell Classifier, which provides a very accurate high-content screen analysis with minimal user interaction, offering access to a variety of advanced machine learning methods.

  1. Interval breast cancer characteristics before, during and after the transition from screen-film to full-field digital screening mammography.

    Science.gov (United States)

    van Bommel, Rob M G; Weber, Roy; Voogd, Adri C; Nederend, Joost; Louwman, Marieke W J; Venderink, Dick; Strobbe, Luc J A; Rutten, Matthieu J C; Plaisier, Menno L; Lohle, Paul N; Hooijen, Marianne J H; Tjan-Heijnen, Vivianne C G; Duijm, Lucien E M

    2017-05-05

    To determine the proportion of "true" interval cancers and tumor characteristics of interval breast cancers prior to, during and after the transition from screen-film mammography screening (SFM) to full-field digital mammography screening (FFDM). We included all women with interval cancers detected between January 2006 and January 2014. Breast imaging reports, biopsy results and breast surgery reports of all women recalled at screening mammography and of all women with interval breast cancers were collected. Two experienced screening radiologists reviewed the diagnostic mammograms, on which the interval cancers were diagnosed, as well as the prior screening mammograms and determined whether or not the interval cancer had been missed on the most recent screening mammogram. If not missed, the cancer was considered an occult ("true") interval cancer. A total of 442 interval cancers had been diagnosed, of which 144 at SFM with a prior SFM (SFM-SFM), 159 at FFDM with a prior SFM (FFDM-SFM) and 139 at FFDM with a prior FFDM (FFDM-FFDM). The transition from SFM to FFDM screening resulted in the diagnosis of more occult ("true") interval cancers at FFDM-SFM than at SFM-SFM (65.4% (104/159) versus 49.3% (71/144), P mammography. However, this increase seems temporary and is no longer detectable after the second round of digital screening. Tumor characteristics and type of surgery are comparable for interval cancers detected prior to, during and after the transition from SFM to FFDM screening mammography, except of a lower proportion of invasive ductal cancers after the transition.

  2. Advanced Fuzzy Potential Field Method for Mobile Robot Obstacle Avoidance

    Science.gov (United States)

    Park, Jong-Wook; Kwak, Hwan-Joo; Kang, Young-Chang; Kim, Dong W.

    2016-01-01

    An advanced fuzzy potential field method for mobile robot obstacle avoidance is proposed. The potential field method primarily deals with the repulsive forces surrounding obstacles, while fuzzy control logic focuses on fuzzy rules that handle linguistic variables and describe the knowledge of experts. The design of a fuzzy controller—advanced fuzzy potential field method (AFPFM)—that models and enhances the conventional potential field method is proposed and discussed. This study also examines the rule-explosion problem of conventional fuzzy logic and assesses the performance of our proposed AFPFM through simulations carried out using a mobile robot. PMID:27123001

  3. Advanced Fuzzy Potential Field Method for Mobile Robot Obstacle Avoidance.

    Science.gov (United States)

    Park, Jong-Wook; Kwak, Hwan-Joo; Kang, Young-Chang; Kim, Dong W

    2016-01-01

    An advanced fuzzy potential field method for mobile robot obstacle avoidance is proposed. The potential field method primarily deals with the repulsive forces surrounding obstacles, while fuzzy control logic focuses on fuzzy rules that handle linguistic variables and describe the knowledge of experts. The design of a fuzzy controller--advanced fuzzy potential field method (AFPFM)--that models and enhances the conventional potential field method is proposed and discussed. This study also examines the rule-explosion problem of conventional fuzzy logic and assesses the performance of our proposed AFPFM through simulations carried out using a mobile robot.

  4. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  5. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  6. Comparison of different dose calculation methods for irregular photon fields

    International Nuclear Information System (INIS)

    Zakaria, G.A.; Schuette, W.

    2000-01-01

    In this work, 4 calculation methods (Wrede method, Clarskon method of sector integration, beam-zone method of Quast and pencil-beam method of Ahnesjoe) are introduced to calculate point doses in different irregular photon fields. The calculations cover a typical mantle field, an inverted Y-field and different blocked fields for 4 and 10 MV photon energies. The results are compared to those of measurements in a water phantom. The Clarkson and the pencil-beam method have been proved to be the methods of equal standard in relation to accuracy. Both of these methods are being distinguished by minimum deviations and applied in our clinical routine work. The Wrede and beam-zone methods deliver useful results to central beam and yet provide larger deviations in calculating points beyond the central axis. (orig.) [de

  7. High-throughput bubble screening method for combinatorial discovery of electrocatalysts for water splitting.

    Science.gov (United States)

    Xiang, Chengxiang; Suram, Santosh K; Haber, Joel A; Guevarra, Dan W; Soedarmadji, Ed; Jin, Jian; Gregoire, John M

    2014-02-10

    Combinatorial synthesis and screening for discovery of electrocatalysts has received increasing attention, particularly for energy-related technologies. High-throughput discovery strategies typically employ a fast, reliable initial screening technique that is able to identify active catalyst composition regions. Traditional electrochemical characterization via current-voltage measurements is inherently throughput-limited, as such measurements are most readily performed by serial screening. Parallel screening methods can yield much higher throughput and generally require the use of an indirect measurement of catalytic activity. In a water-splitting reaction, the change of local pH or the presence of oxygen and hydrogen in the solution can be utilized for parallel screening of active electrocatalysts. Previously reported techniques for measuring these signals typically function in a narrow pH range and are not suitable for both strong acidic and basic environments. A simple approach to screen the electrocatalytic activities by imaging the oxygen and hydrogen bubbles produced by the oxygen evolution reaction (OER) and hydrogen evolution reaction (HER) is reported here. A custom built electrochemical cell was employed to record the bubble evolution during the screening, where the testing materials were subject to desired electrochemical potentials. The transient of the bubble intensity obtained from the screening was quantitatively analyzed to yield a bubble figure of merit (FOM) that represents the reaction rate. Active catalysts in a pseudoternary material library, (Ni-Fe-Co)Ox, which contains 231 unique compositions, were identified in less than one minute using the bubble screening method. An independent, serial screening method on the same material library exhibited excellent agreement with the parallel bubble screening. This general approach is highly parallel and is independent of solution pH.

  8. Stream temperature investigations: field and analytic methods

    Science.gov (United States)

    Bartholow, J.M.

    1989-01-01

    This document provides guidance to the user of the U.S. Fish and Wildlife Service’s Stream Network Temperature Model (SNTEMP). Planning a temperature study is discussed in terms of understanding the management objectives and ensuring that the questions will be accurately answered with the modeling approach being used. A sensitivity analysis of SNTEMP is presented to illustrate which input variables are most important in predicting stream temperatures. This information helps prioritize data collection activities, highlights the need for quality control, focuses on which parameters can be estimated rather than measured, and offers a broader perspective on management options in terms of knowing where the biggest temperature response will be felt. All of the major input variables for stream geometry, meteorology, and hydrology are discussed in detail. Each variable is defined, with guidance given on how to measure it, what kind of equipment to use, where to obtain it from another agency, and how to calculate it if the data are in a form other than that required by SNTEMP. Examples are presented for the various forms in which water temperature, discharge, and meteorological data are commonly found. Ranges of values for certain input variables that are difficult to measure of estimate are given. Particular attention is given to those variables not commonly understood by field biologists likely to be involved in a stream temperature study. Pertinent literature is cited for each variable, with emphasis on how other people have treated particular problems and on results they have found.

  9. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  10. A new screening method for Ganoderma philippii tolerance in ...

    African Journals Online (AJOL)

    Red root rot disease caused by Ganoderma philippii is one of the most economically important diseases of tropical Acacia species. Research on field control of the disease has to date focused on inoculum reduction, silviculture practices and application of biological control agents. Incorporation of tolerant genotypes, a key ...

  11. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  12. Analyzed method for calculating the distribution of electrostatic field

    International Nuclear Information System (INIS)

    Lai, W.

    1981-01-01

    An analyzed method for calculating the distribution of electrostatic field under any given axial gradient in tandem accelerators is described. This method possesses satisfactory accuracy compared with the results of numerical calculation

  13. Predictive simulations and optimization of nanowire field-effect PSA sensors including screening

    KAUST Repository

    Baumgartner, Stefan

    2013-05-03

    We apply our self-consistent PDE model for the electrical response of field-effect sensors to the 3D simulation of nanowire PSA (prostate-specific antigen) sensors. The charge concentration in the biofunctionalized boundary layer at the semiconductor-electrolyte interface is calculated using the propka algorithm, and the screening of the biomolecules by the free ions in the liquid is modeled by a sensitivity factor. This comprehensive approach yields excellent agreement with experimental current-voltage characteristics without any fitting parameters. Having verified the numerical model in this manner, we study the sensitivity of nanowire PSA sensors by changing device parameters, making it possible to optimize the devices and revealing the attributes of the optimal field-effect sensor. © 2013 IOP Publishing Ltd.

  14. Flow method and apparatus for screening chemicals using micro x-ray fluorescence

    Science.gov (United States)

    Warner, Benjamin P [Los Alamos, NM; Havrilla, George J [Los Alamos, NM; Miller, Thomasin C [Bartlesville, OK; Lewis, Cris [Los Alamos, NM; Mahan, Cynthia A [Los Alamos, NM; Wells, Cyndi A [Los Alamos, NM

    2009-04-14

    Method and apparatus for screening chemicals using micro x-ray fluorescence. A method for screening a mixture of potential pharmaceutical chemicals for binding to at least one target binder involves flow-separating a solution of chemicals and target binders into separated components, exposing them to an x-ray excitation beam, detecting x-ray fluorescence signals from the components, and determining from the signals whether or not a binding event between a chemical and target binder has occurred.

  15. Dysregulation of microRNAs in colonic field carcinogenesis: implications for screening.

    Directory of Open Access Journals (Sweden)

    Dhananjay P Kunte

    Full Text Available Colorectal cancer (CRC screening tests often have a trade-off between efficacy and patient acceptability/cost. Fecal tests (occult blood, methylation engender excellent patient compliance but lack requisite performance underscoring the need for better population screening tests. We assessed the utility of microRNAs (miRNAs as markers of field carcinogenesis and their potential role for CRC screening using the azoxymethane (AOM-treated rat model. We found that 63 miRNAs were upregulated and miR-122, miR-296-5p and miR-503# were downregulated in the uninvolved colonic mucosa of AOM rats. We monitored the expression of selected miRNAs in colonic biopsies of AOM rats at 16 weeks and correlated it with tumor development. We noted that the tumor bearing rats had significantly greater miRNA modulation compared to those without tumors. The miRNAs showed good diagnostic performance with an area under the receiver operator curve (AUROC of >0.7. We also noted that the miRNA induction in the colonic mucosa was mirrorred in the mucus layer fecal colonocytes isolated from AOM rat stool and the degree of miRNA induction was greater in the tumor bearing rats compared to those without tumors. Lastly, we also noted significant miRNA modulation in the Pirc rats- the genetic model of colon carcinogenesis, both in the uninvolved colonic mucosa and the fecal colonocytes. We thus demonstrate that miRNAs are excellent markers of field carcinogenesis and could accurately predict future neoplasia. Based on our results, we propose an accurate, inexpensive, non-invasive miRNA test for CRC risk stratification based on rectal brushings or from abraded fecal colonocytes.

  16. SYNTHESIS OF ACTIVE SCREENING SYSTEM OF MAGNETIC FIELD OF HIGH VOLTAGE POWER LINES OF DIFFERENT DESIGN TAKING INTO ACCOUNT SPATIAL AND TEMPORAL DISTRIBUTION OF MAGNETIC FIELD

    Directory of Open Access Journals (Sweden)

    B.I. Kuznetsov

    2017-04-01

    Full Text Available Purpose. Analyze the spatial and temporal distribution of the magnetic field of high voltage power lines with different design allowing and development of recommendations for the design of active screening systems by magnetic field of high voltage power lines. Methodology. Analysis of the spatial and temporal distribution of the magnetic field of high voltage power lines of different design allowing is made on the basis of Maxwell's equations solutions in the quasi-stationary approximation. Determination of the number, configuration, spatial arrangement and the compensation coil currents is formulated in the form of multiobjective optimization problem that is solved by multi-agent multiswarm stochastic optimization based on Pareto optimal solutions. Results of active screening system for the synthesis of various types of transmission lines with different numbers of windings controlled. The possibility of a significant reduction in the level of the flux density of the magnetic field source within a given region of space. Originality. For the first time an analysis of the spatial and temporal distribution of the magnetic field of power lines with different types and based on findings developed recommendations for the design of active screening system by magnetic field of high voltage power lines. Practical value. Practical recommendations on reasonable choice of the number and spatial arrangement of compensating windings of active screening system by magnetic field of high voltage power lines of different design allowing for the spatial and temporal distribution of the magnetic field. Results of active screening system synthesis of the magnetic field of industrial frequency generated by single-circuit 110 kV high voltage power lines with the supports have 330 - 1T «triangle» rotating magnetic field with full polarization in a residential five-storey building, located near the power lines. The system contains three compensating coil and reduces

  17. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    genomic locus, but limits the detection of its correct genomic integration by standard PCR methods. Genomic Long Range PCR (LR-PCR), using primers adjacent to the homology arms, has been used as an alternative to radioactive-based Southern blot screenings. However, LR-PCRs are often difficult and render...... many false positive and false negative results. Here, we propose an alternative screening method based on the detection of a genetic modification at the mRNA level, which we successfully optimized in two mouse models. This screening method consists of a reverse-transcription PCR (RT-PCR) using primers...... that match exons flanking the targeting construct. The detection of the expected modification in this PCR product confirms the integration at the correct genomic location and shows that the mutant mRNA is expressed. This is a simple and sensitive strategy to screen locus-specific recombination of targeting...

  18. Chemical Safety Alert: Identifying Chemical Reactivity Hazards Preliminary Screening Method

    Science.gov (United States)

    Introduces small-to-medium-sized facilities to a method developed by Center for Chemical Process Safety (CCPS), based on a series of twelve yes-or-no questions to help determine hazards in warehousing, repackaging, blending, mixing, and processing.

  19. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  20. Comparing Vertical and Horizontal Screening Methods for Pharmacy Resident Candidates Before Interviews

    Directory of Open Access Journals (Sweden)

    Michael J. Peeters

    2015-01-01

    Full Text Available Purpose: Prior studies have examined autobiographical screening methods among medical student applicants, and demonstrated halo bias with single-rater scoring; though others have questioned its practical significance. Comparing with traditional vertical screening method, we evaluated a horizontal method for initial screening of Post-Graduate Year-1 (PGY-1 pharmacy practice resident candidate applications prior to interviews. Methods: Our screening rubric for PGY-1 pharmacy residency candidates consisted of eight criteria, each scored using a 5-point Likert scale. During the 2014 residency recruitment season, two single-evaluators (A&B scored all eight criteria and their scores were summed into total application scores (vertical method. Meanwhile two other evaluators (C&D each evaluated only two criteria for all applications. The four combined-evaluators (A-D scores, on two criteria each, were summed together into total application scores (horizontal method. For statistical comparison of single-evaluator and combined-evaluators, inter-component reliabilities were analyzed for each evaluator, while inter-rater consistency was also examined. For practical significance, actual selection differences were reviewed. Results:Forty-six applications were evaluated to determine 24 invitations for on-site interviews. Inter-component reliability differed among evaluatorA, evaluatorB, combined-evaluators A-D (Cronbach’s alpha of 0.74, 0.73, 0.58, respectively; lower better. Among raters, inter-rater consistency was excellent (0.86 by intraclass correlation, p Conclusion: Halo bias was seen with the single-evaluators (vertical method; two interview invitations were negatively impacted. For pharmacy resident screening, a horizontal screening method appears to be rigorous in promoting fairness for applicants. As pharmacy residency applications continue to grow, a fair and time-efficient method of screening seems imperative.   Type: Original Research

  1. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  2. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  3. Copper Sulphate Densitometry as a Screening Method for Anaemia ...

    African Journals Online (AJOL)

    to identify those pregnant mothers with severe anemia. The cyanmethaemoglobin. (HiCN) method was performed as recommended by the ICSH (16). Corning. 252 colorimeter was used to read the absorbance and its linearitv was ..... closed glass or plastic containers. As it is shown in Table 3 the comparison bin tile copper ...

  4. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  5. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  6. The Virtual Fields Method Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements

    CERN Document Server

    Pierron, Fabrice

    2012-01-01

    The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is the first book on the Virtual Fields Method (VFM), a technique to identify materials mechanical properties from full-field measurements. Firmly rooted with extensive theoretical description of the method, the book presents numerous examples of application to a wide range of materials (composites, metals, welds, biomaterials) and situations (static, vibration, high strain rate). The authors give a detailed training section with examples of progressive difficulty to lead the reader to program the VFM and include a set of commented Matlab programs as well as GUI Matlab-based software for more general situations. The Virtual Fields Method: Extracting Constitutive Mechanical Parameters from Full-field Deformation Measurements is an ideal book for researchers, engineers, and students interested in applying the VFM to new situations motivated by their research.  

  7. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  8. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  9. Field demonstrations of passive detectors for screening of alpha contaminated soils

    International Nuclear Information System (INIS)

    Meyer, K.E.; Gammage, R.B.; Dudney, C.S.

    1994-01-01

    There are numerous sites around the country, DOE and otherwise, that are faced with the daunting task of remediating radiologically contaminated soils and groundwaters. Some of these sites, such as the Nevada Test Site and the Rocky Flats Plant, have contaminants that have been dispersed over wide areas. The costs of the characterization phase alone for such remediation programs can be prohibitive. Therefore there are pressing needs for testing and evaluation of new technologies for screening for radiological contaminants that may offer significant advantages in capital costs, ease of use, sensitivity, ruggedness, and/or reliability. This work reports on laboratory and Field tests of two types of passive alpha detectors, electret ionization chambers (EIC's) and alpha track detectors (ATD's), that have been commercially developed for indoor radon measurements. Previous work documented calibration and measurement protocols developed for these detectors for indoor surface contamination measurements

  10. Overlay control methodology comparison: field-by-field and high-order methods

    Science.gov (United States)

    Huang, Chun-Yen; Chiu, Chui-Fu; Wu, Wen-Bin; Shih, Chiang-Lin; Huang, Chin-Chou Kevin; Huang, Healthy; Choi, DongSub; Pierson, Bill; Robinson, John C.

    2012-03-01

    Overlay control in advanced integrated circuit (IC) manufacturing is becoming one of the leading lithographic challenges in the 3x and 2x nm process nodes. Production overlay control can no longer meet the stringent emerging requirements based on linear composite wafer and field models with sampling of 10 to 20 fields and 4 to 5 sites per field, which was the industry standard for many years. Methods that have emerged include overlay metrology in many or all fields, including the high order field model method called high order control (HOC), and field by field control (FxFc) methods also called correction per exposure. The HOC and FxFc methods were initially introduced as relatively infrequent scanner qualification activities meant to supplement linear production schemes. More recently, however, it is clear that production control is also requiring intense sampling, similar high order and FxFc methods. The added control benefits of high order and FxFc overlay methods need to be balanced with the increased metrology requirements, however, without putting material at risk. Of critical importance is the proper control of edge fields, which requires intensive sampling in order to minimize signatures. In this study we compare various methods of overlay control including the performance levels that can be achieved.

  11. Screening methods for assessing damage to natural resources following the Exxon Valdez oil spill

    International Nuclear Information System (INIS)

    Krahn, M.M.; Ylitalo, G.M.; Buzitis, J.; Krone, C.A.; Stein, J.E.; Chan, S.L.; Varanasi, U.

    1993-01-01

    Evaluating the extent of the damage to natural resources after a major oil spill, such as the Exxon Valdez spill in Prince William Sound, Alaska, requires the analysis of thousands of samples of sediment and biota. Therefore, the use of rapid, low-cost analytical methods-generally known as screening methods-to estimate concentrations of petroleum-related aromatic compounds in samples is vitally important to the production of timely information in an emergency response. These screening procedures can rapidly process large numbers of samples to yield semiquantitative estimates of contaminant and allow ranking of samples by degree of contamination. Thus, the most contaminated samples can be located rapidly by screening, and detailed analyses; for example, gas chromatography/ mass spectrometry, (GC/MS) can be focused on selected samples to confirm the presence of contaminants. Screening methods were developed for sediments, bile, and tissue. Petroleum-related aromatics are screened for in sediments using size-exclusion HPLC. Aromatic metabolites are screened for in bile and tissue of fish by reversed-phase HPLC with fluorescence detection

  12. Two numerical methods for mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2016-01-09

    Here, we consider numerical methods for stationary mean-field games (MFG) and investigate two classes of algorithms. The first one is a gradient flow method based on the variational characterization of certain MFG. The second one uses monotonicity properties of MFG. We illustrate our methods with various examples, including one-dimensional periodic MFG, congestion problems, and higher-dimensional models.

  13. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening...

  14. Psychophysical Calibration of Mobile Touch-Screens for Vision Testing in the Field

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2015-01-01

    The now ubiquitous nature of touch-screen displays in cell phones and tablet computers makes them an attractive option for vision testing outside of the laboratory or clinic. Accurate measurement of parameters such as contrast sensitivity, however, requires precise control of absolute and relative screen luminances. The nonlinearity of the display response (gamma) can be measured or checked using a minimum motion technique similar to that developed by Anstis and Cavanagh (1983) for the determination of isoluminance. While the relative luminances of the color primaries vary between subjects (due to factors such as individual differences in pre-retinal pigment densities), the gamma nonlinearity can be checked in the lab using a photometer. Here we compare results obtained using the psychophysical method with physical measurements for a number of different devices. In addition, we present a novel physical method using the device's built-in front-facing camera in conjunction with a mirror to jointly calibrate the camera and display. A high degree of consistency between devices is found, but some departures from ideal performance are observed. In spite of this, the effects of calibration errors and display artifacts on estimates of contrast sensitivity are found to be small.

  15. Task 1.11 - Spectroscopic field screening of hazardous waste and toxic spills. Semi-annual report, January 1 - June 30, 1995

    International Nuclear Information System (INIS)

    Gristanti, A.A.

    1995-01-01

    Techniques for the field characterization of soil contamination due to spillage of hazardous waste or toxic chemicals are time-consuming and expensive. Thus, more economical, less time-intensive methods are needed to facilitate rapid field screening of contaminated sites. In situ detection of toxic chemicals in soil offers both time and cost advantages for field screening with additional application to real-time site monitoring. Fourier-transform infrared (FT-IR) spectroscopy coupled with evanescent mode fiber-optic sensors has been demonstrated as a means to remotely detect and classify petroleum products in water using mid-infrared (MIR) optical fibers. This work demonstrated that a fiber-optic evanescent field absorbance sensor (EFAS) could be used to classify petroleum contamination into categories such as crude oil, kerosene, No. 2 fuel and residual distillates using the MIR spectral range. The overall objective of this project is to study the feasibility of using an EFAS FT-IR spectroscopic sensor coupled with cone penetrometry as a field screening method. The Fourier transform infrared cone penetrometry method (FT-IR-CPT) will be developed by building on the work cited above. The specific objectives of this project are: design an accessory for use with FT-IR that interfaces the spectrometer to a cone penetrometer; characterize the response of the FT-IR accessory to selected hydrocarbons in a laboratory-simulated field environment; and determine the ability of the FT-IR-CPT instrument to measure hydrocarbon contamination in soil by direct comparison with a reference method to quantify hydrocarbons from the same soil

  16. Pharmacy Diabetes Screening Trial: protocol for a pragmatic cluster-randomised controlled trial to compare three screening methods for undiagnosed type 2 diabetes in Australian community pharmacy

    OpenAIRE

    Krass, Ines; Carter, Rob; Mitchell, Bernadette; Mohebbi, Mohammadreza; Shih, Sophy T F; Trinder, Peta; Versace, Vincent L; Wilson, Frances; Namara, Kevin Mc

    2017-01-01

    Introduction With the rising prevalence of type 2 diabetes in Australia, screening and earlier diagnosis is needed to provide opportunities to intervene with evidence-based lifestyle and treatment options to reduce the individual, social and economic impact of the disease. The objectives of the Pharmacy Diabetes Screening Trial are to compare the clinical effectiveness and cost-effectiveness of three screening models for type 2 diabetes in a previously undiagnosed population. Methods and anal...

  17. Measuring methods, registration and signal processing for magnetic field research

    International Nuclear Information System (INIS)

    Nagiello, Z.

    1981-01-01

    Some measuring methods and signal processing systems based on analogue and digital technics, which have been applied in magnetic field research using magnetometers with ferromagnetic transducers, are presented. (author)

  18. Primary Care Screening Methods and Outcomes for Asylum Seekers in New York City.

    Science.gov (United States)

    Bertelsen, Nathan S; Selden, Elizabeth; Krass, Polina; Keatley, Eva S; Keller, Allen

    2018-02-01

    Effective screening in primary care among asylum-seekers in the US is critical as this population grows. This study aimed to evaluate disease prevalence and screening methods in this high-risk group. Two hundred ten new clients from 51 countries, plus Tibet, who were accepted into a program for asylum seekers from 2012 to 2014 were included. Screening rates and outcomes for infectious, non-communicable, and mental illnesses were evaluated. Screening rates were highest for PTSD, depression, hepatitis B, and latent tuberculosis. Seventy-one percent of clients screened positive for depression and 55 % for PTSD, followed by latent tuberculosis (41 %), hypertension (10 %), hepatitis B (9.4 %), and HIV (0.8 %). Overall screening rates were high. Point of care testing was more effective than testing that required a repeat visit. A large psychiatric and infectious disease burden was identified. These findings can inform future primary care screening efforts for asylum seekers in the US.

  19. New Method for Solving Inductive Electric Fields in the Ionosphere

    Science.gov (United States)

    Vanhamäki, H.

    2005-12-01

    We present a new method for calculating inductive electric fields in the ionosphere. It is well established that on large scales the ionospheric electric field is a potential field. This is understandable, since the temporal variations of large scale current systems are generally quite slow, in the timescales of several minutes, so inductive effects should be small. However, studies of Alfven wave reflection have indicated that in some situations inductive phenomena could well play a significant role in the reflection process, and thus modify the nature of ionosphere-magnetosphere coupling. The input to our calculation method are the time series of the potential part of the ionospheric electric field together with the Hall and Pedersen conductances. The output is the time series of the induced rotational part of the ionospheric electric field. The calculation method works in the time-domain and can be used with non-uniform, time-dependent conductances. In addition no particular symmetry requirements are imposed on the input potential electric field. The presented method makes use of special non-local vector basis functions called Cartesian Elementary Current Systems (CECS). This vector basis offers a convenient way of representing curl-free and divergence-free parts of 2-dimensional vector fields and makes it possible to solve the induction problem using simple linear algebra. The new calculation method is validated by comparing it with previously published results for Alfven wave reflection from uniformly conducting ionosphere.

  20. Hazard Screening Methods for Nanomaterials: A Comparative Study

    Directory of Open Access Journals (Sweden)

    Barry Sheehan

    2018-02-01

    Full Text Available Hazard identification is the key step in risk assessment and management of manufactured nanomaterials (NM. However, the rapid commercialisation of nano-enabled products continues to out-pace the development of a prudent risk management mechanism that is widely accepted by the scientific community and enforced by regulators. However, a growing body of academic literature is developing promising quantitative methods. Two approaches have gained significant currency. Bayesian networks (BN are a probabilistic, machine learning approach while the weight of evidence (WoE statistical framework is based on expert elicitation. This comparative study investigates the efficacy of quantitative WoE and Bayesian methodologies in ranking the potential hazard of metal and metal-oxide NMs—TiO2, Ag, and ZnO. This research finds that hazard ranking is consistent for both risk assessment approaches. The BN and WoE models both utilize physico-chemical, toxicological, and study type data to infer the hazard potential. The BN exhibits more stability when the models are perturbed with new data. The BN has the significant advantage of self-learning with new data; however, this assumes all input data is equally valid. This research finds that a combination of WoE that would rank input data along with the BN is the optimal hazard assessment framework.

  1. Fingerprints: A simple method for Screening Hemophilic Patients.

    Science.gov (United States)

    Jamalian, M; Mesri, M; Vishteh, H R K; Solhi, H; Salehpour, R

    2014-08-01

    The present study aims to compare hemophilic patients' fingerprint types with the normal people to help diagnose the disease, particularly new occurrences of the disease. This case-control study was conducted in 2012. Sixty two patients with hemophilia type A and 62 normal healthy people were selected. The type of fingerprint was determined by a forensic specialist who was kept unaware of the participants' group. Using advanced Henry method, the main types of fingerprints were classified as arch, loop, whorl, as well as other types. In the control group, loop type (65%) and in the case group the whorl type (34%) were the most frequent fingerprint type (p fingerprint in each finger between two groups. In addition, the average number of whorl type in the patients with mild disease was significantly higher and the average number of arch and other types of fingerprints was significantly lower than patients with moderate or severe disease. The findings of the present study indicated that not only are the fingerprints of normal and hemophilic people different, but also a difference was observed between hemophilic patients with the mild factor level and patients with moderate or severe one.

  2. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  3. Recommendations for Developing Alternative Test Methods for Screening and Prioritization of Chemicals for Developmental Neurotoxicity

    Science.gov (United States)

    Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternative methods to current animal testing protocols and gUidelines. An immediate goal is to develop test methods that are capable of screening large numbers of chemic...

  4. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    renormalization of a 2D material embedded in an arbitrary vdWH. The method evaluates the change in the GW self-energy of the 2D material from the change in the screened Coulomb interaction. The latter is obtained using the quantum-electrostatic heterostructure (QEH) model. We benchmark the GΔW method against full...

  5. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  6. State of the art in the validation of screening methods for the control of antibiotic residues: is there a need for further development?

    Science.gov (United States)

    Gaudin, Valérie

    2017-09-01

    Screening methods are used as a first-line approach to detect the presence of antibiotic residues in food of animal origin. The validation process guarantees that the method is fit-for-purpose, suited to regulatory requirements, and provides evidence of its performance. This article is focused on intra-laboratory validation. The first step in validation is characterisation of performance, and the second step is the validation itself with regard to pre-established criteria. The validation approaches can be absolute (a single method) or relative (comparison of methods), overall (combination of several characteristics in one) or criterion-by-criterion. Various approaches to validation, in the form of regulations, guidelines or standards, are presented and discussed to draw conclusions on their potential application for different residue screening methods, and to determine whether or not they reach the same conclusions. The approach by comparison of methods is not suitable for screening methods for antibiotic residues. The overall approaches, such as probability of detection (POD) and accuracy profile, are increasingly used in other fields of application. They may be of interest for screening methods for antibiotic residues. Finally, the criterion-by-criterion approach (Decision 2002/657/EC and of European guideline for the validation of screening methods), usually applied to the screening methods for antibiotic residues, introduced a major characteristic and an improvement in the validation, i.e. the detection capability (CCβ). In conclusion, screening methods are constantly evolving, thanks to the development of new biosensors or liquid chromatography coupled to tandem-mass spectrometry (LC-MS/MS) methods. There have been clear changes in validation approaches these last 20 years. Continued progress is required and perspectives for future development of guidelines, regulations and standards for validation are presented here.

  7. Field and greenhouse inoculation methods for assessment of sheath blight resistance in rice

    Directory of Open Access Journals (Sweden)

    Leila Garcês de Araújo

    2007-01-01

    Full Text Available Field and greenhouse inoculation methods were compared to determine the genetic variation for resistance toRhizoctonia solani in 38 somaclones of rice cultivar Metica-1. Rice plants in pots were inoculated with isolate 4F1 at the ageof sixty four days, with 2.0 g of the fungal culture, multiplied on rice grain and hull medium and placed on the soil surfacearound the plant. The differences among somaclones in relation to lesion height were significant and varied from 6.5 to 15.5cm. In the field trial of artificial inoculation with fungal culture, 52 days after planting, the lesion height varied from 6.2 to 17.7cm. The correlation between disease severity in the greenhouse and the field was positive and highly significant (r=0.44;P< 0.01, indicating the greenhouse inoculation as a safe method for screening germplasm for sheath blight resistance.

  8. Rapid high temperature field test method for evaluation of geothermal calcite scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1982-08-01

    A test method is described which allows the rapid field testing of calcite scale inhibitors in high- temperature geothermal brines. Five commercial formulations, chosen on the basis of laboratory screening tests, were tested in brines with low total dissolved solids at ca 500 F. Four were found to be effective; of these, 2 were found to be capable of removing recently deposited scale. One chemical was tested in the full-flow brine line for 6 wks. It was shown to stop a severe surface scaling problem at the well's control valve, thus proving the viability of the rapid test method. (12 refs.)

  9. Domain decomposition methods in FVM approach to gravity field modelling.

    Science.gov (United States)

    Macák, Marek

    2017-04-01

    The finite volume method (FVM) as a numerical method can be straightforwardly implemented for global or local gravity field modelling. This discretization method solves the geodetic boundary value problems in a space domain. In order to obtain precise numerical solutions, it usually requires very refined discretization leading to large-scale parallel computations. To optimize such computations, we present a special class of numerical techniques that are based on a physical decomposition of the global solution domain. The domain decomposition (DD) methods like the Multiplicative Schwarz Method and Additive Schwarz Method are very efficient methods for solving partial differential equations. We briefly present their mathematical formulations and we test their efficiency. Presented numerical experiments are dealing with gravity field modelling. Since there is no need to solve special interface problems between neighbouring subdomains, in our applications we use the overlapping DD methods.

  10. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  11. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.

    1992-01-01

    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  12. Anthropometric methods for obesity screening in schoolchildren: the Ouro Preto Study.

    Science.gov (United States)

    Cándido, A P C; Alosta, J P S; Oliveira, C T; Freitas, R N; Freitas, S N; Machado-Coelho, G L L

    2012-01-01

    Childhood obesity is increasing dramatically in last decades. To evaluate the usefulness of body mass index (BMI), skinfold thickness (ST), waist circumference (WC), and foot-to-foot bioelectrical impedance (BIA-FF) for screening for obesity in mixed-race population, using the tetrapolar bioelectrical impedance (BIA-T) technique as reference method. A cross-sectional-based population study was performed in the city of Ouro Preto, Brazil, in 2006. Schoolchildren aged 6-15 years (n = 788) was randomly selected according to age and sex stratified by the proportion of students in each schools of the city. Nonparametric receiver operating characteristic (ROC) analysis was used to define the sensitivity and specificity for each method studied using the tetrapolar method as reference. The BMI and the BIA-FF were the most suitable for adiposity screening in pre-pubertal and pubertal stages because they present a better balance between sensitivity and specificity, and smaller misclassification. For post-pubertal boys, the BF-ST-D was the best body fat assessment method. The results suggest that BIA-FF and BMI are choice methods for obesity screening in mixed population and that the method choice for body fat screening must be done according to sexual maturity of boys and girls. The present study demonstrates the need to perform studies in wider mixed-race population to determine anthropometric parameters and to examine the predictive ability of methods and cut-offs here elucidated in the development of obesity.

  13. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  14. High-amplitude THz and GHz strain waves, generated by ultrafast screening of piezoelectric fields in InGaN/GaN multiple quantum wells

    DEFF Research Database (Denmark)

    Porte, Henrik; van Capel, P.J.S.; Turchinovich, Dmitry

    2010-01-01

    Screening of large built-in piezoelectric fields in InGaN/GaN quantum wells leads to high-amplitude acoustic emission. We will compare acoustic emission by quantum wells with different thicknesses with photoluminescence; indicating screening.......Screening of large built-in piezoelectric fields in InGaN/GaN quantum wells leads to high-amplitude acoustic emission. We will compare acoustic emission by quantum wells with different thicknesses with photoluminescence; indicating screening....

  15. Evaluation of PCR Systems for Field Screening of Bacillus anthracis

    Energy Technology Data Exchange (ETDEWEB)

    Ozanich, Richard M.; Colburn, Heather A.; Victry, Kristin D.; Bartholomew, Rachel A.; Arce, Jennifer S.; Heredia-Langner, Alejandro; Jarman, Kristin; Kreuzer, Helen W.; Bruckner-Lea, Cynthia J.

    2017-02-01

    There is little published data on the performance of hand-portable polymerase chain reaction (PCR) instruments that could be used by first responders to determine if a suspicious powder contains a potential biothreat agent. We evaluated five commercially available hand-portable PCR instruments for detection of Bacillus anthracis (Ba). We designed a cost-effective, statistically-based test plan that allows instruments to be evaluated at performance levels ranging from 0.85-0.95 lower confidence bound (LCB) on the probability of detection (POD) at confidence levels of 80-95%. We assessed specificity using purified genomic DNA from 13 Ba strains and 18 Bacillus near neighbors, interference with 22 common hoax powders encountered in the field, and PCR inhibition when Ba spores were spiked into these powders. Our results indicated that three of the five instruments achieved >0.95 LCB on the POD with 95% confidence at test concentrations of 2,000 genome equivalents/mL (comparable to 2,000 spores/mL), displaying more than sufficient sensitivity for screening suspicious powders. These instruments exhibited no false positive results or PCR inhibition with common hoax powders, and reliably detected Ba spores spiked into common hoax powders, though some issues with instrument controls were observed. Our testing approach enables efficient instrument performance testing to a statistically rigorous and cost-effective test plan to generate performance data that will allow users to make informed decisions regarding the purchase and use of biodetection equipment in the field.

  16. The Diagonal Compression Field Method using Circular Fans

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2005-01-01

    This paper presents a new design method, which is a modification of the diagonal compression field method, the modification consisting of the introduction of circular fan stress fields. The traditional method does not allow changes of the concrete compression direction throughout a given beam if ...... fields may be used whenever changes in the concrete compression direction are desired. To illustrate the new design method, a specific example of a prestressed concrete beam is calculated.......This paper presents a new design method, which is a modification of the diagonal compression field method, the modification consisting of the introduction of circular fan stress fields. The traditional method does not allow changes of the concrete compression direction throughout a given beam...... if equilibrium is strictly required. This is conservative, since it is not possible fully to utilize the concrete strength in regions with low shear stresses. The larger inclination (the smaller -value) of the uniaxial concrete stress the more transverse shear reinforcement is needed; hence it would be optimal...

  17. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  18. Performance evaluation of sound screening Method for estimating sound Risk in small Workshops of Hamadan city

    Directory of Open Access Journals (Sweden)

    Rostam Golmohammadi

    2016-03-01

    Full Text Available Introduction: noise pollution has a negative effect on physiological parameters, efficiency and auditory system. The aim of this study was to evaluate the performance of a sound screening method for estimating sound risk in small workshops of Hamadan city. Methods: This cross-sectional study was conducted in 22 plants with more than 20 workers. Noise screening was done using a screening form. Next, noise level was measured at all the plants by SL 4001 sound level meter and regular grid method. Data were analyzed using Pearson’s test and linear regression by SPSS version 16 software. Results: The mean (SD scores of sound pressure level and screening form were 80.12 dB (7.277 and 60.50 (8.964 in the 22 understudy plants, respectively. The average measured workshop area and volume were 1448 and 10300, respectively. Pearson’s test revealed a significant relationship between the results of the two methods, (P > 0.046. Also the percentage of workers at risk (greater than 85 dB was 32.29 and the percentage of workers within safe limit (less than 85 dB was 63.3. While the largest percentage of workers in the caution zone (82 dB was 67.04. conclusions: A correlation was shown between the results of the two methods. The use of this method to identify workshops with the possibility of noise pollution is effective.

  19. Baseline Screening Mammography: Performance of Full-Field Digital Mammography Versus Digital Breast Tomosynthesis.

    Science.gov (United States)

    McDonald, Elizabeth S; McCarthy, Anne Marie; Akhtar, Amana L; Synnestvedt, Marie B; Schnall, Mitchell; Conant, Emily F

    2015-11-01

    Baseline mammography studies have significantly higher recall rates than mammography studies with available comparison examinations. Digital breast tomosynthesis reduces recalls when compared with digital mammographic screening alone, but many sites operate in a hybrid environment. To maximize the effect of screening digital breast tomosynthesis with limited resources, choosing which patient populations will benefit most is critical. This study evaluates digital breast tomosynthesis in the baseline screening population. Outcomes were compared for 10,728 women who underwent digital mammography screening, including 1204 (11.2%) baseline studies, and 15,571 women who underwent digital breast tomosynthesis screening, including 1859 (11.9%) baseline studies. Recall rates, cancer detection rates, and positive predictive values were calculated. Logistic regression estimated the odds ratios of recall for digital mammography versus digital breast tomosynthesis for patients undergoing baseline screening and previously screened patients, adjusted for age, race, and breast density. In the baseline subgroup, recall rates for digital mammography and digital breast tomosynthesis screening were 20.5% and 16.0%, respectively (p = 0.002); digital breast tomosynthesis screening in the baseline subgroup resulted in a 22% reduction in recall compared with digital mammography, or 45 fewer patients recalled per 1000 patients screened. Digital breast tomosynthesis screening in the previously screened patients resulted in recall reduction of 14.3% (p mammography alone.

  20. Wave field restoration using three-dimensional Fourier filtering method.

    Science.gov (United States)

    Kawasaki, T; Takai, Y; Ikuta, T; Shimizu, R

    2001-11-01

    A wave field restoration method in transmission electron microscopy (TEM) was mathematically derived based on a three-dimensional (3D) image formation theory. Wave field restoration using this method together with spherical aberration correction was experimentally confirmed in through-focus images of amorphous tungsten thin film, and the resolution of the reconstructed phase image was successfully improved from the Scherzer resolution limit to the information limit. In an application of this method to a crystalline sample, the surface structure of Au(110) was observed in a profile-imaging mode. The processed phase image showed quantitatively the atomic relaxation of the topmost layer.

  1. Test-field method for mean-field coefficients with MHD background

    OpenAIRE

    Rheinhardt, M.; Brandenburg, A.

    2010-01-01

    Aims: The test-field method for computing turbulent transport coefficients from simulations of hydromagnetic flows is extended to the regime with a magnetohydrodynamic (MHD) background. Methods: A generalized set of test equations is derived using both the induction equation and a modified momentum equation. By employing an additional set of auxiliary equations, we obtain linear equations describing the response of the system to a set of prescribed test fields. Purely magnetic and MHD backgro...

  2. Breast cancer screening: evidence of benefit depends on the method used

    Science.gov (United States)

    2012-01-01

    In this article, we discuss the most common epidemiological methods used for evaluating the ability of mammography screening to decrease the risk of breast cancer death in general populations (effectiveness). Case-control studies usually find substantial effectiveness. However when breast cancer mortality decreases for reasons unrelated to screening, the case-control design may attribute to screening mortality reductions due to other causes. Studies based on incidence-based mortality have obtained contrasted results compatible with modest to considerable effectiveness, probably because of differences in study design and statistical analysis. In areas where screening has been widespread for a long time, the incidence of advanced breast cancer should be decreasing, which in turn would translate into reduced mortality. However, no or modest declines in the incidence of advanced breast cancer has been observed in these areas. Breast cancer mortality should decrease more rapidly in areas with early introduction of screening than in areas with late introduction of screening. Nonetheless, no difference in breast mortality trends has been observed between areas with early or late screening start. When effectiveness is assessed using incidence-based mortality studies, or the monitoring of advanced cancer incidence, or trends in mortality, the ecological bias is an inherent limitation that is not easy to control. Minimization of this bias requires data over long periods of time, careful selection of populations being compared and availability of data on major confounding factors. If case-control studies seem apparently more adequate for evaluating screening effectiveness, this design has its own limitations and results must be viewed with caution. See related Opinion article: http://www.biomedcentral.com/1741-7015/10/106 and Commentary http://www.biomedcentral.com/1741-7015/10/164 PMID:23234249

  3. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    Ionic liquids (ILs) have attracted considerable attention in both the academic and industrial communities for absorbing and separating gases. However, a data-rich and well-structured systematic database has not yet been established, and screening for highly efficient ILs meeting various requireme......Ionic liquids (ILs) have attracted considerable attention in both the academic and industrial communities for absorbing and separating gases. However, a data-rich and well-structured systematic database has not yet been established, and screening for highly efficient ILs meeting various...... requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  4. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  5. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  6. Tumor characteristics and detection method in the MRISC screening program for the early detection of hereditary breast cancer

    NARCIS (Netherlands)

    Kriege, M.; Brekelmans, C. T. M.; Peterse, H.; Obdeijn, I. M.; Boetes, C.; Zonderland, H. M.; Muller, S. H.; Kok, T.; Manoliu, R. A.; Besnard, A. P. E.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; Bartels, C. C. M.; Meijer, S.; Oosterwijk, J. C.; Hoogerbrugge, N.; Tollenaar, R. A. E. M.; de Koning, H. J.; Rutgers, E. J. T.; Klijn, J. G. M.

    In the MRISC study, women with an inherited risk for breast cancer were screened by a 6-month clinical breast examination (CBE) and yearly MRI and mammography. We found that the MRISC screening scheme could facilitate early breast cancer diagnosis and that MRI was a more sensitive screening method

  7. [The Body Dysmorphic Disorder in Plastic Surgery - A Systematic Review of Screening Methods].

    Science.gov (United States)

    Houschyar, K S; Philipps, H M; Duscher, D; Rein, S; Weissenberg, K; Nietzschmann, I; Maan, Z N; Pyles, M N; Siemers, F

    2017-12-01

    The body dysmorphic disorder (BDD) is considered to be a sub-form of somatoform disorders. BDD can express itself in a delirious experience, an excessive evaluation and employment of the external appearance, in particular the face. Preliminary results suggest that individuals with BDD do not benefit from plastic surgery, so that aesthetic surgery often results in aggravation of their symptoms. Thus, the identification of signs for a BDD is crucial, whether a patient should be operated plastically-aesthetically. This overview explains the often difficult diagnostics of the BDD by summarizing the current literature on its screening. Systematic overview METHODS: An electronic search was conducted in the German and English-language literature in order to identify all screening instruments for the BDD. The specific development and validation processes are assessed whether the screening instruments have a positive predictive value for the BDD. Six different screening instruments were identified for the BDD. Only two of these were evaluated in a cosmetic setting: the "Body Dysmorphic Disorder Questionnaire Dermatology Version" (BDDQ-DV) and the "Dysmorphic Concern Questionnaire" (DCQ). The influence on the subjective results after a plastic-aesthetic procedure was measured only for the DCQ. The limited availability of validated screening instruments for BDD in plastic surgery is markedly in contrast to the supposedly high prevalence of the disease of 2.4 %. Among the currently used screening tools, the BDDQ-DV and the DCQ appear to be most suitable. Further research efforts are needed to establish better screening methods for the BDD in the plastic surgical patient population and to examine the effects of BDD on treatment results. Georg Thieme Verlag KG Stuttgart · New York.

  8. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  9. Stochastic geometry, spatial statistics and random fields asymptotic methods

    CERN Document Server

    2013-01-01

    This volume provides a modern introduction to stochastic geometry, random fields and spatial statistics at a (post)graduate level. It is focused on asymptotic methods in geometric probability including weak and strong limit theorems for random spatial structures (point processes, sets, graphs, fields) with applications to statistics. Written as a contributed volume of lecture notes, it will be useful not only for students but also for lecturers and researchers interested in geometric probability and related subjects.

  10. Testing of Snorre Field Foam Assisted Water Alternating Gas (FAWAG Performance in New Foam Screening Model

    Directory of Open Access Journals (Sweden)

    Spirov Pavel

    2015-11-01

    Full Text Available Eclipse Functional Foam Model was used in order to provide a guideline for the history matching process (Gas-Oil Ratio (GOR, oil and gas production rates to the Foam Assisted Water Alternating Gas method in the Snorre field, Norway, where the surfactant solution was injected in two slugs to control gas mobility and prevent gas breakthrough. The simulation showed that the first short slug was not efficient while significant GOR decrease and incremental oil production was obtained after the second longer slug in some periods. This study shows that the Eclipse foam model is applicable to the planning of water and gas injections, the testing of various surfactant properties, and the evaluation of the efficiency of the method at the field scale.

  11. Multigrid methods for the computation of propagators in gauge fields

    International Nuclear Information System (INIS)

    Kalkreuter, T.

    1992-11-01

    In the present work generalizations of multigrid methods for propagators in gauge fields are investigated. We discuss proper averaging operations for bosons and for staggered fermions. An efficient algorithm for computing C numerically is presented. The averaging kernels C can be used not only in deterministic multigrid computations, but also in multigrid Monte Carlo simulations, and for the definition of block spins and blocked gauge fields in Monte Carlo renormalization group studies of gauge theories. Actual numerical computations of kernels and propagators are performed in compact four-dimensional SU(2) gauge fields. (orig./HSI)

  12. Interferometric methods for mapping static electric and magnetic fields

    DEFF Research Database (Denmark)

    Pozzi, Giulio; Beleggia, Marco; Kasama, Takeshi

    2014-01-01

    The mapping of static electric and magnetic fields using electron probes with a resolution and sensitivity that are sufficient to reveal nanoscale features in materials requires the use of phase-sensitive methods such as the shadow technique, coherent Foucault imaging and the Transport of Intensity...... on theoretical models that form the basis of the quantitative interpretation of electron holographic data. We review the application of electron holography to a variety of samples (including electric fields associated with p–n junctions in semiconductors, quantized magnetic flux in superconductors......) the model-independent determination of the locations and magnitudes of field sources (electric charges and magnetic dipoles) directly from electron holographic data....

  13. Perspective: Ab initio force field methods derived from quantum mechanics

    Science.gov (United States)

    Xu, Peng; Guidez, Emilie B.; Bertoni, Colleen; Gordon, Mark S.

    2018-03-01

    It is often desirable to accurately and efficiently model the behavior of large molecular systems in the condensed phase (thousands to tens of thousands of atoms) over long time scales (from nanoseconds to milliseconds). In these cases, ab initio methods are difficult due to the increasing computational cost with the number of electrons. A more computationally attractive alternative is to perform the simulations at the atomic level using a parameterized function to model the electronic energy. Many empirical force fields have been developed for this purpose. However, the functions that are used to model interatomic and intermolecular interactions contain many fitted parameters obtained from selected model systems, and such classical force fields cannot properly simulate important electronic effects. Furthermore, while such force fields are computationally affordable, they are not reliable when applied to systems that differ significantly from those used in their parameterization. They also cannot provide the information necessary to analyze the interactions that occur in the system, making the systematic improvement of the functional forms that are used difficult. Ab initio force field methods aim to combine the merits of both types of methods. The ideal ab initio force fields are built on first principles and require no fitted parameters. Ab initio force field methods surveyed in this perspective are based on fragmentation approaches and intermolecular perturbation theory. This perspective summarizes their theoretical foundation, key components in their formulation, and discusses key aspects of these methods such as accuracy and formal computational cost. The ab initio force fields considered here were developed for different targets, and this perspective also aims to provide a balanced presentation of their strengths and shortcomings. Finally, this perspective suggests some future directions for this actively developing area.

  14. Isochronous magnetic field shimming method for compact cyclotrons

    International Nuclear Information System (INIS)

    Wang Chuan; Yang Jianjun; Zhong Junqing; Zhang Tianjue

    2009-01-01

    A 100 MeV H-cyclotron, CYCIAE-100, is under construction at China Institute of Atomic Energy. To carry out the experimental verification of CYCIAE-100, a central region model (CRM) cyclotron was developed for the study on various technical aspects, including the main magnet, beam diagnostics, etc. An optimized multiple linear regression shimming method was investigated based on accurate mapping and bar shimming of the CRM cyclotron. By using the magnet mapping data of CRM cyclotron and the numerical simulation of the field by 3D FEM analysis, the optimized multiple linear regression shimming method was realized and verified. This method is a pre-research for the isochronous magnetic field shimming of CYCIAE-100. It can be applied in the isochronous magnetic field shimming of the compact cyclotron, which meets the requirement for beam dynamics analysis. (authors)

  15. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  16. Function-specific virual screening for GPCR ligands using a combined scoring method.

    NARCIS (Netherlands)

    Kooistra, A.J.; Vischer, H.F.; McNaught-Flores, D.; Leurs, R.; de Esch, I.J.P.; de Graaf, C.

    2016-01-01

    The ability of scoring functions to correctly select and rank docking poses of small molecules in protein binding sites is highly target dependent, which presents a challenge for structure-based drug discovery. Here we describe a virtual screening method that combines an energy-based docking scoring

  17. Fast screening method for detection of acyl-HSL-degrading soil isolates

    NARCIS (Netherlands)

    Jafra, S.; Wolf, van der J.M.

    2004-01-01

    A reliable method was developed for screening of bacteria isolates capable of degrading acyl-HSLs, the signal molecules in quorum-sensing-mediated processes of many Proteobacteria. The microtiter assay was based on the use of a GFP-marked Escherichia coli strain, which fluoresces upon the presence

  18. Comparison of three microbial screening methods for antibiotics using routine monitoring samples

    NARCIS (Netherlands)

    Pikkemaat, M.G.; Rapallini, M.; Oostra, S.; Elferink, J.W.A.

    2009-01-01

    Monitoring large numbers of slaughter animals for the presence of antimicrobial residues is preferably carried out using microbiological screening methods, because of their high cost-effectiveness. An evaluation of the Nouws antibiotic test (NAT) was performed on routine monitoring samples and the

  19. Staging Henry Fielding: The Author-Narrator in Tom Jones On Screen

    Directory of Open Access Journals (Sweden)

    Eli Løfaldli

    2017-06-01

    Full Text Available As recent adaptation theory has shown, classic-novel adaptation typically sets issues connected to authorship and literal and figurative ownership into play. This key feature of such adaptations is also central to the screen versions of Henry Fielding’s Tom Jones (1749. In much of Fielding’s fiction, the narrator, typically understood as an embodiment of Fielding himself, is a particularly prominent presence. The author-narrator in Tom Jones is no exception: not only is his presence strongly felt throughout the novel, but through a variety of means, ‘The History of Tom Jones, A Foundling’ is also distinctly marked as being under his control and ownership. The two adaptations of Fielding’s novel, a 1963 film and a 1997 television series, both retain the figure of the author-narrator, but differ greatly in their handling of this device and its consequent thematic ramifications. Although the 1963 film de-emphasises Henry Fielding’s status as proprietor of the story, the author-narrator as represented in the film’s voiceover commentary is a figure of authority and authorial control. In contrast, the 1997 adaptation emphasises Fielding’s ownership of the narrative and even includes the author-narrator as a character in the series, but this ownership is undermined by the irreverent treatment to which he is consistently subjected. The representations of Henry Fielding in the form of the author-narrator in both adaptations are not only indicative of shifting conceptions of authorship, but also of the important interplay between authorship, ownership and adaptation more generally.

  20. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  1. Modeling Enzymatic Transition States by Force Field Methods

    DEFF Research Database (Denmark)

    Hansen, Mikkel Bo; Jensen, Hans Jørgen Aagaard; Jensen, Frank

    2009-01-01

    The SEAM method, which models a transition structure as a minimum on the seam of two diabatic surfaces represented by force field functions, has been used to generate 20 transition structures for the decarboxylation of orotidine by the orotidine-5'-monophosphate decarboxylase enzyme. The dependence...... by various electronic structure methods, where part of the enzyme is represented by a force field description and the effects of the solvent are represented by a continuum model. The relative energies vary by several hundreds of kJ/mol between the transition structures, and tests showed that a large part...

  2. Overdiagnosis associated with breast cancer screening: A simulation study to compare lead-time adjustment methods.

    Science.gov (United States)

    Seigneurin, A; Labarère, J; Duffy, S W; Colonna, M

    2015-12-01

    Estimating overdiagnosis associated with breast cancer screening may use annual incidence rates of cancer. We simulated populations invited to screening programmes to assess two lead-time adjustment methods. Overdiagnosis estimates were computed using the compensatory drop method, which considered the decrease in incidence of cancers among older age groups no longer offered screening, and the method based on the decrease in incidence of late-stage cancers. The true value of overdiagnosis was 0% in all the data sets simulated. The compensatory drop method yielded an overdiagnosis estimate of -0.1% (95% credibility interval -0.5% to 0.5%) when participation rates among the population and risk of cancers were constant. However, if participation rates increased with calendar year as well as risk of cancer with birth cohorts, the overdiagnosis estimated was 11.0% (10.5-11.6%). Using the method based on the incidence of early- and late-stage cancers, overdiagnosis estimates were 8.9% (8.5-9.3%) and 17.6% (17.4-17.9%) when participation rates and risks of cancer were constant or increased with time, respectively. Adjustment for lead time based on the compensatory drop method is accurate only when participation rates and risks of cancer remain constant, whereas the adjustment method based on the incidence of early- and late-stage cancers results in overestimating overdiagnosis regardless of stability of participation rates and breast cancer risk. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Computer-aided detection of masses in full-field digital mammography using screen-film mammograms for training

    International Nuclear Information System (INIS)

    Kallenberg, Michiel; Karssemeijer, Nico

    2008-01-01

    It would be of great value when available databases of screen-film mammography (SFM) images can be used to train full-field digital mammography (FFDM) computer-aided detection (CAD) systems, as compilation of new databases is costly. In this paper, we investigate this possibility. Firstly, we develop a method that converts an FFDM image into an SFM-like representation. In this conversion method, we establish a relation between exposure and optical density by simulation of an automatic exposure control unit. Secondly, we investigate the effects of using the SFM images as training samples compared to training with FFDM images. Our FFDM database consisted of 266 cases, of which 102 were biopsy-proven malignant masses and 164 normals. The images were acquired with systems of two different manufacturers. We found that, when we trained our FFDM CAD system with a small number of images, training with FFDM images, using a five-fold crossvalidation procedure, outperformed training with SFM images. However, when the full SFM database, consisting of 348 abnormal cases (including 204 priors) and 810 normal cases, was used for training, SFM training outperformed FFDMA training. These results show that an existing CAD system for detection of masses in SFM can be used for FFDM images without retraining.

  4. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Directory of Open Access Journals (Sweden)

    Eviatar Ephraim

    2009-02-01

    Full Text Available Abstract Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007 and EMBASE (1975–2007. Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles, the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia.

  5. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  6. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  7. Optimal Screening Methods to Detect Cardiac Disorders in Athletes: An Evidence-Based Review.

    Science.gov (United States)

    Winkelmann, Zachary K; Crossway, Ashley K

    2017-12-01

    Reference/Citation:  Harmon KG, Zigman M, Drezner JA. The effectiveness of screening history, physical exam, and ECG to detect potentially lethal cardiac disorders in athletes: a systematic review/meta-analysis. J Electrocardiol. 2015;48(3):329-338.   Which screening method should be considered best practice to detect potentially lethal cardiac disorders during the preparticipation physical examination (PE) of athletes?   The authors completed a comprehensive literature search of MEDLINE, CINAHL, Cochrane Library, Embase, Physiotherapy Evidence Database (PEDro), and SPORTDiscus from January 1996 to November 2014. The following key words were used individually and in combination: ECG, athlete, screening, pre-participation, history, and physical. A manual review of reference lists and key journals was performed to identify additional studies. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed for this review.   Studies selected for this analysis involved (1) outcomes of cardiovascular screening in athletes using the history, PE, and electrocardiogram (ECG); (2) history questions and PE based on the American Heart Association recommendations and guidelines; and (3) ECGs interpreted following modern standards. The exclusion criteria were (1) articles not in English, (2) conference abstracts, and (3) clinical commentary articles. Study quality was assessed on a 7-point scale for risk of bias; a score of 7 indicated the highest quality. Articles with potential bias were excluded.   Data included number and sex of participants, number of true- and false-positives and negatives, type of ECG criteria used, number of cardiac abnormalities, and specific cardiac conditions. The sensitivity, specificity, false-positive rate, and positive predictive value of each screening tool were calculated and summarized using a bivariate random-effects meta-analysis model.   Fifteen articles reporting on 47 137 athletes

  8. Development of a high throughput screening method to test flavour-forming capabilities of anaerobic micro-organisms.

    NARCIS (Netherlands)

    Smit, B.A.; Engels, W.J.M.; Hylckama Vlieg, van J.E.T.; Wouters, J.T.M.; Smit, G.

    2004-01-01

    Aim: Development of a fast, automated and reliable screening method for screening of large collections of bacterial strains with minimal handling time. Methods and Results: The method is based on the injection of a small headspace sample (100 µl) from culture vials (2 ml) in 96-well format directly

  9. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    OpenAIRE

    Cristina Portalés; Sergio Casas; Inmaculada Coma; Marcos Fernández

    2017-01-01

    The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, w...

  10. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    OpenAIRE

    Portalés Ricart, Cristina; Casas Yrurzum, Sergio; Coma Tatay, Inmaculada; Fernández Marín, Marcos

    2017-01-01

    The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, w...

  11. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  12. A comparison of screening methods in two early phase oral leukoplakia clinical trials.

    Science.gov (United States)

    Rosas, R R; Cole, K A; Darrah, L; Rohrer, M D; Rhodus, N L; Ondrey, F G

    2012-10-01

    Clinical trial accrual for oral dysplasia is difficult in the United States and elsewhere. Patients with dysplastic oral leukoplakia progress to frank invasive carcinoma at a rate of 5-37% over 5 years. We compared two clinical trial screening efforts to hopefully devise better accrual strategies to these types of clinical trials. For the first trial, we identified 244 patients with dysplastic oral leukoplakia in our university database and a media campaign. Patients were notified and screened by examination and biopsy. For the second clinical trial, we established a preneoplastic lesions clinic and teaching and communications network with regional oral healthcare professionals. Only one of 244 patients accrued to the first clinical trial through an organized screening effort based on database/medical records review. The second clinical trial accrued 16/30 screened patients through redirected efforts in teaching, communications, and a preneoplastic lesions clinic. We conclude that significant difficulties resulted from medical record/database review of leukoplakia patients as a screening method for leukoplakia clinical trial entry. We feel that persistent direct contact and education of healthcare professionals who are likely to examine leukoplakia patients improved accrual to the second clinical trial. © 2012 John Wiley & Sons A/S.

  13. A high throughput method and culture medium for rapid screening of phosphate accumulating microorganisms.

    Science.gov (United States)

    Chaudhry, Vasvi; Nautiyal, Chandra Shekhar

    2011-09-01

    A novel PA Medium (PAM) for efficient screening of phosphate-accumulating organisms (PAOs) was developed taking Serratia marcescens NBRI1213 as model organism. The defined National Botanical Research Institute's growth medium (NBRI) supplemented with 0.1% maltose, designed for quantitative estimation of phosphate accumulation was designated as PAM. Our work suggested usage of PAM for efficient qualitative screening and as a microbiological medium for preferential selection of PAOs on Petri-plates. For qualitative screening of PAOs, Toluidine blue-O dye (TBO) was supplemented in PAM, designated as PAM-TBO. Qualitative analysis of phosphate accumulated by various groups correlated well with grouping based upon quantitative analysis of PAOs, effect of carbon, nitrogen, salts, and phosphate accumulation-defective transposon mutants. For significantly increasing sample throughput, efficiency of screening PAOs was further enhanced by adaptation of PAM-TBO assay to microtiter plate based method. It is envisaged that usage of this medium will be salutary for quick screening of PAOs from environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Mathematical methods of many-body quantum field theory

    CERN Document Server

    Lehmann, Detlef

    2004-01-01

    Mathematical Methods of Many-Body Quantum Field Theory offers a comprehensive, mathematically rigorous treatment of many-body physics. It develops the mathematical tools for describing quantum many-body systems and applies them to the many-electron system. These tools include the formalism of second quantization, field theoretical perturbation theory, functional integral methods, bosonic and fermionic, and estimation and summation techniques for Feynman diagrams. Among the physical effects discussed in this context are BCS superconductivity, s-wave and higher l-wave, and the fractional quantum Hall effect. While the presentation is mathematically rigorous, the author does not focus solely on precise definitions and proofs, but also shows how to actually perform the computations.Presenting many recent advances and clarifying difficult concepts, this book provides the background, results, and detail needed to further explore the issue of when the standard approximation schemes in this field actually work and wh...

  15. General Anisotropy Identification of Paperboard with Virtual Fields Method

    Science.gov (United States)

    J.M. Considine; F. Pierron; K.T. Turner; D.W. Vahey

    2014-01-01

    This work extends previous efforts in plate bending of Virtual Fields Method (VFM) parameter identification to include a general 2-D anisotropicmaterial. Such an extension was needed for instances in which material principal directions are unknown or when specimen orientation is not aligned with material principal directions. A new fixture with a multiaxial force...

  16. Systematic review of methods in low-consensus fields

    NARCIS (Netherlands)

    Delaney, Aogán; Tamás, Peter A.; Crane, Todd A.; Chesterman, Sabrina

    2016-01-01

    There is increasing interest in using systematic review to synthesize evidence on the social and environmental effects of and adaptations to climate change. Use of systematic review for evidence in this field is complicated by the heterogeneity of methods used and by uneven reporting. In order to

  17. Field test of a new Australian method of rangeland monitoring

    Science.gov (United States)

    Suzanne Mayne; Neil West

    2001-01-01

    Managers need more efficient means of monitoring changes on the lands they manage. Accordingly, a new Australian approach was field tested and compared to the Daubenmire method of assessing plant cover, litter, and bare soil. The study area was a 2 mile wide by 30.15 mile long strip, mostly covered by salt desert shrub ecosystem types, centered along the SE boundary of...

  18. Analysis of pulsed wire method for field integral measurements in ...

    Indian Academy of Sciences (India)

    of the acoustic wave in the wire could be significant and our analysis provides a method for the evaluation of the magnetic field profile even in such cases taking the effect due to dispersion into account in an exact way. Keywords. Undulator; free-electron laser; synchrotron radiation source; magnetic char- acterization.

  19. Comparison of methods of field planting on cocoa seedling survival ...

    African Journals Online (AJOL)

    cocoa seeds at stake are feasible options in marginal cocoa-growing areas if such activity is properly timed to coincide with the rains. However, the polythene bag method of transplanting cocoa seedlings remains the best option for field planting of cocoa in marginal cocoagrowing areas of Ghana. Les féves de cacao étaient ...

  20. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  1. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  2. Screen-film versus full-field digital mammography: Radiation dose and image quality in a large teaching hospital

    Directory of Open Access Journals (Sweden)

    Stantić Tomislav J.

    2013-01-01

    Full Text Available The objective of this paper is to measure the radiation dose and image quality in conventional screen-film mammography and full-field digital mammography in women referred to mammography examination. Participants underwent bilateral, two-view screen-film mammography or full-field digital mammography. The visibility of anatomical regions and overall clinical image quality was rated by experienced radiologists. Total of 387 women and 1548 mammograms were enrolled in the study. Image quality was assessed in terms of image quality score, whereas patient dose assessment was performed in terms of mean glandular dose. Average mean glandular dose for cranio-caudal projection was 1.5 mGy and 2.1 mGy in full-field digital mammography and screen-film mammography, respectively. For medio-lateral oblique projection, corresponding values were 2.3 and 2.1 mGy. Overall image quality criteria scoring was 0.82 and 0.99 for screen-film and digital systems, respectively. The scores were in the range from 0.11 to 1.0 for different anatomical structures. Overall, full-field digital mammography was superior both in terms of image quality and dose over the screen-film mammography. The results have indicated that phantom dose values can assist in setting the optimisation activities in mammography and for comparison between mammography units. To obtain accurate diagnostic information with an acceptable radiation dose to breast, it is necessary to periodically perform patient dose and image quality surveys in all mammography units.

  3. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  4. Use of field-portable XRF analyzers for rapid screening of toxic elements in FDA-regulated products.

    Science.gov (United States)

    Palmer, Peter T; Jacobs, Richard; Baker, Peter E; Ferguson, Kelly; Webber, Siri

    2009-04-08

    compared to existing methods such as ICP-MS. It concludes with a discussion of a number of different FDA applications and case studies in which XRF has been used to screen, identify, and in some cases quantify toxic elements in various products. This work clearly demonstrates that XRF analyzers are an exceedingly valuable tool for routine and nonroutine elemental analysis investigations, both in the laboratory and in the field. In the future, it is hoped that both field-portable and laboratory-grade XRF analyzers will see more widespread use for investigational and forensic-type applications of food and other regulated consumer products.

  5. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  6. The Diagonal Compression Field Method using Circular Fans

    DEFF Research Database (Denmark)

    Hansen, Thomas

    2006-01-01

    concrete beam. To illustrate the new design method, a specific example of a prestressed concrete beam is calcaluted. In the example it is shown, that the tradionel method with constant -values requires 23% more shear reinforcement than calculated by the new method using circular fan solutions.......In a concrete beam with transverse stirrups the shear forces are carried by inclined compression in the concrete. Along the tensile zone and the compression zone of the beam the transverse components of the inclined compressions are transferred to the stirrups, which are thus subjected to tension....... Since the eighties the diagonal compression field method has been used to design transverse shear reinforcement in concrete beams. The method is based on the lower-bound theorem of the theory of plasticity, and it has been adopted in Eurocode 2. The paper presents a new design method, which...

  7. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  8. Biogeophysical Method for Searching and Exploration of Oil Fields

    Directory of Open Access Journals (Sweden)

    M.Sh. Mardanov

    2015-03-01

    Full Text Available The problems of using biogeophysical method (BGPh method to reveal and map oil accumulations in sedimentary rocks are considered. A working hypothesis of BGPh anomaly generated due to the electromagnetic nature (background of the observed phenomenon has been posited. Methodology for fieldworks and interpretation of the obtained materials has been developed. It is successfully applied in more than 30 objects of the oil companies under study. The results of deep-hole drilling demonstrate in a convincing way that BGPh method provides highly accurate predictions. BGPh studies of old oil fields make it possible to detect zones with commercial reserves of oil, where water cutting of the well pro-duction does not exceed 75–80%. Therefore, there are prospects for areal monitoring of the developed field in order to reveal “washed-out” zones, as well as areas unaffected by exploitation and lithologically isolated (“bypassed” oil.

  9. Extending methods: using Bourdieu's field analysis to further investigate taste

    Science.gov (United States)

    Schindel Dimick, Alexandra

    2015-06-01

    In this commentary on Per Anderhag, Per-Olof Wickman and Karim Hamza's article Signs of taste for science, I consider how their study is situated within the concern for the role of science education in the social and cultural production of inequality. Their article provides a finely detailed methodology for analyzing the constitution of taste within science education classrooms. Nevertheless, because the authors' socially situated methodology draws upon Bourdieu's theories, it seems equally important to extend these methods to consider how and why students make particular distinctions within a relational context—a key aspect of Bourdieu's theory of cultural production. By situating the constitution of taste within Bourdieu's field analysis, researchers can explore the ways in which students' tastes and social positionings are established and transformed through time, space, place, and their ability to navigate the field. I describe the process of field analysis in relation to the authors' paper and suggest that combining the authors' methods with a field analysis can provide a strong methodological and analytical framework in which theory and methods combine to create a detailed understanding of students' interest in relation to their context.

  10. Application of probabilistic methods in the field of nuclear safety

    International Nuclear Information System (INIS)

    Carnino, Annick

    1976-01-01

    Beyond the determination of the risks of accident to the reactors (Rasmussen Report), the probabilistic methods have other fields of application insofar as nuclear safety is concerned. These different fields of application are studied, i.e.: analysis of the accidents and of system performance, research for solutions to obtain an improved reliability, determination of the operating rules of the plants and drawing up of the regulations. In order to illustrate the work tending to improve the reliability, the studies concerning the design of the emergency shutdown system of the Super-Phenix are presented as an example [fr

  11. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  12. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  13. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  14. Method for detecting, screening and/or monitoring a cancer in an individual

    DEFF Research Database (Denmark)

    2003-01-01

    The invention relates to a method for screening and/or detecting and/or monitoring a cancer in an individual, said method comprising determining a first parameter represented by the concentration of TIMP-1 in at least one excreta, e.g. saliva, from the individual. The invention provides a method...... that without the need to use a blood sample is suitable for facilitating the early diagnosis of a cancer, monitoring the recurrence of a cancer, and/or monitoring the status of a cancer or the effect of cancer treatment in an individual....

  15. Method for detecting, screening and/or montoring a cancer in individual

    DEFF Research Database (Denmark)

    2005-01-01

    The invention relates to a method for screening and/or detecting and/or monitoring a cancer in an individual, said method comprising determining a first parameter represented by the concentration of TIMP-1 in at least one excreta, e.g. saliva, from the individual. The invention provides a method...... that without the need to use a blood sample is suitable for facilitating the early diagnosis of a cancer, monitoring the recurrence of a cancer, and/or monitoring the status of a cancer or the effect of cancer treatment in an individual....

  16. Abnormality degree detection method using negative potential field group detectors

    Science.gov (United States)

    Zhang, Hongli; Liu, Shulin; Li, Dong; Shi, Kunju; Wang, Bo; Cui, Jiqiang

    2015-09-01

    Online monitoring methods have been widely used in many major devices, however the normal and abnormal states of equipment are estimated mainly based on the monitoring results whether monitored parameters exceed the setting thresholds. Using these monitoring methods may cause serious false positive or false negative results. In order to precisely monitor the state of equipment, the problem of abnormality degree detection without fault sample is studied with a new detection method called negative potential field group detectors(NPFG-detectors). This method achieves the quantitative expression of abnormality degree and provides the better detection results compared with other methods. In the process of Iris data set simulation, the new algorithm obtains the successful results in abnormal detection. The detection rates for 3 types of Iris data set respectively reach 100%, 91.6%, and 95.24% with 50% training samples. The problem of Bearing abnormality degree detection via an abnormality degree curve is successfully solved.

  17. Modeling of high-frequency wave propagation in the heterogenous Earth using screen method

    Science.gov (United States)

    Ding, Y.; Zheng, Y.

    2017-12-01

    High-frequency (1Hz) wave propagation modeling in the heterogenous Earth is difficult due to computation cost. We have developed one alternative method to do high-frequency wave propagation locally in the Earth. First, we divide the heterogeneous Earth model into two parts: the background gradient velocity model, and the velocity perturbation. Then we trace rays from the source to the Earth surface and make screens perpendicular to the rays. We propagate the wavefield in each screen by Kirchhoff surface integral and account for the velocity perturbations with a phase shift. Recursively, the algorithm will propagate the wavefield locally from the source to the surface. The result is compared with that from the finite difference method.

  18. A tree based method for the rapid screening of chemical fingerprints

    DEFF Research Database (Denmark)

    Kristensen, Thomas Greve; Nielsen, Jesper; Pedersen, Christian Nørgaard Storm

    2009-01-01

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules...... with fingerprints similar to a query fingerprint. In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases......: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds...

  19. Screening methods for linear-scaling short-range hybrid calculations on CPU and GPU architectures.

    Science.gov (United States)

    Beuerle, Matthias; Kussmann, Jörg; Ochsenfeld, Christian

    2017-04-14

    We present screening schemes that allow for efficient, linear-scaling short-range exchange calculations employing Gaussian basis sets for both CPU and GPU architectures. They are based on the LinK [C. Ochsenfeld et al., J. Chem. Phys. 109, 1663 (1998)] and PreLinK [J. Kussmann and C. Ochsenfeld, J. Chem. Phys. 138, 134114 (2013)] methods, but account for the decay introduced by the attenuated Coulomb operator in short-range hybrid density functionals. Furthermore, we discuss the implementation of short-range electron repulsion integrals on GPUs. The introduction of our screening methods allows for speedups of up to a factor 7.8 as compared to the underlying linear-scaling algorithm, while retaining full numerical control over the accuracy. With the increasing number of short-range hybrid functionals, our new schemes will allow for significant computational savings on CPU and GPU architectures.

  20. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  1. A new method for the screening of solid-phase combinatorial libraries for affinity chromatography.

    Science.gov (United States)

    Roque, A Cecília A; Taipa, M Angela; Lowe, Christopher R

    2004-01-01

    A new methodology for the rapid assessment of affinity ligands synthesized by combinatorial solid-phase chemistry is reported. This screening strategy utilizes the target protein conjugated to FITC, and represents an almost universal technique for the preliminary screening of solid-phase combinatorial libraries. The assessment of a triazine-scaffolded solid-phase combinatorial library of ligands, designed to bind to human IgG, was performed with FITC-human IgG, and the results compared with those obtained by conventional affinity chromatographic screening assays. The effect of different molar conjugation ratios of FITC-IgG (F/P) was evaluated. Independently of the F/P ratio, no false negative results were observed, although lower F/P ratios diminished non-specific interactions and the number of false positives. The nature of the substituents on the triazine scaffold was not related to the number of false positive IgG-binding ligands. The reproducibility of the FITC technique, using FITC-human IgG conjugates with low F/P ratio (F/P=2), was also evaluated. The FITC-based technique proved to be efficient and accurate in the identification of strongly binding ligands (binding >50% of loaded protein, by standard affinity chromatographic assays), and is envisaged as a versatile and cost-effective method to screen other systems, and evaluate several binding/elution conditions at small-scale, prior to scale-up to standard affinity chromatography. Copyright 2004 John Wiley & Sons, Ltd.

  2. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  3. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  4. Method for imaging with low frequency electromagnetic fields

    Science.gov (United States)

    Lee, Ki H.; Xie, Gan Q.

    1994-01-01

    A method for imaging with low frequency electromagnetic fields, and for interpreting the electromagnetic data using ray tomography, in order to determine the earth conductivity with high accuracy and resolution. The imaging method includes the steps of placing one or more transmitters, at various positions in a plurality of transmitter holes, and placing a plurality of receivers in a plurality of receiver holes. The transmitters generate electromagnetic signals which diffuse through a medium, such as earth, toward the receivers. The measured diffusion field data H is then transformed into wavefield data U. The traveltimes corresponding to the wavefield data U, are then obtained, by charting the wavefield data U, using a different regularization parameter .alpha. for each transform. The desired property of the medium, such as conductivity, is then derived from the velocity, which in turn is constructed from the wavefield data U using ray tomography.

  5. Multi-phase-field method for surface tension induced elasticity

    Science.gov (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah

    2018-01-01

    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  6. A time-scale sensitometric method for evaluating screen - film systems

    International Nuclear Information System (INIS)

    Goes, E.G.; Pela, C.A.; Ghilardi, N.T.

    1997-01-01

    An x-ray sensitometer is used to measure the characteristic curve of radiographic films exposed with fluorescent intensifying screens. The series of relative exposures, necessary to cover the full density range of the film, can be obtained by either time-scale or intensity-scale sensitometric methods. We have developed a convenient method of exposing film-screen systems for time-scale sensitometry. In this method, during exposure the x-ray kilovoltage, tube current and x-ray intensity remain constant and a geometric series of exposures of the film is modulated by varying the exposure time. This time variation can be obtained when a lead disc with different sector openings is rotated in front of the film system by a stepping motor. The conditions normally used are 70 kVp x-rays, 3.5 mm Al total filtration at the tube, and 2.4 m focal spot-film distance. This exposure latitude gives a complete characteristic curve of film-screen systems. (author)

  7. A time-scale sensitometric method for evaluating screen - film systems

    Energy Technology Data Exchange (ETDEWEB)

    Goes, E.G.; Pela, C.A.; Ghilardi, N.T. [CIDRA - Centro de Instrumentacao, Dosimetria e Radioprotecao, DFM - FFCLRP - USP, Av. Bandeirantes, 3900-14040 901 Ribeirao Preto, SP (Brazil)

    1997-10-01

    An x-ray sensitometer is used to measure the characteristic curve of radiographic films exposed with fluorescent intensifying screens. The series of relative exposures, necessary to cover the full density range of the film, can be obtained by either time-scale or intensity-scale sensitometric methods. We have developed a convenient method of exposing film-screen systems for time-scale sensitometry. In this method, during exposure the x-ray kilovoltage, tube current and x-ray intensity remain constant and a geometric series of exposures of the film is modulated by varying the exposure time. This time variation can be obtained when a lead disc with different sector openings is rotated in front of the film system by a stepping motor. The conditions normally used are 70 kVp x-rays, 3.5 mm Al total filtration at the tube, and 2.4 m focal spot-film distance. This exposure latitude gives a complete characteristic curve of film-screen systems. (author)

  8. Development of a whole-cell-based screening method for a carotenoid assay using aerial microalgae.

    Science.gov (United States)

    Aburai, Nobuhiro; Kazama, Hiroaki; Tsuruoka, Atsushi; Goto, Mizuki; Abe, Katsuya

    2018-02-20

    Non-destructive approaches based on the application of optical spectroscopy are important for monitoring carotenoid accumulation in a whole cell cultured under various conditions. A simple and rapid assay utilizing aerial microalgae helps to identify stress conditions that can efficiently enhance the carotenogenesis in photosynthetic organisms. The spectra of cell suspensions were characterized in the aerial microalga Coelastrella sp. KGU-Y002, which are unicellular and undifferentiated. Total carotenoid contents could be successfully estimated on the basis of the absorbance values of the cell suspensions and calibration data analyzed by HPLC (high-performance liquid chromatography). A novel screening method, the so-called "whole-cell-based screening method" for carotenoid assays (WCA), was developed based on this procedure. It was possible to investigate the effects of various stresses on carotenoid accumulation in the aerial microalga by adapting this bioassay to a 96-well microtiter plate. When bioactive compounds were screened from our library of plant extracts using this method, an active compound was identified from the plant extract. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Evaluation of detection methods for screening meat and poultry products for the presence of foodborne pathogens.

    Science.gov (United States)

    Bohaychuk, Valerie M; Gensler, Gary E; King, Robin K; Wu, John T; McMullen, Lynn M

    2005-12-01

    Rapid and molecular technologies such as enzyme-linked immunosorbent assay (ELISA), PCR, and lateral flow immunoprecipitation can reduce the time and labor involved in screening food products for the presence of pathogens. These technologies were compared with conventional culture methodology for the detection of Salmonella, Campylobacter, Listeria, and Escherichia coli O157:H7 inoculated in raw and processed meat and poultry products. Recommended protocols were modified so that the same enrichment broths used in the culture methods were also used in the ELISA, PCR, and lateral flow immunoprecipitation assays. The percent agreement between the rapid technologies and culture methods ranged from 80 to 100% depending on the pathogen detected and the method used. ELISA, PCR, and lateral flow immunoprecipitation all performed well, with no statistical difference, compared with the culture method for the detection of E. coli O157:H7. ELISA performed better for the detection of Salmonella, with sensitivity and specificity rates of 100%. PCR performed better for the detection of Campylobacter jejuni, with 100% agreement to the culture method. PCR was highly sensitive for the detection of all the foodborne pathogens tested except Listeria monocytogenes. Although the lateral flow immunoprecipitation tests were statistically different from the culture methods for Salmonella and Listeria because of false-positive results, the tests did not produce any false negatives, indicating that this method would be suitable for screening meat and poultry products for these pathogens.

  10. The virtual fields method applied to spalling tests on concrete

    Directory of Open Access Journals (Sweden)

    Forquin P.

    2012-08-01

    Full Text Available For one decade spalling techniques based on the use of a metallic Hopkinson bar put in contact with a concrete sample have been widely employed to characterize the dynamic tensile strength of concrete at strain-rates ranging from a few tens to two hundreds of s−1. However, the processing method mainly based on the use of the velocity profile measured on the rear free surface of the sample (Novikov formula remains quite basic and an identification of the whole softening behaviour of the concrete is out of reach. In the present paper a new processing method is proposed based on the use of the Virtual Fields Method (VFM. First, a digital high speed camera is used to record the pictures of a grid glued on the specimen. Next, full-field measurements are used to obtain the axial displacement field at the surface of the specimen. Finally, a specific virtual field has been defined in the VFM equation to use the acceleration map as an alternative ‘load cell’. This method applied to three spalling tests allowed to identify Young’s modulus during the test. It was shown that this modulus is constant during the initial compressive part of the test and decreases in the tensile part when micro-damage exists. It was also shown that in such a simple inertial test, it was possible to reconstruct average axial stress profiles using only the acceleration data. Then, it was possible to construct local stress-strain curves and derive a tensile strength value.

  11. A radiometric method for estimating blood cholinesterase in the field*

    Science.gov (United States)

    Winteringham, F. P. W.; Disney, R. W.

    1964-01-01

    A radiometric method has been developed which provides for the simple and rapid measurement of human blood cholinesterase under field conditions. The method involves minimal dilution of samples and the use of very low substrate concentrations, and is therefore more sensitive to cholinesterase inhibition by reversible anticholinesterases such as carbamates than the conventional manometric or ΔpH methods. A 20-μl sample of haemolysed whole blood is mixed with 14C-labelled acetylcholine on a cavity microscope slide. After half a minute or three minutes the mixture is acidified and dried. Under these conditions radioactive acetate liberated enzymically is completely volatile while the radioactive unhydrolysed substrate is not. The loss of radioactivity on acidification and drying is therefore a direct measure of the acetylcholinesterase activity. The levels of radioactivity employed are far below those likely to present any significant health hazard or to require special laboratory conditions. Although the method requires a labelled substrate, a single preparation is sufficient for several hundred thousand enzyme assays. The method has been tested under simulated field conditions. PMID:14122430

  12. Development of Method for Quantitative Determination of Water Arsenic by Field Test Kit

    Directory of Open Access Journals (Sweden)

    Makoto SEKINE

    2018-04-01

    Full Text Available Drinking of arsenic (As contaminated ground water is threatening the health of millions of peoples of Bangladesh. The screening of tube wells (TWs water for As in Bangladesh and elsewhere in the world is done by As testing kits. The results of water-As by these kits are semi-quantitative and personal error is high. An attempt has been undertaken for quantitative determination of water-As by MITech arsenic test kit by applying quantitative image analysis method from the digital picture of the colored test paper of the kit. In the quantitative image analysis method, the color of the test paper is numerically determined by color difference between the test water samples with the standard color chart which is calculated from Lab (lightness (L, color opponent green-red (a, and color opponent blue-yellow (b values. TWs water-As concentrations in Bashailbogh village, Munshiganj, Bangladesh were determined by using MITech arsenic field test kit by conventional method, quantitative image analysis method and inductively coupled plasma mass spectrometer (ICP-MS method. The water-As by the quantitative image method gave quite close results (R2 = 0.998 to those obtained with ICP-MS method at concentration up to 50 µg As L-1. The water-As concentration more than 50 µg As L-1 by this method was underestimated. Hence, the developed method may be used for quantitative analysis of water-As in the range of 0–50 µg As L-1 for water-As screening program. [Fundam Appl Agric 2018; 3(1.000: 340-346

  13. High-Solids Enzymatic Saccharification Screening Method for Lignocellulosic Biomass (Poster)

    Energy Technology Data Exchange (ETDEWEB)

    Roche, C. M.; Stickel, J. J.

    2009-05-01

    The ability to screen new biomass pretreatments and advanced enzyme systems at process-relevant conditions is key to developing economically viable lignocellulosic ethanol. While much research is being invested in developing pretreatment technologies and enzyme systems that will more efficiently convert cellulosic biomass to sugars, the current standard reactor vessel, a shake flask, that is used for screening enzymatic saccharification of cellulosic biomass is inadequate at high-solids conditions. Shake flasks do not provide adequate mixing at high solids conditions. In this work, a roller bottle reactor was identified as a small-scale high-solids saccharification reaction vessel, and a method was developed for use in screening both pretreated biomass and enzyme systems at process-relevant conditions. This new method addresses mixing issues observed in high-solids saccharifications. In addition, yield calculations from sugar concentrations on a mass basis were used to account for the two-phase nature of the saccharification slurry, which eliminates discontinuities in comparing high-solids to low-solids saccharifications that occur when using concentrations on a volume basis. The roller bottle reactors out-performed the shake flasks by 5% for an initial insoluble solids loading of 15% and 140% for an initial soluble solids loading of 30%. The reactor system and method was compared at bench and floor scales and determined to be scalable for initial insoluble solids loading in the range of 15% to 30%. Pretreatment and enzyme screening results indicate that mid severity pretreated biomass is more digestible than the low and high severity biomass and GC220 is a superior enzyme to Spezyme CP.

  14. Do recommended doses of glyphosate-based herbicides affect soil invertebrates? Field and laboratory screening tests to risk assessment.

    Science.gov (United States)

    Niemeyer, Júlia Carina; de Santo, Fernanda Benedet; Guerra, Naiara; Ricardo Filho, Altair Maçaneiro; Pech, Tatiani Maria

    2018-05-01

    Despite glyphosate-based herbicides are widely used in agriculture, forestry and gardens, little is known about its effects on non-target organisms. The present work evaluated the ecotoxicity of four formulated products (Roundup ® Original, Trop ® , Zapp ® Qi 620 and Crucial ® ) on soil invertebrates. Screening ecotoxicity tests were carried out with soil and oat straw collected in a field experiment, besides laboratory-spiked soils. Screening tests included avoidance behaviour of earthworms (Eisenia andrei), collembolans (Folsomia candida) and isopods (Porcellio dilatatus) in single and multispecies tests; reproduction of collembolans (F. candida), and bait lamina in field. Non-avoidance behaviour was observed in standard tests (earthworms) in soil, neither in multispecies tests (earthworm + isopods) using oat straw, while for collembolans it occurred for the product Zapp ® Qi 620 even at the recommended dose. Reproduction of F. candida was not impaired even at high doses in laboratory-spiked soils. Feeding activity on bait lamina test was impaired in treatment corresponding to the red label product, Crucial ® . Results showed the relevance of bait lamina test on screening the impact of herbicides in the field. The findings highlight the importance of considering different formulations for the same active ingredient in risk assessment of pesticides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  16. Grassmann phase space methods for fermions. II. Field theory

    Energy Technology Data Exchange (ETDEWEB)

    Dalton, B.J., E-mail: bdalton@swin.edu.au [Centre for Quantum and Optical Science, Swinburne University of Technology, Melbourne, Victoria 3122 (Australia); Jeffers, J. [Department of Physics, University of Strathclyde, Glasgow G4ONG (United Kingdom); Barnett, S.M. [School of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ (United Kingdom)

    2017-02-15

    In both quantum optics and cold atom physics, the behaviour of bosonic photons and atoms is often treated using phase space methods, where mode annihilation and creation operators are represented by c-number phase space variables, with the density operator equivalent to a distribution function of these variables. The anti-commutation rules for fermion annihilation, creation operators suggests the possibility of using anti-commuting Grassmann variables to represent these operators. However, in spite of the seminal work by Cahill and Glauber and a few applications, the use of Grassmann phase space methods in quantum-atom optics to treat fermionic systems is rather rare, though fermion coherent states using Grassmann variables are widely used in particle physics. This paper presents a phase space theory for fermion systems based on distribution functionals, which replace the density operator and involve Grassmann fields representing anti-commuting fermion field annihilation, creation operators. It is an extension of a previous phase space theory paper for fermions (Paper I) based on separate modes, in which the density operator is replaced by a distribution function depending on Grassmann phase space variables which represent the mode annihilation and creation operators. This further development of the theory is important for the situation when large numbers of fermions are involved, resulting in too many modes to treat separately. Here Grassmann fields, distribution functionals, functional Fokker–Planck equations and Ito stochastic field equations are involved. Typical applications to a trapped Fermi gas of interacting spin 1/2 fermionic atoms and to multi-component Fermi gases with non-zero range interactions are presented, showing that the Ito stochastic field equations are local in these cases. For the spin 1/2 case we also show how simple solutions can be obtained both for the untrapped case and for an optical lattice trapping potential.

  17. Grassmann phase space methods for fermions. II. Field theory

    International Nuclear Information System (INIS)

    Dalton, B.J.; Jeffers, J.; Barnett, S.M.

    2017-01-01

    In both quantum optics and cold atom physics, the behaviour of bosonic photons and atoms is often treated using phase space methods, where mode annihilation and creation operators are represented by c-number phase space variables, with the density operator equivalent to a distribution function of these variables. The anti-commutation rules for fermion annihilation, creation operators suggests the possibility of using anti-commuting Grassmann variables to represent these operators. However, in spite of the seminal work by Cahill and Glauber and a few applications, the use of Grassmann phase space methods in quantum-atom optics to treat fermionic systems is rather rare, though fermion coherent states using Grassmann variables are widely used in particle physics. This paper presents a phase space theory for fermion systems based on distribution functionals, which replace the density operator and involve Grassmann fields representing anti-commuting fermion field annihilation, creation operators. It is an extension of a previous phase space theory paper for fermions (Paper I) based on separate modes, in which the density operator is replaced by a distribution function depending on Grassmann phase space variables which represent the mode annihilation and creation operators. This further development of the theory is important for the situation when large numbers of fermions are involved, resulting in too many modes to treat separately. Here Grassmann fields, distribution functionals, functional Fokker–Planck equations and Ito stochastic field equations are involved. Typical applications to a trapped Fermi gas of interacting spin 1/2 fermionic atoms and to multi-component Fermi gases with non-zero range interactions are presented, showing that the Ito stochastic field equations are local in these cases. For the spin 1/2 case we also show how simple solutions can be obtained both for the untrapped case and for an optical lattice trapping potential.

  18. The experimental field work as practical learning method

    Directory of Open Access Journals (Sweden)

    Nicolás Fernández Losa

    2014-11-01

    Full Text Available This paper describes a teaching experience about experimental field work as practical learning method implemented in the subject of Organizational Behaviour. With this teaching experience we pretend to change the practical training, as well as in its evaluation process, in order to favour the development of transversal skills of students. For this purpose, the use of a practice plan, tackled through an experimental field work and carried out with the collaboration of a business organization within a work team (as organic unity of learning, arises as an alternative to the traditional method of practical teachings and allows the approach of business reality into the classroom, as well as actively promote the use of transversal skills. In particular, we develop the experience in three phases. Initially, the students, after forming a working group and define a field work project, should get the collaboration of a nearby business organization in which to obtain data on one or more functional areas of organizational behaviour. Subsequently, students carry out the field work with the realization of the scheduled visits and elaboration of a memory to establish a diagnosis of the strategy followed by the company in these functional areas in order to propose and justify alternative actions that improve existing ones. Finally, teachers assess the different field work memories and their public presentations according to evaluation rubrics, which try to objectify and unify to the maximum the evaluation criteria and serve to guide the learning process of students. The results of implementation of this teaching experience, measured through a Likert questionnaire, are very satisfactory for students.

  19. Field Sample Preparation Method Development for Isotope Ratio Mass Spectrometry

    International Nuclear Information System (INIS)

    Leibman, C.; Weisbrod, K.; Yoshida, T.

    2015-01-01

    Non-proliferation and International Security (NA-241) established a working group of researchers from Los Alamos National Laboratory (LANL), Pacific Northwest National Laboratory (PNNL) and Savannah River National Laboratory (SRNL) to evaluate the utilization of in-field mass spectrometry for safeguards applications. The survey of commercial off-the-shelf (COTS) mass spectrometers (MS) revealed no instrumentation existed capable of meeting all the potential safeguards requirements for performance, portability, and ease of use. Additionally, fieldable instruments are unlikely to meet the International Target Values (ITVs) for accuracy and precision for isotope ratio measurements achieved with laboratory methods. The major gaps identified for in-field actinide isotope ratio analysis were in the areas of: 1. sample preparation and/or sample introduction, 2. size reduction of mass analyzers and ionization sources, 3. system automation, and 4. decreased system cost. Development work in 2 through 4, numerated above continues, in the private and public sector. LANL is focusing on developing sample preparation/sample introduction methods for use with the different sample types anticipated for safeguard applications. Addressing sample handling and sample preparation methods for MS analysis will enable use of new MS instrumentation as it becomes commercially available. As one example, we have developed a rapid, sample preparation method for dissolution of uranium and plutonium oxides using ammonium bifluoride (ABF). ABF is a significantly safer and faster alternative to digestion with boiling combinations of highly concentrated mineral acids. Actinides digested with ABF yield fluorides, which can then be analyzed directly or chemically converted and separated using established column chromatography techniques as needed prior to isotope analysis. The reagent volumes and the sample processing steps associated with ABF sample digestion lend themselves to automation and field

  20. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...... predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher...

  2. Function-specific virtual screening for GPCR ligands using a combined scoring method.

    Science.gov (United States)

    Kooistra, Albert J; Vischer, Henry F; McNaught-Flores, Daniel; Leurs, Rob; de Esch, Iwan J P; de Graaf, Chris

    2016-06-24

    The ability of scoring functions to correctly select and rank docking poses of small molecules in protein binding sites is highly target dependent, which presents a challenge for structure-based drug discovery. Here we describe a virtual screening method that combines an energy-based docking scoring function with a molecular interaction fingerprint (IFP) to identify new ligands based on G protein-coupled receptor (GPCR) crystal structures. The consensus scoring method is prospectively evaluated by: 1) the discovery of chemically novel, fragment-like, high affinity histamine H1 receptor (H1R) antagonists/inverse agonists, 2) the selective structure-based identification of ß2-adrenoceptor (ß2R) agonists, and 3) the experimental validation and comparison of the combined and individual scoring approaches. Systematic retrospective virtual screening simulations allowed the definition of scoring cut-offs for the identification of H1R and ß2R ligands and the selection of an optimal ß-adrenoceptor crystal structure for the discrimination between ß2R agonists and antagonists. The consensus approach resulted in the experimental validation of 53% of the ß2R and 73% of the H1R virtual screening hits with up to nanomolar affinities and potencies. The selective identification of ß2R agonists shows the possibilities of structure-based prediction of GPCR ligand function by integrating protein-ligand binding mode information.

  3. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  4. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  5. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  6. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  7. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products. PMID:26257724

  8. POWER FREQUENCY TECHNOGENIC MAGNETIC FIELD REDUCTION BY ACTIVE SCREENING IN SYSTEM SYNTHESIS IN AREA BASED ON STOCHASTIC MULTI-AGENT OPTIMIZATION

    Directory of Open Access Journals (Sweden)

    B.I. Kuznetsov

    2015-06-01

    Full Text Available Purpose. Development of a method of synthesis of systems of active screening of technogenic power frequency magnetic fields within a given region of space, as well as the synthesis and performance evaluation systems synthesized active shielding magnetic field. Methodology. A mathematical model for calculating the components of the magnetic field created by current distributors power line generator or electrical conductors power and control windings magnetic executive bodies on the basis of the law of Biot - Savart - Laplace. Conductors are taken as a set of elementary sections conductors, which allows to calculate the magnetic field conductors of any shape that is different from the ideal straight lines or rectangles, and in particular, to consider the slack conductors power line power lines. Results. Synthesis of active shielding systems for technogenic power frequency magnetic fields is reduced to the solution of a nonlinear programming problem with constraints, which computation of the objective function and constraints is performed based on the Biot - Savart - Laplace law. Formulated nonlinear programming problem is solved by using the multiextremal and stochastic multi-agent method based on particle swarm optimization, in which the particle swarm move in a multidimensional search space. Originality. First developed a method for the synthesis of active shielding systems for technogenic power frequency magnetic fields using controlled source of the magnetic field by solving a nonlinear programming problem with constraints based on stochastic particle swarm optimization of multi-agent. Practical value. Examples of synthesis of systems of active shielding technogenic power frequency magnetic fields and high efficiency of the synthesized systems.

  9. Does propagation method affect the field performance of peach trees?

    Directory of Open Access Journals (Sweden)

    André Luiz Kulkamp de Souza

    2017-08-01

    Full Text Available Worldwide, peach propagation has been performed mainly by grafting scions of desirable cultivars on rootstocks obtained from seeds. There are, however, other potential propagation methods not widely adopted due to the limited reports on the field performance of the resultant trees. This study addressed this knowledge gap and investigated the field performance of peach trees of the cultivar Maciel that were established in an orchard (5.0 m × 1.4 m spacing in 2011. The trees were trained in a "Y" system, with seedlings from three propagation techniques: 1 Conventional System (CS - vegetative bud grafting of the scion on the rootstock of the Okinawa cultivar obtained from seed; 2 Rootstock by Minicutting (RM - vegetative bud grafting of the scion on the rootstock of the Okinawa cultivar obtained by minicutting in a semi-hydroponic system; 3 Self-Rooting (SR - self-rooting of the scion in a semi-hydroponic system. The vegetative, productive, and fruit quality parameters were assessed during 2012 and 2013. The Maciel peach trees that were propagated by the SR technique were found to have similar or even superior field performance to those propagated by the CS. The RM propagation method was also found to be an important potential alternative to peach propagation, since this it combines two techniques (cutting and grafting to reduce tree vigor, especially if the goal is high-density planting.

  10. Rapid, high-temperature, field test method for evaluation of geothermal calcium carbonate scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1986-09-01

    A new test method is described that allows the rapid field testing of calcium carbonate scale inhibitors at 500/sup 0/F (260/sup 0/C). The method evolved from use of a full-flow test loop on a well with a mass flow rate of about 1 x 10/sup 6/ lbm/hr (126 kg/s). It is a simple, effective way to evaluate the effectiveness of inhibitors under field conditions. Five commercial formulations were chosen for field evaluation on the basis of nonflowing, laboratory screening tests at 500/sup 0/F (260/sup 0/C). Four of these formulations from different suppliers controlled calcium carbonate scale deposition as measured by the test method. Two of these could dislodge recently deposited scale that had not age-hardened. Performance-profile diagrams, which were measured for these four effective inhibitors, show the concentration interrelationship between brine calcium and inhibitor concentrations at which the formulations will and will not stop scale formation in the test apparatus. With these diagrams, one formulation was chosen for testing on the full-flow brine line. The composition was tested for 6 weeks and showed a dramatic decrease in the scaling occurring at the flow-control valve. This scaling was about to force a shutdown of a major, long-term flow test being done for reservoir economic evaluations. The inhibitor stopped the scaling, and the test was performed without interruption.

  11. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  12. Hamiltonian lattice field theory: Computer calculations using variational methods

    International Nuclear Information System (INIS)

    Zako, R.L.

    1991-01-01

    I develop a variational method for systematic numerical computation of physical quantities -- bound state energies and scattering amplitudes -- in quantum field theory. An infinite-volume, continuum theory is approximated by a theory on a finite spatial lattice, which is amenable to numerical computation. I present an algorithm for computing approximate energy eigenvalues and eigenstates in the lattice theory and for bounding the resulting errors. I also show how to select basis states and choose variational parameters in order to minimize errors. The algorithm is based on the Rayleigh-Ritz principle and Kato's generalizations of Temple's formula. The algorithm could be adapted to systems such as atoms and molecules. I show how to compute Green's functions from energy eigenvalues and eigenstates in the lattice theory, and relate these to physical (renormalized) coupling constants, bound state energies and Green's functions. Thus one can compute approximate physical quantities in a lattice theory that approximates a quantum field theory with specified physical coupling constants. I discuss the errors in both approximations. In principle, the errors can be made arbitrarily small by increasing the size of the lattice, decreasing the lattice spacing and computing sufficiently long. Unfortunately, I do not understand the infinite-volume and continuum limits well enough to quantify errors due to the lattice approximation. Thus the method is currently incomplete. I apply the method to real scalar field theories using a Fock basis of free particle states. All needed quantities can be calculated efficiently with this basis. The generalization to more complicated theories is straightforward. I describe a computer implementation of the method and present numerical results for simple quantum mechanical systems

  13. Hamiltonian lattice field theory: Computer calculations using variational methods

    International Nuclear Information System (INIS)

    Zako, R.L.

    1991-01-01

    A variational method is developed for systematic numerical computation of physical quantities-bound state energies and scattering amplitudes-in quantum field theory. An infinite-volume, continuum theory is approximated by a theory on a finite spatial lattice, which is amenable to numerical computation. An algorithm is presented for computing approximate energy eigenvalues and eigenstates in the lattice theory and for bounding the resulting errors. It is shown how to select basis states and choose variational parameters in order to minimize errors. The algorithm is based on the Rayleigh-Ritz principle and Kato's generalizations of Temple's formula. The algorithm could be adapted to systems such as atoms and molecules. It is shown how to compute Green's functions from energy eigenvalues and eigenstates in the lattice theory, and relate these to physical (renormalized) coupling constants, bound state energies and Green's functions. Thus one can compute approximate physical quantities in a lattice theory that approximates a quantum field theory with specified physical coupling constants. The author discusses the errors in both approximations. In principle, the errors can be made arbitrarily small by increasing the size of the lattice, decreasing the lattice spacing and computing sufficiently long. Unfortunately, the author does not understand the infinite-volume and continuum limits well enough to quantify errors due to the lattice approximation. Thus the method is currently incomplete. The method is applied to real scalar field theories using a Fock basis of free particle states. All needed quantities can be calculated efficiently with this basis. The generalization to more complicated theories is straightforward. The author describes a computer implementation of the method and present numerical results for simple quantum mechanical systems

  14. Local Field Response Method Phenomenologically Introducing Spin Correlations

    Science.gov (United States)

    Tomaru, Tatsuya

    2018-03-01

    The local field response (LFR) method is a way of searching for the ground state in a similar manner to quantum annealing. However, the LFR method operates on a classical machine, and quantum effects are introduced through a priori information and through phenomenological means reflecting the states during the computations. The LFR method has been treated with a one-body approximation, and therefore, the effect of entanglement has not been sufficiently taken into account. In this report, spin correlations are phenomenologically introduced as one of the effects of entanglement, by which multiple tunneling at anticrossing points is taken into account. As a result, the accuracy of solutions for a 128-bit system increases by 31% compared with that without spin correlations.

  15. Precise magnetostatic field using the finite element method

    International Nuclear Information System (INIS)

    Nascimento, Francisco Rogerio Teixeira do

    2013-01-01

    The main objective of this work is to simulate electromagnetic fields using the Finite Element Method. Even in the easiest case of electrostatic and magnetostatic numerical simulation some problems appear when the nodal finite element is used. It is difficult to model vector fields with scalar functions mainly in non-homogeneous materials. With the aim to solve these problems two types of techniques are tried: the adaptive remeshing using nodal elements and the edge finite element that ensure the continuity of tangential components. Some numerical analysis of simple electromagnetic problems with homogeneous and non-homogeneous materials are performed using first, the adaptive remeshing based in various error indicators and second, the numerical solution of waveguides using edge finite element. (author)

  16. Plasma Acceleration by Rotating Magnetic Field Method using Helicon Source

    Science.gov (United States)

    Furukawa, Takeru; Shimura, Kaichi; Kuwahara, Daisuke; Shinohara, Shunjiro

    2017-10-01

    Electrodeless plasma thrusters are very promising due to no electrode damage, leading to realize further deep space exploration. As one of the important proposals, we have been concentrating on Rotating Magnetic Field (RMF) acceleration method. High-dense plasma (up to 1013 cm-3) can be generated by using a radio frequency (rf) external antenna, and also accelerated by an antenna wound around outside of a discharge tube. In this scheme, thrust increment is achieved by the axial Lorentz force caused by non linear effects. RMF penetration condition into plasma can be more satisfied than our previous experiment, by increasing RMF coil current and decreasing the RMF frequency, causing higher thrust and fuel efficiency. Measurements of AC RMF component s have been conducted to investigate the acceleration mechanism and the field penetration experimentally. This study has been partially supported by Grant-in-Aid for Scientific Research (B: 17H02995) from the Japan Society for the Promotion of Science.

  17. A screening method of oil-soluble synthetic dyes in chilli products based on multi-wavelength chromatographic fingerprints comparison.

    Science.gov (United States)

    Zhu, Yonghong; Wu, Yanlei; Zhou, Chunjie; Zhao, Bo; Yun, Wen; Huang, Siyu; Tao, Peng; Tu, Dawei; Chen, Shiqi

    2016-02-01

    A multi-wavelength HPLC fingerprint comparison method was proposed for the screening of oil-soluble synthetic dyes in chilli products. The screening was based on the fingerprint differences of normal unadulterated chilli sample with tested chilli samples. The samples were extracted with acetone and fingerprinted by HPLC under four visible light wavelengths (450 nm, 490 nm, 520 nm, and 620 nm). It was found that the fingerprints of different chilli product samples had a relatively fixed number of peaks and stable retention time. When 16 kinds of known synthetic dyes were used as model analytes to assess the screening efficiency, 14 of them could be screened using fingerprint comparison method, with LOD of 0.40-2.41 mg/kg. The new screening method was simple and had the possibility of finding existence of the adulterated dyes which could not be identified using known standard analytes as control. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Computerized Lung Sound Screening for Pediatric Auscultation in Noisy Field Environments.

    Science.gov (United States)

    Emmanouilidou, Dimitra; McCollum, Eric D; Park, Daniel E; Elhilali, Mounya

    2017-06-19

    Chest auscultations offer a non-invasive and low-cost tool for monitoring lung disease. However, they present many shortcomings including inter-listener variability, subjectivity, and vulnerability to noise and distortions. The current work proposes a computer-aided approach to process lung signals acquired in the field under adverse noisy conditions, by improving the signal quality and offering automated iden- tification of abnormal auscultations indicative of respiratory pathologies. The developed noise-suppression scheme eliminates ambient sounds, heart sounds, sensor artifacts and crying contamination. The improved high-quality signal is then mapped onto a rich spectro-temporal feature space before being classified using a trained support-vector machine clas- sifier. Individual signal frame decisions are then combined using an evaluation scheme, providing an overall patient-level decision for unseen patient records. All methods are evaluated on a large data set with > 1,000 children enrolled, 1-59 months old. The noise suppression scheme is shown to significantly improve signal quality; and the classification system achieves an accuracy of 86.7% in distinguishing normal from pathological sounds, far surpassing other state-of-the art methods. Computerized lung sound processing can benefit from the enforcement of advanced noise-suppression. A fairly short processing window size (< 1 s) combined with detailed spectro-temporal features is recommended, in order to capture transient adventitious events without highlighting sharp noise occurrences. Unlike existing methodologies in the literature, the proposed work is not limited in scope or confined to laboratory-settings: this work validates a practical method for fully automated chest sound processing applicable to realistic and noisy auscultation settings.

  19. Developmental neurotoxicity testing: recommendations for developing alternative methods for the screening and prioritization of chemicals.

    Science.gov (United States)

    Crofton, Kevin M; Mundy, William R; Lein, Pamela J; Bal-Price, Anna; Coecke, Sandra; Seiler, Andrea E M; Knaut, Holger; Buzanska, Leonora; Goldberg, Alan

    2011-01-01

    Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternative methods to current animal testing protocols and guidelines. An immediate goal is to develop test methods that are capable of screening large numbers of chemicals. This document provides recommendations for developing alternative DNT approaches that will generate the type of data required for evaluating and comparing predictive capacity and efficiency across test methods and laboratories. These recommendations were originally drafted to stimulate and focus discussions of alternative testing methods and models for DNT at the TestSmart DNT II meeting (http://caat.jhsph.edu/programs/workshops/dnt2.html) and this document reflects critical feedback from all stakeholders that participated in this meeting. The intent of this document is to serve as a catalyst for engaging the research community in the development of DNT alternatives and it is expected that these recommendations will continue to evolve with the science.

  20. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  1. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  2. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  3. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  4. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  5. A field method for monitoring thoron-daughter working level

    International Nuclear Information System (INIS)

    Khan, A.H.; Dhandayatham, R.; Raghavayya, M.; Nambiar, P.P.V.J.

    1975-01-01

    The concept of working level, generally used for radon daughters, has been extended to the daughter products of thoron. Accordingly, thorondaughter working level (TWL) has been defined as the alpha energy released from the ultimate decay of 100 pCi/1 each of the short-lived decay products of thoron. In order to facilitate the evaluation of inhalation hazard in thorium handling areas, a simple field method has been suggested to measure the thoron-daughter working level. A comparison of the potential alpha energies from radon-daughters and that from thoron-daughter is included. (K.B.)

  6. Fast high-throughput screening of temoporfin-loaded liposomal formulations prepared by ethanol injection method.

    Science.gov (United States)

    Yang, Kewei; Delaney, Joseph T; Schubert, Ulrich S; Fahr, Alfred

    2012-03-01

    A new strategy for fast, convenient high-throughput screening of liposomal formulations was developed, utilizing the automation of the so-called ethanol-injection method. This strategy was illustrated by the preparation and screening of the liposomal formulation library of a potent second-generation photosensitizer, temoporfin. Numerous liposomal formulations were efficiently prepared using a pipetting robot, followed by automated size characterization, using a dynamic light scattering plate reader. Incorporation efficiency of temoporfin and zeta potential were also detected in selected cases. To optimize the formulation, different parameters were investigated, including lipid types, lipid concentration in injected ethanol, ratio of ethanol to aqueous solution, ratio of drug to lipid, and the addition of functional phospholipid. Step-by-step small liposomes were prepared with high incorporation efficiency. At last, an optimized formulation was obtained for each lipid in the following condition: 36.4 mg·mL(-1) lipid, 13.1 mg·mL(-1) mPEG(2000)-DSPE, and 1:4 ethanol:buffer ratio. These liposomes were unilamellar spheres, with a diameter of approximately 50 nm, and were very stable for over 20 weeks. The results illustrate this approach to be promising for fast high-throughput screening of liposomal formulations.

  7. SCREENING METHOD OF THE DYSPLASIA OF THE CONNECTIVE TISSUE IN ADOLESCENTS

    Directory of Open Access Journals (Sweden)

    G. Y. Kalaeva

    2016-01-01

    Full Text Available ABSTRACT Aim of the study is to develop the diagnostic checklist based on the incidence and significance analysis of the external features of the dysplasia of the connective tissue (DCT for its screening and assessment of its prevalence in the adolescents’ population.Materials and methods.110 adolescents (aged from 10 to 14 years were examined, 81 of them had the dysplasia of the connective tissue (the first group. The second group was presented by 29 adolescents without DCT. The presence and degree of manifestation of DCT were established according to the criterions of Kadurina T. I., Gorbunova V.N. (2009, Т. Milkovska–Dimitrova (1987. There were the physical, laboratory and instrumental examination. Statistical processing of the results was carried out using Statistica 6.0 program and IBM SPSS Statistics 20.0. The diagnostic efficiency of the developed checklist was appreciated by means of the receiver operating characteristic curve (ROC curve. Results. The frequent occurrence of the DCT’s external features in adolescents was identified. The diagnostic checklist was developed. It was consisted of 12 items with illustrations, allowing readily identification of the dysplastic phenotype presence with diagnostic sensitivity 81.5% and specificity 79.3%. This checklist can be recommended as for the population studies, as for screening about DCT in adolescents during the primary outpatient pediatrician attendance. In the positive result of the screening it is necessary the further checkup to detect the organ changes and diagnosis updating. 

  8. A newborn screening method for cerebrotendinous xanthomatosis using bile alcohol glucuronides and metabolite ratios.

    Science.gov (United States)

    Vaz, Frédéric M; Bootsma, Albert H; Kulik, Willem; Verrips, Aad; Wevers, Ron A; Schielen, Peter C; DeBarber, Andrea E; Huidekoper, Hidde H

    2017-05-01

    Cerebrotendinous xanthomatosis (CTX) is a treatable neurodegenerative metabolic disorder of bile acid synthesis in which symptoms can be prevented if treatment with chenodeoxycholic acid supplementation is initiated early in life, making CTX an excellent candidate for newborn screening. We developed a new dried blood spot (DBS) screening assay for this disorder on the basis of different ratios between the accumulating cholestanetetrol glucuronide (tetrol) and specific bile acids/bile acid intermediates, without the need for derivatization. A quarter-inch DBS punch was extracted with methanol, internal standards were added, and after concentration the extract was injected into the tandem mass spectrometer using a 2 min flow injection analysis for which specific transitions were measured for cholestanetetrol glucuronide, taurochenodeoxycholic acid (t-CDCA), and taurotrihydroxycholestanoic acid (t-THCA). A proof-of-principle experiment was performed using 217 Guthrie cards from healthy term/preterm newborns, CTX patients, and Zellweger patients. Using two calculated biomarkers, tetrol:t-CDCA and t-THCA:tetrol, this straightforward method achieved an excellent separation between DBSs of CTX patients and those of controls, Zellweger patients, and newborns with cholestasis. The results of this small pilot study indicate that the tetrol:t-CDCA ratio is an excellent derived biomarker for CTX that has the potential to be used in neonatal screening programs. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  9. Statistical methods in quantum optics 2 non-classical fields

    CERN Document Server

    Carmichael, H J

    2007-01-01

    Statistical Methods in Quantum Optics 2 - Non-Classical Fields continues the development of the methods used in quantum optics to treat open quantum systems and their fluctuations. Its early chapters build upon the phase-space methods introduced in the first volume Statistical Methods in Quantum Optics 1 - Matter Equations and Fokker-Planck Equations: the difficulties these methods face in treating non-classical light are exposed, where the regime of large fluctuations – failure of the system size expansion – is shown to be particularly problematic. Cavity QED is adopted as a natural vehicle for extending quantum noise theory into this regime. In response to the issues raised, the theory of quantum trajectories is presented as a universal approach to the treatment of fluctuations in open quantum systems. This book presents its material at a level suitable for beginning researchers or students in an advanced course in quantum optics, or a course in quantum mechanics or statistical physics that deals with o...

  10. Field method for detemining thorium-230 in soils

    International Nuclear Information System (INIS)

    Dechant, G.

    1989-05-01

    The US Department of Energy (DOE) Office of Remedial Action and Waste Technology established the Technical Measurements Center at the DOE Grand Junction, Colorado, Projects Office to develop and/or recommend measurement methods for use in support of its remedial action programs. This report describes a field method for the determination of Th-230 in soils for remedial action projects. The method involves a cold acid digestion, organic extraction, and precipitation of Th-230 for counting by alpha spectrometry. An internal Th-228 spike is added early in the method to eliminate the need to determine losses through the separation steps. A step-by-step procedure is included in the report. The method requires a small portable or mobile laboratory equipped with electrical power and ventilation. All additional equipment is commercially available and no special equipment is required. Chemical wastes for each analysis are stored for appropriate disposal off site. A chemist or chemical technician can complete 15--30 analyses per day depending primarily on the number of alpha spectrometers available. 8 refs., 2 figs., 7 tabs

  11. Path planning in uncertain flow fields using ensemble method

    KAUST Repository

    Wang, Tong

    2016-08-20

    An ensemble-based approach is developed to conduct optimal path planning in unsteady ocean currents under uncertainty. We focus our attention on two-dimensional steady and unsteady uncertain flows, and adopt a sampling methodology that is well suited to operational forecasts, where an ensemble of deterministic predictions is used to model and quantify uncertainty. In an operational setting, much about dynamics, topography, and forcing of the ocean environment is uncertain. To address this uncertainty, the flow field is parametrized using a finite number of independent canonical random variables with known densities, and the ensemble is generated by sampling these variables. For each of the resulting realizations of the uncertain current field, we predict the path that minimizes the travel time by solving a boundary value problem (BVP), based on the Pontryagin maximum principle. A family of backward-in-time trajectories starting at the end position is used to generate suitable initial values for the BVP solver. This allows us to examine and analyze the performance of the sampling strategy and to develop insight into extensions dealing with general circulation ocean models. In particular, the ensemble method enables us to perform a statistical analysis of travel times and consequently develop a path planning approach that accounts for these statistics. The proposed methodology is tested for a number of scenarios. We first validate our algorithms by reproducing simple canonical solutions, and then demonstrate our approach in more complex flow fields, including idealized, steady and unsteady double-gyre flows.

  12. The path integral method in quantum field theory

    International Nuclear Information System (INIS)

    Burden, C.J.

    1990-01-01

    Richard Feynman is reputed to have once the that in his whole life he had only ever had two really clever ideas. As it has turned out, these two ideas, the path integral formulation of quantum mechanics and the diagrammatic representation of perturbation theory have become the cornerstone of modern quantum field theory and particle physics. The path integral, first hinted at by Dirac in the thirties but developed fully by Feynman in the late 40's provides us with an alternative, though equivalent, description of quantum mechanics to canonical quantization. It was not until the seventies that it found broad application in quantum field theory (QFT), leading of gauge theories. It has also lead to the invention of non-perturbative techniques such as lattice gauge theory and has revealed an intimate connection between QFT and statistical mechanics. This paper, the author develops the basic of QFT form the path integral formalism and introduce the idea of Feynman diagrams for calculating perturbation expansions. I will concentrate mainly on the example of φ 4 theory since it is probably the simplest example of an interacting field theory, though the methods generalize readily to more sophisticated theories

  13. Fields Institute International Symposium on Asymptotic Methods in Stochastics

    CERN Document Server

    Kulik, Rafal; Haye, Mohamedou; Szyszkowicz, Barbara; Zhao, Yiqiang

    2015-01-01

    This book contains articles arising from a conference in honour of mathematician-statistician Miklόs Csörgő on the occasion of his 80th birthday, held in Ottawa in July 2012. It comprises research papers and overview articles, which provide a substantial glimpse of the history and state-of-the-art of the field of asymptotic methods in probability and statistics, written by leading experts. The volume consists of twenty articles on topics on limit theorems for self-normalized processes, planar processes, the central limit theorem and laws of large numbers, change-point problems, short and long range dependent time series, applied probability and stochastic processes, and the theory and methods of statistics. It also includes Csörgő’s list of publications during more than 50 years, since 1962.

  14. Efficient enforcement of far-field boundary conditions in the Transformed Field Expansions method

    Science.gov (United States)

    Nicholls, David P.

    2011-09-01

    The Method of Transformed Field Expansions (TFE) has been demonstrated to be a robust and highly accurate numerical scheme for simulating solutions of boundary value and free boundary problems from the sciences and engineering. As a Boundary Perturbation Method it builds highly accurate solutions based upon exact solutions in a simple, canonical, geometry and corrects these via Taylor series to fit the actual geometry at hand. The TFE method has significantly enhanced stability properties when compared with other Boundary Perturbation approaches, however, this comes at the cost of requiring a full volumetric discretization as opposed the surface formulation that other methods can realize. In this paper we outline two techniques for ameliorating this shortcoming, first by employing a Legendre Spectral Element Method to implement efficient, graded meshes, and second by utilizing an Artificial Boundary with a Transparent Boundary Condition placed quite close to the boundary of the domain. In this contribution we focus on the specific problem of simulating the Dirichlet-Neumann operator associated to Laplace's equation on a periodic cell (which arises in the water wave problem). While the details of our results are specific to this problem, the general conclusions are valid for the wider class of problems to which the TFE method can be applied. For each technique we discuss implementation details and display numerical results which support the conclusion that each of these techniques can greatly reduce the computational cost of using the TFE method.

  15. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  16. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  17. A graphical screening method for assessing stream water quality using specific conductivity and alkalinity data.

    Science.gov (United States)

    Kney, Arthur D; Brandes, David

    2007-03-01

    In areas of varying geology, it is difficult to infer water quality from specific conductance or electrical conductivity (EC) data without an understanding of the expected range of EC values based on local bedrock composition. This paper describes a user-friendly graphical screening method that addresses this issue by plotting the EC against concurrent alkalinity data, which correlates well with the presence of carbonate bedrock under natural conditions, and thus serves as an index of bedrock type. The upper limit of EC vs. alkalinity expected in a stream is determined using regional groundwater quality data, based on the assumption that stream chemistry reflects groundwater under baseflow conditions. Stream samples with EC/alkalinity values that consistently plot above this limit are considered impacted by anthropogenic sources. The effect of dilution and runoff on the EC vs. alkalinity plot of stream samples is considered using a simple baseflow/storm runoff-mixing model. The graphical method's utility as a screening tool is demonstrated by application to stream chemistry data from watersheds of southeastern Pennsylvania and northwestern New Jersey in several distinct geologic settings; however the method is general and widely applicable to watersheds in humid temperate regions. Its use is intended for watershed stewards of both professional and nonprofessional qualification.

  18. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  19. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  20. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    Science.gov (United States)

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  1. Field analysis of the deterioration after some years of use of four insect-proof screens utilized in Mediterranean greenhouses

    Directory of Open Access Journals (Sweden)

    A. López-Martínez

    2013-09-01

    Full Text Available The installation of insect-proof screens on greenhouse vents is one of the principal methods of protection against harmful insects for crops. Their main disadvantage lies on their negative effects on natural ventilation and greenhouse microclimate, which have been the focus of studies by several authors. However, few works have analysed the effect of accumulated dust and dirt on these screens. The present study has analysed four anti-insect screens, comparing their geometric characteristics before installation and after three to four years of use. Two negative effects have been observed and quantified: deterioration of the threads that make up the screen and reduction of porosity due to accumulated dirt in the pores. This deterioration over time gives leads to a mean increase in thread diameter of 3.1%, as well to a mean decrease in the pore size of 6.2% and 2.3% in the weft (Lpx and the warp (Lpy, respectively. In fact, the insect-proof screen porosity (φ decreased due to the deterioration of the threads by an average of 6.5%, in addition to an average 20.3% reduction due to the accumulation of dirt in the pores, making a total reduction in porosity of 26.8%. This decrease in porosity leads to lower greenhouse ventilation rates, and is therefore detrimental for the greenhouse microclimate. Consequently, it is recommended that insect-proof screens in arid areas such as Almería (Spain, with abundant dust suspended in the atmosphere, be washed monthly using water sprayed at high pressure.

  2. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  3. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  4. Optical sensing method for screening disease in melon seeds by using optical coherence tomography.

    Science.gov (United States)

    Lee, Changho; Lee, Seung-Yeol; Kim, Jeong-Yeon; Jung, Hee-Young; Kim, Jeehyun

    2011-01-01

    We report a noble optical sensing method to diagnose seed abnormalities using optical coherence tomography (OCT). Melon seeds infected with Cucumber green mottle mosaic virus (CGMMV) were scanned by OCT. The cross-sectional sensed area of the abnormal seeds showed an additional subsurface layer under the surface which is not found in normal seeds. The presence of CGMMV in the sample was examined by a blind test (n = 140) and compared by the reverse transcription-polymerase chain reaction. The abnormal layers (n = 40) were quantitatively investigated using A-scan sensing analysis and statistical method. By utilizing 3D OCT image reconstruction, we confirmed the distinctive layers on the whole seeds. These results show that OCT with the proposed data processing method can systemically pick up morphological modification induced by viral infection in seeds, and, furthermore, OCT can play an important role in automatic screening of viral infections in seeds.

  5. The background field method and its equivalence to conventional formulations of quantum field theories

    International Nuclear Information System (INIS)

    Rebhan, A.

    1984-03-01

    It is shown that the formulation of the background field method put forward in papers by De Witt, G. t'Hoff, Abbott and Boulware is equivalent to conventional methods, leading in perturbation theory to the same S matrix. An advantage is that the gauges of the outer lines and the vertex functions respectively can be fixed independently. Simple Lee identities are obtained which considerably simplify the renormalization procedure. The Feynman rules are only slightly more complicated than in conventional methods. Because the simple Lee identities are valid separately for one particle irreducible graphs of the same inner structure, an additional checking possiblity for calculations is obtained. (Author, shortened and translated by G.Q.)

  6. A rapid screening-level method to optimize location of infiltration ponds.

    Science.gov (United States)

    Fennemore, G G; Davis, A; Goss, L; Warrick, A W

    2001-01-01

    A rapid-screening technique was developed to identify lithologies that best disperse artificial recharge via surface infiltration and minimize effects on ground water chemistry. The technique prospectively evaluates basin infiltration rates and water chemistry influences by integrating geotechnical, hydraulic, and water quality data with column test data and numerical modeling. The technique was validated using field data collected from surface infiltration basins designed to recharge ground water pumped from the Pipeline pit gold mine in Nevada. Observed recharge rates at these infiltration sites correlated most significantly with depth to groundwater, with basins in coarse-grained lithologies performing better (0.45 to 0.85 m/day) than those with fine-grained layers ( 2000 mg/L) than coarse-grained soils (infiltration basins for a variety of lithologies. Sites for infiltration basins can be rapidly screened to include areas with greatest depth to groundwater and in coarsest alluvial sediments, and impact to ground water chemistry can be reliably predicted using computer modeling and column test results.

  7. Microbial screening for quinolones residues in cow milk by bio-optical method.

    Science.gov (United States)

    Appicciafuoco, Brunella; Dragone, Roberto; Frazzoli, Chiara; Bolzoni, Giuseppe; Mantovani, Alberto; Ferrini, Anna Maria

    2015-03-15

    The use of antibiotics on lactating cows should be monitored for the possible risk of milk contamination with residues. Accordingly, Maximum Residue Levels (MRLs) are established by the European Commission to guarantee consumers safety. As pointed out by Dec 2002/657/EC, screening is the first step in the strategy for antibiotic residue control, thus playing a key role in the whole control procedure. However, current routine screening methods applied in milk chain still fail to detect residues of quinolones at concentrations of interest. This paper reports the findings of a new bio-optical method for the screening of quinolones residues in bovine milk, based on E. coli ATCC 11303 growth inhibition. The effect of blank and spiked cow milk samples (aliquots equivalents to 0.8%, v/v) is evaluated in Mueller Hinton Broth (MHb) and MHb enriched with MgSO4 2% (MHb-Mg) inoculated with the test strain at the concentration of 10(4)CFU/mL. The presence of quinolones inhibits the cellular growth in MHb, while this effect is neutralized in MHb-Mg allowing both detection and presumptive identification of quinolones. Growth of the test strain is monitored at 37 °C in a Bioscreen C automated system, and Optical Density (OD) at 600 nm is recorded every 10 min after shaking for 10s. Growth curves (OD vs. time) of E. coli ATCC 11303 are assessed in milk samples, with and without quinolones, and their differences in terms of ΔOD (ΔOD600nm=ODMHb-Mg-ODMHb) are calculated. The presence of quinolones is detected by the cellular growth inhibition (OD vs time, none increase in the value OD) and presumptively identified through the increase of the slope of ΔOD600nm curve (ΔOD vs. time), after about 3h of incubation. The detection limit for ciprofloxacin and enrofloxacin is at the level of MRL, for marbofloxacin is at 2-fold the MRL whereas for danofloxacin is at 4-fold the MRL. Although the sensitivity of the method could be further improved and the procedure automated, it is a

  8. Powered by DFT: Screening methods that accelerate materials development for hydrogen in metals applications.

    Science.gov (United States)

    Nicholson, Kelly M; Chandrasekhar, Nita; Sholl, David S

    2014-11-18

    CONSPECTUS: Not only is hydrogen critical for current chemical and refining processes, it is also projected to be an important energy carrier for future green energy systems such as fuel cell vehicles. Scientists have examined light metal hydrides for this purpose, which need to have both good thermodynamic properties and fast charging/discharging kinetics. The properties of hydrogen in metals are also important in the development of membranes for hydrogen purification. In this Account, we highlight our recent work aimed at the large scale screening of metal-based systems with either favorable hydrogen capacities and thermodynamics for hydrogen storage in metal hydrides for use in onboard fuel cell vehicles or promising hydrogen permeabilities relative to pure Pd for hydrogen separation from high temperature mixed gas streams using dense metal membranes. Previously, chemists have found that the metal hydrides need to hit a stability sweet spot: if the compound is too stable, it will not release enough hydrogen under low temperatures; if the compound is too unstable, the reaction may not be reversible under practical conditions. Fortunately, we can use DFT-based methods to assess this stability via prediction of thermodynamic properties, equilibrium reaction pathways, and phase diagrams for candidate metal hydride systems with reasonable accuracy using only proposed crystal structures and compositions as inputs. We have efficiently screened millions of mixtures of pure metals, metal hydrides, and alloys to identify promising reaction schemes via the grand canonical linear programming method. Pure Pd and Pd-based membranes have ideal hydrogen selectivities over other gases but suffer shortcomings such as sensitivity to sulfur poisoning and hydrogen embrittlement. Using a combination of detailed DFT, Monte Carlo techniques, and simplified models, we are able to accurately predict hydrogen permeabilities of metal membranes and screen large libraries of candidate alloys

  9. A field trial of alternative targeted screening strategies for Chagas disease in Arequipa, Peru.

    Science.gov (United States)

    Hunter, Gabrielle C; Borrini-Mayorí, Katty; Ancca Juárez, Jenny; Castillo Neyra, Ricardo; Verastegui, Manuela R; Malaga Chavez, Fernando S; Cornejo del Carpio, Juan Geny; Córdova Benzaquen, Eleazar; Náquira, César; Gilman, Robert H; Bern, Caryn; Levy, Michael Z

    2012-01-01

    Chagas disease is endemic in the rural areas of southern Peru and a growing urban problem in the regional capital of Arequipa, population ∼860,000. It is unclear how to implement cost-effective screening programs across a large urban and periurban environment. We compared four alternative screening strategies in 18 periurban communities, testing individuals in houses with 1) infected vectors; 2) high vector densities; 3) low vector densities; and 4) no vectors. Vector data were obtained from routine Ministry of Health insecticide application campaigns. We performed ring case detection (radius of 15 m) around seropositive individuals, and collected data on costs of implementation for each strategy. Infection was detected in 21 of 923 (2.28%) participants. Cases had lived more time on average in rural places than non-cases (7.20 years versus 3.31 years, respectively). Significant risk factors on univariate logistic regression for infection were age (OR 1.02; p = 0.041), time lived in a rural location (OR 1.04; p = 0.022), and time lived in an infested area (OR 1.04; p = 0.008). No multivariate model with these variables fit the data better than a simple model including only the time lived in an area with triatomine bugs. There was no significant difference in prevalence across the screening strategies; however a self-assessment of disease risk may have biased participation, inflating prevalence among residents of houses where no infestation was detected. Testing houses with infected-vectors was least expensive. Ring case detection yielded four secondary cases in only one community, possibly due to vector-borne transmission in this community, apparently absent in the others. Targeted screening for urban Chagas disease is promising in areas with ongoing vector-borne transmission; however, these pockets of epidemic transmission remain difficult to detect a priori. The flexibility to adapt to the epidemiology that emerges during screening is key to an

  10. A field trial of alternative targeted screening strategies for Chagas disease in Arequipa, Peru.

    Directory of Open Access Journals (Sweden)

    Gabrielle C Hunter

    2012-01-01

    Full Text Available Chagas disease is endemic in the rural areas of southern Peru and a growing urban problem in the regional capital of Arequipa, population ∼860,000. It is unclear how to implement cost-effective screening programs across a large urban and periurban environment.We compared four alternative screening strategies in 18 periurban communities, testing individuals in houses with 1 infected vectors; 2 high vector densities; 3 low vector densities; and 4 no vectors. Vector data were obtained from routine Ministry of Health insecticide application campaigns. We performed ring case detection (radius of 15 m around seropositive individuals, and collected data on costs of implementation for each strategy.Infection was detected in 21 of 923 (2.28% participants. Cases had lived more time on average in rural places than non-cases (7.20 years versus 3.31 years, respectively. Significant risk factors on univariate logistic regression for infection were age (OR 1.02; p = 0.041, time lived in a rural location (OR 1.04; p = 0.022, and time lived in an infested area (OR 1.04; p = 0.008. No multivariate model with these variables fit the data better than a simple model including only the time lived in an area with triatomine bugs. There was no significant difference in prevalence across the screening strategies; however a self-assessment of disease risk may have biased participation, inflating prevalence among residents of houses where no infestation was detected. Testing houses with infected-vectors was least expensive. Ring case detection yielded four secondary cases in only one community, possibly due to vector-borne transmission in this community, apparently absent in the others.Targeted screening for urban Chagas disease is promising in areas with ongoing vector-borne transmission; however, these pockets of epidemic transmission remain difficult to detect a priori. The flexibility to adapt to the epidemiology that emerges during screening is key to

  11. Hydroxamate-based colorimetric method for direct screening of transglutaminase-producing bacteria.

    Science.gov (United States)

    Bourneow, Chaiwut; Benjakul, Soottawat; H-Kittikun, Aran

    2012-05-01

    Microbial transglutaminase (MTGase) is a commercial enzyme that has been applied to many protein containing foods to improve their textural property. The screening of MTGase-producing microorganisms from various sources might lead to the discovery of a new MTGase with different characteristics. This report demonstrates the use of a direct detection method for MTGase-producing bacteria grown on an agar plate by filter paper disc (FPD) assay. The principle of the assay is the formation of a red burgundy color by the hydroxamate-ferric complex. The color developed intensity was linearly correlated by the concentration of hydroxamic acid in the range of 0.1-0.8 μM and was visually scored at 4 levels: 0, 1, 2 and 3. Streptoverticillium mobaraense DSM 40847, a positive MTGase-producer, was chosen for the verification and improving of the proposed method. The colonies grown on the nutrient agar plate at 37°C for 24 h were covered with FPDs and 30 μl of substrates (CBZ-Gln-Gly and hydroxylamine). After incubation, 10 μl of the ferric-TCA-HCl solution was placed on the FPD. The optimal time taken to catalyze the formation of CBZ-Gln-Gly-hydroxamic acid by the MTGase and the time taken for the hydroxamate-ferric complex to form color were 180 and 60 min, respectively. Using this assay, 30 of 189 colonies isolated from wastewater and floating-floc samples showed MTGase-positive colonies which were well correlated to the quantitative screening of MTGase activity (R(2) = 0.9758). The results revealed that the FPD assay could be used for the qualitative screening of MTGase-producing bacteria.

  12. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  13. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  14. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  15. Field tests of nylon-screen diffusion samplers and pushpoint samplers for detection of metals in sediment pore water, Ashland and Clinton, Massachusetts, 2003

    Science.gov (United States)

    Zimmerman, Marc J.; Vroblesky, Don A.; Campo, Kimberly W.; Massey, Andrew J.; Scheible, Walter

    2005-01-01

    Efficient and economical screening methods are needed to detect and to determine the approximate concentrations of potentially toxic trace-element metals in shallow groundwater- discharge areas (pore water) where the metals may pose threats to aquatic organisms; such areas are likely to be near hazardous-waste sites. Pushpoint and nylon-screen diffusion samplers are two complementary options for use in such environments. The pushpoint sampler, a simple well point, is easy to insert manually and to use. Only 1 day is required to collect samples. The nylon-screen diffusion sampler is well suited for use in sediments that do not allow a pump to draw water into a pushpoint sampler. In this study, both types of devices were used in sediments suitable for the use of the pushpoint sampler. Sampling with the nylon-screen diffusion sampler requires at least two site visits: one to deploy the samplers in the sediment, and a second to retrieve the samplers and collect the samples after a predetermined equilibration period. Extensive laboratory quality-control studies, field testing, and laboratory analysis of samples collected at the Nyanza Chemical Waste Dump Superfund site along the Sudbury River in Ashland, Massachusetts, and at a Superfund site-assessment location on Rigby Brook in Clinton, Massachusetts, indicate that these two devices yield comparable results for most metals and should be effective tools for pore-water studies. The nylon-screen diffusion samplers equilibrated within 1-2 days in homogeneous, controlled conditions in the laboratory. Nylon-screen diffusion samplers that were not purged of dissolved oxygen prior to deployment yielded results similar to those that were purged. Further testing of the nylon-screen diffusion samplers in homogeneous media would help to resolve any ambiguities about the data variability from the field studies. Comparison of data from replicate samples taken in both study areas shows that even samples taken from sites within a

  16. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  17. Development of Efficient Screening Method for Resistance of Cabbage to Fusarium oxysporum f. sp. conglutinans

    Directory of Open Access Journals (Sweden)

    Song-Yi Baik

    2011-04-01

    Full Text Available This study was conducted to establish the efficient screening method for resistant cabbage to Fusarium wilt caused by Fusarium oxysporum f. sp. conglutinans. The resistance degrees of nine commercial cabbage cultivars to the disease were evaluated. Among them, five cultivars (YR-honam, Ogane, Greenhot, Redmat, and Ccoccoma showing different resistance to the fungus were selected. Then development of Fusarium wilt of the cultivars according to several conditions including root wounding, dipping period of roots in spore suspension, inoculum concentration, and incubation temperature to develop the disease was investigated. Highly resistant cultivars such as ``YR-honam`` and ``Ogane`` hardly showed change of resistance to the disease by root wounding, dipping period, and inoculum concentration, while disease severity of Fusarium wilt on the cultivars was changed with incubation temperatures (20℃, 25℃ and 30℃. When the cabbage cultivars were incubated at 25℃, they represented the most difference of resistance and susceptibility to Fusarium wilt. From above results, we suggest that an efficient screening method for resistant cabbage to F. oxysporum f. sp. conglutinans is to dip the non-cut roots of 14-day-old seedlings in spore suspension of 1×107 conidia/ml for 0.5 hr and to transplant the seedlings to plastic pots with a fertilized soil, and then to cultivate the plants in a growth chamber at 25℃ for 3 weeks to develop Fusarium wilt.

  18. Dioxins in beef samples from Mexico using a low resolution GC/MS screening method.

    Science.gov (United States)

    Naccha, Lidia; Alanis, Guadalupe; Torres, Anabel; Abad, Esteban; Ábalos, Manuela; Rivera, Josep; Heyer, Lorenzo; Morales, Alberto; Waksman, Noemí

    2010-01-01

    Dioxins in beef were quantified by high resolution gas chromatography coupled to low-resolution mass spectrometry (GC/LRMS). The analyses were performed according to the minimum requirements described in the USEPA 1613 method with some minor modifications. Levels found in the samples were in the range 1.02-8.04 pg WHO-TEQ PCDDs/PCDFs g(-1) fat. For comparison purposes, the maximum level allowed by the European Union is 3 pg WHO-TEQ PCDDs/PCDFs g(-1) fat, and some of these samples surpassed the above-mentioned limit and can be considered as contaminated food. The results confirm that a preliminary screening of dioxins in beef can be performed by GC/LRMS. As far as we know, this is the first report of dioxins in beef in Mexico. After the appropriated tests, the applied methodology could be considered as an alternative screening method for the analysis of PCDD/Fs in other food products.

  19. Agreement between visual inspection with acetic acid and Papanicolaou's smear as screening methods for cervical cancer.

    Science.gov (United States)

    Naz, Uzma; Hanif, Sadia

    2014-04-01

    To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaou's (Pap) smear as screening methods for cervical cancer. A cross-sectional study. Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaou's smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings.

  20. An alternative method for screening lactic acid bacteria for the production of exopolysaccharides with rapid confirmation

    Directory of Open Access Journals (Sweden)

    Elinalva Maciel Paulo

    2012-12-01

    Full Text Available The accumulation of exopolysaccharides (EPS produced by microorganisms occurs in the presence of excess substrate and limiting conditions of elements that are essential to growth, such as nitrogen, phosphorus, sulfur, and magnesium. The presence of EPS produced by bacterial cells contributes to slime colonies formation in solid medium and increased viscosity in liquid medium. This paper proposes an alternative method for screening EPS-producing lactic acid bacteria using solid medium-containing discs of filter paper that are saturated with active cultures. The screening was carried out under different culture conditions varying the type of sugar, pH, and temperature. EPS production was visualized by the presence of mucoid colonies on the discs, which was confirmed by the formation of a precipitate when part of this colony was mixed with absolute alcohol. The established conditions for obtaining a high number of isolates producing EPS were 10% sucrose, pH 7.5 and 28 ºC. This method proved to be effective and economical because several strains could be tested on the same plate, with immediate confirmation.

  1. Acanthamoeba castellanii: A new high-throughput method for drug screening in vitro.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Padrón, José M; Valladares, Basilio; Elsheikha, Hany M

    2016-12-01

    Despite significant public health impact, there is no specific antiprotozoal therapy for prevention and treatment of Acanthamoeba castellanii infection. There is a need for new and efficient anti-Acanthamoeba drugs that are less toxic and can reduce treatment duration and frequency of administration. In this context a new, rapid and sensitive assay is required for high-throughput activity testing and screening of new therapeutic compounds. A colorimetric assay based on sulforhodamine B (SRB) staining has been developed for anti-Acanthamoeba drug susceptibility testing and adapted to a 96-well microtiter plate format. Under these conditions chlorhexidine was tested to validate the assay using two clinical strains of A. castellanii (Neff strain, T4 genotype [IC 50 4.68±0.6μM] and T3 genotype [IC 50 5.69±0.9μM]). These results were in good agreement with those obtained by the conventional Alamar Blue assay, OCR cytotoxicity assay and manual cell counting method. Our new assay offers an inexpensive and reliable method, which complements current assays by enhancing high-throughput anti-Acanthamoeba drug screening capabilities. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  3. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  4. A Multipole Expansion Method for Analyzing Lightning Field Changes

    Science.gov (United States)

    Koshak, William J.; Krider, E. Philip; Murphy, Martin J.

    1998-01-01

    Changes in the surface electric field are frequently used to infer the locations and magnitudes of lightning-caused changes in thundercloud charge distributions. The traditional procedure is to assume that the charges that are effectively deposited by the flash can be modeled either as a single point charge (the Q-model) or a point dipole (the P-model). The Q-model has 4 unknown parameters and provides a good description of many cloud-to-ground (CG) flashes. The P-model has 6 unknown parameters and describes many intracloud (IC) discharges. In this paper, we introduce a new analysis method that assumes that the change in the cloud charge can be described by a truncated multipole expansion, i.e., there are both monopole and dipole terms in the unknown source distribution, and both terms are applied simultaneously. This method can be used to analyze CG flashes that are accompanied by large changes in the cloud dipole moment and complex IC discharges. If there is enough information content in the measurements, the model can also be generalized to include quadrupole and higher order terms. The parameters of the charge moments are determined using a 3-dimensional grid search in combination with a linear inversion, and because of this, local minima in the error function and the associated solution ambiguities are avoided. The multipole method has been tested on computer simulated sources and on natural lightning at the NASA Kennedy Space Center and USAF Eastern Range.

  5. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  6. Methods for Quantitative Interpretation of Retarding Field Analyzer Data

    International Nuclear Information System (INIS)

    Calvey, J.R.; Crittenden, J.A.; Dugan, G.F.; Palmer, M.A.; Furman, M.; Harkay, K.

    2011-01-01

    Over the course of the CesrTA program at Cornell, over 30 Retarding Field Analyzers (RFAs) have been installed in the CESR storage ring, and a great deal of data has been taken with them. These devices measure the local electron cloud density and energy distribution, and can be used to evaluate the efficacy of different cloud mitigation techniques. Obtaining a quantitative understanding of RFA data requires use of cloud simulation programs, as well as a detailed model of the detector itself. In a drift region, the RFA can be modeled by postprocessing the output of a simulation code, and one can obtain best fit values for important simulation parameters with a chi-square minimization method.

  7. Level set methods for modelling field evaporation in atom probe.

    Science.gov (United States)

    Haley, Daniel; Moody, Michael P; Smith, George D W

    2013-12-01

    Atom probe is a nanoscale technique for creating three-dimensional spatially and chemically resolved point datasets, primarily of metallic or semiconductor materials. While atom probe can achieve local high-level resolution, the spatial coherence of the technique is highly dependent upon the evaporative physics in the material and can often result in large geometric distortions in experimental results. The distortions originate from uncertainties in the projection function between the field evaporating specimen and the ion detector. Here we explore the possibility of continuum numerical approximations to the evaporative behavior during an atom probe experiment, and the subsequent propagation of ions to the detector, with particular emphasis placed on the solution of axisymmetric systems, such as isolated particles and multilayer systems. Ultimately, this method may prove critical in rapid modeling of tip shape evolution in atom probe tomography, which itself is a key factor in the rapid generation of spatially accurate reconstructions in atom probe datasets.

  8. Implementing a method of screening one-well hydraulic barrier design alternatives.

    Science.gov (United States)

    Rubin, Hillel; Shoemaker, Christine A; Köngeter, Jürgen

    2009-01-01

    This article provides details of applying the method developed by the authors (Rubin et al. 2008b) for screening one-well hydraulic barrier design alternatives. The present article with its supporting information (manual and electronic spreadsheets with a case history example) provides the reader complete details and examples of solving the set of nonlinear equations developed by Rubin et al. (2008b). It allows proper use of the analytical solutions and also depicting the various charts given by Rubin et al. (2008b). The final outputs of the calculations are the required position and the discharge of the pumping well. If the contaminant source is nonaqueous phase liquid (NAPL) entrapped within the aquifer, then the method provides an estimate of the aquifer remediation progress (which is a by-product) due to operating the hydraulic barrier.

  9. A novel thin-layer chromatography method to screen 1,3-propanediol producers.

    Science.gov (United States)

    Anand, Pinki; Saxena, Rajendra Kumar

    2012-11-01

    To date, there is no established protocol for the screening of 1,3-propanediol producers. The proposed method has a wide applicability to harness the commercial potential of microorganisms which produce 1,3-propanediol as the end product. Glycerol fermentation broth of 50 bacteria spotted on thin-layer chromatography plates and run by appropriate solvent systems followed by colour development using vanillin reagent gave different coloured spots with most of the compounds present in the fermentation broth. The appearance of a purple-coloured spot of 1,3-propanediol with a retention factor (R(f)) of 0.62 forms the basis for the selection of 1,3-propanediol producers. Apart from being a rapid detection system the proposed method is pH independent and its authenticity was reconfirmed by HPLC.

  10. Screening Methods for Identification of the Target Group Autism Spectrum For Special Education Teachers and Psychologists

    Directory of Open Access Journals (Sweden)

    Sorokin A. B.,

    2016-10-01

    Full Text Available We present three screening instruments which can be used by special education teachers and psychologists for assessment of children who may belong to the intervention target group “autism spectrum”. Two of these instruments (Social Communication Questionnaire and Checklist for Autism Spectrum Disorders are parent/caregiver questionnaires and one (Autism Mental Status Exam is a short observation schedule. All three methods were used with 132 children with conditions associated with autism spectrum, other developmental conditions, as well as typically developing children. Correlation coefficient values ranged from 0.7 to 0.82 for the pairwise comparison of the three overall scores. They provide evidence for significant convergent validity of the methods. The article discusses the strong sides of every instrument that professionals may find useful when choosing instruments for their diagnostic toolbox.

  11. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  12. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  13. Observer variability in screen-film mammography versus full-field digital mammography with soft-copy reading

    Energy Technology Data Exchange (ETDEWEB)

    Skaane, Per; Young, Kari [Ullevaal University Hospital, Department of Radiology, Breast Imaging Center, Oslo (Norway); Diekmann, Felix; Diekmann, Susanne [University Charite, Department of Diagnostic Radiology, Berlin (Germany); Balleyguier, Corinne [Institut Gustave Roussy, Villejuif (France); Piguet, Jean-Charles [Institut Imagerive, Geneva (Switzerland); Abdelnoor, Michael [Ullevaal University Hospital, Center for Clinical Research, Section of Epidemiology and Biostatistics, Oslo (Norway); Niklason, Loren [Hologic Inc., Hillsborough, NC (United States)

    2008-06-15

    Full-field digital mammography (FFDM) with soft-copy reading is more complex than screen-film mammography (SFM) with hard-copy reading. The aim of this study was to compare inter- and intraobserver variability in SFM versus FFDM of paired mammograms from a breast cancer screening program. Six radiologists interpreted mammograms of 232 cases obtained with both techniques, including 46 cancers, 88 benign lesions, and 98 normals. Image interpretation included BI-RADS categories. A case consisted of standard two-view mammograms of one breast. Images were scored in two sessions separated by 5 weeks. Observer variability was substantial for SFM as well as for FFDM, but overall there was no significant difference between the observer variability at SFM and FFDM. Mean kappa values were lower, indicating less agreement, for microcalcifications compared with masses. The lower observer agreement for microcalcifications, and especially the low intraobserver concordance between the two imaging techniques for three readers, was noticeable. The level of observer agreement might be an indicator of radiologist performance and could confound studies designed to separate diagnostic differences between the two imaging techniques. The results of our study confirm the need for proper training for radiologists starting FFDM with soft-copy reading in breast cancer screening. (orig.)

  14. Current trends in virtual high throughput screening using ligand-based and structure-based methods.

    Science.gov (United States)

    Sukumar, Nagamani; Das, Sourav

    2011-12-01

    High throughput in silico methods have offered the tantalizing potential to drastically accelerate the drug discovery process. Yet despite significant efforts expended by academia, national labs and industry over the years, many of these methods have not lived up to their initial promise of reducing the time and costs associated with the drug discovery enterprise, a process that can typically take over a decade and cost hundreds of millions of dollars from conception to final approval and marketing of a drug. Nevertheless structure-based modeling has become a mainstay of computational biology and medicinal chemistry, helping to leverage our knowledge of the biological target and the chemistry of protein-ligand interactions. While ligand-based methods utilize the chemistry of molecules that are known to bind to the biological target, structure-based drug design methods rely on knowledge of the three-dimensional structure of the target, as obtained through crystallographic, spectroscopic or bioinformatics techniques. Here we review recent developments in the methodology and applications of structure-based and ligand-based methods and target-based chemogenomics in Virtual High Throughput Screening (VHTS), highlighting some case studies of recent applications, as well as current research in further development of these methods. The limitations of these approaches will also be discussed, to give the reader an indication of what might be expected in years to come.

  15. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  16. Field deployment of loop-mediated isothermal amplification for centralized mass-screening of asymptomatic malaria in Zanzibar: a pre-elimination setting.

    Science.gov (United States)

    Morris, Ulrika; Khamis, Mwinyi; Aydin-Schmidt, Berit; Abass, Ali K; Msellem, Mwinyi I; Nassor, Majda H; González, Iveth J; Mårtensson, Andreas; Ali, Abdullah S; Björkman, Anders; Cook, Jackie

    2015-05-17

    Molecular tools for detection of low-density asymptomatic Plasmodium infections are needed in malaria elimination efforts. This study reports results from the hitherto largest implementation of loop-mediated isothermal amplification (LAMP) for centralized mass screening of asymptomatic malaria in Zanzibar. Healthy individuals present and willing to participate in randomly selected households in 60 villages throughout Zanzibar were screened for malaria by rapid diagnostic tests (RDT). In 50% of the study households, participants were asked to provide 60 μL of finger-prick blood for additional LAMP screening. LAMP was conducted in two centralized laboratories in Zanzibar, by trained technicians with limited or no previous experience of molecular methods. The LAMP assay was performed with Loopamp(TM) MALARIA Pan/Pf Detection Kit (Eiken Chemical Company, Japan). Samples positive for Plasmodium genus (Pan)-LAMP were re-tested using Plasmodium falciparum-specific LAMP kits. Paired RDT and LAMP samples were available from 3983 individuals. The prevalence of asymptomatic malaria was 0.5% (CI 95% 0.1-0.8) and 1.6% (CI 95% 1.1-2.2) by RDT and Pan-LAMP, respectively. LAMP detected 3.4 (CI 95% 2.2-5.2) times more Plasmodium positive samples than RDT. DNA contamination was experienced, but solved by repetitive decontamination of all equipment and reagents. LAMP is a simple and sensitive molecular tool, and has potential in active surveillance and mass-screening programmes for detection of low-density asymptomatic malaria in pre-elimination settings. However, in order to deploy LAMP more effectively in field settings, protocols may need to be adapted for processing larger numbers of samples. A higher throughput, affordable closed system would be ideal to avoid contamination.

  17. Relationship between Fujikawa’s Method and the Background Field Method for the Scale Anomaly

    Directory of Open Access Journals (Sweden)

    Chris L. Lin

    2016-01-01

    Full Text Available We show the equivalence between Fujikawa’s method for calculating the scale anomaly and the diagrammatic approach to calculating the effective potential via the background field method, for an O(N symmetric scalar field theory. Fujikawa’s method leads to a sum of terms, each one superficially in one-to-one correspondence with a vacuum diagram of the 1-loop expansion. From the viewpoint of the classical action, the anomaly results in a breakdown of the Ward identities due to scale-dependence of the couplings, whereas, in terms of the effective action, the anomaly is the result of the breakdown of Noether’s theorem due to explicit symmetry breaking terms of the effective potential.

  18. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  19. Screening for microplastics in sediment, water, marine invertebrates and fish: method development and microplastic accumulation

    NARCIS (Netherlands)

    Karlsson, Therese; Vethaak, A.D.; Carney Almroth, Bethany; Ariese, Freek; van Velzen, M.J.M.; Hassellöv, Martin; Leslie, H.A.

    2017-01-01

    Measurements of microplastics in biota and abiotic matrices are key elements of exposure and risk assessments for this emerging environmental pollutant. We investigated the abundance of microplastics in field-collected biota, sediment and water. An improved sediment extraction method, based on

  20. Low field orientation magnetic separation methods for magnetotactic bacteria

    International Nuclear Information System (INIS)

    Moeschler, F.D.

    1999-01-01

    Microbial biomineralisation of iron often results in a biomass that is magnetic and can be separated from water systems by the application of a magnetic field. Magnetotactic bacteria form magnetic membrane bound crystals within their structure, generally of magnetite. In nature, this enables magnetotactic bacteria to orientate themselves with respect to the local geomagnetic field. The bacteria then migrate with flagellar driven motion towards their preferred environment. This property has been harnessed to produce a process in which metal loaded magnetotactic bacteria can be recovered from a waste stream. This process is known as orientation magnetic separation. Several methods exist which permit the unique magnetic properties of individual magnetotactic bacteria to be studied, such as U-turn analysis, transmission electron microscopy and single wire cell studies. In this work an extension of U-turn analysis was developed. The bacteria were rendered non-motile by the addition of specific metal ions and the resulting 'flip time' which occurs during a field reversal enabled the magnetic moment of individual bacteria to be determined. This method proved to be much faster and more accurate than previous methods. For a successful process to be developed, large scale culturing of magnetotactic bacteria is required Experiments showed that culture vessel geometry was an important factor for high-density growth. Despite intensive studies reproducible culturing at volumes exceeding one litre was not achieved. This work showed that numerous metal ions rendered magnetotactic bacteria non-motile at concentrations below 10 ppm. Sequential adaptation raised typical levels to in excess of 100 ppm for a number of ions. such as zinc and tin. However, specific ions. such as copper or nickel, remained motility inhibiting at lower concentrations. To achieve separation using orientation magnetic separation, motile, field susceptible MTB are required. Despite successful adaptation, the

  1. Selected Tools and Methods from Quality Management Field

    Directory of Open Access Journals (Sweden)

    Kateřina BRODECKÁ

    2009-06-01

    Full Text Available Following paper describes selected tools and methods from Quality management field and their practical applications on defined examples. Solved examples were elaborated in the form of electronic support. This in detail elaborated electronic support provides students opportunity to thoroughly practice specific issues, help them to prepare for exams and consequently will lead to education improvement. Especially students of combined study form will appreciate this support. The paper specifies project objectives, subjects that will be covered by mentioned support, target groups, structure and the way of elaboration of electronic exercise book in view. The emphasis is not only on manual solution of selected examples that may help students to understand the principles and relationships, but also on solving and results interpreting of selected examples using software support. Statistic software Statgraphics Plus v 5.0 is used while working support, because it is free to use for all students of the faculty. Exemplary example from the subject Basic Statistical Methods of Quality Management is also part of this paper.

  2. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  3. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  4. An Improved Method for P2X7R Antagonist Screening.

    Science.gov (United States)

    Soares-Bezerra, Rômulo José; Ferreira, Natiele Carla da Silva; Alberto, Anael Viana Pinto; Bonavita, André Gustavo; Fidalgo-Neto, Antônio Augusto; Calheiros, Andrea Surrage; Frutuoso, Valber da Silva; Alves, Luiz Anastacio

    2015-01-01

    ATP physiologically activates the P2X7 receptor (P2X7R), a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites), this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS) method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG) and oxidized ATP (OATP). The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively) [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  5. An end-point method based on graphene oxide for RNase H analysis and inhibitors screening.

    Science.gov (United States)

    Zhao, Chuan; Fan, Jialong; Peng, Lan; Zhao, Lijian; Tong, Chunyi; Wang, Wei; Liu, Bin

    2017-04-15

    As a highly conserved damage repair protein, RNase H can hydrolysis DNA-RNA heteroduplex endonucleolytically and cleave RNA-DNA junctions as well. In this study, we have developed an accurate and sensitive RNase H assay based on fluorophore-labeled chimeric substrate hydrolysis and the differential affinity of graphene oxide on RNA strand with different length. This end-point measurement method can detect RNase H in a range of 0.01 to 1 units /mL with a detection limit of 5.0×10 -3 units/ mL under optimal conditions. We demonstrate the utility of the assay by screening antibiotics, resulting in the identification of gentamycin, streptomycin and kanamycin as inhibitors with IC 50 of 60±5µM, 70±8µM and 300±20µM, respectively. Furthermore, the assay was reliably used to detect RNase H in complicated biosamples and found that RNase H activity in tumor cells was inhibited by gentamycin and streptomycin sulfate in a concentration-dependent manner. The average level of RNase H in serums of HBV infection group was similar to that of control group. In summary, the assay provides an alternative tool for biochemical analysis for this enzyme and indicates the feasibility of high throughput screening inhibitors of RNase H in vitro and in vivo. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Development of Screening Method for an Frail Elderly by Measurement Quantitative Lower Limb Muscular Strength

    Science.gov (United States)

    Yamashita, Kazuhiko; Iwakami, Yumi; Imaizumi, Kazuya; Sato, Mitsuru; Nakajima, Sawako; Ino, Shuichi; Kawasumi, Masashi; Ifukube, Tohru

    Falling is one of the most serious problems for the elderly. The aim of this study was to develop a screening method for identifying factors that increase the risk of falling among the elderly, particularly with regard to lower limb muscular strength. Subjects were 48 elderly volunteers, including 25 classed as healthy and 23 classed as frail. All subjects underwent measurement of lower limb muscular strength via toe gap force and measurement of muscle strength of the hip joint adductor via knee gap force. In the frail group, toe gap force of the right foot was 20% lower than that in the healthy group; toe gap force of the left foot in the frail group was 23% lower than that in the healthy group, while knee gap force was 20% lower. Furthermore, we found that combining left toe gap force and knee gap force gave the highest odds ratio (6.05) with 82.6% sensitivity and 56.0% specificity when the toe gap force was 24 N and the knee gap force was 100 N. Thus, lower limb muscular strength can be used for simple and efficient screening, and approaches to prevent falls can be based on quantitative data such as lower limb muscular strength.

  7. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Simplified methods for screening cowpea cultivars for manganese leaf-tissue tolerance. [Vigna unguiculata

    Energy Technology Data Exchange (ETDEWEB)

    Wissemeier, A.H.; Horst, W.J. (Univ. of Hannover (West Germany))

    In cowpea (Vigna unguiculata (L.) Walp.) dark brown speckles on old leaves are typical symptoms of Mn toxicity and indicate Mn sensitivity of leaf tissue. Induction and subsequent quantification of brown Mn speckles in leaf tissues were used to screen cowpea cultivars for Mn leaf-tissue tolerance using three different techniques: (i) leaf cuttings cultured for 22 days in solution culture with 20 {mu}M MnSO{sub 4}, (ii) leaf rings mounted on leaves of intact plants and filled with 500 {mu}M MnSO{sub 4} for 5 days, and (iii) leaf disks floated for 3 days on 500 {mu}M MnSO{sub 4}. Density of brown speckles differed considerably among the six cultivars tested, and was not related to the Mn concentrations of the leaf tissues. There were close relationships between genotypic Mn-toxicity symptom expression and depression of dry matter production of the cultivars at high Mn supply in a long-term sand culture experiment. The floating leaf-disk method is particularly suited for screening large numbers of cowpea cultivars for Mn leaf-tissue tolerance because it requires only 3 days. The ranking of the cultivars for Mn tolerance was highly correlated to Mn tolerance of intact plants.

  9. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  10. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  11. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  12. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  13. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  14. A Mixed Methods Review of Education and Patient Navigation Interventions to Increase Breast and Cervical Cancer Screening for Rural Women.

    Science.gov (United States)

    Falk, Derek

    2018-02-07

    Reviews have assessed studies of breast and cervical cancer screening access and utilization for rural women, but none analyze interventions to increase screening rates. A mixed methods literature search identified studies of breast and/or cervical cancer prevention education and patient navigation interventions for rural women. Rural areas need greater implementation and evaluation of screening interventions as these services address the challenges of delivering patient-centered cancer care to un-/underserved communities. The lack of intervention studies on breast and cervical cancer education and patient navigation programs compared to urban studies highlights the need for validation of these programs among diverse, rural populations.

  15. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  16. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust.

    Science.gov (United States)

    Rosati, Jacky A; Bern, Amy M; Willis, Robert D; Blanchard, Fredrick T; Conner, Teri L; Kahn, Henry D; Friedman, David

    2008-02-15

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation.

  17. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  18. Fluorometric method for inorganic pyrophosphatase activity detection and inhibitor screening based on click chemistry.

    Science.gov (United States)

    Xu, Kefeng; Chen, Zhonghui; Zhou, Ling; Zheng, Ou; Wu, Xiaoping; Guo, Longhua; Qiu, Bin; Lin, Zhenyu; Chen, Guonan

    2015-01-06

    A fluorometric method for pyrophosphatase (PPase) activity detection was developed based on click chemistry. Cu(II) can coordinate with pyrophosphate (PPi), the addition of pyrophosphatase (PPase) into the above system can destroy the coordinate compound because PPase catalyzes the hydrolysis of PPi into inorganic phosphate and produces free Cu(II), and free Cu(II) can be reduced by sodium ascorbate (SA) to form Cu(I), which in turn initiates the ligating reaction between nonfluorescent 3-azidocoumarins and terminal alkynes to produce a highly fluorescent triazole complex, based on which, a simple and sensitive turn on fluorometric method for PPase can be developed. The fluorescence intensity of the system has a linear relationship with the logarithm of the PPase concentration in the range of 0.5 and 10 mU with a detection limit down to 0.2 mU (S/N = 3). This method is cost-effective and convenient without any labels or complicated operations. The proposed system was applied to screen the potential PPase inhibitor with high efficiency. The proposed method can be applied to diagnosis of PPase-related diseases.

  19. DNA-electrophoresis of single cells - a method to screen for irradiated foodstuffs

    International Nuclear Information System (INIS)

    Leffke, A.; Helle, N.; Boegl, K.W.; Schreiber, G.A.

    1993-01-01

    Microelectrophoresis of single cells can be used to detect γ-irradiation over a wide dose range and for a variety of products. It is a simple and rapid test for DNA damages and can be used for screening. The method was tested on cell suspensions of bone marrow and muscle cells from frozen chicken legs, chicken heart, turkey liver, beef and pork irradiated with doses up to 3 kGy. Cell suspensions were prepared by incubation of tissues in EDTA-SDS-buffer at pH 8. Single cell electrophoresis was performed in 0.75% agarose gel. DNA was visualised by silver staining. In unirradiated samples no or only a small amount of DNA penetrated the cell membranes. Cells of irradiated samples appeared like a ''comet'' due to to migration of DNA-fragments out of cell. (orig.)

  20. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  1. A new screening method for flunitrazepam in vodka and tequila by fluorescence spectroscopy.

    Science.gov (United States)

    Leesakul, Nararak; Pongampai, Sirintip; Kanatharana, Proespichaya; Sudkeaw, Pravit; Tantirungrotechai, Yuthana; Buranachai, Chittanon

    2013-01-01

    A new screening method for flunitrazepam in colourless alcoholic beverages based on a spectroscopic technique is proposed. Absorption and steady-state fluorescence of flunitrazepam and its protonated form with various acids were investigated. The redshift of the wavelength of maximum absorption was distinctively observed in protonated flunitrazepam. An emissive fluorescence at 472 nm was detected in colourless spirits (vodka and tequila) at room temperature. 2-M perchloric acid was the most appropriated proton source. By using electron ionization mass spectrometry and time-dependent density functional theory calculations, the possible structure of protonated flunitrazepam was identified to be 2-nitro-N-methylacridone, an acridone derivative as opposed to 2-methylamino-5-nitro-2'-fluorobenzophenone, a benzophenone derivative. Copyright © 2012 John Wiley & Sons, Ltd.

  2. A Simple Surface-Enhanced Raman Spectroscopic Method for on-Site Screening of Tetracycline Residue in Whole Milk

    Directory of Open Access Journals (Sweden)

    Sagar Dhakal

    2018-02-01

    Full Text Available Therapeutic and subtherapeutic use of veterinary drugs has increased the risk of residue contamination in animal food products. Antibiotics such as tetracycline are used for mastitis treatment of lactating cows. Milk expressed from treated cows before the withdrawal period has elapsed may contain tetracycline residue. This study developed a simple surface-enhanced Raman spectroscopic (SERS method for on-site screening of tetracycline residue in milk and water. Six batches of silver colloid nanoparticles were prepared for surface enhancement measurement. Milk-tetracycline and water-tetracycline solutions were prepared at seven concentration levels (1000, 500, 100, 10, 1, 0.1, and 0.01 ppm and spiked with silver colloid nanoparticles. A 785 nm Raman spectroscopic system was used for spectral measurement. Tetracycline vibrational modes were observed at 1285, 1317 and 1632 cm−1 in water-tetracycline solutions and 1322 and 1621 cm−1 (shifted from 1317 and 1632 cm−1, respectively in milk-tetracycline solutions. Tetracycline residue concentration as low as 0.01 ppm was detected in both the solutions. The peak intensities at 1285 and 1322 cm−1 were used to estimate the tetracycline concentrations in water and milk with correlation coefficients of 0.92 for water and 0.88 for milk. Results indicate that this SERS method is a potential tool that can be used on-site at field production for qualitative and quantitative detection of tetracycline residues.

  3. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  4. Screening and selection of most potent diazotrophic cyanobacterial isolate exhibiting natural tolerance to rice field herbicides for exploitation as biofertilizer.

    Science.gov (United States)

    Singh, Surendra; Datta, Pallavi

    2006-01-01

    Periodic applications of heavy dosages of herbicides in modern rice-agriculture are a necessary evil for obtaining high crop productivity. Such herbicides are not only detrimental to weeds but biofertilizer strains of diazotrophic cyanobacteria also. It is therefore, essential to screen and select such biofertilizer strains of diazotrophic cyanobacteria exhibiting natural tolerance to common rice-field herbicides that can be further improved by mutational techniques to make biofertilizer technology a viable one. Therefore, efforts have been made to screen five dominant diazotrophic cyanobacterial forms e.g. filamentous heterocystous Nostoc punctiforme , Nostoc calcicola , Anabaena variabilis and unicellular Gloeocapsa sp. and Aphanocapsa sp. along with standard laboratory strain Nostoc muscorum ISU against increasing concentrations (0-100 mg l(-1) of four commercial grade common rice-field herbicides i.e. Arozin, Butachlor, Alachlor and 2,4-D under diazotrophic growth conditions. The lethal and IGC(50) concentrations for all four herbicides tested were found highest for A. variabilis as compared to other test cyanobacteria. The lowest reduction in chlorophyll a content, photosynthetic oxygen evolution, and N(2)-fixation was found in A. variabilis as compared to other rice field isolates and standard laboratory strain N. muscorum ISU. On the basis of prolong survival potential and lowest reductions in vital metabolic activities tested at IGC(50) concentration of four herbicides, it is concluded that A. variabilis is the most potent and promising cyanobacterial isolate as compared with other forms. This could be further improved by mutational techniques for exploitation as most potential and viable biofertilizer strain.

  5. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  6. Semi-empirical equivalent field method for dose determination in midline block fields for cobalt - 60 beam

    International Nuclear Information System (INIS)

    Tagoe, S.N.A.; Nani, E.K.; Yarney, J.; Edusa, C.; Quayson-Sackey, K.; Nyamadi, K.M.; Sasu, E.

    2012-01-01

    For teletherapy treatment time calculations, midline block fields are resolved into two fields, but neglecting scattering from other fields, the effective equivalent square field size of the midline block is assumed to the resultant field. Such approach is underestimation, and may be detrimental in achieving the recommended uncertainty of ± 5 % for patient's radiation dose delivery. By comparison, the deviations of effective equivalent square field sizes by calculations and experiments were within 13.2 % for cobalt 60 beams of GWGP80 cobalt 60 teletherapy. Therefore, a modified method incorporating the scatter contributions was adopted to estimate the effective equivalent square field size for midline block field. The measured outputs of radiation beams with the block were compared with outputs of square fields without the blocks (only the block tray) at depths of 5 and 10 cm for the teletherapy machine employing isocentric technique, and the accuracy was within ± 3 % for the cobalt 60 beams. (au)

  7. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  8. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  9. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  10. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  11. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  12. Heteroduplex analysis: a useful screening method for glycogen storage disease type Ia.

    Science.gov (United States)

    Narita, T; Tsuruta, Y; Chiba, K

    1998-04-01

    Glycogen storage disease type Ia (GSDIa), also known as von Gierke disease, is the most common and severe disease of glycogenoses and is caused by a deficiency of glucose-6-phosphatase (G6Pase) and transmitted by an autosomal recessive trait. The encoding gene of G6Pase is composed of only five exons and each exon is short. With heteroduplex analysis (HDA) method, we analyzed the genomic DNA from a patient diagnosed with GSDIa and from her parents. Exons II and IV of the patient showed heteroduplex bands. The mother had a heteroduplex band of exon II, and the father had a heteroduplex band of exon IV. In a mini-slab electrophoresis, exons II and IV of the patient did not show clear heteroduplex bands, but they appeared broader than the others, which made us suspect that they were heteroduplex bands. HDA is an easy and simple method and can verify mutant homozygous DNA fragments by adding wild-type DNA. We think that HDA may be a very useful screening method for the detection of novel genomic mutation in GSDIa in large-scale and mini-slab electrophoresis.

  13. Acanthocephalan fish parasites (Rhadinorhynchidae Lühe, 1912) as potential biomarkers: Molecular-chemical screening by pyrolysis-field ionization mass spectrometry

    Science.gov (United States)

    Kleinertz, S.; Eckhardt, K.-U.; Theisen, S.; Palm, H. W.; Leinweber, P.

    2016-07-01

    The present study represents the first molecular-chemical screening by pyrolysis-field ionization mass spectrometry applied on fish parasites. A total of 71 fishes from Balinese fish markets, 36 Auxis rochei (Risso, 1810) and 35 A. thazard (Lacepède, 1800), were studied for their acanthocephalan parasites. This is the first record of Rhadinorhynchus zhukovi in Balinese waters, Indonesia, and we describe for the first time A. rochei and A. thazard as R. zhukovi hosts. Using this method, small scale variations within the chemical compounds of acanthocephalans could be detected. Using this methodology it will be possible to generate additional, pollutant specific information from aquatic habitats in future with the potential of a new bioindicator application for parasite/host origin and/or environmental pollution.

  14. Estimating the diffuseness of sound fields: A wavenumber analysis method

    DEFF Research Database (Denmark)

    Nolan, Melanie; Davy, John L.; Brunskog, Jonas

    2017-01-01

    The concept of a diffuse sound field is widely used in the analysis of sound in enclosures. The diffuse sound field is generally described as composed of plane waves with random phases, which wave number vectors are uniformly distributed over all angles of incidence. In this study, an interpretat......The concept of a diffuse sound field is widely used in the analysis of sound in enclosures. The diffuse sound field is generally described as composed of plane waves with random phases, which wave number vectors are uniformly distributed over all angles of incidence. In this study...

  15. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  16. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  17. The Stroop Smartphone App is A Short and Valid Method to Screen for Minimal Hepatic Encephalopathy

    Science.gov (United States)

    Bajaj, Jasmohan S; Thacker, Leroy R; Heuman, Douglas M; Fuchs, Michael; Sterling, Richard K; Sanyal, Arun J; Puri, Puneet; Siddiqui, Mohammad S; Stravitz, Richard T; Bouneva, Iliana; Luketic, Velimir; Noble, Nicole; White, Melanie B; Monteith, Pamela; Unser, Ariel; Wade, James B

    2013-01-01

    Minimal hepatic encephalopathy(MHE) detection is difficult due to the unavailability of short screening tools. Therefore MHE patients can remain undiagnosed and untreated. Aim To use a Stroop smartphone application(EncephalApp_Stroop) to screen for MHE. Methods The App and standard psychometric tests(SPT; 2/4 abnormal is MHE, gold standard), psychometric hepatic encephalopathy score(PHES) and Inhibitory control(ICT) tests were administered to cirrhotics [with/without prior-overt HE(OHE)] and age-matched controls from two centers; a subset underwent re-testing. A separate validation cohort was also recruited. Stroop has “off”state with neutral stimuli and “on”state with incongruent stimuli. Outcomes: time to complete five correct runs, number of trials needed in On(Ontime) and Off(Offtime) states. Stroop results were compared between controls and cirrhotics with/without OHE, and those with/without MHE(using SPT,ICT,PHES). ROC analysis was performed to diagnose MHE in cirrhotics with/without prior OHE. Results 125 cirrhotics (43 prior OHE) and 134 controls were included in the original cohort. App times were correlated with MELD (Offtime:r=0.57,Ontime:r=0.61,pStroop performance was also significantly impaired in those with MHE compared to no-MHE according to SPT,ICT and PHES (all p274.9 seconds(OnTime+OffTime) had an AUC=0.89 in all patients and 0.84 in patients without prior OHE for MHE diagnosis using SPT as the gold standard. The validation cohort showed 78% sensitivity and 90% specificity with the >274.9 seconds OnTime+OffTime cut-off. App result patterns were similar between the centers. Test-retest reliability in controls and those without prior OHE was good; a learning effect on Ontime in cirrhotics without prior OHE was seen. In conclusion, the Stroop smartphone app is a short, valid and reliable tool for screening of MHE. PMID:23389962

  18. Mass screening for celiac disease from the perspective of newly diagnosed adolescents and their parents: A mixed-method study

    Directory of Open Access Journals (Sweden)

    Rosén Anna

    2011-10-01

    Full Text Available Abstract Background Mass screening for celiac disease (CD as a public health intervention is controversial. Prior to implementation, acceptability to the targeted population should be addressed. We aimed at exploring adolescents' and parents' experiences of having the adolescents' CD detected through mass screening, and their attitudes towards possible future mass screening. Methods All adolescents (n = 145 with screening-detected CD found in a Swedish school-based screening study, and their parents, were invited to this study about one year after diagnosis. In all, 14 focus group discussions were conducted with 31 adolescents and 43 parents. Written narrative was completed by 91 adolescents (63% and 105 parents (72%, and questionnaires returned by 114 parents (79%. Data were analyzed using qualitative content analysis. In addition, narratives and questionnaire data allowed for quantified measures. Results Adolescents and parents described how they agreed to participate "for the good of others," without considering consequences for themselves. However, since the screening also introduced a potential risk of having the disease, the invitation was regarded as "an offer hard to resist." For the majority, receiving the diagnosis was described as "a bolt of lightning," but for some it provided an explanation for previous health problems, and "suddenly everything made sense." Looking back at the screening, the predominant attitude was "feeling grateful for being made aware," but some adolescents and parents also expressed "ambivalent feelings about personal benefits." Among parents, 92% supported future CD screening. The most common opinion among both adolescents and parents was that future CD mass screening should be "a right for everyone" and should be offered as early as possible. However, some argued that it should be "only for sufferers" with symptoms, whereas others were "questioning the benefits" of CD mass screening. Conclusions Although the

  19. Identification of imprinted genes using a novel screening method based on asynchronous DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Kawame, H.; Hansen, R.S.; Gartler, S.M. [Univ. of Washington, Seattle, WA (United States)

    1994-09-01

    Genomic imprinting refers to the process of epigenetic change that occurs during germ cell development that results in either maternal- or paternal-specific gene expression. Identification of imprinted genes is of primary importance to the understanding of imprinting mechanisms and the role of specific imprinted genes in human disease. Recently, it has been established that chromosomal regions known to contain imprinted genes replicate asynchronously. We propose a novel screening method to identify imprinted genes based on replication asynchrony as a marker for imprinted domains. Dividing human cells were pulse-labeled with BrdU and separated into different fractions of S-phase by flow cytometry. A library of late-replicating inter-Alu sequences should be enriched in gene-associated sequences that replicate early on one chromosome and late on the other homologue. Clones were analyzed for replication timing by hybridization to inter-Alu replication profiles. Candidates for replication asynchrony exhibited broad or biphasic replication timing, and these were analyzed for chromosomal location by hybridizations to inter-Alu products from a hybrid mapping panel. Initial screening of 123 clones resulted in 3 asynchronously-replicating clones that localized to single chromosomes. Chromosome 17 and chromosome 19 candidates might be located in regions thought to be imprinted by synteny with mouse chromosomes. A chromosome 15 clone was further characterized because of its possible localization to the Prader-Willi/Angelman locus. This sequence was localized outside the region deleted in Prader-Willi patients, and was found to be expressed in human cell lines. Replication asynchrony for this sequence appears to be polymorphic because cells derived from some individuals indicated synchronous replication. This appears to be the first example of a polymorphism in replication asynchrony.

  20. Screening and comparison of remedial alternatives for the South Field and flyash piles at the Fernald site

    International Nuclear Information System (INIS)

    Bumb, A.C.; Jones, G.N.

    1996-05-01

    The South Field, the Inactive Flyash Pile, and the Active Flyash Pile are in close proximity to each other and are part of Operable Unit 2 (OU2) at the Fernald Environmental Management Project (FEMP). The baseline risk assessment indicated that the exposure pathways which pose the most significant risk are external radiation from radionuclides in surface soils and use of uranium contaminated groundwater. This paper presents screening and comparison of various remedial alternatives considered to mitigate risks from the groundwater pathway. Eight remedial alternatives were developed which consisted of consolidation and capping, excavation and off-site disposal with or without treatment, excavation and on-site disposal with or without treatment and combinations of these. Risk-based source (soil) preliminary remediation levels (PRLs) and waste acceptance criteria (WACs) were developed for consolidation and capping, excavation, and on-site disposal cell. The PRLs and WACs were developed using an integrated modeling tool consisting of an infiltration model, a surface water model, a vadose zone model, and a three-dimensional contaminant migration model in saturated media. The PRLs and WACs were then used to determine need for soil treatment, determine excavation volumes, and screen remedial alternatives. The selected remedial alternative consisted of excavation and on-site disposal with off-site disposal of the fraction exceeding the WAC

  1. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  2. Utilization of breast cancer screening methods in a developing nation: results from a nationally representative sample of Malaysian households.

    Science.gov (United States)

    Dunn, Richard A; Tan, Andrew K G

    2011-01-01

    As is the case in many developing nations, previous studies of breast cancer screening behavior in Malaysia have used relatively small samples that are not nationally representative, thereby limiting the generalizability of results. Therefore, this study uses nationally representative data from the Malaysia Non-Communicable Disease Surveillance-1 to investigate the role of socio-economic status on breast cancer screening behavior in Malaysia, particularly differences in screening behaviour between ethnic groups. The decisions of 816 women above age 40 in Malaysia to screen for breast cancer using mammography, clinical breast exams (CBE), and breast self-exams (BSE) are modeled using logistic regression. Results indicate that after adjusting for differences in age, education, household income, marital status, and residential location, Malay women are less likely than Chinese and Indian women to utilize mammography, but more likely to perform BSE. Education level and urban residence are positively associated with utilization of each method, but these relationships vary across ethnicity. Higher education levels are strongly related to using each screening method among Chinese women, but have no statistically significant relationship to screening among Malays. © 2011 Wiley Periodicals, Inc.

  3. Coal Field Fire Fighting - Practiced methods, strategies and tactics

    Science.gov (United States)

    Wündrich, T.; Korten, A. A.; Barth, U. H.

    2009-04-01

    achieved. For an effective and efficient fire fighting optimal tactics are requiered and can be divided into four fundamental tactics to control fire hazards: - Defense (digging away the coal, so that the coal can not begin to burn; or forming a barrier, so that the fire can not reach the not burning coal), - Rescue the coal (coal mining of a not burning seam), - Attack (active and direct cooling of burning seam), - Retreat (only monitoring till self-extinction of a burning seam). The last one is used when a fire exceeds the organizational and/or technical scope of a mission. In other words, "to control a coal fire" does not automatically and in all situations mean "to extinguish a coal fire". Best-practice tactics or a combination of them can be selected for control of a particular coal fire. For the extinguishing works different extinguishing agents are available. They can be applied by different application techniques and varying distinctive operating expenses. One application method may be the drilling of boreholes from the surface or covering the surface with low permeability soils. The mainly used extinction agents for coal field fire are as followed: Water (with or without additives), Slurry, Foaming mud/slurry, Inert gases, Dry chemicals and materials and Cryogenic agents. Because of its tremendous dimension and its complexity the worldwide challenge of coal fires is absolutely unique - it can only be solved with functional application methods, best fitting strategies and tactics, organisation and research as well as the dedication of the involved fire fighters, who work under extreme individual risks on the burning coal fields.

  4. Follow-up and Final Results of the Oslo I Study Comparing Screen-Film Mammography and Full-field Digital Mammography with Soft-Copy Reading

    Energy Technology Data Exchange (ETDEWEB)

    Skaane, P.; Skjennald, A.; Young, K. [Ullevaal Univ. Hospital, Oslo (Norway). Dept. of Radiology] [and others

    2005-11-01

    Purpose: To compare cancer detection rates of screen-film (SFM) and full-field digital mammography (FFDM) with soft-copy reading in a screening program including the initial positive scores for interval cancers and cancers in the subsequent screening round, and to analyze the false-negative FFDM interpretations. Material and Methods: Using a paired study design, 3683 women underwent SFM and FFDM in a population-based screening program. Two standard views of each breast were acquired. The images were interpreted without previous films for comparison. Independent double reading using a 5-point rating scale for probability of cancer was used for each modality. An examination was defined as positive if at least one of the two independent readers scored 2 or higher on the 5-point rating scale. SFM-positive cases were discussed in a SFM consensus meeting and FFDM-positive cases in a separate FFDM consensus meeting before recall. The study population was followed for more than 2 years so that interval cancers and screen-detected cancers in the subsequent screening round could be included. Cancer detection rates were compared using the McNemar test for paired proportions. The kappa statistic and Wilcoxon signed-rank test for matched pairs were used for comparing rating scores. The reading time was recorded for all FFDM interpretations. Results: A total of 31 cancers (detection rate 0.84%) were diagnosed initially, of which SFM detected 28 and FFDM 23 (McNemar test P 0.23, discordant pair 8 and 3). Two cancers with a positive score at initial SFM reading and three with a positive score at initial FFDM reading were dismissed at SFM and FFDM consensus meetings, respectively. The difference in cancer detection after recall (discordant pair 11 and 5) was not significant (McNemar test, P = 0.21). Of the 10 interval cancers and 16 screen-detected cancers in the subsequent round, 3 had true-positive SFM scores while 4 had true-positive FFDM scores in the initial reading session. A

  5. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  6. NMR-based screening method for transglutaminases: rapid analysis of their substrate specificities and reaction rates.

    Science.gov (United States)

    Shimba, Nobuhisa; Yokoyama, Kei-ichi; Suzuki, Ei-ichiro

    2002-03-13

    Incorporation of inter- or intramolecular covalent cross-links into food proteins with microbial transglutaminase (MTG) improves the physical and textural properties of many food proteins such as tofu, boiled fish paste, and sausage. Other transglutaminases (TGases) are expected to be used in the same way, and also to extend the scope of industrial applications to materials, drugs, and so on. The TGases have great diversity, not only in amino acid sequence and size, but also in their substrate specificities and catalytic activities, and therefore, it is quite difficult to estimate their reactivity. We have developed an NMR-based method using the enzymatic labeling technique (ELT) for simultaneous analysis of the substrate specificities and reaction rates of TGases. It is quite useful for comparing the existing TGases and for screening new TGases or TGases variants. This method has shown that MTG is superior for industrial use because of its lower substrate specificity compared with those of guinea pig liver transglutaminase (GTG) and red sea bream liver transglutaminase (FTG). We have also found that an MTG variant lacking an N-terminal aspartic acid residue has higher activity than that of the native enzyme.

  7. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  8. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  9. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  10. A hybrid method combining the TD-MoM with the TD-UTD to calculate the transient radiation of thin dipoles in presence of a perfectly conducting screen

    Science.gov (United States)

    Becker, A.; Hansen, V.

    2005-05-01

    A time domain Method of Moments algorithm (TD-MoM) is combined with the time domain version of the Uniform Theory of Diffraction (TD-UTD). By use of the TD-MoM the fields radiated from thin wire structures positioned in free space are determined. The TD-UTD is applied to calculate the fields scattered by a perfectly conducting screen. Both techniques are hybridized by adding possible reflected and diffracted fields in the TD-MoM algorithm and by using the TD-MoM solution to calculate the fields which impinge on to the screen. To show the accuracy of the developed hybrid method, numerical results are compared to results obtained by established frequency domain numerical codes.

  11. Sequence-based spa typing as a rapid screening method for the areal and nosocomial outbreaks of MRSA.

    Science.gov (United States)

    Narukawa, Munetoshi; Yasuoka, Akira; Note, Ryougo; Funada, Hisashi

    2009-07-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the leading cause of nosocomial infection and MRSA outbreaks have become a major problem. Therefore, the rapid and accurate typing of MRSA isolates is important for epidemiological surveys and nosocomial infection control. Pulsed-field gel electrophoresis (PFGE) is considered as the gold standard technique for MRSA typing, because of its high discriminatory power, but its procedure is rather complicated and time-consuming. The spa gene encodes a cell wall component of Staphylococcus aureus protein A, and exhibits polymorphism. Sequencing the spa gene is expected superior to PFGE in speed and data interpretation. In the present study, we evaluated whether spa typing of MRSA is useful for nosocomial outbreak analysis and epidemiological investigations. We analyzed 19 nosocomial outbreak isolates from 4 separate hospitals and 26 isolates from outpatients of Toyama University Hospital. Either PFGE or spa typing revealed a single nosocomial strain that appears unique to each hospital. Indeed, spa typing confirmed the four different strains, but PFGE demonstrated only 3 strains. With the total 45 isolates, PFGE showed 16 different patterns and spa typing showed 12 patterns. Moreover, we were able to analyze the spa gene in about 2 days, from sampling to obtaining the results, whereas it took about 7 days with PFGE. In conclusion, sequence-based spa typing shows comparable sensitivities to PFGE, and is a rapid and easy handling method. The sequence-based spa typing can be used as the rapid screening test when MRSA outbreak is suspected in areas and hospitals.

  12. Combined use of Clauss and prothrombin time-derived methods for determining fibrinogen concentrations: Screening for congenital dysfibrinogenemia.

    Science.gov (United States)

    Xiang, Liqun; Luo, Meiling; Yan, Jie; Liao, Lin; Zhou, Weijie; Deng, Xuelian; Deng, Donghong; Cheng, Peng; Lin, Faquan

    2017-09-18

    In this study, the significance of fibrinogen concentration assessed by a combination of Clauss and prothrombin time (PT)-derived methods for screening for congenital dysfibrinogenemia were investigated, and the screening efficiency of fibrinogen PT-derived/Clauss ratio on congenital dysfibrinogenemia was analyzed. We compared fibrinogen concentrations determined by the Clauss, PT-derived, and enzyme-linked immunosorbent assay (ELISA) methods in 73 patients with congenital dysfibrinogenemia and 81 normal controls. Receiver operating characteristic (ROC) curves were utilized to evaluate the efficacy of fibrinogen PT-derived/Clauss ratio in screening for congenital dysfibrinogenemia. Fibrinogen concentrations determined by the Clauss method were dramatically lower than by the PT-derived method and ELISA, and correlated poorly with the latter two methods in patients with congenital dysfibrinogenemia. Fibrinogen concentrations in normal controls were slightly lower according to the Clauss method than to the PT-derived method and ELISA; however, each method yielded results within the normal range and the correlation was good. The area under the ROC curve of fibrinogen PT-derived/Clauss ratio for diagnosis of congenital dysfibrinogenemia was 1 with a standard error of 0, 95% confidence interval of 0.976-1.00, and optimal critical diagnosis point of 1.43. When fibrinogen PT-derived/Clauss ratio was >1.43, the sensitivity and specificity for diagnosis of congenital dysfibrinogenemia were both 100%. The combined use of Clauss and PT-derived methods for determining fibrinogen concentrations improves the efficiency of screening for congenital dysfibrinogenemia, as the fibrinogen PT-derived/Clauss ratio has high sensitivity and specificity in diagnosis of congenital dysfibrinogenemia. This ratio could serve an important screening tool for this disease. © 2017 Wiley Periodicals, Inc.

  13. ALTERNATIVE FIELD METHODS TO TREAT MERCURY IN SOIL

    Energy Technology Data Exchange (ETDEWEB)

    Ernest F. Stine Jr; Steven T. Downey

    2002-08-14

    U.S. Department of Energy (DOE) used large quantities of mercury in the uranium separating process from the 1950s until the late 1980s in support of national defense. Some of this mercury, as well as other hazardous metals and radionuclides, found its way into, and under, several buildings, soil and subsurface soils and into some of the surface waters. Several of these areas may pose potential health or environmental risks and must be dealt with under current environmental regulations. DOE's National Energy Technology Laboratory (NETL) awarded a contract ''Alternative Field Methods to Treat Mercury in Soil'' to IT Group, Knoxville TN (IT) and its subcontractor NFS, Erwin, TN to identify remedial methods to clean up mercury-contaminated high-clay content soils using proven treatment chemistries. The sites of interest were the Y-12 National Security Complex located in Oak Ridge, Tennessee, the David Witherspoon properties located in Knoxville, Tennessee, and at other similarly contaminated sites. The primary laboratory-scale contract objectives were (1) to safely retrieve and test samples of contaminated soil in an approved laboratory and (2) to determine an acceptable treatment method to ensure that the mercury does not leach from the soil above regulatory levels. The leaching requirements were to meet the TC (0.2 mg/l) and UTS (0.025 mg/l) TCLP criteria. In-situ treatments were preferred to control potential mercury vapors emissions and liquid mercury spills associated with ex-situ treatments. All laboratory work was conducted in IT's and NFS laboratories. Mercury contaminated nonradioactive soil from under the Alpha 2 building in the Y-12 complex was used. This soils contained insufficient levels of leachable mercury and resulted in TCLP mercury concentrations that were similar to the applicable LDR limits. The soil was spiked at multiple levels with metallic (up to 6000 mg/l) and soluble mercury compounds (up to 500 mg/kg) to

  14. A screening method for detection of hexavalent chromium levels in soils

    Directory of Open Access Journals (Sweden)

    Débora V Franco

    2011-01-01

    Full Text Available A rapid and low cost method to determine Cr(VI in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

  15. High-throughput siRNA screening as a method of perturbation of biological systems and identification of targeted pathways coupled with compound screening.

    Science.gov (United States)

    Kiefer, Jeff; Yin, Hongwei H; Que, Qiang Q; Mousses, Spyro

    2009-01-01

    High-throughput RNA interference (HT-RNAi) is a powerful research tool for parallel, 'genome-wide', targeted knockdown of specific gene products. Such perturbation of gene product expression allows for the systematic query of gene function. The phenotypic results can be monitored by assaying for specific alterations in molecular and cellular endpoints, such as promoter activation, cell proliferation and survival. RNAi profiling may also be coupled with drug screening to identify molecular correlates of drug response. As with other genomic-scale data, methods of data analysis are required to handle the unique aspects of data normalization and statistical processing. In addition, novel techniques or knowledge-mining strategies are required to extract useful biological information from HT-RNAi data. Knowledge-mining strategies involve the novel application of bioinformatic tools and expert curation to provide biological context to genomic-scale data such as that generated from HT-RNAi data. Pathway-based tools, whether text-mining based or manually curated, serve an essential role in knowledge mining. These tools can be applied during all steps of HT-RNAi screen experiments including pre-screen knowledge gathering, assay development and hit confirmation and validation. Most importantly, pathway tools allow the interrogation of HT-RNAi data to identify and prioritize pathway-based biological information as a result of specific loss of gene function.

  16. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  17. Numerical methods for electromagnetic fields analysis; Methodes numerique d'analyse des champs electromagnetiques

    Energy Technology Data Exchange (ETDEWEB)

    Madrangeas, V. [Faculte des Sciences de Limoges, 87 (France); Nicolas, L. [Ecole Centrale de Lyon, 69 (France)

    2001-07-01

    This book is a reedition of a special issue (2001, vol. 4) of the journal 'Revue Internationale de Genie Electrique'. It brings together 11 selected papers among the hundred presented at the Numelec 2000 conference devoted to the analysis, modeling and optimization of electromagnetic fields. Content: a new hysteresis model for oriented grains sheets, inverse problem modeling of ferromagnetic sheets, adaptative approximation of objective functions using diffuse elements method, application of generic algorithms for the localizing of a magnetic dipole, optimization of an active shielding, mixed symbolic and numerical model for the dimensioning of converters, resolution of differential equations for the study of power electronic circuits, large problems resolution using boundary integrals method, gradient-type optimization methodology for the dimensioning of electrical devices, currents and reconnection torque amplitudes of a self-primed asynchronous machine, bi-static scattering of electromagnetic waves from sea surface and snowy-covered surfaces. (J.S.)

  18. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  19. Field calculations. Part I: Choice of variables and methods

    International Nuclear Information System (INIS)

    Turner, L.R.

    1981-01-01

    Magnetostatic calculations can involve (in order of increasing complexity) conductors only, material with constant or infinite permeability, or material with variable permeability. We consider here only the most general case, calculations involving ferritic material with variable permeability. Variables suitable for magnetostatic calculations are the magnetic field, the magnetic vector potential, and the magnetic scalar potential. For two-dimensional calculations the potentials, which each have only one component, have advantages over the field, which has two components. Because it is a single-valued variable, the vector potential is perhaps the best variable for two-dimensional calculations. In three dimensions, both the field and the vector potential have three components; the scalar potential, with only one component,provides a much smaller system of equations to be solved. However the scalar potential is not single-valued. To circumvent this problem, a calculation with two scalar potentials can be performed. The scalar potential whose source is the conductors can be calculated directly by the Biot-Savart law, and the scalar potential whose source is the magnetized material is single valued. However in some situations, the fields from the two potentials nearly cancel; and the numerical accuracy is lost. The 3-D magnetostatic program TOSCA employs a single total scalar potential; the program GFUN uses the magnetic field as its variable

  20. Field screening of guar (cyamopsis tetragonoloba (l.) taub.) accessions for enhanced forage production on hot drylands

    International Nuclear Information System (INIS)

    Ali, Z.; Ashraf, M.

    2015-01-01

    To explore the high biomass producing accessions of guar (Cyamopsis tetragonoloba (L.) Taub.), under hot and dry conditions, an experiment was conducted under natural field conditions located at Research Station, University College of Agriculture, Sargodha, Pakistan using 36 different accessions. Twenty-day old plants grown under normal irrigation were subjected to control and drought (withholding of irrigation for 20 and 40 days) conditions. It was observed that plant fresh and dry biomass, plant height, net CO/sub 2/ assimilation rate (Pn), transpiration rate (E) and inter CO/sub 2/ conc. (Ci) of all guar accessions under study decreased considerably on withholding of irrigation for both 20 and 40 days. Of all guar accessions, Acc. BR99, 5597, BWP 5595, BWP 5596, BWP 5609, BWP 5611, 24323, Chiniot Black, Khushab Black were relatively higher in plant height and plant biomass (fresh and dry) under water stress conditions. However, a significant increase particularly in BR99, BWP 5595, BWP 5599, BWP 5609, 41671 followed by Sialkot White was observed in the relative membrane permeability of all guar accessions under water limited conditions. All accessions varied significantly in terms of Pn, E and Ci. Accessions BR90, BR99, BWP 5596, 24323, 24332, Chiniot Black, Khushab Black, 41671, 24323, BWP 5611, Khushab White, Mardan, Khanewal Local 2 and Sialkot White were better in Pn, Ci and E. No significant change was observed in the water-use efficiency of guar accessions under water-limited conditions. Overall, BR99, 5597, BWP 5595, BWP 5596, BWP 5609, BWP 5611, 24323, Chiniot Black and Khushab Black were higher, whereas accessions BWP 5595, 24321, Khushab White, Silanwali White, Sialkot Black and Khanewal Local lower in plant biomass and different gas exchange characteristics under water limited conditions, so the earlier mentioned accessions can be recommended as high biomass producing guar accessions for their cultivation on hot drought-prone areas. (author)

  1. A Novel Screening Method to Identify Late-Stage Dementia Patients for Palliative Care Research and Practice.

    Science.gov (United States)

    Ernecoff, Natalie C; Wessell, Kathryn L; Gabriel, Stacey; Carey, Timothy S; Hanson, Laura C

    2017-12-27

    Investigators need novel methods for timely identification of patients with serious illness to test or implement new palliative care models. The study's aim was to develop an electronic health record (EHR) phenotype to identify patients with late-stage dementia for a clinical trial of palliative care consultation. We developed a computerized method to identify patients with dementia on hospital admission. Within a data warehouse derived from the hospital's EHR, we used search terms of age, admission date, and ICD-9 and ICD-10 diagnosis codes to create an EHR dementia phenotype, followed by brief medical record review to confirm late-stage dementia. We calculated positive predictive value, false discovery rate, and false negative rate of this novel screening method. The EHR phenotype screening method had a positive predictive value of 76.3% for dementia patients and 24.5% for late-stage dementia patients; a false discovery rate of 23.7% for dementia patients and 75.5% for late-stage dementia patients compared to physician assessment. The sensitivity of this screening method was 59.7% to identify hospitalized patients with dementia. Daily screening-including confirmatory chart reviews-averaged 20 minutes and was more feasible, efficient, and more complete than manual screening. A novel method using an EHR phenotype plus brief medical record review is effective to identify hospitalized patients with late-stage dementia. In health care systems with similar clinical data warehouses, this method may be applied to serious illness populations to improve enrollment in clinical trials of palliative care or to facilitate access to palliative care services. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  2. IN SEARCH OF A FAST SCREENING METHOD FOR DETECTING THE MALINGERING OF COGNITIVE IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Amada Ampudia

    2012-07-01

    Full Text Available Forensic settings demand expedient and conclusive forensic psychological assessment. The aim of this study was to design a simple and fast, but reliable psychometric instrument for detecting the malingering of cognitive impairment. In a quasi-experimental design, 156 individuals were divided into three groups: a normal group with no cognitive impairment; a Mild Cognitive Impairment (MCI group; and a group of informed malingerers with no MCI who feigned cognitive impairment. Receiver Operating Curve (ROC analysis of the Test of Memory Malingering (TOMM, and of several subtests of the Wechsler Memory Scale (WMS-III revealed that the WMS-III was as reliable and accurate as the TOMM in discriminating malingerers from the honest. The results revealed that the diagnostic accuracy, sensitivity and specificity of the WMS-III Auditory Recognition Delayed of Verbal Paired Associates subtest was similar to the TOMM in discriminating malingering from genuine memory impairment. In conclusion, the WMS-III Recognition of Verbal Paired Associates subtest and the TOMM provide a fast, valid and reliable screening method for detecting the malingering of cognitive impairment.

  3. Retinal vascular fractals in Behçet's Disease: A screening method?

    Science.gov (United States)

    Norouzpour, Amir; Mehdizadeh, Alireza

    2015-01-01

    The branching pattern of retinal vessels may be affected in Behçet's Disease (BD). Fractal analysis can be used as a new method to quantify the changes of the vascular branching pattern. In this study, we examined, for the first time, the relationship between retinal fractal dimension (D f) and retinal vascular changes seen in patients with BD. We conducted a retrospective study of 10 new cases of BD with clinically ocular involvement. Color fundus images taken from both eyes of the participants have been analyzed, and D f of the whole retinal vasculature was quantified using a novel computer-based program. The resultant D f was compared with that of healthy individuals. The mean D f, calculated from 20 fundus images of cases with BD, was 1.59 ± 0.064. It was lower than that of healthy participants (1.65 ± 0.060) significantly (P = 0.013). Retinal fractal analysis of cases with BD has been performed for the first time, and the results showed that early retinal vascular changes seen in new cases of BD are associated with lower retinal D f. Retinal fractal analysis in BD can be practically utilized as a potential tool for screening of retinal involvement, evaluating the prognosis and the response to treatment.

  4. Genealogical tree study as screening method in the Lynch syndrome prior to genetic test.

    Science.gov (United States)

    Delgado-Plasencia, Luciano; Medina-Arana, Vicente; Barrios Del Pino, Ysamar; Fernández-Peralta, Antonia; González-Aguilera, Juan J

    2010-08-01

    Despite genetic advances in the study of Lynch syndrome (LS), difficulties remain in the diagnosis of the syndrome. The aim of this study was to assess the usefulness of a detailed genealogical tree as a screening method to identify Tenerife island families with a high probability of LS. We elaborated complete genealogical trees of the families. According to the degree of fulfillment of the Amsterdam Criteria II, the genealogical trees were classified as high or low probability of LS. Additionally, we analyzed the level of tumor microsatellite instability (MSI+) and identified a mutation in exon 13 of the MSH2 gene by single-strand conformation polymorphism, sequencing, and PCR-RFLP. According the genealogical trees, we found 10 families with high probability of LS and 30 families with low probability of LS. The families with high probability of LS showed high MSI+ in all cases. Conversely, families with low probability were MSS (microsatellite stable). In 5 of the 10 families with high probability, we discovered a T-->G mutation in position 688 of exon 13 of MSH2, which appeared in all the family members with the tumor, except 1 patient with a retinoblastoma. Our results indicate that genealogical tree is a highly effective tool for classifying families with a high probability of Lynch Syndrome prior to genetic test.

  5. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  6. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Science.gov (United States)

    Sahin, Levent; Bozkurt, Murat; Sahin, Hilal; Gürel, Aykut; Yumru, Ayse Ender

    2014-10-01

    To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD) aneuploidy screening (AS) is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss. Copyright © 2014. Published by Elsevier Taiwan.

  7. A novel method for screening of potential probiotics for high adhesion capability.

    Science.gov (United States)

    Wang, Xin; Wu, Qinglong; Deng, Kan; Wei, Qiang; Hu, Ping; He, Jingjing; Liu, Huan; Zheng, Yong; Wei, Hua; Shah, Nagendra P; Chen, Tingtao

    2015-07-01

    To screen for potential probiotics with high adhesion capability, a chemostat model-based cultured human feces and denaturing gradient gel electrophoresis methods were applied, and the adhesion capability of the isolates was evaluated in vitro and in vivo. Lactobacillus plantarum (HM218749), Lactobacillus reuteri (EU547310), and Enterococcus faecalis (HM218543) were isolated from the slime on the chemostat wall, as these organisms could grow better at 37°C in an anaerobic environment and could resist harsh conditions (pH 1.5 and 0.30% bile salt). Lactobacillus plantarum, L. reuteri, and E. faecalis could adhere to HT-29 cells and reduce the adhesion of Shigella dysenteriae 2457, Staphylococcus aureus Cowan1, Enterobacter sakazakii 45401, and Escherichia coli 44102 to HT-29 cells. Moreover, the animal experiment showed that L. plantarum could adhere to mice intestine, increasing the number of lactobacilli and decreasing the number of enterococci. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Directory of Open Access Journals (Sweden)

    Levent Sahin

    2014-10-01

    Full Text Available To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD aneuploidy screening (AS is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss.

  9. DO TIE LABORATORY BASED ASSESSMENT METHODS REALLY PREDICT FIELD EFFECTS?

    Science.gov (United States)

    Sediment Toxicity Identification and Evaluation (TIE) methods have been developed for both porewaters and whole sediments. These relatively simple laboratory methods are designed to identify specific toxicants or classes of toxicants in sediments; however, the question of whethe...

  10. DO TIE LABORATORY BASED METHODS REALLY REFLECT FIELD CONDITIONS

    Science.gov (United States)

    Sediment Toxicity Identification and Evaluation (TIE) methods have been developed for both interstitial waters and whole sediments. These relatively simple laboratory methods are designed to identify specific toxicants or classes of toxicants in sediments; however, the question ...

  11. Methods of gas hydrate concentration estimation with field examples

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, D.; Dash, R.; Dewangan, P.

    accuracy, sensitivity and cost issue. Seismic methods are the most common but the estimated gas hydrate concentration can be less accurate than coring method. Although coring method has certain difficulty such as the core sampling, preserving samples... general. The gas saturation is ignored for simplification, but in the case of free gas and gas hydrate coexisting both can be simultaneously estimated. The steps for hydrate saturation estimation in method 1 are: 1) first create a table of modeled seismic...

  12. Analysis of pulsed wire method for field integral measurements in ...

    Indian Academy of Sciences (India)

    [2] P V Bousine, S V Tolmachev and A A Varfolomeev, Nucl. Instrum. Methods in Phys. A393, 414 (1997). [3] T C Fan et al, Rev. Sci. Instrum. 73, 1430 (2002). [4] O Shahal and R Rohtagi, Nucl. Instrum. Methods in Phys. A285, 299 (1989). [5] O Shahal, B V Elkonin and J S Sokolowski, Nucl. Instrum. Methods in Phys. A296,.

  13. Alternative global goodness metrics and sensitivity analysis: heuristics to check the robustness of conclusions from studies comparing virtual screening methods.

    Science.gov (United States)

    Sheridan, Robert P

    2008-02-01

    We introduce two ways of testing the robustness of conclusions from studies comparing virtual screening methods: alternative "global goodness" metrics and sensitivity analysis. While the robustness tests cannot eliminate all biases in virtual screening comparisons, they are useful as a "reality check" for any given study. To illustrate this, we apply them to a set of enrichments published in McGaughey et al. (J. Chem. Inf. Model. 2007, 47, 1504-1519) where 11 target protein/ligand combinations are tested on 2D and 3D similarity methods, plus docking. The major conclusions in that paper, for instance, that ligand-based methods are better than docking methods, hold up. However, some minor conclusions, such as Glide being the best docking method, do not.

  14. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  15. A streamlined risk screening method for managing reutilization of abandoned factories in Taiwan

    Directory of Open Access Journals (Sweden)

    I-Chun Chen

    2017-05-01

    Full Text Available An integrated management strategy that considers the competing relationships between land values and associated risks in the process of land-use conversion is needed to assess and manage the reutilization of brownfields. However, the often large number of individual brownfields renders it difficult to conduct a completed risk assessment for all sites, and a streamlined risk screening method would facilitate prioritization of the redevelopment of those factories. This methodology takes into account the spatial heterogeneity of contaminated lands and produces risk mapping that compiles complex risk-related information. Using abandoned factories in Taiwan as a case study, the method considers 40 points (50% accumulated probability as the threshold of acceptable risk. Emergency risk should be over 90% of accumulated probability. For the sustainability of brownfield reutilization in Taiwan, this research uses a risk matrix to identify the low, middle, and high risk for brownfield reutilization. It can indicate zones with a high risk level or low economic incentive as areas of concern for future decision making. In Taiwan, high-risk sites with high incentive account for only 21.3% of the sites. In contrast, the sites with the lowest incentive and low risk account for 57.6% of the sites. To avoid failure in the brownfield market, three strategies are suggested: (1 flexible land management with urban planning is a feasible option for protecting the receptor's health; (2 the government could provide the tool or brownfield funds to reduce the uncertainty of investment risk; and (3 risk monitoring and management can reduce the possible pitfalls associated with brownfield reutilization.

  16. Electrostatic Dust Cloth: A Passive Screening Method to Assess Occupational Exposure to Organic Dust in Bakeries

    Directory of Open Access Journals (Sweden)

    Carla Viegas

    2018-02-01

    Full Text Available Organic dust is widespread in the environment including occupational settings, such as bakeries. Recently, a new collection device—the electrostatic dust cloth (EDC—has been described for the assessment of occupational exposures. The aim of this study was to investigate the suitability of EDC for identifying the distribution patterns and exposure concentrations of particulate matter and microbial contaminants such as fungi and bacteria in bakeries. Twelve bakeries were selected, and dust was allowed to settle for 13 to 16 days on EDCs (a total of 33 samples. Particle counts and size distribution (0.3 µm, 0.5 µm, 1 µm, 2.5 µm, 5 µm and 10 µm were measured with direct-reading equipment. Higher EDC mass was significantly correlated (p values < 0.05 with higher fungal load on dichloran glycerol (DG18 and with particle size distribution in the 0.3 µm, 0.5 µm, 1.0 µm and 10.0 µm range. Fungal levels on malt extract agar (MEA ranged from 0 to 2886 CFU/m2 EDC in the warehouse setting, 0 to 500 CFU/m2 EDC in the production setting, and 0 to 3135 CFU/m2 EDC in the store. Penicillium sp. (42.56% was the most frequent fungi. Total bacterial load ranged from 0 to 18,859 CFU/m2 EDC in the warehouse, 0 to 71,656 CFU/m2 EDC in production, and 0 to 21,746 CFU/m2 EDC in the store. EDC assessment provided a longer-term integrated sample of organic dust, useful for identifying critical worksites in which particulate matter and bio-burden exposures are elevated. These findings suggest that EDC can be applied as a screening method for particulate matter-exposure assessment and as a complementary method to quantify exposures in occupational environments.

  17. Effective and efficient method of calculating Bessel beam fields

    CSIR Research Space (South Africa)

    Litvin, IA

    2005-01-01

    Full Text Available beams for SRS applications. However, to model the self reconstruction property of Bessel beams, it is necessary to calculate the field at all points in space before and after the obstacle – a computationally intensive task give the large spatial...

  18. A field cancellation signal extraction method for magnetic particle imaging

    NARCIS (Netherlands)

    Schulz, V.; Straub, M.; Mahlke, M.; Hubertus, S.; Lammers, Twan Gerardus Gertudis Maria; Kiessling, F.

    2015-01-01

    Nowadays, magnetic particle imaging (MPI) signal detection and excitation happens at the same time. This concept, however, leads to a strong coupling of the drive (excitation) field (DF) with the receive chain. As the induced DF signal is several orders of magnitude higher, special measures have to

  19. Thermocouple based method of temperature and velocity field mapping

    Czech Academy of Sciences Publication Activity Database

    Gregor, J.; Jakubová, I.; Mendl, T.; Šenk, J.; Kopecký, Vladimír

    2002-01-01

    Roč. 52, supplement D (2002), s. 596-600 ISSN 0011-4626. [Symposium on Plasma Physics and Technology/20th./. Prague, 10.06.2002-13.06.2002] Institutional research plan: CEZ:AV0Z2043910 Keywords : determination of temperature, velocity field Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 0.311, year: 2002

  20. Analytic methods for field induced tunneling in quantum wells with ...

    Indian Academy of Sciences (India)

    Quantum wells (QW) formed in the semiconductor heterostructures have been given con- siderable theoretical attention because of their optical device applications [1]. For under- standing the operating principles of devices, it is necessary to study the optical absorption spectra in the QW under an applied dc electric field ...

  1. Enhancing Field Research Methods with Mobile Survey Technology

    Science.gov (United States)

    Glass, Michael R.

    2015-01-01

    This paper assesses the experience of undergraduate students using mobile devices and a commercial application, iSurvey, to conduct a neighborhood survey. Mobile devices offer benefits for enhancing student learning and engagement. This field exercise created the opportunity for classroom discussions on the practicalities of urban research, the…

  2. Grassmann methods in lattice field theory and statistical mechanics

    International Nuclear Information System (INIS)

    Bilgici, E.; Gattringer, C.; Huber, P.

    2006-01-01

    Full text: In two dimensions models of loops can be represented as simple Grassmann integrals. In our work we explore the generalization of these techniques to lattice field theories and statistical mechanic systems in three and four dimensions. We discuss possible strategies and applications for representations of loop and surface models as Grassmann integrals. (author)

  3. Tsunakawa-Shaw method - an absolute paleointensity technique using alternating field demagnetization

    Science.gov (United States)

    Yamamoto, Y.; Mochizuki, N.; Shibuya, H.; Tsunakawa, H.

    2015-12-01

    Among geologic materials volcanic rocks have been typically used to deduce an absolute paleointensity. In the last decade, however, there seems a becoming consensus that volcanic rocks are not so ideal materials due to such as magnetic grains other than non-interacting single domain particles. One approach to obtain a good paleointensity estimate from the rocks is to reduce and correct the non-ideality, suppress alterations in laboratory and screen out suspicious results. We have been working on a development and an application of the Tsunakawa-Shaw method, which has been previously called the LTD-DHT Shaw method. This method is an AF(alternating field)-based technique and thus a paleointensity is estimated using coercivity spectra. To reduce the non-ideality, all remanences undergo low-temperature demagnetization (LTD) before any AF demagnetizations to remove multi-domain like component. To correct the non-ideality, anhysteretic remanent magnetizations (ARMs) are imparted with their directions parallel to natural remanent magnetizations and laboratory-imparted thermoremanent magnetizations (TRMs) and measured before and after laboratory heating. These ARMs are used to correct remanence anisotropies, possible interaction effects originated from the non-ideal grains and TRM changes caused by laboratory alterations. TRMs are imparted by heating specimens above their Curie temperatures and then cooling to room temperature at once to simulate nature conditions. These cycles are done in vacuum to suppress alterations in laboratory. Obtained results are judged by selection criteria, including a check for validity of the ARM corrections.It has been demonstrated that successful paleointensities are obtained from historical lavas in Japan and Hawaii, and from baked clay samples from a reconstructed ancient kiln, with the flow-mean precision of 5-10%. In case of old volcanic rocks, however, the method does not necessarily seem to be perfect. We will summarize these points in

  4. LC-ESI/MS/MS method for rapid screening and confirmation of 44 exogenous anabolic steroids in human urine.

    Science.gov (United States)

    Jeon, Byoung Wook; Yoo, Hye Hyun; Jeong, Eun Sook; Kim, Ho Jun; Jin, Changbae; Kim, Dong Hyun; Lee, Jaeick

    2011-09-01

    A sensitive and rapid method based on liquid chromatography-triple-quadrupole tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI) has been developed and validated for the screening and confirmation of 44 exogenous anabolic steroids (29 parent steroids and 15 metabolites) in human urine. The method involves an enzymatic hydrolysis, liquid-liquid extraction, and detection by LC-MS/MS. A triple-quadrupole mass spectrometer was operated in positive ESI mode with selected reaction monitoring (SRM) mode for the screening and product ion scan mode for the confirmation. The protonated molecular ions were used as precursor ions for the SRM analysis and product ion scan. The intraday and interday precisions of the target analytes at concentrations of the minimum required performance levels for the screening were 2-14% and 2-15%, respectively. The limits of detection for the screening and confirmation method were 0.1-10 ng/mL and 0.2-10 ng/mL, respectively, for 44 steroids. This method was successfully applied to analysis of urine samples from suspected anabolic steroid abusers.

  5. Screening for hearing and visual loss among elderly with questionnaires and tests : which method is the most convincing for action?

    NARCIS (Netherlands)

    Eekhof, JAH; De Bock, GH; Schaapveld, K; Springer, MP

    2000-01-01

    Objective - To examine the extent to which self-report and performance-based measures identify the same people, and also whether one of these methods any more than the other induces the general practitioner (GP) to offer a patient help? Design - Comparison of tests and questionnaire in a screening

  6. [Performance of different methods of estimating risk screening for chromosomal anomalies].

    Science.gov (United States)

    Avătăjitei, Maria-Cristina; Moscalu, Mihaela; Martiniuc, Violeta; Onofriescu, M

    2012-01-01

    In the last 10 years, several studies have been carried out on additional ultrasound markers in the first trimester of pregnancy in order to improve detection rate of fetal numerical chromosome abnormalities (aneuploidy) and to reduce the rate of false-positive diagnosis. The purpose of this study was to evaluate the performance of various recommendations for which amniocentesis was performed followed by FISH testing in the diagnosis of aneuploidy. These evaluations were conducted in order to determine whether ultrasound aspects are associated with fetal aneuploidy and to estimate the risk level of individual markers using probability estimation analysis. The study has been carried out at the Clinical Hospital of Obstetrics and Gynecology "CuzaVodă" Iaşi, at the Laboratory of cytogenetic--prenatal diagnosis, during January 2004-December 2011, on a target group of 1406 pregnant women. As part of this study, 1411 amniocentesis were performed. increased efficiency of screening for fetal aneuploidy in the first trimester of pregnancy is obtained through combined method (maternal age over 35 years, increased nuchal translucency and the presence of double test risk) which has 100% detection rate and a rate false-positive result of 0%. The efficiency of this method is provided also by the relatively high risk (RR = 17.2) and its specificity (Sp = 100%). Making the assessment following the study false positive rate, it appears that a good method of risk assessment for aneuploidy is the combined evaluation of increased nuchal translucency (NT) with maternal age over 35 years (specificity 99.5%, a detection rate of 40% false positive rate of 0.45% and a relative risk of 7.09 for the presence of aneuploidy). The achievement of a correct prenatal diagnosis and the increase of the method efficiency, requires a correct selection of cases with aneuploidy risk assessment, based on the results of ultrasound and biochemical (double test risk) investigations correlated with

  7. Identification of priority health conditions for field-based screening in urban slums in Bangalore, India.

    Science.gov (United States)

    Abdi, Sarah; Wadugodapitiya, Avanti; Bedaf, Sandra; George, Carolin Elizabeth; Norman, Gift; Hawley, Mark; de Witte, Luc

    2018-03-02

    Urban slums are characterised by unique challenging living conditions, which increase their inhabitants' vulnerability to specific health conditions. The identification and prioritization of the key health issues occurring in these settings is essential for the development of programmes that aim to enhance the health of local slum communities effectively. As such, the present study sought to identify and prioritise the key health issues occurring in urban slums, with a focus on the perceptions of health professionals and community workers, in the rapidly growing city of Bangalore, India. The study followed a two-phased mixed methods design. During Phase I of the study, a total of 60 health conditions belonging to four major categories: - 1) non-communicable diseases; 2) infectious diseases; 3) maternal and women's reproductive health; and 4) child health - were identified through a systematic literature review and semi-structured interviews conducted with health professionals and other relevant stakeholders with experience working with urban slum communities in Bangalore. In Phase II, the health issues were prioritised based on four criteria through a consensus workshop conducted in Bangalore. The top health issues prioritized during the workshop were: diabetes and hypertension (non-communicable diseases category), dengue fever (infectious diseases category), malnutrition and anaemia (child health, and maternal and women's reproductive health categories). Diarrhoea was also selected as a top priority in children. These health issues were in line with national and international reports that listed them as top causes of mortality and major contributors to the burden of diseases in India. The results of this study will be used to inform the development of technologies and the design of interventions to improve the health outcomes of local communities. Identification of priority health issues in the slums of other regions of India, and in other low and lower middle

  8. Non-invasive method of field imaging in parallel plate waveguides

    DEFF Research Database (Denmark)

    Iwaszczuk, Krzysztof; Andryieuski, Andrei; Lavrinenko, Andrei

    2011-01-01

    We present a new non-invasive air-photonic-based method of terahertz (THz) field imaging inside a parallel plate waveguide. The method is based on THz field-enhanced second harmonic generation of the fundamental laser beam in an external electric field. We also demonstrate the direct measurements...

  9. A PiggyBac-based recessive screening method to identify pluripotency regulators.

    Directory of Open Access Journals (Sweden)

    Ge Guo

    2011-04-01

    Full Text Available Phenotype driven genetic screens allow unbiased exploration of the genome to discover new biological regulators. Bloom syndrome gene (Blm deficient embryonic stem (ES cells provide an opportunity for recessive screening due to frequent loss of heterozygosity. We describe a strategy for isolating regulators of mammalian pluripotency based on conversion to homozygosity of PiggyBac gene trap insertions combined with stringent selection for differentiation resistance. From a screen of 2000 mutants we obtained a disruptive integration in the Tcf3 gene. Homozygous Tcf3 mutants showed impaired differentiation and enhanced self-renewal. This phenotype was reverted in a dosage sensitive manner by excision of one or both copies of the gene trap. These results provide new evidence confirming that Tcf3 is a potent negative regulator of pluripotency and validate a forward screening methodology to identify modulators of pluripotent stem cell biology.

  10. A newborn screening method for cerebrotendinous xanthomatosis using bile alcohol glucuronides and metabolite ratios

    NARCIS (Netherlands)

    Vaz, Frédéric M.; Bootsma, Albert H.; Kulik, Willem; Verrips, Aad; Wevers, Ron A.; Schielen, Peter C.; DeBarber, Andrea E.; Huidekoper, Hidde H.

    2017-01-01

    Cerebrotendinous xanthomatosis (CTX) is a treatable neurodegenerative metabolic disorder of bile acid synthesis in which symptoms can be prevented if treatment with chenodeoxycholic acid supplementation is initiated early in life, making CTX an excellent candidate for newborn screening. We developed

  11. Integrated field equations methods for the computation of electromagnetic fields in strongly inhomogeneous media

    NARCIS (Netherlands)

    Jorna, P.

    2005-01-01

    Electromagnetic field theory plays a very important role in present-day technology; examples of technologies based on electromagnetism that are inextricably bound up with every day life are: radar, remote sensing, geoelectromagnetics, bioelectromagnetics, antennas, wireless communication, optics,

  12. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman M.

    2016-11-23

    Drug discovery is a process that takes many years and hundreds of millions of dollars to reveal a confident conclusion about a specific treatment. Part of this sophisticated process is based on preliminary investigations to suggest a set of chemical compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training prediction models. Yet, the difficulties imposed by big expansion in data and its dimensionality are inevitable. In this thesis, I address the main challenges that come when data mining techniques are used for virtual screening. In order to achieve an efficient virtual screening using data mining, I start by addressing the problem of feature selection and provide analysis of best ways to describe a chemical compound for an enhanced screening performance. High-throughput screening (HTS) assays data used for virtual screening are characterized by a great class imbalance. To handle this problem of class imbalance, I suggest using a novel algorithm called DRAMOTE to narrow down promising candidate chemicals aimed at interaction with specific molecular targets before they are experimentally evaluated. Existing works are mostly proposed for small-scale virtual screening based on making use of few thousands of interactions. Thus, I propose enabling large-scale (or big) virtual screening through learning millions of interaction while exploiting any relevant dependency for a better accuracy. A novel solution called DRABAL that incorporates structure learning of a Bayesian Network as a step to model dependency between the HTS assays, is showed to achieve significant improvements over existing state-of-the-art approaches.

  13. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  14. Reconstructing Holocene geomagnetic field variation: new methods, models and implications

    Science.gov (United States)

    Nilsson, Andreas; Holme, Richard; Korte, Monika; Suttie, Neil; Hill, Mimi

    2014-07-01

    Reconstructions of the Holocene geomagnetic field and how it varies on millennial timescales are important for understanding processes in the core but may also be used to study long-term solar-terrestrial relationships and as relative dating tools for geological and archaeological archives. Here, we present a new family of spherical harmonic geomagnetic field models spanning the past 9000 yr based on magnetic field directions and intensity stored in archaeological artefacts, igneous rocks and sediment records. A new modelling strategy introduces alternative data treatments with a focus on extracting more information from sedimentary data. To reduce the influence of a few individual records all sedimentary data are resampled in 50-yr bins, which also means that more weight is given to archaeomagnetic data during the inversion. The sedimentary declination data are treated as relative values and adjusted iteratively based on prior information. Finally, an alternative way of treating the sediment data chronologies has enabled us to both assess the likely range of age uncertainties, often up to and possibly exceeding 500 yr and adjust the timescale of each record based on comparisons with predictions from a preliminary model. As a result of the data adjustments, power has been shifted from quadrupole and octupole to higher degrees compared with previous Holocene geomagnetic field models. We find evidence for dominantly westward drift of northern high latitude high intensity flux patches at the core mantle boundary for the last 4000 yr. The new models also show intermittent occurrence of reversed flux at the edge of or inside the inner core tangent cylinder, possibly originating from the equator.

  15. On multiplying methods in the field of research evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Derrick, G.; Molas-Gallart, J.; De Rijcke, S.; Meijer, I.; Van der Weijden, I.; Wouters, P.

    2016-07-01

    This special session forms part of a larger program aimed at the multiplication and integration of methodological approaches in the research evaluation and innovation policy field. The session builds on previous initiatives by Gemma Derrick and colleagues at CWTS, INGENIO, the Rathenau Instituut and SPRU, exploring the advantages of qualitative methodological tools at the STI/ENID conference in Lugano, and an international workshop in London in October 2015. The program is highly topical: the research evaluation field is currently reconsidering its methodological foundations in light of new research questions arising from policy initiatives regarding a) the move toward open science; b) a reconceptualization of research excellence to include societal relevance; c) diversification of academic careers, and d) the search for indicators showcasing responsible research behavior and innovation. This new special session at STI2016 will advance and broaden the scope of previous initiatives by building bridges between cutting edge research involving quantitative, qualitative, and mixed methodological research designs. Bringing together leading experts and promising researchers with distinctive methodological skill-sets, the session will demonstrate the advantages of cross-fertilization between ‘core’ and ‘peripheral’ methodological approaches for the research evaluation and science indicators field. (Author)

  16. PROGRESS ON GENERIC PHASE-FIELD METHOD DEVELOPMENT

    Energy Technology Data Exchange (ETDEWEB)

    Biner, Bullent; Tonks, Michael; Millett, Paul C.; Li, Yulan; Hu, Shenyang Y.; Gao, Fei; Sun, Xin; Martinez, E.; Anderson, D.

    2012-09-26

    In this report, we summarize our current collobarative efforts, involving three national laboratories: Idaho National Laboratory (INL), Pacific Northwest National Laboratory (PNNL) and Los Alamos National Laboatory (LANL), to develop a computational framework for homogenous and heterogenous nucleation mechanisms into the generic phase-field model. During the studies, the Fe-Cr system was chosen as a model system due to its simplicity and availability of reliable thermodynamic and kinetic data, as well as the range of applications of low-chromium ferritic steels in nuclear reactors. For homogenous nucleation, the relavant parameters determined from atomistic studies were used directly to determine the energy functional and parameters in the phase-field model. Interfacial energy, critical nucleus size, nucleation rate, and coarsening kinetics were systematically examined in two- and three- dimensional models. For the heteregoneous nucleation mechanism, we studied the nucleation and growth behavior of chromium precipitates due to the presence of dislocations. The results demonstrate that both nucleation schemes can be introduced to a phase-field modeling algorithm with the desired accuracy and computational efficiency.

  17. Practical methods for generating alternating magnetic fields for biomedical research

    Science.gov (United States)

    Christiansen, Michael G.; Howe, Christina M.; Bono, David C.; Perreault, David J.; Anikeeva, Polina

    2017-08-01

    Alternating magnetic fields (AMFs) cause magnetic nanoparticles (MNPs) to dissipate heat while leaving surrounding tissue unharmed, a mechanism that serves as the basis for a variety of emerging biomedical technologies. Unfortunately, the challenges and costs of developing experimental setups commonly used to produce AMFs with suitable field amplitudes and frequencies present a barrier to researchers. This paper first presents a simple, cost-effective, and robust alternative for small AMF working volumes that uses soft ferromagnetic cores to focus the flux into a gap. As the experimental length scale increases to accommodate animal models (working volumes of 100s of cm3 or greater), poor thermal conductivity and volumetrically scaled core losses render that strategy ineffective. Comparatively feasible strategies for these larger volumes instead use low loss resonant tank circuits to generate circulating currents of 1 kA or greater in order to produce the comparable field amplitudes. These principles can be extended to the problem of identifying practical routes for scaling AMF setups to humans, an infrequently acknowledged challenge that influences the extent to which many applications of MNPs may ever become clinically relevant.

  18. Analytic methods for field induced tunneling in quantum wells with ...

    Indian Academy of Sciences (India)

    Electric field induced tunneling is studied in three different types of quantum wells by solving time-independent effective mass equation in analytic methods based on three different Airy function approaches. Comparison of different Airy function methods indicates that they are identical and connected to each other by the ...

  19. A method of simultaneous no-screen X-ray film taking with direct twofold magnification of hands and feet

    International Nuclear Information System (INIS)

    Zajgner, J.; Szymanska-Prach, H.

    1978-01-01

    The authors propose an original method of X-ray examination of hands and feet which makes possible simultaneous radiography without screen and direct twofold magnified film taking. The method is not connected with the necessity of exposing the patient to an additional dose of X-rays. It has been tried in 20 patients with suspected rheumatoid arthritis. It requires an X-ray tube with 0.3 x 0.3 mm microfocus. (author)

  20. Impact of the transition from screen-film to digital screening mammography on interval cancer characteristics and treatment : A population based study from the Netherlands

    NARCIS (Netherlands)

    Nederend, J.; Duijm, L.E.; Louwman, M.W.J.; Coebergh, J.W.; Roumen, R.M.H.; Lohle, P.N.; Roukema, J.A.; Rutten, M.J.; van Steenbergen, L.N.; Ernst, M.F.; Jansen, F.H.; Plaisier, M.L.; Hooijen, M.J.H.H.; Voogd, A.C.

    2014-01-01

    Introduction In most breast screening programmes screen-film mammography (SFM) has been replaced by full-field digital mammography (FFDM). We compared interval cancer characteristics at SFM and FFDM screening mammography. Patients and methods We included all 297 screen-detected and 104 interval

  1. Performance evaluation of structure based and ligand based virtual screening methods on ten selected anti-cancer targets.

    Science.gov (United States)

    Ramasamy, Thilagavathi; Selvam, Chelliah

    2015-10-15

    Virtual screening has become an important tool in drug discovery process. Structure based and ligand based approaches are generally used in virtual screening process. To date, several benchmark sets for evaluating the performance of the virtual screening tool are available. In this study, our aim is to compare the performance of both structure based and ligand based virtual screening methods. Ten anti-cancer targets and their corresponding benchmark sets from 'Demanding Evaluation Kits for Objective In silico Screening' (DEKOIS) library were selected. X-ray crystal structures of protein-ligand complexes were selected based on their resolution. Openeye tools such as FRED, vROCS were used and the results were carefully analyzed. At EF1%, vROCS produced better results but at EF5% and EF10%, both FRED and ROCS produced almost similar results. It was noticed that the enrichment factor values were decreased while going from EF1% to EF5% and EF10% in many cases. Published by Elsevier Ltd.

  2. Electrostatic field in inhomogeneous dielectric media. I. Indirect boundary element method

    International Nuclear Information System (INIS)

    Goel, N.S.; Gang, F.; Ko, Z.

    1995-01-01

    A computationally fast method is presented for calculating electrostatic field in arbitrary inhomogeneous dielectric media with open boundary condition. The method involves dividing the whole space into cubical cells and then finding effective dielectric parameters for interfacial cells consisting of several dielectrics. The electrostatic problem is then solved using either the indirect boundary element method described in this paper or the so-called volume element method described in the companion paper. Both methods are tested for accuracy by comparing the numerically calculated electrostatic fields against those analytically obtained for a dielectric sphere and dielectric ellipsoid in a uniform field and for a dielectric sphere in a point charge field

  3. Implementation of visual programming methods for numerical techniques used in electromagnetic field theory

    Directory of Open Access Journals (Sweden)

    Metin Varan

    2017-08-01

    Full Text Available Field theory is one of the two sub-field theories in electrical and electronics engineering that for creates difficulties for undergraduate students. In undergraduate period, field theory has been taught under the theory of electromagnetic fields by which describes using partial differential equations and integral methods. Analytical methods for solution of field problems on the basis of a mathematical model may result the understanding difficulties for undergraduate students due to their mathematical and physical infrastructure. The analytical methods which can be applied in simple model lose their applicability to more complex models. In this case, the numerical methods are used to solve more complex equations. In this study, by preparing some field theory‘s web-based graphical user interface numerical methods of applications it has been aimed to increase learning levels of field theory problems for undergraduate and graduate students while taking in mind their computer programming capabilities.

  4. Methods for production of aluminium powders and their application fields

    Energy Technology Data Exchange (ETDEWEB)

    Gopienko, V.G.; Kiselev, V.P.; Zobnina, N.S. (Vsesoyuznyj Nauchno-Issledovatel' skij i Proektnyj Inst. Alyuminievoj, magnievoj i ehlektrodnoj promyshlennosti (USSR))

    1984-12-01

    Different types of powder products made of alluminium and its alloys (powder, fine powders, granules and pastes) as well as their basic physicochemical properties are briefly characterized. The principle methods for alluminium powder production are outlined: physicochemical methods, the melt spraying by compressed gas being the mostly developed among them, and physico-mechanical ones. Main application spheres for powder productions of aluminium and its alloys are reported in short.

  5. Solution of reverse problems in nuclear geophysics (equivalent field method)

    Energy Technology Data Exchange (ETDEWEB)

    Barenbaum, A.A.; Polyachenko, A.L.; Yakubson, K.I.

    1982-06-01

    The approach to the solution of reverse problems in nuclear geophysics based on special integration of two nuclear methods of near similar physical nature is theoretically substantiated. Taking into account the required accuracy of the reverse problem solution such an approach substantially simplifies the interpretation algorithm. The effectiveness of the approach is illustrated by numerical calculations on the example of several complexes of nuclear methods.

  6. Biogeophysical Method for Searching and Exploration of Oil Fields

    OpenAIRE

    M.Sh. Mardanov; R.G. Khannanov; V.B. Podavalov; U.R. Galimov; V.N. D’yachkov

    2015-01-01

    The problems of using biogeophysical method (BGPh method) to reveal and map oil accumulations in sedimentary rocks are considered. A working hypothesis of BGPh anomaly generated due to the electromagnetic nature (background) of the observed phenomenon has been posited. Methodology for fieldworks and interpretation of the obtained materials has been developed. It is successfully applied in more than 30 objects of the oil companies under study. The results of deep-hole drilling demonstrate in a...

  7. Contribution of surface analysis spectroscopic methods to the lubrication field

    International Nuclear Information System (INIS)

    Blanc, C.

    1979-01-01

    The analytical surface technics such as ESCA, AES and SIMS are tested to be applied to a particular lubrication field. One deals with a 100 C 6 steel surface innumered in tricresylphosphate at 110 0 C for 15 days. The nature of the first layers is studied after relevant solvant cleaning. An iron oxide layer is produced on the bearing surface, namely αFe 2 -O 3 . ESCA, AES and SIMS studies show an overlayer of iron phosphate. The exact nature of iron phosphate is not clearly established but the formation of a ferrous phosphate coating can be assumed from ESCA analysis [fr

  8. Two-field photography can identify patients with vision-threatening diabetic retinopathy - A screening approach in the primary care setting

    NARCIS (Netherlands)

    Stellingwerf, C; Hardus, PLLJ; Hooymans, JMM

    2001-01-01

    OBJECTIVE - To compare the effectiveness of two 45 degrees photographic fields per eye in the screening for diabetic retinopathy with the routine ophthalmologist's examination and to study the effectiveness of visual acuity measurement in the detection of diabetic macular edema, RESEARCH DESIGN AND

  9. A method for the real-time construction of a full parallax light field

    Science.gov (United States)

    Tanaka, Kenji; Aoki, Soko

    2006-02-01

    We designed and implemented a light field acquisition and reproduction system for dynamic objects called LiveDimension, which serves as a 3D live video system for multiple viewers. The acquisition unit consists of circularly arranged NTSC cameras surrounding an object. The display consists of circularly arranged projectors and a rotating screen. The projectors are constantly projecting images captured by the corresponding cameras onto the screen. The screen rotates around an in-plane vertical axis at a sufficient speed so that it faces each of the projectors in sequence. Since the Lambertian surfaces of the screens are covered by light-collimating plastic films with vertical louver patterns that are used for the selection of appropriate light rays, viewers can only observe images from a projector located in the same direction as the viewer. Thus, the dynamic view of an object is dependent on the viewer's head position. We evaluated the system by projecting both objects and human figures and confirmed that the entire system can reproduce light fields with a horizontal parallax to display video sequences of 430x770 pixels at a frame rate of 45 fps. Applications of this system include product design reviews, sales promotion, art exhibits, fashion shows, and sports training with form checking.

  10. The development and reliability of a simple field based screening tool to assess core stability in athletes.

    Science.gov (United States)

    O'Connor, S; McCaffrey, N; Whyte, E; Moran, K

    2016-07-01

    To adapt the trunk stability test to facilitate further sub-classification of higher levels of core stability in athletes for use as a screening tool. To establish the inter-tester and intra-tester reliability of this adapted core stability test. Reliability study. Collegiate athletic therapy facilities. Fifteen physically active male subjects (19.46 ± 0.63) free from any orthopaedic or neurological disorders were recruited from a convenience sample of collegiate students. The intraclass correlation coefficients (ICC) and 95% Confidence Intervals (CI) were computed to establish inter-tester and intra-tester reliability. Excellent ICC values were observed in the adapted core stability test for inter-tester reliability (0.97) and good to excellent intra-tester reliability (0.73-0.90). While the 95% CI were narrow for inter-tester reliability, Tester A and C 95% CI's were widely distributed compared to Tester B. The adapted core stability test developed in this study is a quick and simple field based test to administer that can further subdivide athletes with high levels of core stability. The test demonstrated high inter-tester and intra-tester reliability. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  12. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    Energy Technology Data Exchange (ETDEWEB)

    Liaparinos, P. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece); Kandarakis, I.; Cavouras, D. [Department of Medical Instruments Technology, Technological Educational Institution of Athens, Ag. Spyridonos Street, Aigaleo, 12210 Athens (Greece); Kalivas, N. [Greek Atomic Energy Commission, 15310 Athens (Greece); Delis, H. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece); Panayiotakis, G. [Department of Medical Physics, Medical School, University of Patras, 26500 Patras (Greece)], E-mail: panayiot@upatras.gr

    2007-09-21

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd{sub 2}O{sub 2}S:Tb phosphor material with packing density of 70% and grain size of 7 {mu}m and (c) phosphor thickness ranging between 30 and 70 mg/cm{sup 2}. The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm{sup 2} phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems.

  13. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    Science.gov (United States)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-09-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2O 2S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2. The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems.

  14. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-07-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts.

  15. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-01-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2 O 2 S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2 . The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems

  16. Development of a method for efficient cost-effective screening of Aspergillus niger mutants having increased production of glucoamylase.

    Science.gov (United States)

    Zhu, Xudong; Arman, Bessembayev; Chu, Ju; Wang, Yonghong; Zhuang, Yingping

    2017-05-01

    To develop an efficient cost-effective screening process to improve production of glucoamylase in Aspergillus niger. The cultivation of A. niger was achieved with well-dispersed morphology in 48-deep-well microtiter plates, which increased the throughput of the samples compared to traditional flask cultivation. There was a close negative correlation between glucoamylase and its pH of the fermentation broth. A novel high-throughput analysis method using Methyl Orange was developed. When compared to the conventional analysis method using 4-nitrophenyl α-D-glucopyranoside as substrate, a correlation coefficient of 0.96 by statistical analysis was obtained. Using this novel screening method, we acquired a strain with an activity of 2.2 × 10 3  U ml -1 , a 70% higher yield of glucoamylase than its parent strain.

  17. Comparing 3 values clarification methods for colorectal cancer screening decision-making: a randomized trial in the US and Australia.

    Science.gov (United States)

    Brenner, Alison; Howard, Kirsten; Lewis, Carmen; Sheridan, Stacey; Crutchfield, Trisha; Hawley, Sarah; Reuland, Dan; Kistler, Christine; Pignone, Michael

    2014-03-01

    To compare the effects of three methods of values clarification (VCM): balance sheet; rating and ranking; and a discrete choice experiment (DCE) on decision-making about colorectal cancer (CRC) screening among adults in the US and Australia. Using online panels managed by a survey research organization in the US and Australia, we recruited adults ages 50-75 at average risk for CRC for an online survey. Those eligible were randomized to one of the three VCM tasks. CRC screening options were described in terms of five key attributes: reduction in risk of CRC incidence and mortality; nature of the screening test; screening frequency; complications from screening; and chance of requiring a colonoscopy (as initial or follow-up testing). Main outcomes included self-reported most important attribute and unlabeled screening test preference by VCM and by country, assessed after the VCM. A total of 920 participants were enrolled; 51 % were Australian; mean age was 59.0; 87.0 % were white; 34.2 % had a 4-year college degree; 42.8 % had household incomes less than $45,000 USD per year; 44.9 % were up to date with CRC screening. Most important attribute differed across VCM groups: the rating and ranking group was more likely to choose risk reduction as most important attribute (69.8 %) than the balance sheet group (54.7 %) or DCE (49.3 %), p important attribute did not vary by country (p = 0.236). The fecal occult blood test (FOBT)-like test was the most frequently preferred test overall (55.9 %). Unlabeled test choice did not differ meaningfully by VCM. Australians were more likely to prefer the FOBT (AU 66.2 % vs. US 45.1 %, OR 2.4, 95 % CI 1.8, 3.1). Few participants favored no screening (US: 9.2 %, AU: 6.2 %). Screening test attribute importance varied by VCM, but not by country. FOBT was more commonly preferred by Australians than by Americans, but test preferences were heterogeneous in both countries.

  18. An efficient screening method for the isolation of heterotrophic bacteria influencing growth of diatoms under photoautotrophic conditions.

    Science.gov (United States)

    Zecher, Karsten; Jagmann, Nina; Seemann, Philipp; Philipp, Bodo

    2015-12-01

    Interactions between photoautotrophic diatoms and heterotrophic bacteria are important for the biogeochemical C-cycle in the oceans. Additionally, biofilms formed by diatoms and bacteria are the initiating step of biofouling processes, which causes high costs in shipping. Despite this ecological and economical importance, the knowledge about biochemical and molecular mechanisms underlying these interkingdom interactions is relatively small. For analyzing these mechanisms, laboratory model systems are required. In this study, an efficient screening method for isolating bacteria influencing photoautotrophic diatom growth was established. First, diatom cultures of Phaeodactylum tricornutum and Thalassiosira pseudonana were made axenic by applying β-lactam antibiotics. Second, a non-invasive method for measuring growth of multiple parallel diatom cultures by chlorophyll fluorescence was established. This method allowed semi-quantitative chlorophyll determination of cultures with up to 3 μg (chlorophyll) ml(-1). Axenic diatom cultures were then used for enriching bacteria and led to the isolation of 24 strains influencing growth of both diatom strains in various ways. For example, Rheinheimera sp. strain Tn16 inhibited growth of T. pseudonana, while it stimulated growth and cell aggregation of P. tricornutum. Thus, this screening method is appropriate for isolating heterotrophic bacteria showing different interactions with different diatom species ranging from synergistic to antagonistic. In consecutive applications, this method will be useful to screen for bacterial mutants with altered phenotypes regarding the influence on diatom growth. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Oscillometric blood pressure measurement: a simple method in screening for peripheral arterial disease

    DEFF Research Database (Denmark)

    Mehlsen, Jesper; Wiinberg, Niels; Bruce, Christopher

    2008-01-01

    Blood pressure at the ankle level is a reliable indicator of peripheral arterial disease (PAD) and the ankle brachial index (ABI) is a useful non-invasive screening tool for the early detection of atherosclerosis. In the first part of the study, systolic blood pressures obtained by oscillometry...... and plethysmography were compared in 80 subjects referred for possible vascular disease. In the second part of the study, 31 general practitioners enrolled 1258 consecutive patients aged more than 60 years. ABI was estimated by oscillometry. Patients with an ABI lower than 0.9 were referred to the local hospital...... of PAD was sufficiently high in subjects over the age of 60 years to warrant screening. The ankle brachial index based on measurements with an oscillometric device was shown reliable in the exclusion of PAD, thereby fulfilling an important criterion for the use in screening....

  20. Two stochastic mean-field polycrystal plasticity methods

    Energy Technology Data Exchange (ETDEWEB)

    Tonks, Michael [Los Alamos National Laboratory

    2008-01-01

    In this work, we develop two mean-field polycrystal plasticity models in which the L{sup c} are approximated stochastically. Through comprehensive CPFEM analyses of an idealized tantalum polycrystal, we verify that the L{sup c} tend to follow a normal distribution and surmise that this is due to the crystal interactions. We draw on these results to develop the STM and the stochastic no-constraints model (SNCM), which differ in the manner in which the crystal strain rates D{sup c} are prescribed. Calibration and validation of the models are performed using data from tantalum compression experiments. Both models predict the compression textures more accurately than the FCM, and the SNCM predicts them more accurately than the STM. The STM is extremely computationally efficient, only slightly more expensive than the FCM, while the SNCM is three times more computationally expensive than the STM.