WorldWideScience

Sample records for features including duplications

  1. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  2. MLPA analysis for a panel of syndromes with mental retardation reveals imbalances in 5.8% of patients with mental retardation and dysmorphic features, including duplications of the Sotos syndrome and Williams-Beuren syndrome regions

    DEFF Research Database (Denmark)

    Kirchhoff, Maria; Bisgaard, Anne-Marie; Bryndorf, Thue

    2007-01-01

    MLPA analysis for a panel of syndromes with mental retardation (MRS-MLPA) was used for investigation of 258 mentally retarded and dysmorphic patients with normal conventional karyotypes (P064 probe set, MRC-Holland, for detection of (micro)deletions associated with 1p36-deletion, Sotos, Williams...... referred with a clinical suspicion of a specific syndrome, which was confirmed in 17 patients (21.3%). The remaining 90 patients were referred because of mental retardation and dysmorphism but without suspicion of a specific syndrome. Seven imbalances, including four duplications, were detected in these 90...

  3. Exposing region duplication through local geometrical color invariant features

    Science.gov (United States)

    Gong, Jiachang; Guo, Jichang

    2015-05-01

    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  4. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  5. Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2016-10-01

    Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Near-Duplicate Web Page Detection: An Efficient Approach Using Clustering, Sentence Feature and Fingerprinting

    Directory of Open Access Journals (Sweden)

    J. Prasanna Kumar

    2013-02-01

    Full Text Available Duplicate and near-duplicate web pages are the chief concerns for web search engines. In reality, they incur enormous space to store the indexes, ultimately slowing down and increasing the cost of serving results. A variety of techniques have been developed to identify pairs of web pages that are aldquo;similarardquo; to each other. The problem of finding near-duplicate web pages has been a subject of research in the database and web-search communities for some years. In order to identify the near duplicate web pages, we make use of sentence level features along with fingerprinting method. When a large number of web documents are in consideration for the detection of web pages, then at first, we use K-mode clustering and subsequently sentence feature and fingerprint comparison is used. Using these steps, we exactly identify the near duplicate web pages in an efficient manner. The experimentation is carried out on the web page collections and the results ensured the efficiency of the proposed approach in detecting the near duplicate web pages.

  7. Autism Spectrum Disorder, Developmental and Psychiatric Features in 16p11.2 Duplication.

    Science.gov (United States)

    Green Snyder, LeeAnne; D'Angelo, Debra; Chen, Qixuan; Bernier, Raphael; Goin-Kochel, Robin P; Wallace, Arianne Stevens; Gerdts, Jennifer; Kanne, Stephen; Berry, Leandra; Blaskey, Lisa; Kuschner, Emily; Roberts, Timothy; Sherr, Elliot; Martin, Christa L; Ledbetter, David H; Spiro, John E; Chung, Wendy K; Hanson, Ellen

    2016-08-01

    The 16p11.2 duplication (BP4-BP5) is associated with Autism Spectrum Disorder (ASD), although significant heterogeneity exists. Quantitative ASD, behavioral and neuropsychological measures and DSM-IV diagnoses in child and adult carriers were compared with familial non-carrier controls, and to published results from deletion carriers. The 16p11.2 duplication phenotype ranges widely from asymptomatic presentation to significant disability. The most common diagnoses were intellectual disability, motor delays and Attention Deficit Hyperactivity Disorder in children, and anxiety in adults. ASD occurred in nearly 20 % of child cases, but a majority of carriers did not show the unique social features of ASD. The 16p11.2 duplication phenotype is characterized by wider variability than the reciprocal deletion, likely reflecting contributions from additional risk factors.

  8. Passive Forensics for Region Duplication Image Forgery Based on Harris Feature Points and Local Binary Patterns

    Directory of Open Access Journals (Sweden)

    Jie Zhao

    2013-01-01

    Full Text Available Nowadays the demand for identifying the authenticity of an image is much increased since advanced image editing software packages are widely used. Region duplication forgery is one of the most common and immediate tampering attacks which are frequently used. Several methods to expose this forgery have been developed to detect and locate the tampered region, while most methods do fail when the duplicated region undergoes rotation or flipping before being pasted. In this paper, an efficient method based on Harris feature points and local binary patterns is proposed. First, the image is filtered with a pixelwise adaptive Wiener method, and then dense Harris feature points are employed in order to obtain a sufficient number of feature points with approximately uniform distribution. Feature vectors for a circle patch around each feature point are extracted using local binary pattern operators, and the similar Harris points are matched based on their representation feature vectors using the BBF algorithm. Finally, RANSAC algorithm is employed to eliminate the possible erroneous matches. Experiment results demonstrate that the proposed method can effectively detect region duplication forgery, even when an image was distorted by rotation, flipping, blurring, AWGN, JPEG compression, and their mixed operations, especially resistant to the forgery with the flat area of little visual structures.

  9. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  10. Xq28 duplications including MECP2 in five females: Expanding the phenotype to severe mental retardation.

    Science.gov (United States)

    Bijlsma, E K; Collins, A; Papa, F T; Tejada, M I; Wheeler, P; Peeters, E A J; Gijsbers, A C J; van de Kamp, J M; Kriek, M; Losekoot, M; Broekma, A J; Crolla, J A; Pollazzon, M; Mucciolo, M; Katzaki, E; Disciglio, V; Ferreri, M I; Marozza, A; Mencarelli, M A; Castagnini, C; Dosa, L; Ariani, F; Mari, F; Canitano, R; Hayek, G; Botella, M P; Gener, B; Mínguez, M; Renieri, A; Ruivenkamp, C A L

    2012-06-01

    Duplications leading to functional disomy of chromosome Xq28, including MECP2 as the critical dosage-sensitive gene, are associated with a distinct clinical phenotype in males, characterized by severe mental retardation, infantile hypotonia, progressive neurologic impairment, recurrent infections, bladder dysfunction, and absent speech. Female patients with Xq duplications including MECP2 are rare. Only recently submicroscopic duplications of this region on Xq28 have been recognized in four females, and a triplication in a fifth, all in combination with random X-chromosome inactivation (XCI). Based on this small series, it was concluded that in females with MECP2 duplication and random XCI, the typical symptoms of affected boys are not present. We present clinical and molecular data on a series of five females with an Xq28 duplication including the MECP2 gene, both isolated and as the result of a translocation, and compare them with the previously reported cases of small duplications in females. The collected data indicate that the associated phenotype in females is distinct from males with similar duplications, but the clinical effects may be as severe as seen in males. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  11. Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens

    Directory of Open Access Journals (Sweden)

    Ming TIAN,Suyun FANG,Yanqiang WANG,Xiaorong GU,Chungang FENG,Rui HAO,Xiaoxiang HU,Ning LI

    2014-06-01

    Full Text Available The dermal hyperpigmentation phenotype in chickens is controlled by the dominant fibromelanosis allele. One of the ten unique characteristics of Silkie chickens is the fibromelanosis phenotype, which is pigmentation in the dermal layer of the skin and connective tissue. In this study, we found a mutation of fibromelanosis, a genomic rearrangement that included an inverted duplication of endothelin3 (EDN3, is responsible. We show that, as a stimulator of melanoblast proliferation, EDN3 expression was increased in silkie embryos and in both skin and muscle throughout adulthood. EDN3 expression led to an increase in expression of the downstream genes EDNRB2 and TYRP2, and was closely relate with the hyperpigmentation phenotype. We examined eight different Chinese chicken breeds showing hyperpigmentation and conclude that this structural genetic variant exists in all fibromelanosis chicken breeds.

  12. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  13. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  14. Including product features in process redesign

    DEFF Research Database (Denmark)

    Hvam, Lars; Hauksdóttir, Dagný; Mortensen, Niels Henrik

    2017-01-01

    do not take into account how the product features are applied throughout the process, which makes it difficult to obtain a comprehensive understanding of the activities in the processes and to generate significant improvements. The suggested approach models the product family using the so......This article suggests a visual modelling method for integrating models of product features with business process models for redesigning the business processes involving specifications of customer-tailored products and services. The current methods for redesigning these types of business processes......-called product variant master and the business process modelling notation for modelling the process flow. The product model is combined with the process map by identifying features used in each step of the process flow. Additionally, based on the information absorbed from the integrated model, the value stream...

  15. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Directory of Open Access Journals (Sweden)

    Michael J Considine

    Full Text Available Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised

  16. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Science.gov (United States)

    Considine, Michael J; Wan, Yizhen; D'Antuono, Mario F; Zhou, Qian; Han, Mingyu; Gao, Hua; Wang, Man

    2012-01-01

    Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised. Impacts of

  17. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  18. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  19. 22q11.2q13 duplication including SOX10 causes sex-reversal and peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease.

    Science.gov (United States)

    Falah, Nadia; Posey, Jennifer E; Thorson, Willa; Benke, Paul; Tekin, Mustafa; Tarshish, Brocha; Lupski, James R; Harel, Tamar

    2017-04-01

    Diagnosis of genetic syndromes may be difficult when specific components of a disorder manifest at a later age. We present a follow up of a previous report [Seeherunvong et al., (2004); AJMGA 127: 149-151], of an individual with 22q duplication and sex-reversal syndrome. The subject's phenotype evolved to include peripheral and central demyelination, Waardenburg syndrome type IV, and Hirschsprung disease (PCWH; MIM 609136). DNA microarray analysis defined the duplication at 22q11.2q13, including SOX10. Sequencing of the coding region of SOX10 did not reveal any mutations. Our data suggest that SOX10 duplication can cause disorders of sex development and PCWH, supporting the hypothesis that SOX10 toxic gain of function rather than dominant negative activity underlies PCWH. © 2017 Wiley Periodicals, Inc.

  20. A recurrent deletion syndrome at chromosome bands 2p11.2-2p12 flanked by segmental duplications at the breakpoints and including REEP1.

    Science.gov (United States)

    Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L

    2015-04-01

    We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.

  1. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  2. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  3. Pulmonary nodule characterization, including computer analysis and quantitative features.

    Science.gov (United States)

    Bartholmai, Brian J; Koo, Chi Wan; Johnson, Geoffrey B; White, Darin B; Raghunath, Sushravya M; Rajagopalan, Srinivasan; Moynagh, Michael R; Lindell, Rebecca M; Hartman, Thomas E

    2015-03-01

    Pulmonary nodules are commonly detected in computed tomography (CT) chest screening of a high-risk population. The specific visual or quantitative features on CT or other modalities can be used to characterize the likelihood that a nodule is benign or malignant. Visual features on CT such as size, attenuation, location, morphology, edge characteristics, and other distinctive "signs" can be highly suggestive of a specific diagnosis and, in general, be used to determine the probability that a specific nodule is benign or malignant. Change in size, attenuation, and morphology on serial follow-up CT, or features on other modalities such as nuclear medicine studies or MRI, can also contribute to the characterization of lung nodules. Imaging analytics can objectively and reproducibly quantify nodule features on CT, nuclear medicine, and magnetic resonance imaging. Some quantitative techniques show great promise in helping to differentiate benign from malignant lesions or to stratify the risk of aggressive versus indolent neoplasm. In this article, we (1) summarize the visual characteristics, descriptors, and signs that may be helpful in management of nodules identified on screening CT, (2) discuss current quantitative and multimodality techniques that aid in the differentiation of nodules, and (3) highlight the power, pitfalls, and limitations of these various techniques.

  4. Further delineation of the MECP2 duplication syndrome phenotype in 59 French male patients, with a particular focus on morphological and neurological features.

    Science.gov (United States)

    Miguet, Marguerite; Faivre, Laurence; Amiel, Jeanne; Nizon, Mathilde; Touraine, Renaud; Prieur, Fabienne; Pasquier, Laurent; Lefebvre, Mathilde; Thevenon, Julien; Dubourg, Christèle; Julia, Sophie; Sarret, Catherine; Remerand, Ganaëlle; Francannet, Christine; Laffargue, Fanny; Boespflug-Tanguy, Odile; David, Albert; Isidor, Bertrand; Vigneron, Jacqueline; Leheup, Bruno; Lambert, Laetitia; Philippe, Christophe; Béri-Dexheimer, Mylène; Cuisset, Jean-Marie; Andrieux, Joris; Plessis, Ghislaine; Toutain, Annick; Guibaud, Laurent; Cormier-Daire, Valérie; Rio, Marlene; Bonnefont, Jean-Paul; Echenne, Bernard; Journel, Hubert; Burglen, Lydie; Chantot-Bastaraud, Sandrine; Bienvenu, Thierry; Baumann, Clarisse; Perrin, Laurence; Drunat, Séverine; Jouk, Pierre-Simon; Dieterich, Klaus; Devillard, Françoise; Lacombe, Didier; Philip, Nicole; Sigaudy, Sabine; Moncla, Anne; Missirian, Chantal; Badens, Catherine; Perreton, Nathalie; Thauvin-Robinet, Christel; AChro-Puce, Réseau; Pedespan, Jean-Michel; Rooryck, Caroline; Goizet, Cyril; Vincent-Delorme, Catherine; Duban-Bedu, Bénédicte; Bahi-Buisson, Nadia; Afenjar, Alexandra; Maincent, Kim; Héron, Delphine; Alessandri, Jean-Luc; Martin-Coignard, Dominique; Lesca, Gaëtan; Rossi, Massimiliano; Raynaud, Martine; Callier, Patrick; Mosca-Boidron, Anne-Laure; Marle, Nathalie; Coutton, Charles; Satre, Véronique; Caignec, Cédric Le; Malan, Valérie; Romana, Serge; Keren, Boris; Tabet, Anne-Claude; Kremer, Valérie; Scheidecker, Sophie; Vigouroux, Adeline; Lackmy-Port-Lis, Marilyn; Sanlaville, Damien; Till, Marianne; Carneiro, Maryline; Gilbert-Dussardier, Brigitte; Willems, Marjolaine; Van Esch, Hilde; Portes, Vincent Des; El Chehadeh, Salima

    2018-04-04

    The Xq28 duplication involving the MECP2 gene ( MECP2 duplication) has been mainly described in male patients with severe developmental delay (DD) associated with spasticity, stereotypic movements and recurrent infections. Nevertheless, only a few series have been published. We aimed to better describe the phenotype of this condition, with a focus on morphological and neurological features. Through a national collaborative study, we report a large French series of 59 affected males with interstitial MECP2 duplication. Most of the patients (93%) shared similar facial features, which evolved with age (midface hypoplasia, narrow and prominent nasal bridge, thick lower lip, large prominent ears), thick hair, livedo of the limbs, tapered fingers, small feet and vasomotor troubles. Early hypotonia and global DD were constant, with 21% of patients unable to walk. In patients able to stand, lower limbs weakness and spasticity led to a singular standing habitus: flexion of the knees, broad-based stance with pseudo-ataxic gait. Scoliosis was frequent (53%), such as divergent strabismus (76%) and hypermetropia (54%), stereotypic movements (89%), without obvious social withdrawal and decreased pain sensitivity (78%). Most of the patients did not develop expressive language, 35% saying few words. Epilepsy was frequent (59%), with a mean onset around 7.4 years of age, and often (62%) drug-resistant. Other medical issues were frequent: constipation (78%), and recurrent infections (89%), mainly lung. We delineate the clinical phenotype of MECP2 duplication syndrome in a large series of 59 males. Pulmonary hypertension appeared as a cause of early death in these patients, advocating its screening early in life. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  6. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  7. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  8. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features resembling Coffin-Siris Syndrome.

    Science.gov (United States)

    Zhu, Jun; Qiu, Jun; Magrane, Gregg; Abedalthagafi, Malak; Zanko, Andrea; Golabi, Mahin; Chehab, Farid F

    2012-01-01

    We characterized the t(7;22)(q32;q11.2) chromosomal translocation in an obese female with coarse features, short stature, developmental delay and a hypoplastic fifth digit. While these clinical features suggest Coffin-Siris Syndrome (CSS), we excluded a CSS diagnosis by exome sequencing based on the absence of deleterious mutations in six chromatin-remodeling genes recently shown to cause CSS. Thus, molecular characterization of her translocation could delineate genes that underlie other syndromes resembling CSS. Comparative genomic hybridization microarrays revealed on chromosome 7 the duplication of a 434,682 bp region that included the tail end of an uncharacterized gene termed C7orf58 (also called CPED1) and spanned the entire WNT16 and FAM3C genes. Because the translocation breakpoint on chromosome 22 did not disrupt any apparent gene, her disorder was deemed to result from the rearrangement on chromosome 7. Mapping of yeast and bacterial artificial chromosome clones by fluorescent in situ hybridization on chromosome spreads from this patient showed that the duplicated region and all three genes within it were located on both derivative chromosomes 7 and 22. Furthermore, DNA sequencing of exons and splice junctional regions from C7orf58, WNT16 and FAM3C revealed the presence of potential splice site and promoter mutations, thereby augmenting the detrimental effect of the duplicated genes. Hence, dysregulation and/or disruptions of C7orf58, WNT16 and FAM3C underlie the phenotype of this patient, serve as candidate genes for other individuals with similar clinical features and could provide insights into the physiological role of the novel gene C7orf58.

  9. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22(q32.1;q11.2 chromosomal translocation and clinical features resembling Coffin-Siris Syndrome.

    Directory of Open Access Journals (Sweden)

    Jun Zhu

    Full Text Available We characterized the t(7;22(q32;q11.2 chromosomal translocation in an obese female with coarse features, short stature, developmental delay and a hypoplastic fifth digit. While these clinical features suggest Coffin-Siris Syndrome (CSS, we excluded a CSS diagnosis by exome sequencing based on the absence of deleterious mutations in six chromatin-remodeling genes recently shown to cause CSS. Thus, molecular characterization of her translocation could delineate genes that underlie other syndromes resembling CSS. Comparative genomic hybridization microarrays revealed on chromosome 7 the duplication of a 434,682 bp region that included the tail end of an uncharacterized gene termed C7orf58 (also called CPED1 and spanned the entire WNT16 and FAM3C genes. Because the translocation breakpoint on chromosome 22 did not disrupt any apparent gene, her disorder was deemed to result from the rearrangement on chromosome 7. Mapping of yeast and bacterial artificial chromosome clones by fluorescent in situ hybridization on chromosome spreads from this patient showed that the duplicated region and all three genes within it were located on both derivative chromosomes 7 and 22. Furthermore, DNA sequencing of exons and splice junctional regions from C7orf58, WNT16 and FAM3C revealed the presence of potential splice site and promoter mutations, thereby augmenting the detrimental effect of the duplicated genes. Hence, dysregulation and/or disruptions of C7orf58, WNT16 and FAM3C underlie the phenotype of this patient, serve as candidate genes for other individuals with similar clinical features and could provide insights into the physiological role of the novel gene C7orf58.

  10. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  11. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  12. Antenatal diagnosis of complete facial duplication--a case report of a rare craniofacial defect.

    Science.gov (United States)

    Rai, V S; Gaffney, G; Manning, N; Pirrone, P G; Chamberlain, P F

    1998-06-01

    We report a case of the prenatal sonographic detection of facial duplication, the diprosopus abnormality, in a twin pregnancy. The characteristic sonographic features of the condition include duplication of eyes, mouth, nose and both mid- and anterior intracranial structures. A heart-shaped abnormality of the cranial vault should prompt more detailed examination for other supportive features of this rare condition.

  13. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  14. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  15. Oropharyngeal Dysphagia in Dermatomyositis: Associations with Clinical and Laboratory Features Including Autoantibodies

    OpenAIRE

    Mugii, Naoki; Hasegawa, Minoru; Matsushita, Takashi; Hamaguchi, Yasuhito; Oohata, Sacihe; Okita, Hirokazu; Yahata, Tetsutarou; Someya, Fujiko; Inoue, Katsumi; Murono, Shigeyuki; Fujimoto, Manabu; Takehara, Kazuhiko

    2016-01-01

    Objective Dysphagia develops with low frequency in patients with dermatomyositis. Our objective was to determine the clinical and laboratory features that can estimate the development of dysphagia in dermatomyositis. Methods This study included 92 Japanese patients with adult-onset dermatomyositis. The associations between dysphagia and clinical and laboratory features including disease-specific autoantibodies determined by immunoprecipitation assays were analyzed. Results Videofluoroscopy sw...

  16. 77 FR 48550 - Technicolor Creative Services, Post Production Feature Mastering Division Including On-Site...

    Science.gov (United States)

    2012-08-14

    ... Services, Post Production Feature Mastering Division Including On-Site Leased Workers From Ajilon... Services, Post Production Feature Mastering Division, Hollywood, California (subject firm). The worker... the workers meet the eligibility requirements of the Trade Act of 1974. Conclusion After careful...

  17. Tail-like Congenital Duplication of Lower Extremity (Extra Leg or ...

    African Journals Online (AJOL)

    2018-01-01

    Jan 1, 2018 ... ABSTRACT. BACKGROUND: Congenital duplication of lower extremity, either complete or incomplete is extremely rare. Only 26 cases had been reported till 2010, of which only 5 cases had feature of complete duplication. Theories have been proposed that the cause of this abnormality includes maternal ...

  18. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  19. Including pride and its group-based, relational, and contextual features in theories of contempt.

    Science.gov (United States)

    Sullivan, Gavin Brent

    2017-01-01

    Sentiment includes emotional and enduring attitudinal features of contempt, but explaining contempt as a mixture of basic emotion system affects does not adequately address the family resemblance structure of the concept. Adding forms of individual, group-based, and widely shared arrogance and contempt is necessary to capture the complex mixed feelings of proud superiority when "looking down upon" and acting harshly towards others.

  20. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  1. 3p interstitial deletion including PRICKLE2 in identical twins with autistic features.

    Science.gov (United States)

    Okumura, Akihisa; Yamamoto, Toshiyuki; Miyajima, Masakazu; Shimojima, Keiko; Kondo, Satoshi; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki

    2014-11-01

    Microdeletion and microduplication syndromes without characteristic dysmorphic features are difficult to diagnose without chromosomal microarrays. We describe the clinical course and genetic findings of monozygotic twins with intellectual disabilities and autistic features associated with mild facial dysmorphism and microdeletion of chromosome 3p14. The postnatal course of the second twin was complicated by intestinal malrotation, whereas that of the first twin was unremarkable. Both twins had several mild dysmorphic features including upswept frontal hair, low-set posterior rotated ears, arched down-slanting eyebrows, prominent forehead, epicanthic folds, micrognathia, hypertelorism, broad nasal bridge, short philtrum, and camptodactyly of the bilateral fifth fingers. They had autistic features such as poor eye contact and no social smile, stereotyped behaviors, and preference for solitary play. Array comparative genomic hybridization analysis revealed de novo 6.88-Mb deletions of 3p14 (chr3: 60,472,496-67,385,119) involving 17 genes in both twins. The deleted region contained 17 genes, five of which are known or presumed to be related to central nervous system disorders: FEZF2, SYNPR, ATXN7, PRICKLE2, and MAGI1. We consider that PRICKLE2 is the most likely causative gene for the autistic features exhibited by these individuals. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. RELAP5-3D Code Includes ATHENA Features and Models

    International Nuclear Information System (INIS)

    Riemke, Richard A.; Davis, Cliff B.; Schultz, Richard R.

    2006-01-01

    Version 2.3 of the RELAP5-3D computer program includes all features and models previously available only in the ATHENA version of the code. These include the addition of new working fluids (i.e., ammonia, blood, carbon dioxide, glycerol, helium, hydrogen, lead-bismuth, lithium, lithium-lead, nitrogen, potassium, sodium, and sodium-potassium) and a magnetohydrodynamic model that expands the capability of the code to model many more thermal-hydraulic systems. In addition to the new working fluids along with the standard working fluid water, one or more noncondensable gases (e.g., air, argon, carbon dioxide, carbon monoxide, helium, hydrogen, krypton, nitrogen, oxygen, SF 6 , xenon) can be specified as part of the vapor/gas phase of the working fluid. These noncondensable gases were in previous versions of RELAP5-3D. Recently four molten salts have been added as working fluids to RELAP5-3D Version 2.4, which has had limited release. These molten salts will be in RELAP5-3D Version 2.5, which will have a general release like RELAP5-3D Version 2.3. Applications that use these new features and models are discussed in this paper. (authors)

  3. Oropharyngeal Dysphagia in Dermatomyositis: Associations with Clinical and Laboratory Features Including Autoantibodies.

    Science.gov (United States)

    Mugii, Naoki; Hasegawa, Minoru; Matsushita, Takashi; Hamaguchi, Yasuhito; Oohata, Sacihe; Okita, Hirokazu; Yahata, Tetsutarou; Someya, Fujiko; Inoue, Katsumi; Murono, Shigeyuki; Fujimoto, Manabu; Takehara, Kazuhiko

    2016-01-01

    Dysphagia develops with low frequency in patients with dermatomyositis. Our objective was to determine the clinical and laboratory features that can estimate the development of dysphagia in dermatomyositis. This study included 92 Japanese patients with adult-onset dermatomyositis. The associations between dysphagia and clinical and laboratory features including disease-specific autoantibodies determined by immunoprecipitation assays were analyzed. Videofluoroscopy swallow study (VFSS) was performed for all patients with clinical dysphagia (n = 13, 14.1%) but not for patients without clinical dysphagia. Typical findings of dysphagia (pharyngeal pooling, n = 11 and/or nasal regurgitation, n = 4) was detected by VFSS in all patients with clinical dysphagia. Eleven patients with dysphagia (84.6%) had anti-transcription intermediary factor 1γ (TIF-1γ) antibody. By univariate analysis, the average age and the male to female ratio, internal malignancy, and anti-TIF-1γ antibody were significantly higher and the frequency of interstitial lung diseases and manual muscle testing (MMT) scores of sternomastoid and dertoid muscles were significantly lower in patients with dysphagia than in patients without dysphagia. Among patients with anti-TIF-1γ antibody, the mean age, the ratios of male to female and internal malignancy were significantly higher and mean MMT scores of sternomastoid muscle were significantly lower in patients with dysphagia compared with patients without dysphagia. By multivariable analysis, the risk of dysphagia was strongly associated with the existence of internal malignancy and ant-TIF-1γ antibody and was also associated with reduced scores of manual muscle test of sternomastoid muscle. Dysphagia was markedly improved after the treatment against myositis in all 13 patients. These findings indicate that dysphagia can develop frequently in patients with internal malignancy, anti-TIF-1γ antibody, or severe muscle weakness of sternomastoid muscle.

  4. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  5. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  6. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  7. An HMM posterior decoder for sequence feature prediction that includes homology information

    DEFF Research Database (Denmark)

    Käll, Lukas; Krogh, Anders Stærmose; Sonnhammer, Erik L. L.

    2005-01-01

    Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines probabil......Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines......://phobius.cgb.ki.se/poly.html . An implementation of the algorithm is available on request from the authors....

  8. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  9. Use of diagnostic imaging in the evaluation of gastrointestinal tract duplications.

    Science.gov (United States)

    Laskowska, Katarzyna; Gałązka, Przemysław; Daniluk-Matraś, Irena; Leszczyński, Waldemar; Serafin, Zbigniew

    2014-01-01

    Gastrointestinal tract duplication is a rare malformation associated with the presence of additional segment of the fetal gut. The aim of this study was to retrospectively review clinical features and imaging findings in intraoperatively confirmed cases of gastrointestinal tract duplication in children. The analysis included own material from the years 2002-2012. The analyzed group included 14 children, among them 8 boys and 6 girls. The youngest patient was diagnosed at the age of three weeks, and the oldest at 12 years of age. The duplication cysts were identified in the esophagus (n=2), stomach (n=5), duodenum (n=1), terminal ileum (n=5), and rectum (n=1). In four cases, the duplication coexisted with other anomalies, such as patent urachus, Meckel's diverticulum, mesenteric cyst, and accessory pancreas. Clinical manifestation of gastrointestinal duplication cysts was variable, and some of them were detected accidently. Thin- or thick-walled cystic structures adjacent to the wall of neighboring gastrointestinal segment were documented on diagnostic imaging. Ultrasound and computed tomography are the methods of choice in the evaluation of gastrointestinal duplication cysts. Apart from the diagnosis of the duplication cyst, an important issue is the detection of concomitant developmental pathologies, including pancreatic heterotopy.

  10. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  11. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  12. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  13. Occupational methaemoglobinaemia. Mechanisms of production, features, diagnosis and management including the use of methylene blue.

    Science.gov (United States)

    Bradberry, Sally M

    2003-01-01

    Methaemoglobin is formed by oxidation of ferrous (FeII) haem to the ferric (FeIII) state and the mechanisms by which this occurs are complex. Most cases are due to one of three processes. Firstly, direct oxidation of ferrohaemoglobin, which involves the transfer of electrons from ferrous haem to the oxidising compound. This mechanism proceeds most readily in the absence of oxygen. Secondly, indirect oxidation, a process of co-oxidation which requires haemoglobin-bound oxygen and is involved, for example, in nitrite-induced methaemoglobinaemia. Thirdly, biotransformation of a chemical to an active intermediate that initiates methaemoglobin formation by a variety of mechanisms. This is the means by which most aromatic compounds, such as amino- and nitro-derivatives of benzene, produce methaemoglobin. Methaemoglobinaemia is an uncommon occupational occurrence. Aromatic compounds are responsible for most cases, their lipophilic nature and volatility facilitating absorption during dermal and inhalational exposure, the principal routes implicated in the workplace. Methaemoglobinaemia presents clinically with symptoms and signs of tissue hypoxia. Concentrations around 80% are life-threatening. Features of toxicity may develop over hours or even days when exposure, whether by inhalation or repeated skin contact, is to relatively low concentrations of inducing chemical(s). Not all features observed in patients with methaemoglobinaemia are due to methaemoglobin formation. For example, the intravascular haemolysis caused by oxidising chemicals such as chlorates poses more risk to life than the methaemoglobinaemia that such chemicals induce. If an occupational history is taken, the diagnosis of methaemoglobinaemia should be relatively straightforward. In addition, two clinical observations may help: firstly, the victim is often less unwell than one would expect from the severity of 'cyanosis' and, secondly, the 'cyanosis' is unresponsive to oxygen therapy. Pulse oximetry is

  14. Distal trisomy 10q syndrome, report of a patient with duplicated q24.31 – qter, autism spectrum disorder and unusual features

    Science.gov (United States)

    Al-Sarraj, Yasser; Al-Khair, Hakam Abu; Taha, Rowaida Ziad; Khattab, Namat; El Sayed, Zakaria H; Elhusein, Bushra; El-Shanti, Hatem

    2014-01-01

    Key Clinical Message We report on a patient with distal trisomy 10q syndrome presenting with a few previously undescribed physical features, as well as, autism spectrum disorder (ASD). We recommend that patients with distal trisomy 10q syndrome should have a behavioral evaluation for ASD for the early institution of therapy. PMID:25614812

  15. MR features of the developing perianterior horn structure including subcallosal fasciculus in infants and children

    International Nuclear Information System (INIS)

    Utsunomiya, Hidetsuna; Nakamura, Yasuhiro

    2007-01-01

    To describe the changes in the magnetic resonance (MR) signal of the perianterior horn structure (PAS) with increasing age, we studied 69 infants and children aged between 3 days and 9.4 years (average: 2.8 years) without any neurological deficits. T1- and T2-weighted images and FLAIR (fluid attenuation inversion recovery) images were obtained in the axial plane. Based on a comparison of the intensity of the PAS with that of the cortex in each sequence (T1-WI/FLAIR/T2-WI), we classified the signal-intensity patterns into four types: I, low/low/high; II, low/high/high; III, iso/high/high; IV, high/low/low. Signal-intensity types I, II, III and IV were seen in 22, 8, 17, and 22 subjects, respectively, with younger subjects showing type I or II intensity patterns and older subjects showing type III or IV. In addition, T1-weighted and FLAIR images of subjects with a type I intensity pattern showed a rim of an isointensity component around the PAS that histologically coincided with migrating glial cells. The low-intensity area on FLAIR and T2-WI images of subjects with a type IV intensity pattern may represent myelinated fibers of the subcallosal fasciculus (ScF). The intensity of the MR signals of the PAS changes with increasing age, and this change may reflect histological features. A better understanding of these characteristics may help us to clarify myelination abnormalities, particularly those related to the ScF in the frontal lobe in infants and children. (orig.)

  16. CT features of lymphobronchial tuberculosis in children, including complications and associated abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, Susan; Andronikou, Savvas [Faculty of Health Sciences, University of the Witwatersrand, Department of Radiology, Johannesburg (South Africa); Goussard, Pierre; Gie, Robert [Stellenbosch University, Department Paediatrics, Stellenbosch (South Africa)

    2012-08-15

    Lymphobronchial tuberculosis (TB) is tuberculous lymphadenopathy involving the airways, which is particularly common in children. To describe CT findings of lymphobronchial TB in children, the parenchymal complications and associated abnormalities. CT scans of children with lymphobronchial TB were reviewed retrospectively. Lymphadenopathy, bronchial narrowing, parenchymal complications and associations were documented. Infants comprised 51% of patients. The commonest site of lymphadenopathy was the subcarinal mediastinum (97% of patients). Bronchial compression was seen in all children (259 bronchi, of these 28% the bronchus intermedius) with severe or complete stenosis in 23% of affected bronchi. Parenchymal complications were present in 94% of patients, including consolidation (88%), breakdown (42%), air trapping (38%), expansile pneumonia (28%), collapse (17%) and bronchiectasis (9%), all predominantly on the right side (63%). Associated abnormalities included ovoid lesions, miliary nodules, pleural disease and intracavitary bodies. Airway compression was more severe in infants and most commonly involved the bronchus intermedius. Numerous parenchymal complications were documented, all showing right-side predominance. (orig.)

  17. Slowly progressive fluent aphasia; Clinical features and an imaging study including MRI, SPECT and PET

    Energy Technology Data Exchange (ETDEWEB)

    Sakurai, Yasuhisa; Momose, Toshimitsu; Watanabe, Toshiaki; Ishikawa, Takashi; Iwata, Makoto (Tokyo Univ. (Japan). Faculty of Medicine); Bando, Mitsuaki

    1991-05-01

    Three patients with slowly progressive fluent aphasia are reported. One of the patients presented with memory disturbance. They were characterized clinically by having selective deficits in vocabulary, which resulted in impairment of confrontation naming, and auditory comprehension. MRI showed an atrophy not only in the left temporal lobe (including the superior, middle and inferior temporal gyri), hippocampus, parahippocampual gyrus, and fusiform gyrus, but also in the left parietal lobe. I-123 IMP SPECT and F-18 FDG PET were used to determine regional cerebral blood flow and regional cerebral metabolic rate, respectively. In addition to the decreased tracer uptake in the left temporal and/or parietal lobe, a decreased uptake was seen in the bilateral basal ganglia, the inner side of the temporal lobe (including the bilateral hippocampus), the right anterior temporal lobe, and the left thalamus. These findings may deny the previous thought that lesions are localized in slowly progressive fluent aphasia. Furthermore, noticeable difficulty in naming, i.e., patients unable to recognize the right answer, are considered attributable to widespread lesions from the whole left temporal lobe, including the hippocampus, to the right temporal lobe. (N.K.).

  18. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  19. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

    Science.gov (United States)

    Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

    2018-01-01

    Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

  20. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

    Directory of Open Access Journals (Sweden)

    Corina Diana Ceapă

    Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

  1. Review of nuclear fuel cycle alternatives including certain features pertaining to weapon proliferation

    International Nuclear Information System (INIS)

    Williams, D.C.; Rosenstroch, B.

    1978-01-01

    Largely as a result of concerns over nuclear weapon proliferation, the U.S. program to develop and commercialize the plutonium-fueled breeder reactor has been slowed down; interest in alternative fuel cycles has increased. The report offers an informal review of the various nuclear fuel cycle options including some aspects relevant to weapon proliferation, although no complete review of the latter subject is attempted. Basic principles governing breeding, reactor safety, and efficient utilization of fission energy resources (thorium and uranium) are discussed. The controversial problems of weapon proliferation and its relation to fuel reprocessing (which is essential for efficient fuel cycles) are reviewed and a number of proposed approaches to reducing proliferation risks are noted. Some representative specific reactor concepts are described, with emphasis on their development status, their potentials for resource utilization, and their implications for proliferation

  2. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  3. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  4. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  5. Laparoscopic excision of a newborn rectal duplication cyst.

    Science.gov (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L

    2008-08-01

    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  6. Surgical management of complete penile duplication accompanied by multiple anomalies.

    Science.gov (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya

    2014-09-01

    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  7. Williams Syndrome and 15q Duplication: Coincidence versus Association.

    Science.gov (United States)

    Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila

    2017-01-01

    Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

  8. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  9. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  10. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  11. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  12. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  13. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  14. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  15. The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly.

    Science.gov (United States)

    Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni

    2011-08-01

    Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

  16. Major features of immunesenescence, including reduced thymic output, are ameliorated by high levels of physical activity in adulthood.

    Science.gov (United States)

    Duggal, Niharika Arora; Pollock, Ross D; Lazarus, Norman R; Harridge, Stephen; Lord, Janet M

    2018-04-01

    It is widely accepted that aging is accompanied by remodelling of the immune system including thymic atrophy and increased frequency of senescent T cells, leading to immune compromise. However, physical activity, which influences immunity but declines dramatically with age, is not considered in this literature. We assessed immune profiles in 125 adults (55-79 years) who had maintained a high level of physical activity (cycling) for much of their adult lives, 75 age-matched older adults and 55 young adults not involved in regular exercise. The frequency of naïve T cells and recent thymic emigrants (RTE) were both higher in cyclists compared with inactive elders, and RTE frequency in cyclists was no different to young adults. Compared with their less active counterparts, the cyclists had significantly higher serum levels of the thymoprotective cytokine IL-7 and lower IL-6, which promotes thymic atrophy. Cyclists also showed additional evidence of reduced immunesenescence, namely lower Th17 polarization and higher B regulatory cell frequency than inactive elders. Physical activity did not protect against all aspects of immunesenescence: CD28 -ve CD57 +ve senescent CD8 T-cell frequency did not differ between cyclists and inactive elders. We conclude that many features of immunesenescence may be driven by reduced physical activity with age. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  17. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  18. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  19. Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.

    Science.gov (United States)

    Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H

    2014-01-01

    Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.

  20. Airborne electromagnetic detection of shallow seafloor topographic features, including resolution of multiple sub-parallel seafloor ridges

    Science.gov (United States)

    Vrbancich, Julian; Boyd, Graham

    2014-05-01

    The HoistEM helicopter time-domain electromagnetic (TEM) system was flown over waters in Backstairs Passage, South Australia, in 2003 to test the bathymetric accuracy and hence the ability to resolve seafloor structure in shallow and deeper waters (extending to ~40 m depth) that contain interesting seafloor topography. The topography that forms a rock peak (South Page) in the form of a mini-seamount that barely rises above the water surface was accurately delineated along its ridge from the start of its base (where the seafloor is relatively flat) in ~30 m water depth to its peak at the water surface, after an empirical correction was applied to the data to account for imperfect system calibration, consistent with earlier studies using the same HoistEM system. A much smaller submerged feature (Threshold Bank) of ~9 m peak height located in waters of 35 to 40 m depth was also accurately delineated. These observations when checked against known water depths in these two regions showed that the airborne TEM system, following empirical data correction, was effectively operating correctly. The third and most important component of the survey was flown over the Yatala Shoals region that includes a series of sub-parallel seafloor ridges (resembling large sandwaves rising up to ~20 m from the seafloor) that branch out and gradually decrease in height as the ridges spread out across the seafloor. These sub-parallel ridges provide an interesting topography because the interpreted water depths obtained from 1D inversion of TEM data highlight the limitations of the EM footprint size in resolving both the separation between the ridges (which vary up to ~300 m) and the height of individual ridges (which vary up to ~20 m), and possibly also the limitations of assuming a 1D model in areas where the topography is quasi-2D/3D.

  1. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  2. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  3. Design data and safety features of commercial nuclear power plants including cumulative index for Volumes I--VI

    International Nuclear Information System (INIS)

    Heddleson, F.A.

    1977-01-01

    Design data, safety features, and site characteristics are summarized for 12 nuclear power units in 6 power stations in the United States. Six pages of data are presented for each station, consisting of thermal-hydraulic and nuclear factors, containment features, emergency-core-cooling systems, site features, circulating water system data, and miscellaneous factors. In addition, an aerial perspective is presented for each plant. This volume covers plants with docket numbers 50-553 through 50-569 (Phipps Bend, Black Fox, Yellow Creek, and NEP) and two earlier plants not previously reported--Hope Creek (50-354, 50-355) and WPPSS 1 and 4 (50-460, 50-513). Indexes for this volume and the five earlier volumes are presented in three forms--by docket number, by plant name, and by participating utility

  4. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  5. Complete cloacal duplication imaged before and during pregnancy.

    Science.gov (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi

    2009-01-01

    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  6. Benchmarking spliced alignment programs including Spaln2, an extended version of Spaln that incorporates additional species-specific features.

    Science.gov (United States)

    Iwata, Hiroaki; Gotoh, Osamu

    2012-11-01

    Spliced alignment plays a central role in the precise identification of eukaryotic gene structures. Even though many spliced alignment programs have been developed, recent rapid progress in DNA sequencing technologies demands further improvements in software tools. Benchmarking algorithms under various conditions is an indispensable task for the development of better software; however, there is a dire lack of appropriate datasets usable for benchmarking spliced alignment programs. In this study, we have constructed two types of datasets: simulated sequence datasets and actual cross-species datasets. The datasets are designed to correspond to various real situations, i.e. divergent eukaryotic species, different types of reference sequences, and the wide divergence between query and target sequences. In addition, we have developed an extended version of our program Spaln, which incorporates two additional features to the scoring scheme of the original version, and examined this extended version, Spaln2, together with the original Spaln and other representative aligners based on our benchmark datasets. Although the effects of the modifications are not individually striking, Spaln2 is consistently most accurate and reasonably fast in most practical cases, especially for plants and fungi and for increasingly divergent pairs of target and query sequences.

  7. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections.

    Science.gov (United States)

    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang

    2012-08-21

    Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 - 153,589,577) from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  8. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections

    Directory of Open Access Journals (Sweden)

    Xu Xiu

    2012-08-01

    Full Text Available Abstract Background Autistic spectrum disorders (ASDs are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 – 153,589,577 from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. Conclusions To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  9. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  10. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  11. Partial craniofacial duplication: a review of the literature and case report.

    Science.gov (United States)

    Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P

    2014-06-01

    Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.

  12. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  13. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  14. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  16. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  17. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  18. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  19. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  20. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  1. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  2. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  3. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  4. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  5. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  6. 17q12 deletion and duplication syndrome in Denmark-A clinical cohort of 38 patients and review of the literature

    DEFF Research Database (Denmark)

    Rasmussen, Maria; Vestergaard, Else Marie; Graakjaer, Jesper

    2016-01-01

    deletions and 26 phenotyped patients with 17q12 duplications. The total cohort includes 19 index patients and 19 family members. We also reviewed the literature in order to further improve the basis for the counseling. We emphasize that renal disease, learning disability, behavioral abnormalities, epilepsy...... a variable degree of learning disabilities, delayed language development, delayed motor milestones, and a broad range of psychiatric and neurological features. This patient group also included adults achieving an academic degree. Assessing index patients and non-index patients separately, our observations...... illustrate that an overall milder disease burden is seen, in particular in patients with 17q12 duplications who are ascertained on the duplication rather than the phenotype. This evidence may be useful in prenatal counseling...

  7. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.

    Science.gov (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat

    2015-08-01

    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  8. Dependency Parsing with Transformed Feature

    Directory of Open Access Journals (Sweden)

    Fuxiang Wu

    2017-01-01

    Full Text Available Dependency parsing is an important subtask of natural language processing. In this paper, we propose an embedding feature transforming method for graph-based parsing, transform-based parsing, which directly utilizes the inner similarity of the features to extract information from all feature strings including the un-indexed strings and alleviate the feature sparse problem. The model transforms the extracted features to transformed features via applying a feature weight matrix, which consists of similarities between the feature strings. Since the matrix is usually rank-deficient because of similar feature strings, it would influence the strength of constraints. However, it is proven that the duplicate transformed features do not degrade the optimization algorithm: the margin infused relaxed algorithm. Moreover, this problem can be alleviated by reducing the number of the nearest transformed features of a feature. In addition, to further improve the parsing accuracy, a fusion parser is introduced to integrate transformed and original features. Our experiments verify that both transform-based and fusion parser improve the parsing accuracy compared to the corresponding feature-based parser.

  9. MECP2 duplication phenotype in symptomatic females: report of three further cases

    OpenAIRE

    Novara, Francesca; Simonati, Alessandro; Sicca, Federico; Battini, Roberta; Fiori, Simona; Contaldo, Annarita; Criscuolo, Lucia; Zuffardi, Orsetta; Ciccone, Roberto

    2014-01-01

    Background Xq28 duplications, including MECP2 (methyl CpG-binding protein 2; OMIM 300005), have been identified in approximately 140 male patients presenting with hypotonia, severe developmental delay/intellectual disability, limited or absent speech and ambulation, and recurrent respiratory infections. Female patients with Xq28 duplication have been rarely reported and are usually asymptomatic. Altogether, only fifteen symptomatic females with Xq28 duplications including MECP2 have been repo...

  10. Array comparative genomic hybridization analysis of a familial duplication of chromosome 13q: A recognizable syndrome

    NARCIS (Netherlands)

    Mathijssen, Inge B.; Hoovers, Jan M. N.; Mul, Adri N. P. M.; Man, Hai-Yen; Ket, Jan L.; Hennekam, Raoul C. M.

    2005-01-01

    We report on a family with six persons in three generations who have mild mental retardation, behavioral problems, seizures, hearing loss, strabismus, dental anomalies, hypermobility, juvenile hallux valgus, and mild dysmorphic features. Classical cytogenetic analysis showed a partial duplication of

  11. What is included with your online e-cigarette order? An analysis of e-cigarette shipping, product and packaging features.

    Science.gov (United States)

    Kong, Amanda Y; Derrick, Jason C; Abrantes, Anthony S; Williams, Rebecca S

    2016-06-29

    The electronic cigarette industry is growing, with youth using e-cigarettes at higher rates than they are using cigarettes, and retail and online sales projected to reach $10 billion in 2017. Minimal regulation of the production and marketing of e-cigarettes exists to date, which has allowed companies to promote unsupported claims. We assessed the shipping, product features and packaging of a wide variety of e-cigarettes purchased online by adults and youth. The most popular internet e-cigarette vendors were identified from a larger study of internet tobacco vendors. Between August 2013 and June 2014, adults made 56 purchase attempts from online vendors, and youth made 98 attempts. Packages received were assessed for exterior and internal packaging features, including product information, health warnings and additional materials. We analysed a total of 125 orders featuring 86 unique brands of e-cigarettes. The contents were rarely indicated on package exteriors. Product information came with just 60% of orders and just 38.4% included an instruction manual. Only 44.6% of products included a health warning, and some had unsupported claims, such as lack of secondhand smoke exposure. Additionally, some products were leaking e-liquid and battery fluid on arrival. A large variety of e-cigarette products are manufactured and marketed to consumers. Many products do not include instructions for use, and unsupported claims are being presented to consumers. Effective federal regulation of the manufacturing, packaging, product information and health claims surrounding e-cigarettes is necessary to ensure consumers are presented with accurate e-cigarette use information. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  12. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  13. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  14. Oculocutaneous albinism in a patient with 17p13.2-pter duplication - a review on the molecular syndromology of 17p13 duplication.

    Science.gov (United States)

    Kucharczyk, Marzena; Jezela-Stanek, Aleksandra; Gieruszczak-Bialek, Dorota; Kugaudo, Monika; Cieslikowska, Agata; Pelc, Magdalena; Krajewska-Walasek, Malgorzata

    2015-06-01

    Chromosomal duplications involving 17p13.3 have recently been defined as a new distinctive syndrome with several diagnosed patients. Some variation is known to occur in the breakpoints of the duplicated region and, consequently, in the phenotype as well. We report on a patient, the fifth to our knowledge, a 4-year-old girl with a pure de novo subtelomeric 17p13.2-pter duplication. She presents all of the facial features described so far for this duplication and in addition, a unilateral palmar transversal crease and oculocutaneous albinism which has not been reported previously. A detailed molecular description of the reported aberration and correlation with the observed phenotypical features based on a literature review. We discuss the possible molecular etiology of albinism in regard to the mode of inheritance. The new data provided here may be useful for further genotype correlations in syndromes with oculocutaneous albinism, especially of autosomal dominant inheritance.

  15. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  17. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  18. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  19. Colonic duplication in adults: Report of two cases presenting with rectal bleeding

    Institute of Scientific and Technical Information of China (English)

    C Fotiadis; M Genetzakis; I Papandreou; EP Misiakos; E Agapitos; GC Zografos

    2005-01-01

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients,colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging,histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  20. Colonic duplication in adults: report of two cases presenting with rectal bleeding.

    Science.gov (United States)

    Fotiadis, C; Genetzakis, M; Papandreou, I; Misiakos, E P; Agapitos, E; Zografos, G C

    2005-08-28

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients, colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging, histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  1. Diprosopus (partially duplicated head) associated with anencephaly: a case report.

    Science.gov (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M

    1999-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  2. Local Chromatin Features Including PU.1 and IKAROS Binding and H3K4 Methylation Shape the Repertoire of Immunoglobulin Kappa Genes Chosen for V(DJ Recombination

    Directory of Open Access Journals (Sweden)

    Louise S. Matheson

    2017-11-01

    Full Text Available V(DJ recombination is essential for the generation of diverse antigen receptor (AgR repertoires. In B cells, immunoglobulin kappa (Igκ light chain recombination follows immunoglobulin heavy chain (Igh recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh, as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(DJ recombination and provide avenues for further investigation of chromatin signatures that may underpin V(DJ-mediated chromosomal translocations.

  3. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari

    2014-01-01

    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  4. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco

    2010-01-01

    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  5. Ten-year outcome including patterns of failure and toxicity for adjuvant whole abdominopelvic irradiation in high-risk and poor histologic feature patients with endometrial carcinoma

    International Nuclear Information System (INIS)

    Stewart, Kimberly D.; Martinez, Alvaro A.; Weiner, Sheldon; Podratz, Karl; Stromberg, Jannifer S.; Schray, Mark; Mitchell, Christina; Sherman, Alfred; Chen, Peter; Brabbins, Donald A.

    2002-01-01

    Purpose: To evaluate the long-term results of treatment using adjuvant whole abdominal irradiation (WAPI) with a pelvic/vaginal boost in patients with Stage I-III endometrial carcinoma at high risk of intra-abdominopelvic recurrence, including clear cell (CC) and serous-papillary (SP) histologic features. Methods and Materials: In a prospective nonrandomized trial, 119 patients were treated with adjuvant WAPI between November 1981 and April 2000. All patients were analyzed, including those who did not complete therapy. The mean age at diagnosis was 66 years (range 39-88). Thirty-eight patients (32%) had 1989 FIGO Stage I-II disease and 81 (68%) had Stage III. The pathologic features included the following: 64 (54%) with deep myometrial invasion, 48 (40%) with positive peritoneal cytologic findings, 69 (58%) with high-grade lesions, 21 (18%) with positive pelvic/para-aortic lymph nodes, and 44 (37%) with SP or CC histologic findings. Results: The mean follow-up was 5.8 years (range 0.2-14.7). For the entire group, the 5- and 10-year cause-specific survival (CSS) rate was 75% and 69% and the disease-free survival (DFS) rate was 58% and 48%, respectively. When stratified by histologic features, the 5- and 10-year CSS rate for adenocarcinoma was 76% and 71%, and for serous papillary/CC subtypes, it was 74% and 63%, respectively (p=0.917). The 5- and 10-year DFS rate for adenocarcinoma was 60% and 50% and was 54% and 37% serous papillary/CC subtypes, respectively (p=0.498). For surgical Stage I-II, the 5-year CSS rate was 82% for adenocarcinoma and 87% for SP/CC features (p=0.480). For Stage III, it was 75% and 57%, respectively (p=0.129). Thirty-seven patients had a relapse, with the first site of failure the abdomen/pelvis in 14 (38%), lung in 8 (22%), extraabdominal lymph nodes in 7 (19%), vagina in 6 (16%), and other in 2 (5%). When stratified by histologic variant, 32% of patients with adenocarcinoma and 30% with the SP/CC subtype developed recurrent disease. Most

  6. Craniofacial Duplication (Diprosopus) in the Cat — Case Report and Review of the Literature

    International Nuclear Information System (INIS)

    Sekeles, E.; Aharon, D.C.; Fass, U.

    1985-01-01

    A kitten displaying the features of symmetrical partial duplication of the head (diprosopus) is described. The morphological description of this double monster is compared to three previous similar cases. All four cases were similar in that duplication of the orbits and eyes were not completed and fission of the oral and nasal cavities and their contents were partial. Furthermore, the central nervous systems were duplicated as far caudal as the brain stem. Present case displayed cleft palate in the two faces, a feature that was not described earlier. Though diprosopus is a rare anomaly in cats, it is more common than in the dog, pig and sheep. In cattle, anterior duplications are one of the largest groups of congenital anomalies. Based on generally accepted considerations concerning the mechanism behind the formation of monozyous twins, conjoined twins and anterior duplications, integrated with experimental data on induction of duplications in animals, an hypothesis is proposed for early embryonic fission. It suggests a constant cleaving factor active along the median plane with affinity to midline structures. Its temporal relations with the developing embryo, especially in susceptible species, decide the degree and type of duplication

  7. The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability.

    Science.gov (United States)

    Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo

    2016-01-01

    1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication

  8. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  9. 11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.

    Science.gov (United States)

    Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata

    2015-06-01

    Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.

  10. A rare association of rectal and genitourinary duplication and anorectal malformation

    Institute of Scientific and Technical Information of China (English)

    王俊; 施诚仁; 余世耀; 吴燕; 徐长辉

    2003-01-01

    @@ It is very rare to see multiple malformations occurring in both the urogenital and digestive systems in a case of congenital anorectal malformation. In this particular care, an imperforated anus occurred with other multiple malformations, including a double kidney, urethral duplication and rectal duplication, etc.

  11. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  12. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  13. Duplicate Record Elimination in Large Data Files.

    Science.gov (United States)

    1981-08-01

    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  14. Different clinical presentations, diagnostic difficulties, and management of cecal duplication.

    Science.gov (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün

    2013-03-01

    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  16. Social network analysis of duplicative prescriptions: One-month analysis of medical facilities in Japan.

    Science.gov (United States)

    Takahashi, Yoshimitsu; Ishizaki, Tatsuro; Nakayama, Takeo; Kawachi, Ichiro

    2016-03-01

    Duplicative prescriptions refer to situations in which patients receive medications for the same condition from two or more sources. Health officials in Japan have expressed concern about medical "waste" resulting from this practices. We sought to conduct descriptive analysis of duplicative prescriptions using social network analysis and to report their prevalence across ages. We analyzed a health insurance claims database including 1.24 million people from December 2012. Through social network analysis, we examined the duplicative prescription networks, representing each medical facility as nodes, and individual prescriptions for patients as edges. The prevalence of duplicative prescription for any drug class was strongly correlated with its frequency of prescription (r=0.90). Among patients aged 0-19, cough and colds drugs showed the highest prevalence of duplicative prescriptions (10.8%). Among people aged 65 and over, antihypertensive drugs had the highest frequency of prescriptions, but the prevalence of duplicative prescriptions was low (0.2-0.3%). Social network analysis revealed clusters of facilities connected via duplicative prescriptions, e.g., psychotropic drugs showed clustering due to a few patients receiving drugs from 10 or more facilities. Overall, the prevalence of duplicative prescriptions was quite low - less than 10% - although the extent of the problem varied by drug class and age group. Our approach illustrates the potential utility of using a social network approach to understand these practices. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  18. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  19. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  20. Rectal duplication cyst in a cat.

    Science.gov (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio

    2010-12-01

    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  1. [Rectal duplication cyst--case report].

    Science.gov (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J

    2009-06-01

    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  2. A large duplication involving the IHH locus mimics acrocallosal syndrome.

    Science.gov (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd

    2012-06-01

    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  5. Fenestrations and Various Duplications of the Posterior Communicating Artery in the Prenatal and Postnatal Periods.

    Science.gov (United States)

    Trandafilović, Milena; Vasović, Ljiljana; Vlajković, Slobodan; Đorđević, Gordana; Stojanović, Borisav; Mladenović, Marija

    2016-07-01

    The 2 paired arteries-the posterior communicating arteries (PCoAs) and the precommunicating parts of the posterior cerebral arteries-form the so-called posterior segment of the cerebral arterial circle on the base of the brain. A number of (ab)normal morphologic features were described in the literature (e.g., unusual kinking, or extreme elongations, hypoplasia, duplications, fenestrations, the infundibular widening, or aplasia of the PCoA in the prenatal and/or postnatal periods). The aim of this study was to analyze an incidence of various fenestrations and duplications of the PCoA, and describe their general features and their association with other vascular abnormalities. The research was performed on the brains of 200 human fetuses and 377 adult cadavers of both genders and different ages using microdissection and macrodissection methods. There were 0.34% cases with PCoA fenestrations and 3.12% cases with various PCoA duplications. Their morphologic features were described and compared with the similar PCoA abnormalities recorded in the scientific literature. There was no association between the PCoA and either duplication or aneurysm in adult cases. After thorough examination, the fenestrations and duplications of the PCoA are distinguished as 2 special forms of vascular abnormalities, and the PCoA duplications are characterized as partial and total. Furthermore, whereas the low incidence of a fenestration of the PCoA suggests it to be a sufficiently rare phenomenon, the duplications of the PCoA trunk are fairly frequent, especially concerning its terminal segment. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A case with concurrent duplication, triplication, and uniparental isodisomy at 1q42.12-qter supporting microhomology-mediated break-induced replication model for replicative rearrangements.

    Science.gov (United States)

    Kohmoto, Tomohiro; Okamoto, Nana; Naruto, Takuya; Murata, Chie; Ouchi, Yuya; Fujita, Naoko; Inagaki, Hidehito; Satomura, Shigeko; Okamoto, Nobuhiko; Saito, Masako; Masuda, Kiyoshi; Kurahashi, Hiroki; Imoto, Issei

    2017-01-01

    Complex genomic rearrangements (CGRs) consisting of interstitial triplications in conjunction with uniparental isodisomy (isoUPD) have rarely been reported in patients with multiple congenital anomalies (MCA)/intellectual disability (ID). One-ended DNA break repair coupled with microhomology-mediated break-induced replication (MMBIR) has been recently proposed as a possible mechanism giving rise to interstitial copy number gains and distal isoUPD, although only a few cases providing supportive evidence in human congenital diseases with MCA have been documented. Here, we report on the chromosomal microarray (CMA)-based identification of the first known case with concurrent interstitial duplication at 1q42.12-q42.2 and triplication at 1q42.2-q43 followed by isoUPD for the remainder of chromosome 1q (at 1q43-qter). In distal 1q duplication/triplication overlapping with 1q42.12-q43, variable clinical features have been reported, and our 25-year-old patient with MCA/ID presented with some of these frequently described features. Further analyses including the precise mapping of breakpoint junctions within the CGR in a sequence level suggested that the CGR found in association with isoUPD in our case is a triplication with flanking duplications, characterized as a triplication with a particularly long duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) structure. Because microhomology was observed in both junctions between the triplicated region and the flanking duplicated regions, our case provides supportive evidence for recently proposed replication-based mechanisms, such as MMBIR, underlying the formation of CGRs + isoUPD implicated in chromosomal disorders. To the best of our knowledge, this is the first case of CGRs + isoUPD observed in 1q and having DUP-TRP/INV-DUP structure with a long proximal duplication, which supports MMBIR-based model for genomic rearrangements. Molecular cytogenetic analyses using CMA containing single

  7. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2015-01-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case. PMID:28018799

  8. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction.

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2016-12-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case.

  9. A case of asymptomatic ileal duplication cyst associated with acute appendicitis

    Directory of Open Access Journals (Sweden)

    Hülya İpek

    2017-07-01

    Full Text Available Duplications of the alimentary tract are infrequent anomalies. They are most frequently located in the terminal ileum, and majority of them became symptomatic before the age of 2. Presenting symptoms may include abdominal mass, intestinal obstruction, intussusception, rectal bleeding, and abdominal pain. Preoperative diagnosis is usually difficult, intra-abdominal duplications are usually diagnosed during surgical explorations of above complications. We presented a 12-year-old girl with asymptomatic ileal duplication cyst associated with non-complicated acute appendicitis, whose imaging studies at admission were compatible with complicated perforated appendicitis.

  10. [Total tubular colonic duplication in a neonate with rectal bleeding: value of the endoscopy in the diagnose and treatment].

    Science.gov (United States)

    Piñera, M J Guirao; Morote, J M Sánchez; Bermejo, J P Hernández; Vallejo, O Girón; Alberca, F; Ruiz, S Chacón; Serradilla, J L Roqués; Carmona, G A Zambudio; Cantó, M A Gutiérrez

    2007-01-01

    Gastrointestinal duplication is an infrequent congenital abnormality. Colonic and tubular duplications are the least common. In neonates there are few described cases. It's difficult to identify the duplication preoperatively and a standard surgical approach has not been developped. We report a neonate with bleeding of the digestive tube who presented a colonic duplication who required multiple diagnostic test before the diagnosis was made for colonoscopy. Laparotomy showed a total tubular duplication of the right, transverse and left colon with proximal and distal communication. Exclusion of the duplicated segment was performed, but three months after the operation, subocclusion due to stenosis of the colonic distal loop was developed. This finding was confirmed by a second colonoscopy and septum was partially removed. The study implies that CD, though uncommon, should be included in the differential diagnosis of rectal bleeding and the importance of the colonoscopy in the diagnosis and treatment of this malformation.

  11. Duplication of Key Frames of Video Streams in Wireless Networks

    OpenAIRE

    Sagatov, Evgeny S.; Sukhov, Andrei M.

    2011-01-01

    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  12. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1971-10-15

    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  13. [Intestinal volvulus due to yeyunal duplication].

    Science.gov (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L

    2014-10-01

    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  14. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William

    2010-01-01

    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  15. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  16. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  17. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  18. Using sea urchin gametes and zygotes to investigate centrosome duplication.

    Science.gov (United States)

    Sluder, Greenfield

    2016-01-01

    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  19. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  20. Is a Picture Worth a Thousand Words? Few Evidence-Based Features of Dietary Interventions Included in Photo Diet Tracking Mobile Apps for Weight Loss.

    Science.gov (United States)

    Hales, Sarah; Dunn, Caroline; Wilcox, Sara; Turner-McGrievy, Gabrielle M

    2016-11-01

    Apps using digital photos to track dietary intake and provide feedback are common, but currently there has been no research examining what evidence-based strategies are included in these apps. A content analysis of mobile apps for photo diet tracking was conducted, including whether effective techniques for interventions promoting behavior change, including self-regulation, for healthy eating (HE) are targeted. An initial search of app stores yielded 34 apps (n = 8 Android and Apple; n = 11 Android; n = 15 Apple). One app was removed (unable to download), and other apps (n = 4) were unable to be rated (no longer available). Remaining apps (n = 29) were downloaded, reviewed, and coded by 2 independent reviewers to determine the number of known effective self-regulation and other behavior change techniques included. The raters met to compare their coding of the apps, calculate interrater agreement, resolve any discrepancies, and come to a consensus. Six apps (21%) did not utilize any of the behavior change techniques examined. Three apps (10%) provided feedback to users via crowdsourcing or collective feedback from other users and professionals, 7 apps (24%) used crowdsourcing or collective feedback, 1 app (3%) used professionals, and 18 apps (62%) did not provide any dietary feedback to users. Few photo diet-tracking apps include evidence-based strategies to improve dietary intake. Use of photos to self-monitor dietary intake and receive feedback has the potential to reduce user burden for self-monitoring, yet photo diet tracking apps need to incorporate known effective behavior strategies for HE, including self-regulation. © 2016 Diabetes Technology Society.

  1. Quantitative fluorescence-polymerase chain reaction assay for the detection of the duplication of the Charcot Marie Tooth disease type 1A critical region.

    Science.gov (United States)

    De Toffol, Simona; Bellone, Emilia; Dulcetti, Francesca; Ruggeri, Anna Maria; Maggio, Pietro Paolo; Pulimeno, Maria Rosaria; Mandich, Paola; Maggi, Federico; Simoni, Giuseppe; Grati, Francesca Romana

    2010-04-01

    Charcot Marie Tooth (CMT) syndrome is the most common hereditary peripheral neuropathy, with an incidence of about 1 in 2500. The subtype 1A (CMT1A) is caused by a tandem duplication of a 1.5-Mb region encompassing the PMP22 gene. Conventional short tandem repeat (STR) analysis can reveal this imbalance if a triallelic pattern, defining with certainty the presence of duplication, is present. In case of duplication with a biallelic pattern, it can only indicate a semiquantitative dosage of the fluorescence intensity ratio of the two fragments. In this study we developed a quantitative fluorescence-PCR using seven highly informative STRs within the CMT1A critical region that successfully disclosed or excluded the presence of the pathogenic imbalance in a cohort of 60 samples including 40 DNAs from samples with the CMT1A duplication previously characterized with two different molecular approaches, and 20 diagnostic samples from 10 members of a five-generation pedigree segregating CMT1A, 8 unrelated cases and 2 prenatal samples. The application of the quantitative fluorescence-PCR using STRs located in the critical region could be a reliable method to evaluate the presence of the PMP22 duplication for the diagnosis and classification of hereditary neuropathies in asymptomatic subjects with a family history of inherited neuropathy, in prenatal samples in cases with one affected parent, and in unrelated patients with a sporadic demyelinating neuropathy with clinical features resembling CMT (i.e., pes cavus with hammer toes) or with conduction velocities in the range of CMT1A.

  2. Deletions in 16p13 including GRIN2A in patients with intellectual disability, various dysmorphic features, and seizure disorders of the rolandic region.

    NARCIS (Netherlands)

    Reutlinger, C.; Helbig, I.; Gawelczyk, B.; Subero, J.I.; Tonnies, H.; Muhle, H.; Finsterwalder, K.; Vermeer, S.; Pfundt, R.; Sperner, J.; Stefanova, I.; Gillessen-Kaesbach, G.; Spiczak, S. von; Baalen, A. van; Boor, R.; Siebert, R.; Stephani, U.; Caliebe, A.

    2010-01-01

    Seizure disorders of the rolandic region comprise a spectrum of different epilepsy syndromes ranging from benign rolandic epilepsy to more severe seizure disorders including atypical benign partial epilepsy/pseudo-Lennox syndrome,electrical status epilepticus during sleep, and Landau-Kleffner

  3. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  4. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  5. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  6. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  7. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  8. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem

    2018-05-01

    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  9. Acute abdominal pain presenting as a rare appendiceal duplication: a case report

    Directory of Open Access Journals (Sweden)

    Mahmood Ali

    2012-03-01

    Full Text Available Abstract Introduction Appendiceal duplication is a rare anomaly that can manifest as right lower quadrant pain. There are several variations described for this condition. We recommend aggressive operative management should this anatomical variation present in the presence of acute appendicitis. Case presentation We report the case of a 15-year-old African American girl who presented to our hospital with right lower quadrant pain and was subsequently found to have appendiceal duplication. Conclusion There are two categorical systems that have described and stratified appendiceal duplication. Both classification systems have been outlined and referenced in this case report. A computed tomography scan has been included to provide a visual aid to help identify true vermiform appendiceal duplication. The presence of this anatomical abnormality is not a reason for surgical intervention; however, should this be found in the setting of acute appendicitis, aggressive resection of both appendices is mandatory.

  10. Fine mapping of a de novo interstitial 10q22-q23 duplication in a patient with congenital heart disease and microcephaly

    DEFF Research Database (Denmark)

    Erdogan, F; Belloso, J M; Gabau, E

    2008-01-01

    deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22...

  11. Thalamic Massa Intermedia Duplication in a Dysmorphic 14 month-old Toddler.

    Science.gov (United States)

    Whitehead, Matthew T

    2015-06-01

    The massa intermedia is an inconstant parenchymal band connecting the medial thalami. It may be thickened in various disease processes such as Chiari II malformation or absent in other disease states. However, the massa intermedia may also be absent in up to 30% of normal human brains. To the best of my knowledge, detailed imaging findings of massa intermedia duplication have only been described in a single case report. An additional case of thalamic massa intermedia duplication discovered on a routine brain MR performed for dysmorphic facial features is reported herein.

  12. Partial facial duplication (diprosopus) in a goat kid.

    Science.gov (United States)

    Mukaratirwa, S; Sayi, S T

    2006-03-01

    The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  13. Partial facial duplication (diprosopus in a goat kid : clinical communication

    Directory of Open Access Journals (Sweden)

    S. Mukaratirwa

    2006-06-01

    Full Text Available The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  14. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)

    2013-01-15

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  15. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun

    2013-01-01

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  16. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko

    2009-01-01

    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  18. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  19. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  20. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  1. Incidence of Data Duplications in a Randomly Selected Pool of Life Science Publications.

    Science.gov (United States)

    Oksvold, Morten P

    2016-04-01

    Since the solution to many public health problems depends on research, it is critical for the progress and well-being for the patients that we can trust the scientific literature. Misconduct and poor laboratory practice in science threatens the scientific progress, leads to loss of productivity and increased healthcare costs, and endangers lives of patients. Data duplication may represent one of challenges related to these problems. In order to estimate the frequency of data duplication in life science literature, a systematic screen through 120 original scientific articles published in three different cancer related journals [journal impact factor (IF) 20] was completed. The study revealed a surprisingly high proportion of articles containing data duplication. For the IF 20 journals, 25% of the articles were found to contain data duplications. The IF 5-10 journal showed a comparable proportion (22.5%). The proportion of articles containing duplicated data was comparable between the three journals and no significant correlation to journal IF was found. The editorial offices representing the journals included in this study and the individual authors of the detected articles were contacted to clarify the individual cases. The editorial offices did not reply and only 1 out of 29 cases were apparently clarified by the authors, although no supporting data was supplied. This study questions the reliability of life science literature, it illustrates that data duplications are widespread and independent of journal impact factor and call for a reform of the current peer review and retraction process of scientific publishing.

  2. Duplicate study on the dietary intake of PCDD/F by small children from Germany

    International Nuclear Information System (INIS)

    Wittsiepe, J.; Schrey, P.; Schmidt, E.; Wilhelm, M.

    2002-01-01

    The dietary intake of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/F) by 42 small children at the age of 14 to 47 months was measured by the duplicate method. The children were living in urban or rural areas of Northrhine-Westphalia, Germany, and had different food consumption behaviour. The duplicates were collected over a period of seven days between May and September 1998. The PCDD/F-levels in the food duplicates were in the range of 39.2 to 325 pg I-TEq/kg dry weight (median: 90.7; arithmetic mean: 96.6). The doses were between 0.681 and 5.43 pg I-TEq/(kg body weight day) with a median of 1.56 and an arithmetric mean of 1.60. The aspired limit of 1 pg I-TEq/(kg body weight . day) was exceeded by most children. Food duplicates of children living in an urban industrialized area with food consumption including products from the family owned vegetable gardens or the surrounding area and/or products from domestic animals showed no statistically significant different PCDD/F-concentrations, calculated as I-TEq, than food duplicates of children living in a rural area with similar food consumption behavior or than food duplicates of children consuming exclusively food from the supermarket. The same was observed for the calculated intake rates of PCDD/F. Efforts to reduce the contamination of food with PCDD/F should be continued. (orig.) [de

  3. Cosmic abundances: The impact of stellar duplicity

    OpenAIRE

    Jorissen, A.; Van Eck, S.

    2004-01-01

    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  4. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  5. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  6. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung

    2004-01-01

    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  7. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder

    2016-01-01

    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  8. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  9. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  10. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  11. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  12. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook

    2003-01-01

    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  13. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  14. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  15. Deep Constrained Siamese Hash Coding Network and Load-Balanced Locality-Sensitive Hashing for Near Duplicate Image Detection.

    Science.gov (United States)

    Hu, Weiming; Fan, Yabo; Xing, Junliang; Sun, Liang; Cai, Zhaoquan; Maybank, Stephen

    2018-09-01

    We construct a new efficient near duplicate image detection method using a hierarchical hash code learning neural network and load-balanced locality-sensitive hashing (LSH) indexing. We propose a deep constrained siamese hash coding neural network combined with deep feature learning. Our neural network is able to extract effective features for near duplicate image detection. The extracted features are used to construct a LSH-based index. We propose a load-balanced LSH method to produce load-balanced buckets in the hashing process. The load-balanced LSH significantly reduces the query time. Based on the proposed load-balanced LSH, we design an effective and feasible algorithm for near duplicate image detection. Extensive experiments on three benchmark data sets demonstrate the effectiveness of our deep siamese hash encoding network and load-balanced LSH.

  16. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  17. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  18. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2016-01-01

    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  19. NASAwide electronic publishing system: Electronic printing and duplicating, stage-2 evaluation report (GSFC)

    Science.gov (United States)

    Tuey, Richard C.; Lane, Robert; Hart, Susan V.

    1995-01-01

    The NASA Scientific and Technical Information Office was assigned the responsibility to continue with the expansion of the NASAwide networked electronic duplicating effort by including the Goddard Space Flight Center (GSFC) as an additional node to the existing configuration of networked electronic duplicating systems within NASA. The subject of this report is the evaluation of a networked electronic duplicating system which meets the duplicating requirements and expands electronic publishing capabilities without increasing current operating costs. This report continues the evaluation reported in 'NASA Electronic Publishing System - Electronic Printing and Duplicating Evaluation Report' (NASA TM-106242) and 'NASA Electronic Publishing System - Stage 1 Evaluation Report' (NASA TM-106510). This report differs from the previous reports through the inclusion of an external networked desktop editing, archival, and publishing functionality which did not exist with the previous networked electronic duplicating system. Additionally, a two-phase approach to the evaluation was undertaken; the first was a paper study justifying a 90-day, on-site evaluation, and the second phase was to validate, during the 90-day evaluation, the cost benefits and productivity increases that could be achieved in an operational mode. A benchmark of the functionality of the networked electronic publishing system and external networked desktop editing, archival, and publishing system was performed under a simulated daily production environment. This report can be used to guide others in determining the most cost effective duplicating/publishing alternative through the use of cost/benefit analysis and return on investment techniques. A treatise on the use of these techniques can be found by referring to 'NASA Electronic Publishing System -Cost/Benefit Methodology' (NASA TM-106662).

  20. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira

    2014-11-01

    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  1. Concomitant urethral triplication, bladder, and colon duplication.

    Science.gov (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi

    2012-02-01

    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  2. A case of de novo duplication of 15q24-q26.3

    Directory of Open Access Journals (Sweden)

    Hye Ran Kim

    2011-06-01

    Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.

  3. An effective detection algorithm for region duplication forgery in digital images

    Science.gov (United States)

    Yavuz, Fatih; Bal, Abdullah; Cukur, Huseyin

    2016-04-01

    Powerful image editing tools are very common and easy to use these days. This situation may cause some forgeries by adding or removing some information on the digital images. In order to detect these types of forgeries such as region duplication, we present an effective algorithm based on fixed-size block computation and discrete wavelet transform (DWT). In this approach, the original image is divided into fixed-size blocks, and then wavelet transform is applied for dimension reduction. Each block is processed by Fourier Transform and represented by circle regions. Four features are extracted from each block. Finally, the feature vectors are lexicographically sorted, and duplicated image blocks are detected according to comparison metric results. The experimental results show that the proposed algorithm presents computational efficiency due to fixed-size circle block architecture.

  4. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  5. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  6. Spinal Accessory Nerve Duplication: A Case Report and Literature Review

    OpenAIRE

    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios

    2018-01-01

    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  7. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)

    2009-12-15

    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  8. A duplication of the mouth associated with a dysontogenic cyst: a case report and discussion of theories of origin.

    Science.gov (United States)

    Mews, Lorissa; Isaac, Andre; Leonard, Norma; Lacson, Atilano G; AlQudehy, Zeinab Ali; El-Hakim, Hamdy

    2014-05-01

    IMPORTANCE Diprosopus is a medical condition that refers to full or partial craniofacial duplication. A particular subset of this condition, duplication of the mouth, is an exceedingly rare condition, with 7 reported cases in the medical literature. The embryogenesis and mechanism of disease are not well understood. The objective of this report was to describe a case of partial facial duplication with a discussion of the previous literature, leading to a proposed theory of embryogenesis for this rare anomaly. OBSERVATIONS We present a rare case of duplication of the mouth associated with an intraoral dysontogenic cyst, which presented with upper airway obstruction. The diagnostic and management strategies are discussed, as well as the histopathological features and theories of embryogenesis. CONCLUSIONS AND RELEVANCE On the basis of our findings, we propose the mechanism of origin for duplication of the mouth to be duplication of the first branchial arch. This case offers a deeper understanding of the mechanism of this disease than previously reported. Additional basic science and clinical research is needed to corroborate this theory.

  9. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha

    2009-07-01

    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  10. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  11. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  12. Conjoined twin piglets with duplicated cranial and caudal axes.

    Science.gov (United States)

    McManus, C A; Partlow, G D; Fisher, K R

    1994-06-01

    Twins with doubling of the cranial and caudal poles, yet having a single thorax, are rare. One set of diprosopus, dipygus porcine conjoined twins was studied. In addition to the conjoining anomaly, these twins also exhibited ambiguous internal reproductive features. The twins had two snouts, three eyes, a single thorax, and were duplicated from the umbilicus caudally. Radiography indicated a single vertebral column in the cervical region. The vertebral columns were separate caudally from this point. There was a total of six limbs--one pair of forelimbs and two pairs of hindlimbs. Many medial structures failed to develop in these twins. Medial cranial nerves V-XII were absent or displaced although apparently normal laterally. The medial palates were present but shortened, whereas the medial mandibular rami had folded back on themselves rostrally to form a midline mass between the two chins. Each twin had only one lateral kidney and one lateral testis. Medial scrotal sacs were present but devoid of a testis. There was a midline, "uterine"-like structure which crossed between the twins. However, histological analysis of this structure revealed it to be dysplastic testicular tissue. The relationship between the abnormal reproductive features in these twins and the conjoining is unclear. The anatomy of these twins, in addition to the literature reviewed, illustrates the internal anatomical heterogeneity of grossly similar conjoined twins. A review of the literature also suggests that conjoined twinning may be more common in swine than was previously suspected.

  13. NASA wide electronic publishing system: Electronic printing and duplicating. Stage 3 evaluation report

    Science.gov (United States)

    Tuey, Richard C.; Moore, Fred W.; Ryan, Christine A.

    1995-01-01

    The report is presented in four sections: The Introduction describes the duplicating configuration under evaluation and the Background contains a chronological description of the evaluation segmented by phases 1 and 2. This section includes the evaluation schedule, printing and duplicating requirements, storage and communication requirements, electronic publishing system configuration, existing processes and proposed processes, billing rates, costs and productivity analysis, and the return on investment based upon the data gathered to date. The third section contains the phase 1 comparative cost and productivity analysis. This analysis demonstrated that LaRC should proceed with a 90-day evaluation of the DocuTech and follow with a phase 2 cycle to actually demonstrate that the proposed system would meet the needs of LaRC's printing and duplicating requirements, benchmark results, cost comparisons, benchmark observations, and recommendations. These are documented after the recommendations.

  14. Analysis of DuPont and Kodak duplicating films and chemistries in a Fultron spray processor

    Science.gov (United States)

    Weinstein, M. S.

    1972-01-01

    A test program was conducted with duPont duplicating film type SR 112 and SCOLOR developer and Kodak duplicating film types 2430, 2422, and FE 2628 (SO-467) and MX-641 developer to determine sensitometric and image quality characteristics of these materials when used with a fultron spray processor. The test results show that the SCOLOR developer foams excessively in the fultron processor when used with or without the addition of an antifoaming agent. The Kodak type FE 2628 film with MX-641 chemistry had the longest linear Log E range at a 1.0 gamma. Sensitometric curves and granularity traces for all film process combinations tested are included.

  15. The Centrosome and Its Duplication Cycle

    Science.gov (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.

    2015-01-01

    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  16. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  17. Solar Features

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of solar feature datasets contributed by a number of national and private solar observatories located worldwide.

  18. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  19. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  20. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho

    2002-01-01

    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  1. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  2. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  3. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  4. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki

    2015-01-01

    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  5. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜

    1983-01-01

    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  6. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate.

    Science.gov (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun

    2010-03-01

    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  7. Rectal duplication cyst: a combined abdominal and endoanal operative approach.

    Science.gov (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri

    2007-04-01

    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  8. Ruptured rectal duplication with urogenital abnormality: Unusual presentation.

    Science.gov (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh

    2015-01-01

    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  9. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  10. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly.

    Science.gov (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag

    2017-02-01

    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  11. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  12. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.

    Science.gov (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon

    2011-12-01

    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  13. Endoscopic ultrasonography and rectal duplication cyst in an adult.

    Science.gov (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S

    2017-01-01

    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  14. Local Chromatin Features Including PU.1 and IKAROS Binding and H3K4 Methylation Shape the Repertoire of Immunoglobulin Kappa Genes Chosen for V(D)J Recombination.

    Science.gov (United States)

    Matheson, Louise S; Bolland, Daniel J; Chovanec, Peter; Krueger, Felix; Andrews, Simon; Koohy, Hashem; Corcoran, Anne E

    2017-01-01

    V(D)J recombination is essential for the generation of diverse antigen receptor (AgR) repertoires. In B cells, immunoglobulin kappa ( Igκ ) light chain recombination follows immunoglobulin heavy chain ( Igh ) recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS) of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh , as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(D)J recombination and provide avenues for further investigation of chromatin signatures that may underpin V(D)J-mediated chromosomal translocations.

  15. Fate of males with urethral "Y-duplication": 40-year long follow-up in 8 patients.

    Science.gov (United States)

    Lima, Mario; Destro, Francesca; Di Salvo, Neil; Gargano, Tommaso; Ruggeri, Giovanni

    2017-08-01

    The spectrum of male urethral duplication is heterogeneous and it includes the Y-duplication. The malformation is rare and there is only a few case series reported in the literature. The management of Y-forms remains challenging for the surgeon and the long-term follow-up is still scarcely investigated. We report our 40-year experience in the management of patients with Y-duplication. We conducted a restrospective analysis collecting information of patients with urethral Y-duplication treated at our department from April 1975 to April 2015. We investigated long-term effects of surgery by using a questionnaire. Ten male patients with Y-duplication came to our attention. One was treated conservatively, seven underwent surgery and two were lost. Surgery consisted of removal of the ectopic branch (via perineal or ASTRA/anterior sagittal trans-rectal approach approach) and reconstruction of the orthotopic urethra. Post-operative complications included stenosis and infections. Long-term results are influenced by associated anomalies and significant problems (incontinence, urinary tract infections and orchiepididimitis) have been reported. Y-duplication (or λ-duplication, as we prefer calling it) is a particular form of urethral duplication. The management of patients should be based upon the identification of the functional channel. The removal of the ectopic channel with ASTRA approach is safe and feasible. On the other hand, the reconstruction of the anterior urethra (when steno-atresic) is more challenging and justifies the need for many procedures. The P.A.D.U.A. (progressive augmentation by dilating the anterior urethra) technique was not effective. Skin tube grafts were responsible for infections ("hairy urethra"). BMFG (bladder mucosa free graft) urethroplasty is a good alternative, although associated with well-known complications. Associated anomalies influence long-term outcomes. Clinical study with type IV level of evidence. Copyright © 2016 Elsevier Inc

  16. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  17. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  18. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  19. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  20. The Prevalence of Inappropriate Image Duplication in Biomedical Research Publications

    Science.gov (United States)

    Casadevall, Arturo; Fang, Ferric C.

    2016-01-01

    ABSTRACT Inaccurate data in scientific papers can result from honest error or intentional falsification. This study attempted to determine the percentage of published papers that contain inappropriate image duplication, a specific type of inaccurate data. The images from a total of 20,621 papers published in 40 scientific journals from 1995 to 2014 were visually screened. Overall, 3.8% of published papers contained problematic figures, with at least half exhibiting features suggestive of deliberate manipulation. The prevalence of papers with problematic images has risen markedly during the past decade. Additional papers written by authors of papers with problematic images had an increased likelihood of containing problematic images as well. As this analysis focused only on one type of data, it is likely that the actual prevalence of inaccurate data in the published literature is higher. The marked variation in the frequency of problematic images among journals suggests that journal practices, such as prepublication image screening, influence the quality of the scientific literature. PMID:27273827

  1. MURCS Association with Partial Duplication of the Distal Long Chromosome 5 and Unilateral Ovarian Agenesis

    Directory of Open Access Journals (Sweden)

    Anna Dabkowska-Huc

    2013-01-01

    Full Text Available A combination of the congenital abnormalities, Müllerian duct aplasia, renal aplasia, and cervicothoracic somite dysplasia, is defined as the MURCS association. Various genetic defects have been described in the MURCS association so far, yet the unambiguous molecular basis of these disorders has not been established. We report the case of an 18-year-old woman who presented with primary amenorrhea, right kidney, Arnold-Chiari malformation, and Klippel-Feil syndrome. In addition, the patient showed the following unusual features: right ovarian and Skenes gland agenesis, cubitus valgus with hyperextension and decreased range of motion at elbows, and facial changes. Moreover, the performed DNA analysis showed interstitial duplication in chromosome 5 (5q35.1. In the duplicated region, there are genes whose function is not well known. It is thought that they have an influence on the early stages of development and their joining in the later period can lead to neoplastic disorders, especially leukemias.

  2. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  3. Reciprocal duplication of the Williams-Beuren syndrome deletion on chromosome 7q11.23 is associated with schizophrenia.

    Science.gov (United States)

    Mulle, Jennifer Gladys; Pulver, Ann E; McGrath, John A; Wolyniec, Paula S; Dodd, Anne F; Cutler, David J; Sebat, Jonathan; Malhotra, Dheeraj; Nestadt, Gerald; Conrad, Donald F; Hurles, Matthew; Barnes, Chris P; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F; Gejman, Pablo V; Sanders, Alan R; Duan, Jubao; Mitchell, Adele A; Peter, Inga; Sklar, Pamela; O'Dushlaine, Colm T; Grozeva, Detelina; O'Donovan, Michael C; Owen, Michael J; Hultman, Christina M; Kähler, Anna K; Sullivan, Patrick F; Kirov, George; Warren, Stephen T

    2014-03-01

    Several copy number variants (CNVs) have been implicated as susceptibility factors for schizophrenia (SZ). Some of these same CNVs also increase risk for autism spectrum disorders, suggesting an etiologic overlap between these conditions. Recently, de novo duplications of a region on chromosome 7q11.23 were associated with autism spectrum disorders. The reciprocal deletion of this region causes Williams-Beuren syndrome. We assayed an Ashkenazi Jewish cohort of 554 SZ cases and 1014 controls for genome-wide CNV. An excess of large rare and de novo CNVs were observed, including a 1.4 Mb duplication on chromosome 7q11.23 identified in two unrelated patients. To test whether this 7q11.23 duplication is also associated with SZ, we obtained data for 14,387 SZ cases and 28,139 controls from seven additional studies with high-resolution genome-wide CNV detection. We performed a meta-analysis, correcting for study population of origin, to assess whether the duplication is associated with SZ. We found duplications at 7q11.23 in 11 of 14,387 SZ cases with only 1 in 28,139 control subjects (unadjusted odds ratio 21.52, 95% confidence interval: 3.13-922.6, p value 5.5 × 10(-5); adjusted odds ratio 10.8, 95% confidence interval: 1.46-79.62, p value .007). Of three SZ duplication carriers with detailed retrospective data, all showed social anxiety and language delay premorbid to SZ onset, consistent with both human studies and animal models of the 7q11.23 duplication. We have identified a new CNV associated with SZ. Reciprocal duplication of the Williams-Beuren syndrome deletion at chromosome 7q11.23 confers an approximately tenfold increase in risk for SZ. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  4. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2011-02-01

    Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.

  5. Gastric duplication cyst: A cause of rectal bleeding in a young child.

    Science.gov (United States)

    Surridge, Clare A; Goodier, Matthew D

    2014-01-01

    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  6. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge

    2014-01-01

    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  7. Partial duplication of head--a rare congenital anomaly.

    Science.gov (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass

    2004-10-01

    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  8.  Hypertelorism in Charcot-Marie-Tooth disease 1A from the common PMP22 duplication: A Case Report

    Directory of Open Access Journals (Sweden)

    Josef Finsterer

    2012-03-01

    Full Text Available  The 1.4Mb tandem-duplication in the PMP22 gene at 17p11.2 usually manifests as hereditary sensorimotor polyneuropathy with foot deformity, sensorineural hearing-loss, moderate developmental delay, and gait disturbance. Hypertelorism and marked phenotypic variability within a single family has not been reported. In a single family, the PMP22 tandem-duplication manifested as short stature, sensorimotor polyneuropathy, tremor, ataxia, sensorineural hearing-loss, and hypothyroidism in the 27 years-old index case, as mild facial dysmorphism, muscle cramps, tinnitus, intention tremor, bradydiadochokinesia, and sensorimotor polyneuropathy in the 31 year-old half-brother of the index-patient, and as sensorimotor polyneuropathy and foot deformityin the father of the two. The half-brother additionally presented with hypertelorism, not previously reported in PMP22tandem-duplication carriers. The presented cases show that the tandem-duplication 17p11.2 may present with marked intra-familialphenotype variability and that mild facial dysmorphism with stuck-out ears and hypertelorism may be a rare phenotypic feature of this mutation. The causal relation between facial dysmorphism and the PMP22 tandem-duplication, however, remains speculative.

  9. First case of a vermiform appendix duplication type A volvulus: A very rare cause of acute abdomen

    Directory of Open Access Journals (Sweden)

    Gustavo H. Peniche González

    2015-09-01

    Full Text Available The duplication of the vermiform appendix is a rare anatomical variant. Most of the cases reported with symptomatology of appendicitis and the finding of a duplication of vermiform appendix. A seven year old female, with abdominal septic shock, plain abdominal radiography with distended transverse intestinal loop with air-fluid levels and absence of air in distal colon and rectal ampula. Emergency laparotomy was performed finding a blind loop with secondary necrosis volvulus, with the torsion being at the base of the duplication, connected at the middle portion of the vermiform appendix; desvolvulus and resection was performed in a block fashion with Parker-Kerr technique using a 4-0 polyglactin suture. There are 100 cases of duplication of appendix reported worldwide. In our case, a duplication of the vermiform appendix type A was presented, shown by the surgical findings and corroborated by pathology samples of intestinal tissue featuring smooth muscle tissue and transmural necrosis and fibrinopurulent exudate in serous.

  10. Meiotic UV-sensitive mutant that causes deletion of duplications in neurospora

    International Nuclear Information System (INIS)

    Newmeyer, D.; Galeazzi, D.R.

    1978-01-01

    The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) when homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to uv, (3) its growth is inhibited by histidine, and (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25 0 ; the effects on sensitivity to uv and to histidine are expressed strongly at 38.5 0 but only slightly at 25 0 . Nevertheless, all four effects were shown to be due to a single gene. Mei-3 is not allelic with previously reported uv-sensitive mutants. Two other results were obtained that are not necessarily due to mei-3: (1) a cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to uv or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant to mei-3. Mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a uv-sensitive mutant could cause such precise deletions

  11. Diphallus with imperforate anus and complete duplication of recto-sigmoid colon and lower urinary tract.

    Science.gov (United States)

    Mirshemirani, Alireza; Roshanzamir, Fatollah; Shayeghi, Shahnaz; Mohajerzadeh, Leily; Hasas-Yeganeh, Shaghayegh

    2010-06-01

    Diphallus is a rare anomaly and accompanying anomalies vary from bifid scrotum, bladder exstrophy, imperforate anus and colo-rectal anomaly such as duplication, and other associated anomalies. A 2-day old infant is reported with imperforate anus and complete duplication of recto-sigmoid colon, rectal pouch, doubling of the genitalia with completely formed penis (diphallus), double bladder, urethra and hypospadias. No family history of abnormalities was noted. The patient underwent several operations: laparatory and colostomy at 3rd day of life, and after clinical and paraclinical investigations, cystoplasty, ureteral reimplantation and resection of left phallus were carried out when 4 months old. At the age of 1 year, after colostogram and total colon evaluation, laparatomy, resection of duplicated recto-sigmoid colon, and pull-through was carried out; 3 months later colostomy closure was performed and the patient discharged without complications. The patients with diphallus have to be examined carefully because of the high incidence of other systemic anomalies. Treatment of diphallus usually includes excision of the duplicated penile structure, its urethra, and repair of associated anomalies.

  12. Diphallus with Imperforate Anus and Complete Duplication of Recto-Sigmoid Colon and Lower Urinary Tract

    Science.gov (United States)

    Mirshemirani, Alireza; Roshanzamir, Fatollah; Shayeghi, Shahnaz; Mohajerzadeh, Leily; Hasas-yeganeh, Shaghayegh

    2010-01-01

    Background Diphallus is a rare anomaly and accompanying anomalies vary from bifid scrotum, bladder exstrophy, imperforate anus and colo-rectal anomaly such as duplication, and other associated anomalies. Case Presentation A 2-day old infant is reported with imperforate anus and complete duplication of recto-sigmoid colon, rectal pouch, doubling of the genitalia with completely formed penis (diphallus), double bladder, urethra and hypospadias. No family history of abnormalities was noted. The patient underwent several operations: laparatory and colostomy at 3rd day of life, and after clinical and paraclinical investigations, cystoplasty, ureteral reimplantation and resection of left phallus were carried out when 4 months old. At the age of 1 year, after colostogram and total colon evaluation, laparatomy, resection of duplicated recto-sigmoid colon, and pull-through was carried out; 3 months later colostomy closure was performed and the patient discharged without complications. Conclusion The patients with diphallus have to be examined carefully because of the high incidence of other systemic anomalies. Treatment of diphallus usually includes excision of the duplicated penile structure, its urethra, and repair of associated anomalies. PMID:23056710

  13. No significant effect of monosomy for distal 21q22. 3 on the Down syndrom phenotype in mirror' duplications of chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Pangalos, C.; Prieur, M.; Rethore, M.O.; Lejeune, J. (Institut de Progenese, Paris (France)); Theophile, D.; Sinet, P.M.; Chettouh, Z.; Delabar, J.M. (Hopital Necker Enfants Malades, Paris (France)); Marks, A. (Univ. of Toronto, Ontario (Canada)); Stamboulieh-Abazis, D. (Diagnostic Genetic Center, Athens (Greece)); Verellen, C. (Centre de Genetique Humaine, Brussels (Belgium))

    1992-12-01

    Three Down syndrome patients for whom karyotypic analysis showed a mirror' (reverse tandem) duplication of chromosome 21 were studied by phenotypic, cytogenetic, and molecular methods. On high-resolution R-banding analysis performed in two cases, the size of the fusion 21q22.3 band was apparently less than twice the size of the normal 21q22.3, suggesting a partial deletion of distal 21q. The evaluation of eight chromosome 21 single-copy sequences of the 21q22 region - namely, SOD1, D21S15, D21S42, CRYA1, PFKL, CD18, COL6A1, and S100B - by a slot blot method showed in all three cases a partial deletion of 21q22.3 and partial monosomy. The translocation breakpoints were different in each patient, and in two cases the rearranged chromosome was found to be asymmetrical. The molecular definition of the monosomy 21 in each patient was, respectively, COL6A1-S100B, CD18-S100B, and PFKL-S100B. DNA polymorphism analysis indicated in all cases a homozygosity of the duplicated material. The duplicated region was maternal in two patients and paternal in one patient. These data suggest that the reverse tandem chromosomes did not result from a telomeric fusion between chromosomes 21 but from a translocation between sister chromatids. The phenotypes of these patients did not differ significantly from that of individuals with full trisomy 21, except in one case with large ears with an unfolded helix. The fact that monosomy of distal 21q22.3 in these patients resulted in a phenotype very similar to Down syndrome suggests that the duplication of the genes located in this part of chromosome 21 is not necessary for the pathogenesis of the Down syndrome features observed in these patients, including most of the facial and hand features, muscular hypotonia, cardiopathy of the Fallot tetralogy type, and part of the mental retardation. 54 refs., 5 figs., 3 tabs.

  14. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  15. Obstetric significance of fetal craniofacial duplication. A case report.

    Science.gov (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H

    1985-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  16. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  17. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  18. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  19. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  20. Duplicate laboratory test reduction using a clinical decision support tool.

    Science.gov (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice

    2014-05-01

    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  1. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  2. Crh and Oprm1 mediate anxiety-related behavior and social approach in a mouse model of MECP2 duplication syndrome.

    Science.gov (United States)

    Samaco, Rodney C; Mandel-Brehm, Caleigh; McGraw, Christopher M; Shaw, Chad A; McGill, Bryan E; Zoghbi, Huda Y

    2012-01-08

    Genomic duplications spanning Xq28 are associated with a spectrum of phenotypes, including anxiety and autism. The minimal region shared among affected individuals includes MECP2 and IRAK1, although it is unclear which gene when overexpressed causes anxiety and social behavior deficits. We report that doubling MECP2 levels causes heightened anxiety and autism-like features in mice and alters the expression of genes that influence anxiety and social behavior, such as Crh and Oprm1. To test the hypothesis that alterations in these two genes contribute to heightened anxiety and social behavior deficits, we analyzed MECP2 duplication mice (MECP2-TG1) that have reduced Crh and Oprm1 expression. In MECP2-TG1 animals, reducing the levels of Crh or its receptor, Crhr1, suppressed anxiety-like behavior; in contrast, reducing Oprm1 expression improved abnormal social behavior. These data indicate that increased MeCP2 levels affect molecular pathways underlying anxiety and social behavior and provide new insight into potential therapies for MECP2-related disorders.

  3. Duplicate Health Insurance Coverage: Determinants of Variation Across States

    OpenAIRE

    Luft, Harold S.; Maerki, Susan C.

    1982-01-01

    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  4. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)

    1995-11-20

    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  5. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey

    2013-01-01

    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  6. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  7. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  8. An unusual presentation of a rectal duplication cyst.

    Science.gov (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D

    2012-01-01

    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  9. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  10. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin

    2018-06-01

    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  11. Identification of approximately duplicate material records in ERP systems

    Science.gov (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic

    2017-03-01

    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  12. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  13. Williams syndrome deletions and duplications: Genetic windows to understanding anxiety, sociality, autism, and schizophrenia.

    Science.gov (United States)

    Crespi, Bernard J; Procyshyn, Tanya L

    2017-08-01

    We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)

    1995-12-31

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  15. Neutral Evolution of Duplicated DNA: An Evolutionary Stick-Breaking Process Causes Scale-Invariant Behavior

    Science.gov (United States)

    Massip, Florian; Arndt, Peter F.

    2013-04-01

    Recently, an enrichment of identical matching sequences has been found in many eukaryotic genomes. Their length distribution exhibits a power law tail raising the question of what evolutionary mechanism or functional constraints would be able to shape this distribution. Here we introduce a simple and evolutionarily neutral model, which involves only point mutations and segmental duplications, and produces the same statistical features as observed for genomic data. Further, we extend a mathematical model for random stick breaking to analytically show that the exponent of the power law tail is -3 and universal as it does not depend on the microscopic details of the model.

  16. Genetic diversity and population structure inferred from the partially duplicated genome of domesticated carp, Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Feldman Marcus W

    2007-04-01

    Full Text Available Abstract Genetic relationships among eight populations of domesticated carp (Cyprinus carpio L., a species with a partially duplicated genome, were studied using 12 microsatellites and 505 AFLP bands. The populations included three aquacultured carp strains and five ornamental carp (koi variants. Grass carp (Ctenopharyngodon idella was used as an outgroup. AFLP-based gene diversity varied from 5% (grass carp to 32% (koi and reflected the reasonably well understood histories and breeding practices of the populations. A large fraction of the molecular variance was due to differences between aquacultured and ornamental carps. Further analyses based on microsatellite data, including cluster analysis and neighbor-joining trees, supported the genetic distinctiveness of aquacultured and ornamental carps, despite the recent divergence of the two groups. In contrast to what was observed for AFLP-based diversity, the frequency of heterozygotes based on microsatellites was comparable among all populations. This discrepancy can potentially be explained by duplication of some loci in Cyprinus carpio L., and a model that shows how duplication can increase heterozygosity estimates for microsatellites but not for AFLP loci is discussed. Our analyses in carp can help in understanding the consequences of genotyping duplicated loci and in interpreting discrepancies between dominant and co-dominant markers in species with recent genome duplication.

  17. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report.

    Science.gov (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S

    2007-01-01

    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  18. Identifying significant environmental features using feature recognition.

    Science.gov (United States)

    2015-10-01

    The Department of Environmental Analysis at the Kentucky Transportation Cabinet has expressed an interest in feature-recognition capability because it may help analysts identify environmentally sensitive features in the landscape, : including those r...

  19. Germline or somatic GPR101 duplication leads to X-linked acrogigantism: a clinico-pathological and genetic study.

    Science.gov (United States)

    Iacovazzo, Donato; Caswell, Richard; Bunce, Benjamin; Jose, Sian; Yuan, Bo; Hernández-Ramírez, Laura C; Kapur, Sonal; Caimari, Francisca; Evanson, Jane; Ferraù, Francesco; Dang, Mary N; Gabrovska, Plamena; Larkin, Sarah J; Ansorge, Olaf; Rodd, Celia; Vance, Mary L; Ramírez-Renteria, Claudia; Mercado, Moisés; Goldstone, Anthony P; Buchfelder, Michael; Burren, Christine P; Gurlek, Alper; Dutta, Pinaki; Choong, Catherine S; Cheetham, Timothy; Trivellin, Giampaolo; Stratakis, Constantine A; Lopes, Maria-Beatriz; Grossman, Ashley B; Trouillas, Jacqueline; Lupski, James R; Ellard, Sian; Sampson, Julian R; Roncaroli, Federico; Korbonits, Márta

    2016-06-01

    Non-syndromic pituitary gigantism can result from AIP mutations or the recently identified Xq26.3 microduplication causing X-linked acrogigantism (XLAG). Within Xq26.3, GPR101 is believed to be the causative gene, and the c.924G > C (p.E308D) variant in this orphan G protein-coupled receptor has been suggested to play a role in the pathogenesis of acromegaly.We studied 153 patients (58 females and 95 males) with pituitary gigantism. AIP mutation-negative cases were screened for GPR101 duplication through copy number variation droplet digital PCR and high-density aCGH. The genetic, clinical and histopathological features of XLAG patients were studied in detail. 395 peripheral blood and 193 pituitary tumor DNA samples from acromegaly patients were tested for GPR101 variants.We identified 12 patients (10 females and 2 males; 7.8 %) with XLAG. In one subject, the duplicated region only contained GPR101, but not the other three genes in found to be duplicated in the previously reported patients, defining a new smallest region of overlap of duplications. While females presented with germline mutations, the two male patients harbored the mutation in a mosaic state. Nine patients had pituitary adenomas, while three had hyperplasia. The comparison of the features of XLAG, AIP-positive and GPR101&AIP-negative patients revealed significant differences in sex distribution, age at onset, height, prolactin co-secretion and histological features. The pathological features of XLAG-related adenomas were remarkably similar. These tumors had a sinusoidal and lobular architecture. Sparsely and densely granulated somatotrophs were admixed with lactotrophs; follicle-like structures and calcifications were commonly observed. Patients with sporadic of familial acromegaly did not have an increased prevalence of the c.924G > C (p.E308D) GPR101 variant compared to public databases.In conclusion, XLAG can result from germline or somatic duplication of GPR101. Duplication of GPR101

  20. [Anterior rectal duplication in adult patient: a case report].

    Science.gov (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E

    2009-01-01

    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  1. Penile Duplication and Two Anal Openings; Report of a Very Rare Case

    OpenAIRE

    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad

    2012-01-01

    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  2. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  3. Plk4-dependent phosphorylation of STIL is required for centriole duplication

    Directory of Open Access Journals (Sweden)

    Anne-Sophie Kratz

    2015-02-01

    Full Text Available Duplication of centrioles, namely the formation of a procentriole next to the parental centriole, is regulated by the polo-like kinase Plk4. Only a few other proteins, including STIL (SCL/TAL1 interrupting locus, SIL and Sas-6, are required for the early step of centriole biogenesis. Following Plk4 activation, STIL and Sas-6 accumulate at the cartwheel structure at the initial stage of the centriole assembly process. Here, we show that STIL interacts with Plk4 in vivo. A STIL fragment harboring both the coiled-coil domain and the STAN motif shows the strongest binding affinity to Plk4. Furthermore, we find that STIL is phosphorylated by Plk4. We identified Plk4-specific phosphorylation sites within the C-terminal domain of STIL and show that phosphorylation of STIL by Plk4 is required to trigger centriole duplication.

  4. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  5. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  6. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  7. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  8. Rectal duplication cyst in an adult: the laparoscopic approach.

    Science.gov (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles

    2002-12-01

    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  9. Comprehensive review of the duplication 3q syndrome and report of a patient with Currarino syndrome and de novo duplication 3q26.32-q27.2.

    Science.gov (United States)

    Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M

    2017-05-01

    Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook

    2006-01-01

    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  11. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani

    2016-01-01

    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  12. Ruptured rectal duplication cyst with classical bladder exstrophy.

    Science.gov (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh

    2010-07-01

    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.

    1998-01-01

    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  14. Multimodality characterization of a noncommunicating congenital duodenal duplication cyst causing pyloric outflow obstruction in a young dog.

    Science.gov (United States)

    Mutascio, Liliana; Vilaplana Grosso, Federico; Ramos-Vara, José; Simons, Micha

    2017-05-11

    A 10-month-old German Shepherd Dog presented for evaluation of intermittent vomiting. Abdominal radiographs revealed a marked right cranial mass effect. Initial differentials included abscess/cyst or less likely neoplasia from undetermined origin. On abdominal ultrasound the mass appeared cystic and thin walled. Computed tomography revealed a large cystic lesion originating from the pyloroduodenal junction causing pyloric outflow obstruction. A noncommunicating duodenal duplication cyst was found on exploratory laparotomy and further confirmed with histopathology and immunohistochemistry. Enteric duplication cyst should be considered as a differential in young dogs with gastrointestinal signs and a cystic abdominal mass detected with different imaging modalities. © 2017 American College of Veterinary Radiology.

  15. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  16. Neurodevelopmental and neurobehavioral characteristics in males and females with CDKL5 duplications.

    Science.gov (United States)

    Szafranski, Przemyslaw; Golla, Sailaja; Jin, Weihong; Fang, Ping; Hixson, Patricia; Matalon, Reuben; Kinney, Daniel; Bock, Hans-Georg; Craigen, William; Smith, Janice L; Bi, Weimin; Patel, Ankita; Wai Cheung, Sau; Bacino, Carlos A; Stankiewicz, Paweł

    2015-07-01

    Point mutations and genomic deletions of the CDKL5 (STK9) gene on chromosome Xp22 have been reported in patients with severe neurodevelopmental abnormalities, including Rett-like disorders. To date, only larger-sized (8-21 Mb) duplications harboring CDKL5 have been described. We report seven females and four males from seven unrelated families with CDKL5 duplications 540-935 kb in size. Three families of different ethnicities had identical 667kb duplications containing only the shorter CDKL5 isoform. Four affected boys, 8-14 years of age, and three affected girls, 6-8 years of age, manifested autistic behavior, developmental delay, language impairment, and hyperactivity. Of note, two boys and one girl had macrocephaly. Two carrier mothers of the affected boys reported a history of problems with learning and mathematics while at school. None of the patients had epilepsy. Similarly to CDKL5 mutations and deletions, the X-inactivation pattern in all six studied females was random. We hypothesize that the increased dosage of CDKL5 might have affected interactions of this kinase with its substrates, leading to perturbation of synaptic plasticity and learning, and resulting in autistic behavior, developmental and speech delay, hyperactivity, and macrocephaly.

  17. Caudal duplication syndrome: imaging evaluation of a rare entity in an adult patient

    Directory of Open Access Journals (Sweden)

    Tianshen Hu, BS

    2016-03-01

    Full Text Available Several theories have been put forth to explain the complex yet symmetrical malformations and the myriad of clinical presentations of caudal duplication syndrome. Hereby, reported case is a 28-year-old female, gravida 2 para 2, with congenital caudal malformation who has undergone partial reconstructive surgeries in infancy to connect her 2 colons. She presented with recurrent left lower abdominal pain associated with nausea, vomiting, and subsequent feculent anal discharge. Imaging reveals duplication of the urinary bladder, urethra, and colon with with cloacal malformations and fistulae from the left-sided cloaca, uterus didelphys with separate cervices and vaginal canals, right-sided aortic arch and descending thoracic aorta, and dysraphic midline sacrococcygeal defect. Hydronephrosis of the left kidney with left hydroureter and inflammation of one of the colons were suspected to be the cause of the patient’s acute complaints. She improved symptomatically over the course of her hospitalization stay with conservative treatments. The management for this syndrome is individualized and may include surgical intervention to fuse or excise the duplicated organs.

  18. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  19. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.

    Science.gov (United States)

    Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E

    2006-09-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.

  20. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  1. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  2. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  3. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Evolution of Rosaceae Fruit Types Based on Nuclear Phylogeny in the Context of Geological Times and Genome Duplication.

    Science.gov (United States)

    Xiang, Yezi; Huang, Chien-Hsun; Hu, Yi; Wen, Jun; Li, Shisheng; Yi, Tingshuang; Chen, Hongyi; Xiang, Jun; Ma, Hong

    2017-02-01

    Fruits are the defining feature of angiosperms, likely have contributed to angiosperm successes by protecting and dispersing seeds, and provide foods to humans and other animals, with many morphological types and important ecological and agricultural implications. Rosaceae is a family with ∼3000 species and an extraordinary spectrum of distinct fruits, including fleshy peach, apple, and strawberry prized by their consumers, as well as dry achenetum and follicetum with features facilitating seed dispersal, excellent for studying fruit evolution. To address Rosaceae fruit evolution and other questions, we generated 125 new transcriptomic and genomic datasets and identified hundreds of nuclear genes to reconstruct a well-resolved Rosaceae phylogeny with highly supported monophyly of all subfamilies and tribes. Molecular clock analysis revealed an estimated age of ∼101.6 Ma for crown Rosaceae and divergence times of tribes and genera, providing a geological and climate context for fruit evolution. Phylogenomic analysis yielded strong evidence for numerous whole genome duplications (WGDs), supporting the hypothesis that the apple tribe had a WGD and revealing another one shared by fleshy fruit-bearing members of this tribe, with moderate support for WGDs in the peach tribe and other groups. Ancestral character reconstruction for fruit types supports independent origins of fleshy fruits from dry-fruit ancestors, including the evolution of drupes (e.g., peach) and pomes (e.g., apple) from follicetum, and drupetum (raspberry and blackberry) from achenetum. We propose that WGDs and environmental factors, including animals, contributed to the evolution of the many fruits in Rosaceae, which provide a foundation for understanding fruit evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  6. Duplication of lower lip and mandible--a rare diprosopus.

    Science.gov (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R

    2011-01-01

    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  8. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  9. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.

    1983-01-01

    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  10. Cryptorchidism due to chromosome 5q inversion duplication.

    Science.gov (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  11. Verification and characterization of chromosome duplication in haploid maize.

    Science.gov (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

    2015-06-26

    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  12. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso

    2014-08-01

    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  13. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy.

    Science.gov (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis

    2013-09-21

    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  14. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.

    1986-01-01

    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  15. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction.

    Science.gov (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D

    1997-07-01

    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  16. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  17. 48 CFR 1352.231-71 - Duplication of effort.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  18. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.

    1949-01-01

    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  19. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  20. 10 CFR 9.35 - Duplication fees.

    Science.gov (United States)

    2010-01-01

    ...) Microfiche-to-paper reproduction is $0.30 per page. Aperture card blowback to paper is $3.00 per square foot..., Rockville, Maryland, may be found on the NRC's Web site at http://www.nrc.gov/reading-rm/pdr/copy-service...: (i) Paper-to-paper reproduction is $0.30 per page for standard size (up to and including 11″ × 14...

  1. Online feature selection with streaming features.

    Science.gov (United States)

    Wu, Xindong; Yu, Kui; Ding, Wei; Wang, Hao; Zhu, Xingquan

    2013-05-01

    We propose a new online feature selection framework for applications with streaming features where the knowledge of the full feature space is unknown in advance. We define streaming features as features that flow in one by one over time whereas the number of training examples remains fixed. This is in contrast with traditional online learning methods that only deal with sequentially added observations, with little attention being paid to streaming features. The critical challenges for Online Streaming Feature Selection (OSFS) include 1) the continuous growth of feature volumes over time, 2) a large feature space, possibly of unknown or infinite size, and 3) the unavailability of the entire feature set before learning starts. In the paper, we present a novel Online Streaming Feature Selection method to select strongly relevant and nonredundant features on the fly. An efficient Fast-OSFS algorithm is proposed to improve feature selection performance. The proposed algorithms are evaluated extensively on high-dimensional datasets and also with a real-world case study on impact crater detection. Experimental results demonstrate that the algorithms achieve better compactness and higher prediction accuracy than existing streaming feature selection algorithms.

  2. Centrobin-centrosomal protein 4.1-associated protein (CPAP) interaction promotes CPAP localization to the centrioles during centriole duplication.

    Science.gov (United States)

    Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan

    2014-05-30

    Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Centrobin-Centrosomal Protein 4.1-associated Protein (CPAP) Interaction Promotes CPAP Localization to the Centrioles during Centriole Duplication*

    Science.gov (United States)

    Gudi, Radhika; Zou, Chaozhong; Dhar, Jayeeta; Gao, Qingshen; Vasu, Chenthamarakshan

    2014-01-01

    Centriole duplication is the process by which two new daughter centrioles are generated from the proximal end of preexisting mother centrioles. Accurate centriole duplication is important for many cellular and physiological events, including cell division and ciliogenesis. Centrosomal protein 4.1-associated protein (CPAP), centrosomal protein of 152 kDa (CEP152), and centrobin are known to be essential for centriole duplication. However, the precise mechanism by which they contribute to centriole duplication is not known. In this study, we show that centrobin interacts with CEP152 and CPAP, and the centrobin-CPAP interaction is critical for centriole duplication. Although depletion of centrobin from cells did not have an effect on the centriolar levels of CEP152, it caused the disappearance of CPAP from both the preexisting and newly formed centrioles. Moreover, exogenous expression of the CPAP-binding fragment of centrobin also caused the disappearance of CPAP from both the preexisting and newly synthesized centrioles, possibly in a dominant negative manner, thereby inhibiting centriole duplication and the PLK4 overexpression-mediated centrosome amplification. Interestingly, exogenous overexpression of CPAP in the centrobin-depleted cells did not restore CPAP localization to the centrioles. However, restoration of centrobin expression in the centrobin-depleted cells led to the reappearance of centriolar CPAP. Hence, we conclude that centrobin-CPAP interaction is critical for the recruitment of CPAP to procentrioles to promote the elongation of daughter centrioles and for the persistence of CPAP on preexisting mother centrioles. Our study indicates that regulation of CPAP levels on the centrioles by centrobin is critical for preserving the normal size, shape, and number of centrioles in the cell. PMID:24700465

  4. Saskatchewan resources. [including uranium

    Energy Technology Data Exchange (ETDEWEB)

    1979-09-01

    The production of chemicals and minerals for the chemical industry in Saskatchewan are featured, with some discussion of resource taxation. The commodities mentioned include potash, fatty amines, uranium, heavy oil, sodium sulfate, chlorine, sodium hydroxide, sodium chlorate and bentonite. Following the successful outcome of the Cluff Lake inquiry, the uranium industry is booming. Some developments and production figures for Gulf Minerals, Amok, Cenex and Eldorado are mentioned.

  5. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  6. X-linked congenital ptosis and associated intellectual disability, short stature, microcephaly, cleft palate, digital and genital abnormalities define novel Xq25q26 duplication syndrome

    DEFF Research Database (Denmark)

    Møller, R S; Jensen, L R; Maas, S M

    2014-01-01

    , hypogonadism and feeding difficulties. Female carriers are often phenotypically normal or show a similar but milder phenotype, as in most cases the X-chromosome harbouring the duplication is subject to inactivation. Xq28, which includes MECP2 is the major locus for submicroscopic X-chromosome duplications......, whereas duplications in Xq25 and Xq26 have been reported in only a few cases. Using genome-wide array platforms we identified overlapping interstitial Xq25q26 duplications ranging from 0.2 to 4.76 Mb in eight unrelated families with in total five affected males and seven affected females. All affected...... males shared a common phenotype with intrauterine- and postnatal growth retardation and feeding difficulties in childhood. Three had microcephaly and two out of five suffered from epilepsy. In addition, three males had a distinct facial appearance with congenital bilateral ptosis and large protruding...

  7. Recent Duplication and Functional Divergence in Parasitic Nematode Levamisole-Sensitive Acetylcholine Receptors.

    Directory of Open Access Journals (Sweden)

    Thomas B Duguet

    2016-07-01

    Full Text Available Helminth parasites rely on fast-synaptic transmission in their neuromusculature to experience the outside world and respond to it. Acetylcholine plays a pivotal role in this and its receptors are targeted by a wide variety of both natural and synthetic compounds used in human health and for the control of parasitic disease. The model, Caenorhabditis elegans is characterized by a large number of acetylcholine receptor subunit genes, a feature shared across the nematodes. This dynamic family is characterized by both gene duplication and loss between species. The pentameric levamisole-sensitive acetylcholine receptor has been characterized from C. elegans, comprised of five different subunits. More recently, cognate receptors have been reconstituted from multiple parasitic nematodes that are found to vary in subunit composition. In order to understand the implications of receptor composition change and the origins of potentially novel drug targets, we investigated a specific example of subunit duplication based on analysis of genome data for 25 species from the 50 helminth genome initiative. We found multiple independent duplications of the unc-29, acetylcholine receptor subunit, where codon substitution rate analysis identified positive, directional selection acting on amino acid positions associated with subunit assembly. Characterization of four gene copies from a model parasitic nematode, Haemonchus contortus, demonstrated that each copy has acquired unique functional characteristics based on phenotype rescue of transgenic C. elegans and electrophysiology of receptors reconstituted in Xenopus oocytes. We found evidence that a specific incompatibility has evolved for two subunits co-expressed in muscle. We demonstrated that functional divergence of acetylcholine receptors, driven by directional selection, can occur more rapidly than previously thought and may be mediated by alteration of receptor assembly. This phenomenon is common among the

  8. The genomic distribution of intraspecific and interspecific sequence divergence of human segmental duplications relative to human/chimpanzee chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Eichler Evan E

    2008-08-01

    Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.

  9. T-Cell Lymphopenia Detected by Newborn Screening in Two Siblings with an Xq13.1 Duplication

    Directory of Open Access Journals (Sweden)

    Xavier Rios

    2017-07-01

    Full Text Available Newborn screening for severe combined immunodeficiency has proven successful in identifying infants with T-cell deficiencies before they become severely ill. Additionally, the newborn screen can detect subtle early phenotypes that may become severe later in life. We present the case of siblings with features suggestive of T-cell lymphopenia identified as having low T-cell receptor excision circles counts by newborn screening. Expanded immune testing showed robust lymphocyte mitogen and antigen responses with normal vaccine responses and immunoglobulin levels for both boys over time. Genetic analysis revealed an Xq13.1 duplication in each child not found in the mother. The variant is downstream of the IL2RG gene with potential regulatory significance, suggesting a mechanism for the T-cell lymphopenia. The newborn screen provided these patients heightened surveillance and patient-specific management, including delayed live vaccines and Pneumocystis jiroveci pneumonia prophylaxis. Fortunately, the brothers have not suffered invasive or opportunistic infections and are well at ages 3 and 4 years. In this report, we illustrate the challenges of managing seemingly asymptomatic immunodeficient patients without a definitive genetic diagnosis and show how unbiased genetic analysis can expand understanding about primary immunodeficiency phenotypes.

  10. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  11. Water Distribution Lines, Includes water pipes (not connections to structures, fire hydrants and other features. Capture in Microstation and does not contain attribution. Has annotation and is converted to GIS semi-anually. Only available upon permission., Published in 2011, 1:2400 (1in=200ft) scale, Howard County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Water Distribution Lines dataset current as of 2011. Includes water pipes (not connections to structures, fire hydrants and other features. Capture in Microstation...

  12. Characterization of a complex rearrangement involving duplication and deletion of 9p in an infant with craniofacial dysmorphism and cardiac anomalies

    Directory of Open Access Journals (Sweden)

    Di Bartolo Daniel L

    2012-07-01

    Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.

  13. A patient with de-novo partial deletion of Xp (p11.4-pter) and partial duplication of 22q (q11.2-qter).

    Science.gov (United States)

    Armour, Christine M; McGowan-Jordan, Jean; Lawrence, Sarah E; Bouchard, Amélie; Basik, Mark; Allanson, Judith E

    2008-01-01

    We report on a girl with partial deletion of Xp and partial duplication of 22q. Family studies demonstrate that both the patient's mother and her nonidentical twin sister carry the corresponding balanced translocation; 46,X,t(X;22)(p11.4;q11.2). This girl has developmental delay, microcephaly, mild dysmorphisms and hearing loss but otherwise shows few of the features described in individuals with duplications of the long arm of chromosome 22. She does manifest characteristics, such as short stature and biochemical evidence of ovarian failure, which are seen in partial or complete Xp deletions and Turner's syndrome.

  14. A de novo 11p12-p15.4 duplication in a patient with pharmacoresistant epilepsy, mental retardation, and dysmorphisms.

    Science.gov (United States)

    Coppola, Antonietta; Striano, Pasquale; Gimelli, Stefania; Ciampa, Clotilde; Santulli, Lia; Caranci, Ferdinando; Zuffardi, Orsetta; Gimelli, Giorgio; Striano, Salvatore; Zara, Federico

    2010-03-01

    We report a 22-year-old male patient with pharmacoresistant epilepsy, mental retardation and dysmorphisms. Standard cytogenetic analysis revealed a de novo interstitial duplication of the short arm of chromosome 11 (11p). High density array-CGH analysis showed that the rearrangement spans about 35Mb on chromosome 11p12-p15.4. Duplications of 11p are rare and usually involve the distal part of the chromosome arm (11p15), being not associated with epilepsy, whereas our patient showed a unique epileptic phenotype associated with mental retardation and dysmorphic features. The role of some rearranged genes in epilepsy pathogenesis in this patient is also discussed.

  15. Nasal Duplication Combined with Cleft Lip and Palate: Surgical Correction and Long-Term Follow-Up.

    Science.gov (United States)

    Long, Kanharith; Yamaguchi, Kazuaki; Lonic, Daniel; Long, Vanna; Chhoeurn, Vuthy; Lo, Lun-Jou

    2017-10-01

    Diprosopus dirrhinus, or nasal duplication, is a rare entity of partial craniofacial duplication. The case we present is the first report of diprosopus dirrhinus associated with complete cleft lip and palate. The baby was born in Cambodia at full term by normal vaginal delivery with no significant perinatal and family history. Physical examination revealed significant facial deformity due to the duplicated nose and the left complete cleft lip/palate on the right subset. There were 4 nostrils; both medial apertures including the cleft site were found to be 10-15 mm deep cul-de-sac structures without communication to the nasopharynx. The upper third of the face was notable for hypertelorism with a duplication of the soft-tissue nasion and glabella. Between the 2 nasal dorsums, there was a small cutaneous depression with a lacrimal fistula in the midline. Surgical treatment included the first stage of primary lip and nose repair and the second stage of palatoplasty. The patient was followed up at the age of 10 years showing satisfactory results for both aesthetic and functional aspects. Further management in the future will be required for the hypertelorism and nasal deformity.

  16. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  17. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  18. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  19. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan

    2016-01-01

    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  20. Development of a Repeatable Protocol to Uniformly Coat Internal Complex Geometries of Fine Featured 3D Printed Objects with Ceramic Material, including Determination of Viscosity Limits to Properly Coat Certain Pore Sizes

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-05-18

    HEPA filters are commonly used in air filtration systems ranging in application from simple home systems to the more advanced networks used in research and development. Currently, these filters are most often composed of glass fibers with diameter on the order of one micron with polymer binders. These fibers, as well as the polymers used, are known to be fragile and can degrade or become extremely brittle with heat, severely limiting their use in high temperature applications. Ceramics are one promising alternative and can enhance the filtration capabilities compared to the current technology. Because ceramic materials are more thermally resistant and chemically stable, there is great interest in developing a repeatable protocol to uniformly coat fine featured polymer objects with ceramic material for use as a filter. The purpose of this experiment is to determine viscosity limits that are able to properly coat certain pore sizes in 3D printed objects, and additionally to characterize the coatings themselves. Latex paint was used as a surrogate because it is specifically designed to produce uniform coatings.

  1. Rectal duplications accompanying rectovestibular fistula: report of two cases.

    Science.gov (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur

    2013-08-01

    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  2. Recurrent rectal prolapse caused by colonic duplication in a dog.

    Science.gov (United States)

    Landon, B P; Abraham, L A; Charles, J A; Edwards, G A

    2007-09-01

    A 9-month-old female Shar Pei cross-bred dog was presented with a history of recurrent rectal prolapse over 7 months. Repeated reduction and anal purse string sutures and subsequent incisional colopexy failed to prevent recurrent rectal prolapse. Digital rectal examination following reduction of the prolapse identified a faeces-filled sac within the ventral wall of the rectum and an orifice in the ventral colonic wall, cranial to the pubic brim. A ventral, communicating tubular colonic duplication was diagnosed by means of a barium enema. Surgical excision of the duplicated colonic tube was performed via a caudal ventral midline laparotomy. At 20 weeks post-operation, there has been no recurrence of rectal prolapse.

  3. Reversion in variants from a duplication strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Menezes, E.M.; Azevedo, J.L.

    1978-01-01

    Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de

  4. Duplication of the glans penis manifested at puberty.

    Science.gov (United States)

    Gentileschi, S; Bracaglia, R; Seccia, A; Farallo, E

    2006-01-01

    We report the case of a complete duplication of the glans, with prepuce and a blind end urethra just proximal to the dorsal aspect of the balanopreputial fold. The malformation was not evident at birth and during childhood, and became manifest only at puberty, with the growth of the external genitalia. It was not associated with other urinary malformations. Surgical excision was easy and uneventful.

  5. Delusion of fetal duplication in a Capgras patient.

    Science.gov (United States)

    Silva, J A; Leong, G B; Longhitano, M; Botello, T E

    1991-02-01

    A case of Capgras syndrome in a pregnant patient is described. In addition to perceiving living family members as impostors, she believed that there was a double or twin of her fetus. She conceptualized her "twins" differently than the way she viewed doubles of family members. Her fetus may represent the youngest "person" to have been duplicated. The relationship of Capgras syndrome to misidentification phenomena is discussed.

  6. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    International Nuclear Information System (INIS)

    Rao, Narasimha; Joseph, Benjamin

    2002-01-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  7. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Narasimha; Joseph, Benjamin [Department of Orthopaedics, Kasturba Medical College, Karnataka State (India)

    2002-03-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  8. Efficient image duplicated region detection model using sequential block clustering

    Czech Academy of Sciences Publication Activity Database

    Sekeh, M. A.; Maarof, M. A.; Rohani, M. F.; Mahdian, Babak

    2013-01-01

    Roč. 10, č. 1 (2013), s. 73-84 ISSN 1742-2876 Institutional support: RVO:67985556 Keywords : Image forensic * Copy–paste forgery * Local block matching Subject RIV: IN - Informatics, Computer Science Impact factor: 0.986, year: 2013 http://library.utia.cas.cz/separaty/2013/ZOI/mahdian-efficient image duplicated region detection model using sequential block clustering.pdf

  9. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  10. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  11. Adenocarcinoma within a rectal duplication cyst: case report and literature review.

    Science.gov (United States)

    Michael, D; Cohen, C R; Northover, J M

    1999-05-01

    Intestinal duplications are uncommon but recognised developmental anomalies. Duplications of the rectum are the most uncommon of these anomalies. They may present with perianal fistulae, bleeding, a pelvic mass or symptoms produced by a mass, or, rarely, malignant change. We present a case of an adenocarcinoma within a rectal duplication cyst which was initially thought to be inoperable but was treated by radical surgery.

  12. Understanding Legacy Features with Featureous

    DEFF Research Database (Denmark)

    Olszak, Andrzej; Jørgensen, Bo Nørregaard

    2011-01-01

    Java programs called Featureous that addresses this issue. Featureous allows a programmer to easily establish feature-code traceability links and to analyze their characteristics using a number of visualizations. Featureous is an extension to the NetBeans IDE, and can itself be extended by third...

  13. Operative correction and follow-up of craniofacial duplication.

    Science.gov (United States)

    Kotrikova, Bibiana; Hassfeld, Stefan; Steiner, Hans H; Hähnel, Stefan; Krempien, Robert; Mühling, Joachim

    2007-03-01

    Anterior craniofacial duplication (diprosopus) is an extremely rare form of conjoined twins. The children share a single trunk with normal extremities and varying degrees of facial malformation. Duplication of specific structures, such as the nose (diprosopus dirrhinus), eyes (diprosopus tetraophthalmus), and ears, is possible. The authors present a case of partial facial duplication (diprosopus dirrhinus) in a male infant. The clinical and radiographic findings and the surgical correction and follow-up are described. In a single surgical session, the authors were able to achieve not only a functionally but also an aesthetically acceptable result. In the postoperative course, the child showed nearly normal growth and satisfactory psychosocial and motor development. However, 40 months postoperatively, we noticed a tendency of the orbitae to diverge (i.e., toward hypertelorism). The surgical management of complex craniofacial malformations such as diprosopus needs a precise morphologic analysis of the patient's deformity followed by a clear treatment plan. A staged reconstructive approach is carried out to coincide with facial growth patterns and brain and eye function. If the interorbital distance in our patient increases progressively, a second operation for reduction of the interorbital distance may be necessary.

  14. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph

    2010-09-01

    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  15. De novo 12q22.q23.3 duplication associated with temporal lobe epilepsy.

    Science.gov (United States)

    Vari, Maria Stella; Traverso, Monica; Bellini, Tommaso; Madia, Francesca; Pinto, Francesca; Minetti, Carlo; Striano, Pasquale; Zara, Federico

    2017-08-01

    Temporal lobe epilepsy (TLE) is the most common form of focal epilepsy and may be associated with acquired central nervous system lesions or could be genetic. Various susceptibility genes and environmental factors are believed to be involved in the aetiology of TLE, which is considered to be a heterogeneous, polygenic, and complex disorder. Rare point mutations in LGI1, DEPDC5, and RELN as well as some copy number variations (CNVs) have been reported in families with TLE patients. We perform a genetic analysis by Array-CGH in a patient with dysmorphic features and temporal lobe epilepsy. We report a de novo duplication of the long arm of chromosome 12. We confirm that 12q22-q23.3 is a candidate locus for familial temporal lobe epilepsy with febrile seizures and highlight the role of chromosomal rearrangements in patients with epilepsy and intellectual disability. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  16. Feature Article

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Feature Article. Articles in Resonance – Journal of Science Education. Volume 1 Issue 1 January 1996 pp 80-85 Feature Article. What's New in Computers Windows 95 · Vijnan Shastri · More Details Fulltext PDF. Volume 1 Issue 1 January 1996 pp 86-89 Feature ...

  17. Adenocarcinoma arising in rectal duplication cyst: case report and review of the literature.

    Science.gov (United States)

    Shivnani, Anand T; Small, William; Benson, Al; Rao, Sambasiva; Talamonti, Mark S

    2004-11-01

    Duplication cyst of the gastrointestinal (GI) tract is a rare congenital anomaly, and rectal duplication cysts comprise a small fraction these cases. Most patients present for the first time in adulthood, and the origin of rectal duplication cysts is unclear. Prior series document malignant transformation in approximately 20 per cent of cases. The following case report describes a carcinoma arising in a rectal duplication cyst. Given the lack of data demonstrating adequate control for patients with adenocarcinoma arising in a rectal duplication cyst and our experience with this patient, we recommend all patients undergo multidisciplinary evaluation prior to any therapy.

  18. Pseudohypoparathyroidism type Ib associated with novel duplications in the GNAS locus.

    Directory of Open Access Journals (Sweden)

    Gustavo Perez-Nanclares

    Full Text Available Pseudohypoparathyroidism type 1b (PHP-Ib is characterized by renal resistance to PTH (and, sometimes, a mild resistance to TSH and absence of any features of Albright's hereditary osteodystrophy. Patients with PHP-Ib suffer of defects in the methylation pattern of the complex GNAS locus. PHP-Ib can be either sporadic or inherited in an autosomal dominant pattern. Whereas familial PHP-Ib is well characterized at the molecular level, the genetic cause of sporadic PHP-Ib cases remains elusive, although some molecular mechanisms have been associated with this subtype.The aim of the study was to investigate the molecular and imprinting defects in the GNAS locus in two unrelated patients with PHP-Ib.We have analyzed the GNAS locus by direct sequencing, Methylation-Specific Multiplex Ligation-dependent Probe Amplification, microsatellites, Quantitative Multiplex PCR of Short Fluorescent fragments and array-Comparative Genomic Hybridization studies in order to characterize two unrelated families with clinical features of PHP-Ib.We identified two duplications in the GNAS region in two patients with PHP-Ib: one of them, comprising ∼ 320 kb, occurred 'de novo' in the patient, whereas the other one, of ∼ 179 kb in length, was inherited from the maternal allele. In both cases, no other known genetic cause was observed.In this article, we describe the to-our-knowledge biggest duplications reported so far in the GNAS region. Both are associated to PHP-Ib, one of them occurring 'de novo' and the other one being maternally inherited.

  19. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  20. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  1. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  2. Bias and efficiency loss in regression estimates due to duplicated observations: a Monte Carlo simulation

    Directory of Open Access Journals (Sweden)

    Francesco Sarracino

    2017-04-01

    Full Text Available Recent studies documented that survey data contain duplicate records. We assess how duplicate records affect regression estimates, and we evaluate the effectiveness of solutions to deal with duplicate records. Results show that the chances of obtaining unbiased estimates when data contain 40 doublets (about 5% of the sample range between 3.5% and 11.5% depending on the distribution of duplicates. If 7 quintuplets are present in the data (2% of the sample, then the probability of obtaining biased estimates ranges between 11% and 20%. Weighting the duplicate records by the inverse of their multiplicity, or dropping superfluous duplicates outperform other solutions in all considered scenarios. Our results illustrate the risk of using data in presence of duplicate records and call for further research on strategies to analyze affected data.

  3. Discriminative topological features reveal biological network mechanisms

    Directory of Open Access Journals (Sweden)

    Levovitz Chaya

    2004-11-01

    Full Text Available Abstract Background Recent genomic and bioinformatic advances have motivated the development of numerous network models intending to describe graphs of biological, technological, and sociological origin. In most cases the success of a model has been evaluated by how well it reproduces a few key features of the real-world data, such as degree distributions, mean geodesic lengths, and clustering coefficients. Often pairs of models can reproduce these features with indistinguishable fidelity despite being generated by vastly different mechanisms. In such cases, these few target features are insufficient to distinguish which of the different models best describes real world networks of interest; moreover, it is not clear a priori that any of the presently-existing algorithms for network generation offers a predictive description of the networks inspiring them. Results We present a method to assess systematically which of a set of proposed network generation algorithms gives the most accurate description of a given biological network. To derive discriminative classifiers, we construct a mapping from the set of all graphs to a high-dimensional (in principle infinite-dimensional "word space". This map defines an input space for classification schemes which allow us to state unambiguously which models are most descriptive of a given network of interest. Our training sets include networks generated from 17 models either drawn from the literature or introduced in this work. We show that different duplication-mutation schemes best describe the E. coli genetic network, the S. cerevisiae protein interaction network, and the C. elegans neuronal network, out of a set of network models including a linear preferential attachment model and a small-world model. Conclusions Our method is a first step towards systematizing network models and assessing their predictability, and we anticipate its usefulness for a number of communities.

  4. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers.

    Science.gov (United States)

    Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A

    2009-01-20

    Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  5. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers

    Directory of Open Access Journals (Sweden)

    Finnerty John R

    2009-01-01

    Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  6. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  7. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  8. A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay.

    Science.gov (United States)

    Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming

    2016-01-01

    Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

  9. 6q16.3q23.3 duplication associated with Prader-Willi-like syndrome.

    Science.gov (United States)

    Desch, Laurent; Marle, Nathalie; Mosca-Boidron, Anne-Laure; Faivre, Laurence; Eliade, Marie; Payet, Muriel; Ragon, Clemence; Thevenon, Julien; Aral, Bernard; Ragot, Sylviane; Ardalan, Azarnouche; Dhouibi, Nabila; Bensignor, Candace; Thauvin-Robinet, Christel; El Chehadeh, Salima; Callier, Patrick

    2015-01-01

    Prader-Willi syndrome (PWS) is characterized by hypotonia, delayed neuropsychomotor development, overeating, obesity and mental deficiency. This phenotype is encountered in other conditions, defining Prader-Willi-like syndrome (PWLS). We report a 14-year-old boy with a complex small supernumerary marker chromosome (sSMC) associated with PWLS. The propositus presents clinical features commonly found in patients with PWLS, including growth hormone deficit. Banding karyotype analysis and fluorescence in situ hybridization (FISH) revealed a marker derived from chromosome 6 and a neocentromere as suspected, but array-CGH enabled us to characterize this marker as a der(10)t(6;10)(6qter → 6q23.3::10p11.1 → 10p11.21)dn. As far as we know, this is the first diagnosed case of PWLS associated with a complex sSMC, involving a 30.9 Mb gain in the 6q16.3q23.3 region and a 3.5 Mb gain in the 10p11.21p11.1 region. Several genes have been mapped to the 6q region including the TCBA1 gene, which is associated with developmental delay and recurrent infections, the ENPP1 gene, associated with insulin resistance and susceptibility to obesity and the BMIQ3 gene, associated with body mass index (BMI). No OMIM gene was found in the smallest 10p11.21p11.1 region. We suggest that the duplicated chromosome segment 6q16.3q23.3 may be responsible for the phenotype of our case and may also be a candidate locus of PWLS.

  10. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  11. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  12. Dietary intakes of pesticides based on community duplicate diet samples.

    Science.gov (United States)

    Melnyk, Lisa Jo; Xue, Jianping; Brown, G Gordon; McCombs, Michelle; Nishioka, Marcia; Michael, Larry C

    2014-01-15

    The calculation of dietary intake of selected pesticides was accomplished using food samples collected from individual representatives of a defined demographic community using a community duplicate diet approach. A community of nine participants was identified in Apopka, FL from which intake assessments of organophosphate (OP) and pyrethroid pesticides were made. From these nine participants, sixty-seven individual samples were collected and subsequently analyzed by gas chromatography/mass spectrometry. Measured concentrations were used to estimate dietary intakes for individuals and for the community. Individual intakes of total OP and pyrethroid pesticides ranged from 6.7 to 996 ng and 1.2 to 16,000 ng, respectively. The community intake was 256 ng for OPs and 3430 ng for pyrethroid pesticides. The most commonly detected pesticide was permethrin, but the highest overall intake was of bifenthrin followed by esfenvalerate. These data indicate that the community in Apopka, FL, as represented by the nine individuals, was potentially exposed to both OP and pyrethroid pesticides at levels consistent with a dietary model and other field studies in which standard duplicate diet samples were collected. Higher levels of pyrethroid pesticides were measured than OPs, which is consistent with decreased usage of OPs. The diversity of pyrethroid pesticides detected in food samples was greater than expected. Continually changing pesticide usage patterns need to be considered when determining analytes of interest for large scale epidemiology studies. The Community Duplicate Diet Methodology is a tool for researchers to meet emerging exposure measurement needs that will lead to more accurate assessments of intake which may enhance decisions for chemical regulation. Successfully determining the intake of pesticides through the dietary route will allow for accurate assessments of pesticide exposures to a community of individuals, thereby significantly enhancing the research benefit

  13. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  14. Duplicated facial nerve trunk with a first branchial cleft cyst.

    Science.gov (United States)

    Hinson, Drew; Poteet, Perry; Bower, Charles

    2014-03-01

    First branchial cleft anomalies are rare and their various anatomical relationships to the facial nerve have been described. We encountered a 15-year-old female with a type II first branchial cleft cyst presenting as a right neck mass that we found during surgical excision to transverse two main facial nerve trunks. To our knowledge, this is the first reported case of a first branchial cleft anomaly in conjunction with a duplicated facial nerve trunk. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  15. 10p Duplication characterized by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)

    1994-09-01

    We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.

  16. Intragenic Duplication A Novel Mutational Mechanism in Hereditary Pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, M. T.; Geisz, A.; Brusgaard, K.

    2011-01-01

    OBJECTIVES: In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide...... pancreatitis. The accelerated activation of p.K23_I24insIDK by cathepsin B is a unique biochemical property not found in any other pancreatitis-associated trypsinogen mutant. In contrast, the robust autoactivation of the novel mutant confirms the notion that increased autoactivation is a disease......-relevant mechanism in hereditary pancreatitis....

  17. Urethral Triplication Without Bladder Duplication: Endourologic Diagnosis and Management

    Science.gov (United States)

    Ortiz, Ruben; Burgos, Laura; Angulo, Jose Maria

    2018-01-01

    Abstract Urethral triplication is a rare congenital anomaly of the lower urinary system, with urethra ending in glans. At the beginning of toilet training, urine output was observed along the rectum. Rigid cystoscopy shows a perineal urethra starting in the posterior urethra. Subsequently, flexible cystoscopy showed entry of epispadic urethra in the bladder immediately superior to the bladder neck. It was running parallel to primary urethra. Then, we observed two most frequent types of urethral duplication in the sagittal plane in a single patient. PMID:29675475

  18. Bionic Duplication of Fresh Navodon septentrionalis Fish Surface Structures

    Directory of Open Access Journals (Sweden)

    Bing Qu

    2011-01-01

    Full Text Available Biomimetic superhydrophobic surface was fabricated by replicating topography of the fresh fish skin surface of Navodon septentrionalis with polydimethylsiloxane (PDMS elastomer. A two-step replicating method was developed to make the surface structure of the fresh fish skin be replicated with high fidelity. After duplication, it was found that the static contact angle of the replica was as large as 173°. Theoretic analysis based on Young's and Cassie-Baxter (C-B model was performed to explain the relationship between structure and hydrophobicity.

  19. Tracheal Atresia with Segmental Esophageal Duplication: An Unusual Anatomic Arrangement.

    Science.gov (United States)

    Gaerty, Kirsten; Thomas, Joseph T; Petersen, Scott; Tan, Edwin; Kumar, Sailesh; Gardener, Glenn; Armes, Jane

    2016-01-01

    An unusual anatomic configuration of segmental tracheal agenesis/atresia with esophageal duplication on autopsy in a fetus that demised in utero at 29 weeks is reported. The mother was scanned initially for a cardiac anomaly at 20 weeks and on follow-up scan at 27 weeks had polyhydramnios and underwent amnioreduction. The final autopsy diagnosis was vertebral, ano-rectal, cardiac, tracheoesophageal, renal, and limb malformations (VACTERL). We discuss the autopsy findings along with the embryological mechanisms and compare the configuration with Floyd's classification for tracheal agenesis. The difficulties in prenatal diagnosis are discussed.

  20. Esophageal carcinoma originating in a duplication cyst: case report

    Directory of Open Access Journals (Sweden)

    Pimenta Amadeu P. A.

    1997-01-01

    Full Text Available The authors present the case report of a 61-year-old man, admitted with middle third squamous cell esophageal carcinoma. He was submitted to a curative gastroesophageal resection via a medium laparotomy and a right thoracotomy. An intrathoracic esophagogastric anastomosis was performed. The pathological analysis of the surgical specimen revealed a squamous cell carcinoma clearly originating from the epithelial lining of an esophageal duplication cyst. Immunohistochemitry showed p 53 staining of the tumor cells. The patient at 11 month follow up was asymptomatic.

  1. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  2. Method of duplicating film using the CR system. Evaluation of detectability in a simulated nodule

    International Nuclear Information System (INIS)

    Fukuyama, Atsushi; Ando, Satoshi; Maeda, Kayoko; Ida, Kazushi; Suzuki, Tomoaki; Fukuyama, Kouichi; Hasegawa, Takeo

    2005-01-01

    Since film processors used for screen-film systems have been decreasing recently, it is becoming difficult to develop duplicating film (Dup film) used conventionally. The purpose of this study was to evaluate the usefulness of the method of duplicating film using a computed radiography (CR) system. The process of duplicating film using CR is to eliminate energy accumulated on the imaging plate (IP) using white light, to accumulate energy on the whole surface, and to place the original film in piles. After an exposure of white light, duplicated films can be obtained by CR system. In order to evaluate the reproducibiliy of our system, duplicated films were read by experienced observers and receiver operating characteristic (ROC) analysis was carried out. Observers read 50 images with a simulated nodule and 50 images without a simulated nodule. The average Az values were 0.94 for the original films, 0.91 for films duplicated using Dup film, and 0.90 for films duplicated using the CR system. When the two-tailed paired-T test was performed for each result, there were no statistically significant differences at p<0.05. The detectability of a simulated nodule for films duplicated using the CR system did not differ from the detectability of films duplicated using Dup film. This method may be a reasonable substitute for the conventional duplication system. (author)

  3. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  4. 4p16.1-p15.31 duplication and 4p terminal deletion in a 3-years old Chinese girl: Array-CGH, genotype-phenotype and neurological characterization.

    Science.gov (United States)

    Piccione, Maria; Salzano, Emanuela; Vecchio, Davide; Ferrara, Dante; Malacarne, Michela; Pierluigi, Mauro; Ferrara, Ines; Corsello, Giovanni

    2015-07-01

    Microscopically chromosome rearrangements of the short arm of chromosome 4 include the two known clinical entities: partial trisomy 4p and deletions of the Wolf-Hirschhorn critical regions 1 and 2 (WHSCR-1 and WHSCR-2, respectively), which cause cranio-facial anomalies, congenital malformations and developmental delay/intellectual disability. We report on clinical findings detected in a Chinese patient with a de novo 4p16.1-p15.32 duplication in association with a subtle 4p terminal deletion of 6 Mb in size. This unusual chromosome imbalance resulted in WHS classical phenotype, while clinical manifestations of 4p trisomy were practically absent. This observation suggests the hypothesis that haploinsufficiency of sensitive dosage genes with regulatory function placed in WHS critical region, is more pathogenic than concomitant 4p duplicated segment. Additionally clinical findings in our patient confirm a variable penetrance of major malformations and neurological features in Chinese children despite of WHS critical region's deletion. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  5. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  6. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  7. Reactor protection system including engineered features actuation system

    International Nuclear Information System (INIS)

    Palmaers, W.

    1982-01-01

    The safety concept requires to ensure that - the reactor protection system - the active engineered safeguard - and the necessary auxiliary systems are so designed and interfaced in respect of design and mode of action that, in the event of single component failure reliable control of the consequences of accidents remains ensured at all times and that the availability of the power plant is not limited unnecessarily. In order to satisfy these requirements due, importance was attached to a consistent spacial separation of the mutually redundant subsystems of the active safety equipment. The design and layout of the reactor protection system, of the power supply (emergency power supply), and of the auxiliary systems important from the safety engineering point of view, are such that their subsystems also largely satisfy the requirements of independence and spacial separation. (orig./RW)

  8. Systematic evaluation program review of NRC Safety Topic VI-10.A associated with the electrical, instrumentation and control portions of the testing of reactor trip system and engineered safety features, including response time for the Dresden station, Unit II nuclear power plant

    International Nuclear Information System (INIS)

    St Leger-Barter, G.

    1980-11-01

    This report documents the technical evaluation and review of NRC Safety Topic VI-10.A, associated with the electrical, instrumentation, and control portions of the testing of reactor trip systems and engineered safety features including response time for the Dresden II nuclear power plant, using current licensing criteria

  9. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  11. Enteric duplication in children: clinical presentation and outcome.

    Science.gov (United States)

    Rasool, Naima; Safdar, Chaudhry Aqeel; Ahmad, Asrar; Kanwal, Shehla

    2013-06-01

    Enteric duplication (ED) is an anomaly with varied presentations and possible involvement of the alimentary tract. Once diagnosed, resection of the lesion and the involved part of the gut is usually required. The aim of this study was to evaluate the clinical presentations, diagnostic investigations, management and outcomes of patients with ED. This was a descriptive case study conducted at the Department of Paediatric Surgery, Military Hospital, Rawalpindi, Pakistan, from January 2005 to January 2011. The medical records of all patients diagnosed with ED were retrospectively analysed with respect to age, presentation, investigations, site and type of lesion, surgical procedures, histological findings and complications. A total of nine patients were managed during the study period. The patients' ages ranged from three months to five years. Four out of nine EDs were rectal duplications. Three EDs were of the cystic type, five were of the tubular type and one was a complex mixed anomaly. Patients presented with varied symptoms, with the two most common being the presence of an abdominal mass and bleeding per rectum. Diagnosis was mainly achieved based on magnetic resonance imaging and computed tomography, although Meckel's scan provided accurate diagnosis in three of the nine patients. All the cysts were resected without any major complications, and patients were event-free during the five-year follow-up. EDs should be kept in mind when examining patients with an abdominal mass and bleeding per rectum. Meckel's scan can provide accurate diagnosis of EDs with bleeding. Prompt diagnosis and management results in satisfactory outcomes.

  12. Motion analysis for duplicate frame removal in wireless capsule endoscope

    Science.gov (United States)

    Lee, Hyun-Gyu; Choi, Min-Kook; Lee, Sang-Chul

    2011-03-01

    Wireless capsule endoscopy (WCE) has been intensively researched recently due to its convenience for diagnosis and extended detection coverage of some diseases. Typically, a full recording covering entire human digestive system requires about 8 to 12 hours for a patient carrying a capsule endoscope and a portable image receiver/recorder unit, which produces 120,000 image frames on average. In spite of the benefits of close examination, WCE based test has a barrier for quick diagnosis such that a trained diagnostician must examine a huge amount of images for close investigation, normally over 2 hours. The main purpose of our work is to present a novel machine vision approach to reduce diagnosis time by automatically detecting duplicated recordings caused by backward camera movement, typically containing redundant information, in small intestine. The developed technique could be integrated with a visualization tool which supports intelligent inspection method, such as automatic play speed control. Our experimental result shows high accuracy of the technique by detecting 989 duplicate image frames out of 10,000, equivalently to 9.9% data reduction, in a WCE video from a real human subject. With some selected parameters, we achieved the correct detection ratio of 92.85% and the false detection ratio of 13.57%.

  13. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere

    2008-09-01

    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  14. Sox9 duplications are a relevant cause of Sry-negative XX sex reversal dogs.

    Science.gov (United States)

    Rossi, Elena; Radi, Orietta; De Lorenzi, Lisa; Vetro, Annalisa; Groppetti, Debora; Bigliardi, Enrico; Luvoni, Gaia Cecilia; Rota, Ada; Camerino, Giovanna; Zuffardi, Orsetta; Parma, Pietro

    2014-01-01

    Sexual development in mammals is based on a complicated and delicate network of genes and hormones that have to collaborate in a precise manner. The dark side of this pathway is represented by pathological conditions, wherein sexual development does not occur properly either in the XX and the XY background. Among them a conundrum is represented by the XX individuals with at least a partial testis differentiation even in absence of SRY. This particular condition is present in various mammals including the dog. Seven dogs characterized by XX karyotype, absence of SRY gene, and testicular tissue development were analysed by Array-CGH. In two cases the array-CGH analysis detected an interstitial heterozygous duplication of chromosome 9. The duplication contained the SOX9 coding region. In this work we provide for the first time a causative mutation for the XXSR condition in the dog. Moreover this report supports the idea that the dog represents a good animal model for the study of XXSR condition caused by abnormalities in the SOX9 locus.

  15. Sox9 duplications are a relevant cause of Sry-negative XX sex reversal dogs.

    Directory of Open Access Journals (Sweden)

    Elena Rossi

    Full Text Available Sexual development in mammals is based on a complicated and delicate network of genes and hormones that have to collaborate in a precise manner. The dark side of this pathway is represented by pathological conditions, wherein sexual development does not occur properly either in the XX and the XY background. Among them a conundrum is represented by the XX individuals with at least a partial testis differentiation even in absence of SRY. This particular condition is present in various mammals including the dog. Seven dogs characterized by XX karyotype, absence of SRY gene, and testicular tissue development were analysed by Array-CGH. In two cases the array-CGH analysis detected an interstitial heterozygous duplication of chromosome 9. The duplication contained the SOX9 coding region. In this work we provide for the first time a causative mutation for the XXSR condition in the dog. Moreover this report supports the idea that the dog represents a good animal model for the study of XXSR condition caused by abnormalities in the SOX9 locus.

  16. Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Guo

    Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

  17. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  18. Glacial Features (Point) - Quad 168 (EPPING, NH)

    Data.gov (United States)

    University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...

  19. Duplication of the vertebral artery: report of two cases and review of the literature

    International Nuclear Information System (INIS)

    Goddard, A.J.P.; Annesley-Williams, D.; Guthrie, J.A.; Weston, M.

    2001-01-01

    Duplication of the vertebral artery is rare. We report two cases in which it was an incidental finding. In the first, duplication of the right vertebral artery was demonstrated by magnetic resonance angiography (MRA) and conventional angiography. The second patient had duplication of the right vertebral artery demonstrated by MRA. We discuss the origin of this abnormality, its radiological implications and its potential clinical significance are discussed. (orig.)

  20. Craniofacial duplication (diprosopus): CT, MR imaging, and MR angiography findings case report.

    Science.gov (United States)

    Hähnel, Stefan; Schramm, Peter; Hassfeld, Stefan; Steiner, Hans H; Seitz, Angelika

    2003-01-01

    Diprosopus is one of the rarest malformations in humans. In addition to the facial structures, the cerebral frontal lobes were duplicated in this case. Three pairs of anterior cerebral arteries were detected, and the rostral parts of the superior sagittal sinus were duplicated. Computed tomography, magnetic resonance (MR) imaging, and MR angiography allowed study of the degree of duplicative changes in diprosopus, especially for planning cosmetic correction. Copyright RSNA, 2002

  1. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  2. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  3. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  4. Detection and correction of false segmental duplications caused by genome mis-assembly

    Science.gov (United States)

    2010-01-01

    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  5. Gastric Duplication Cyst: A Rare Congenital Disease Often Misdiagnosed in Adults

    Directory of Open Access Journals (Sweden)

    Jessica Falleti

    2013-01-01

    Full Text Available Gastrointestinal duplication is a rare congenital disease which affected more commonly the ileum, while the stomach is rarely involved. Generally diagnosed in paediatric or young age, it could be difficult to suspect a gastrointestinal duplication in adults. Herein, we report a 55-year-old male with a gastric duplication cyst found on routinely checkup for chronic hepatitis and first misdiagnosed as a gastrointestinal stromal tumor (GIST; we also discuss its embryology.

  6. Phenotypic variation in a large Swedish pedigree due to SNCA duplication and triplication

    DEFF Research Database (Denmark)

    Fuchs, J; Nilsson, C; Kachergus, J

    2007-01-01

    complex. The genetic basis for familial parkinsonism is an SNCA-MMRN11 multiplication, but whereas SNCA-MMRN1 duplication in the Swedish proband (Branch J) leads to late-onset autonomic dysfunction and parkinsonism, SNCA-MMRN1 triplication in the Swedish American family (Branch I) leads to early......BACKGROUND: The "Lister family complex," an extensive Swedish family with autosomal dominant Parkinson disease, was first described by Henry Mjönes in 1949. On the basis of clinical, molecular, and genealogic findings on a Swedish and an American family branch, we provide genetic evidence...... that explains the parkinsonism in this extended pedigree. METHODS: Clinical methods included a detailed neurologic exam of the proband of the Swedish family branch, MRI, and ([123]I)-beta-CIT SPECT imaging. Genomic analysis included alpha-synuclein sequencing, SNCA real-time PCR dosage, chromosome 4q21...

  7. Feature Extraction

    CERN Document Server

    CERN. Geneva

    2015-01-01

    Feature selection and reduction are key to robust multivariate analyses. In this talk I will focus on pros and cons of various variable selection methods and focus on those that are most relevant in the context of HEP.

  8. Site Features

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset consists of various site features from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times...

  9. A new case of Beckwith-Wiedemann syndrome with an 11p15 duplication of paternal origin [46,XY,-21,+der(21), t(11;21)(p15.2;q22.3)pat].

    Science.gov (United States)

    Krajewska-Walasek, M; Gutkowska, A; Mospinek-Krasnopolska, M; Chrzanowska, K

    1996-01-01

    We present a new case of 11p15 duplication (trisomy 11p15) in a boy (46,XY,-21,+der(21), t(11;21)(p15.2;q22.3)] suffering from Beckwith-Wiedemann syndrome (BWS), whose phenotypically normal father carries a balanced translocation between chromosomes 11 and 21[46,XY, t(11;21)(p15.2;q22.3)]. The paternal grandmother has the same balanced translocation and is also clinically normal. BWS was suspected when the boy was 6 months old because of gigantism, macroglossia, visceromegaly, ear lobe creases and abdominal distention. Apart from the characteristic BWS phenotype, the boy has other features which are almost exclusively observed in 11p trisomy (high forehead with frontal upsweep of hair, wide central nose bridge, slightly beaked nose, chubby cheeks and severe mental retardation). So far, at least eight cases of 11p15 duplication have been described as patients with BWS. In six of these, the duplication was due to inheritance of a translocated or rearranged paternal chromosome. This was also the case in our patient. In the two other previously published cases, the 11p15 duplications were de novo, but in one of these, DNA analysis has subsequently shown that the duplication was of paternal origin. We discuss our observations in relation to the above-mentioned previous cases of 11p15 duplication and the possible role of genomic imprinting in the etiology of BWS.

  10. Wide rectal duplication cyst in an adult resected by anterior approach: efficacy and recurrence.

    Science.gov (United States)

    Ceriotti, Michela; Saccomani, Giorgia; Lacelli, Francesca; Saccomani, Giovanni E

    2017-06-01

    Alimentary tract duplications are uncommon congenital abnormalities usually diagnosed and treated in childhood. Rectal involvement is extremely rare. We report the case of a 22-year-old female who presented with chronic abdominal and perianal pain; feeling of rectal fullness. Workup revealed a rectal duplication cyst. The patient underwent a complete transabdominal excision of the cyst: an hybrid laparoscopic and laparotomic technique was adopted. The hybrid isolated anterior abdominal approach is safe and feasible even for the treatment of wide rectal duplication cysts. Real recurrence in rectal duplication cysts is uncommon when the first operation was performed with radical intent.

  11. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations*

    Science.gov (United States)

    Amos, Kathleen A.

    2014-01-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations. PMID:24860263

  12. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations.

    Science.gov (United States)

    Amos, Kathleen A

    2014-04-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations.

  13. Error analysis of filtering operations in pixel-duplicated images of diabetic retinopathy

    Science.gov (United States)

    Mehrubeoglu, Mehrube; McLauchlan, Lifford

    2010-08-01

    In this paper, diabetic retinopathy is chosen for a sample target image to demonstrate the effectiveness of image enlargement through pixel duplication in identifying regions of interest. Pixel duplication is presented as a simpler alternative to data interpolation techniques for detecting small structures in the images. A comparative analysis is performed on different image processing schemes applied to both original and pixel-duplicated images. Structures of interest are detected and and classification parameters optimized for minimum false positive detection in the original and enlarged retinal pictures. The error analysis demonstrates the advantages as well as shortcomings of pixel duplication in image enhancement when spatial averaging operations (smoothing filters) are also applied.

  14. Two-stage Keypoint Detection Scheme for Region Duplication Forgery Detection in Digital Images.

    Science.gov (United States)

    Emam, Mahmoud; Han, Qi; Zhang, Hongli

    2018-01-01

    In digital image forensics, copy-move or region duplication forgery detection became a vital research topic recently. Most of the existing keypoint-based forgery detection methods fail to detect the forgery in the smooth regions, rather than its sensitivity to geometric changes. To solve these problems and detect points which cover all the regions, we proposed two steps for keypoint detection. First, we employed the scale-invariant feature operator to detect the spatially distributed keypoints from the textured regions. Second, the keypoints from the missing regions are detected using Harris corner detector with nonmaximal suppression to evenly distribute the detected keypoints. To improve the matching performance, local feature points are described using Multi-support Region Order-based Gradient Histogram descriptor. Based on precision-recall rates and commonly tested dataset, comprehensive performance evaluation is performed. The results demonstrated that the proposed scheme has better detection and robustness against some geometric transformation attacks compared with state-of-the-art methods. © 2017 American Academy of Forensic Sciences.

  15. De novo duplication of 17p13.1-p13.2 in a patient with intellectual disability and obesity.

    Science.gov (United States)

    Kuroda, Yukiko; Ohashi, Ikuko; Tominaga, Makiko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Masuno, Mitsuo; Kurosawa, Kenji

    2014-06-01

    17p13.1 Deletion encompassing TP53 has been described as a syndrome characterized by intellectual disability and dysmorphic features. Only one case with a 17p13.1 duplication encompassing TP53 has been reported in a patient with intellectual disability, seizures, obesity, and diabetes mellitus. Here, we present a patient with a 17p13.1 duplication who exhibited obesity and intellectual disability, similar to the previous report. The 9-year-old proposita was referred for the evaluation of intellectual disability and obesity. She also exhibited insulin resistance and liver dysfunction. She had wide palpebral fissures, upturned nostrils, a long mandible, short and slender fingers, and skin hyperpigmentation. Array comparative genomic hybridization (array CGH) detected a 3.2 Mb duplication of 17p13.1-p13.2 encompassing TP53, FXR2, NLGN2, and SLC2A4, which encodes the insulin-responsive glucose transporter 4 (GLUT4) associated with insulin-stimulated glucose uptake in adipocytes and muscle. We suggest that 17p13.1 duplication may represent a clinically recognizable condition characterized partially by a characteristic facial phenotype, developmental delay, and obesity. © 2014 Wiley Periodicals, Inc.

  16. Prenatal detection of a de novo terminal inverted duplication 4p in a fetus with the Wolf-Hirschhorn syndrome phenotype.

    Science.gov (United States)

    Beaujard, M-P; Jouannic, J-M; Bessières, B; Borie, C; Martin-Luis, I; Fallet-Bianco, C; Portnoï, M-F

    2005-06-01

    To present the prenatal diagnosis of a de novo terminal inversion duplication of the short arm of chromosome 4 and a review of the literature. An amniocentesis for chromosome analysis was performed at 33 weeks' gestation because ultrasound examination showed a female fetus with multiple abnormalities consisting of severe intrauterine growth retardation, microcephaly, a cleft lip and renal hypoplasia. Cytogenetic analysis and FISH studies of the cultured amniocytes revealed a de novo terminal inversion duplication of the short arm of chromosome 4 characterized by a duplication of 4p14-p16.1 chromosome region concomitant with a terminal deletion 4p16.1-pter. The karyotype was thus: 46,XX, inv dup del (4)(:p14-->p16.1::p16.1-->qter). The parents opted to terminate the pregnancy. Fetopathological examination showed dysmorphic features and abnormalities consistent with a Wolf-Hirschhorn syndrome (WHS) diagnosis, clinical manifestations of partial 4p trisomy being mild. Although relatively rare, inverted duplications have been reported repeatedly in an increasing number of chromosomes. Only two previous cases with de novo inv dup del (4p) and one with tandem dup 4p have been reported, all of them associated with a 4pter deletion. We report the first case diagnosed prenatally. Breakpoints are variable, resulting in different abnormal phenotype. In our case, clinical manifestations resulted in a WHS phenotype.

  17. Molecular archaeology of Flaviviridae untranslated regions: duplicated RNA structures in the replication enhancer of flaviviruses and pestiviruses emerged via convergent evolution.

    Directory of Open Access Journals (Sweden)

    Dmitri J Gritsun

    Full Text Available RNA secondary structures in the 3'untranslated regions (3'UTR of the viruses of the family Flaviviridae, previously identified as essential (promoters or beneficial (enhancers for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV. RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.

  18. Molecular Archaeology of Flaviviridae Untranslated Regions: Duplicated RNA Structures in the Replication Enhancer of Flaviviruses and Pestiviruses Emerged via Convergent Evolution

    Science.gov (United States)

    Gritsun, Dmitri J.; Jones, Ian M.; Gould, Ernest A.; Gritsun, Tamara S.

    2014-01-01

    RNA secondary structures in the 3′untranslated regions (3′UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3′UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3′UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3′UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3′UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3′UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs. PMID:24647143

  19. Delusional misidentifications and duplications: right brain lesions, left brain delusions.

    Science.gov (United States)

    Devinsky, Orrin

    2009-01-06

    When the delusional misidentification syndromes reduplicative paramnesia and Capgras syndromes result from neurologic disease, lesions are usually bifrontal and/or right hemispheric. The related disorders of confabulation and anosognosis share overlapping mechanisms and anatomic pathology. A dual mechanism is postulated for the delusional misidentification syndromes: negative effects from right hemisphere and frontal lobe dysfunction as well as positive effects from release (i.e., overactivity) of preserved left hemisphere areas. Negative effects of right hemisphere injury impair self-monitoring, ego boundaries, and attaching emotional valence and familiarity to stimuli. The unchecked left hemisphere unleashes a creative narrator from the monitoring of self, memory, and reality by the frontal and right hemisphere areas, leading to excessive and false explanations. Further, the left hemisphere's cognitive style of categorization, often into dual categories, leads it to invent a duplicate or impostor to resolve conflicting information. Delusions result from right hemisphere lesions. But it is the left hemisphere that is deluded.

  20. On face antimagic labeling of double duplication of graphs

    Science.gov (United States)

    Shobana, L.; Kuppan, R.

    2018-04-01

    A Labeling of a plane graph G is called d-antimagic if every numbers, the set of s-sided face weights is Ws={as,as+d,as+2d,...,as+(fs-1)d} for some integers as and d (as>0,d≥0),where fs is the number of s-sided faces. We allow differentsets ws of different s.In this paper, we proved the existence of face antimagic labeling of types (1,0,0),(1,0,1),(1,1,0),(0,1,1) and (1,1,1) of double duplication of all vertices by edges of a cycle graph Cn: n≥3 and a tree of order n.

  1. Bibliographic review of intestinal duplication in the pediatric patient

    International Nuclear Information System (INIS)

    Molina Campos, Cesar

    2013-01-01

    An exhaustive bibliographical review was carried out on all the clinical, diagnostic and therapeutic aspects related to intestinal duplication, to update the concepts that are exposed in the literature. An observational and descriptive study of the literature found was carried out, using as source the articles found in the National Library of Health and Social Security (BINAS) and on the Internet, in addition to the official textbook of the pediatric surgery graduate in Costa Rica. A study of updating of the clinical findings, approach and therapeutic of the pathology was carried out. A protocolization of all diagnosis, can be considered as a valuable tool to help make this diagnosis as expeditious and accurate as possible, in order to provide adequate and safe treatment to the patient, significantly reducing the risks and morbidity in surgery as definitive treatment [es

  2. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  3. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  4. Clinical presentation of epignathus teratoma with cleft palate; and duplication of cranial base, tongue, mandible, and pituitary gland.

    Science.gov (United States)

    Maeda, Yujiro; Suenaga, Hideyuki; Sugiyama, Madoka; Saijo, Hideto; Hoshi, Kazuto; Mori, Yoshiyuki; Takato, Tsuyoshi

    2013-07-01

    A 2-day-old girl was diagnosed with an oral epignathus teratoma and an uncommon combination of orofacial malformations including cleft palate; tongue, mandible, cranial base, cervical vertebrae, lower lip, and pituitary gland duplications; and fistula of the glabella and lower lip. Computed tomography revealed that the mass within the nasal cavity had tooth-like calcifications and protruded into the nasopharynx and oral cavity. It was implanted on the anterior wall of the body of the sphenoid bone and was accompanied with mandibular duplication. Magnetic resonance imaging detected duplication of the pituitary gland and confirmed the absence of intracranial communication of the nasopharyngeal mass. The teratoma did not cause respiratory obstruction; however, the patient required continuous nasogastric tube feeding. Usually, an epignathus teratoma is associated with few midline defects and can be corrected with multiple interventions at different time points. The current study describes the surgical procedure comprising excision of the tumor along with reconstructive surgeries of the mandible, tongue, and fistulae undertaken when the infant reached 7 months of age. The cleft palate was repaired at 18 months of age using the Kaplan buccal flap method. Histopathologic examination confirmed a grade 0 teratoma covered with keratinized skin and containing pilosebaceous and sweat glands, adipose tissue, and smooth muscle. The long-term success of this intervention was determined at the follow-up examination conducted at 3 years of age, with no signs of the teratoma recurrence observed.

  5. mvp - an open-source preprocessor for cleaning duplicate records and missing values in mass spectrometry data.

    Science.gov (United States)

    Lee, Geunho; Lee, Hyun Beom; Jung, Byung Hwa; Nam, Hojung

    2017-07-01

    Mass spectrometry (MS) data are used to analyze biological phenomena based on chemical species. However, these data often contain unexpected duplicate records and missing values due to technical or biological factors. These 'dirty data' problems increase the difficulty of performing MS analyses because they lead to performance degradation when statistical or machine-learning tests are applied to the data. Thus, we have developed missing values preprocessor (mvp), an open-source software for preprocessing data that might include duplicate records and missing values. mvp uses the property of MS data in which identical chemical species present the same or similar values for key identifiers, such as the mass-to-charge ratio and intensity signal, and forms cliques via graph theory to process dirty data. We evaluated the validity of the mvp process via quantitative and qualitative analyses and compared the results from a statistical test that analyzed the original and mvp-applied data. This analysis showed that using mvp reduces problems associated with duplicate records and missing values. We also examined the effects of using unprocessed data in statistical tests and examined the improved statistical test results obtained with data preprocessed using mvp.

  6. Duplicated Enhancer Region Increases Expression of CTSB and Segregates with Keratolytic Winter Erythema in South African and Norwegian Families.

    Science.gov (United States)

    Ngcungcu, Thandiswa; Oti, Martin; Sitek, Jan C; Haukanes, Bjørn I; Linghu, Bolan; Bruccoleri, Robert; Stokowy, Tomasz; Oakeley, Edward J; Yang, Fan; Zhu, Jiang; Sultan, Marc; Schalkwijk, Joost; van Vlijmen-Willems, Ivonne M J J; von der Lippe, Charlotte; Brunner, Han G; Ersland, Kari M; Grayson, Wayne; Buechmann-Moller, Stine; Sundnes, Olav; Nirmala, Nanguneri; Morgan, Thomas M; van Bokhoven, Hans; Steen, Vidar M; Hull, Peter R; Szustakowski, Joseph; Staedtler, Frank; Zhou, Huiqing; Fiskerstrand, Torunn; Ramsay, Michele

    2017-05-04

    Keratolytic winter erythema (KWE) is a rare autosomal-dominant skin disorder characterized by recurrent episodes of palmoplantar erythema and epidermal peeling. KWE was previously mapped to 8p23.1-p22 (KWE critical region) in South African families. Using targeted resequencing of the KWE critical region in five South African families and SNP array and whole-genome sequencing in two Norwegian families, we identified two overlapping tandem duplications of 7.67 kb (South Africans) and 15.93 kb (Norwegians). The duplications segregated with the disease and were located upstream of CTSB, a gene encoding cathepsin B, a cysteine protease involved in keratinocyte homeostasis. Included in the 2.62 kb overlapping region of these duplications is an enhancer element that is active in epidermal keratinocytes. The activity of this enhancer correlated with CTSB expression in normal differentiating keratinocytes and other cell lines, but not with FDFT1 or NEIL2 expression. Gene expression (qPCR) analysis and immunohistochemistry of the palmar epidermis demonstrated significantly increased expression of CTSB, as well as stronger staining of cathepsin B in the stratum granulosum of affected individuals than in that of control individuals. Analysis of higher-order chromatin structure data and RNA polymerase II ChIA-PET data from MCF-7 cells did not suggest remote effects of the enhancer. In conclusion, KWE in South African and Norwegian families is caused by tandem duplications in a non-coding genomic region containing an active enhancer element for CTSB, resulting in upregulation of this gene in affected individuals. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  8. Distal 3p duplication and terminal 7q deletion associated with nuchal edema and cyclopia in a fetus and a review of the literature

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2015-06-01

    Conclusion: Simultaneous occurrence of 7q deletion and 3p duplication can be associated with alobar holoprosencephaly. For the couple with a parental translocation involving 7q and 3p, prenatal ultrasound should include a detailed investigation of central nervous system anomalies.

  9. X-linked recessive panhypopituitarism associated with a regional duplication in Xq25-q26.

    Science.gov (United States)

    Lagerström-Fermér, M; Sundvall, M; Johnsen, E; Warne, G L; Forrest, S M; Zajac, J D; Rickards, A; Ravine, D; Landegren, U; Pettersson, U

    1997-01-01

    We present a linkage analysis and a clinical update on a previously reported family with X-linked recessive panhypopituitarism, now in its fourth generation. Affected members exhibit variable degrees of hypopituitarism and mental retardation. The markers DXS737 and DXS1187 in the q25-q26 region of the X chromosome showed evidence for linkage with a peak LOD score (Zmax) of 4.12 at zero recombination fraction (theta(max) = 0). An apparent extra copy of the marker DXS102, observed in the region of the disease gene in affected males and heterozygous carrier females, suggests that a segment including this marker is duplicated. The gene causing this disorder appears to code for a dosage-sensitive protein central to development of the pituitary. Images Figure 2 PMID:9106538

  10. Tubular sigmoid duplication in an adult man: an interesting incidental finding.

    Science.gov (United States)

    Asour, Amani; Kim, Hyun-Kyung; Arya, Shobhit; Hepworth, Clive

    2017-11-12

    A 61-year-old man attended an outpatient colorectal clinic for a chronic, non-specific abdominal pain, associated with rectal bleeding. He underwent a number of investigations including a CT pneumocolon, which revealed an incidental finding of 20 cm of additional sigmoid colon. This case is interesting because tubular sigmoid duplication is an extremely unusual condition, rarely diagnosed in adults; only a few cases have been reported of this condition in the adult population. Our team chose to treat this patient conservatively, in order to avoid putting the patient at risk of an unnecessary surgery. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Inference of the ancestral vertebrate phenotype through vestiges of the whole-genome duplications.

    Science.gov (United States)

    Onimaru, Koh; Kuraku, Shigehiro

    2018-03-16

    Inferring the phenotype of the last common ancestor of living vertebrates is a challenging problem because of several unresolvable factors. They include the lack of reliable out-groups of living vertebrates, poor information about less fossilizable organs and specialized traits of phylogenetically important species, such as lampreys and hagfishes (e.g. secondary loss of vertebrae in adult hagfishes). These factors undermine the reliability of ancestral reconstruction by traditional character mapping approaches based on maximum parsimony. In this article, we formulate an approach to hypothesizing ancestral vertebrate phenotypes using information from the phylogenetic and functional properties of genes duplicated by genome expansions in early vertebrate evolution. We named the conjecture as 'chronological reconstruction of ohnolog functions (CHROF)'. This CHROF conjecture raises the possibility that the last common ancestor of living vertebrates may have had more complex traits than currently thought.

  12. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  13. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  14. Megalourethra with Y-Type Duplication of Urethra Presented as Perianal Fistula: A Rare Case Report

    Directory of Open Access Journals (Sweden)

    Shashi Verma

    2015-01-01

    Full Text Available Megalourethra with Y-type duplication is an extremely rare anomaly. We report here one such case, diagnosed with retrograde urethrogram, which was done from both penile meatus and perianal opening simultaneously. Patient was successfully treated by laser optical internal urethrotomy (OIU, excision of duplicated urethra, and reduction urethroplasty in a single stage.

  15. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  16. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management.

    Science.gov (United States)

    Balaji, Dhiraj K; Basavaraju, Mamatha

    2015-01-01

    Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP) for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD). We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  17. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management

    Directory of Open Access Journals (Sweden)

    Dhiraj K Balaji

    2015-01-01

    Full Text Available Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD. We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  18. Intestinal Duplication Cyst presenting as Volvulus: A rare case report with Review of Literatures

    Directory of Open Access Journals (Sweden)

    Prasan Kumar Hota

    2015-03-01

    Full Text Available Intestinal duplication cyst is a rare congenital anomaly occurring any where along the alimentary tract, from mouth to anus. They can present with numerous complications like perforation, bleeding or intestinal obstruction. We report a rare case  of intestinal duplication cyst of ileum with acute intestinal obstruction due to volvulus with review of literature.

  19. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  1. 46 CFR Sec. 5 - Responsibility for duplicating copies of NSA-WORKSMALREP Contract.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Responsibility for duplicating copies of NSA-WORKSMALREP Contract. Sec. 5 Section 5 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL... INDIVIDUAL CONTRACT FOR MINOR REPAIRS-NSA-WORKSMALREP Sec. 5 Responsibility for duplicating copies of NSA...

  2. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  3. Paracentric inversion of chromosome 2 associated with cryptic duplication of 2q14 and deletion of 2q37 in a patient with autism.

    Science.gov (United States)

    Devillard, Françoise; Guinchat, Vincent; Moreno-De-Luca, Daniel; Tabet, Anne-Claude; Gruchy, Nicolas; Guillem, Pascale; Nguyen Morel, Marie-Ange; Leporrier, Nathalie; Leboyer, Marion; Jouk, Pierre-Simon; Lespinasse, James; Betancur, Catalina

    2010-09-01

    We describe a patient with autism and a paracentric inversion of chromosome 2q14.2q37.3, with a concurrent duplication of the proximal breakpoint at 2q14.1q14.2 and a deletion of the distal breakpoint at 2q37.3. The abnormality was derived from his mother with a balanced paracentric inversion. The inversion in the child appeared to be cytogenetically balanced but subtelomere FISH revealed a cryptic deletion at the 2q37.3 breakpoint. High-resolution single nucleotide polymorphism array confirmed the presence of a 3.5 Mb deletion that extended to the telomere, and showed a 4.2 Mb duplication at 2q14.1q14.2. FISH studies using a 2q14.2 probe showed that the duplicated segment was located at the telomeric end of chromosome 2q. This recombinant probably resulted from breakage of a dicentric chromosome. The child had autism, mental retardation, speech and language delay, hyperactivity, growth retardation with growth hormone deficiency, insulin-dependent diabetes, and mild facial dysmorphism. Most of these features have been previously described in individuals with simple terminal deletion of 2q37. Pure duplications of the proximal chromosome 2q are rare and no specific syndrome has been defined yet, so the contribution of the 2q14.1q14.2 duplication to the phenotype of the patient is unknown. These findings underscore the need to explore apparently balanced chromosomal rearrangements inherited from a phenotypically normal parent in subjects with autism and/or developmental delay. In addition, they provide further evidence indicating that chromosome 2q terminal deletions are among the most frequently reported cytogenetic abnormalities in individuals with autism.

  4. Rectal duplication in an adult: unusual cause of a buttock mass. Report of a case.

    Science.gov (United States)

    Monek, O; Martin, L; Heyd, B; Mantion, G

    1999-06-01

    Duplications of the rectum are extremely rare embryologic events, with almost 70 cases reported in the world literature. We report on a 39-year-old female patient with a duplication of the rectum. Physical examination showed a left buttock mass; rectal examination revealed the presence of a painless mass compressing the rectum posterolaterally, confirmed by computerized tomography. The patient was operated on with a abdominal then a sacrococcygeal approach. After a complete excision, the postoperative course was unremarkable. Histology revealed a rectal duplication lined with heterotopic cylindric ciliated epithelium. This case shows that the diagnosis of rectal duplication is difficult and can be confused with other types of anorectal pathology. The presence of heterotopic ciliated epithelium has rarely been described. Complete excision of the duplication should be possible in most cases using a transcoccygeal, transanal, or abdominoperineal approach, depending on anatomic considerations.

  5. Large tubular colonic duplication in an adult treated with a small midline incision

    Science.gov (United States)

    Yong, Yuen Geng; Jung, Kyung Uk; Cho, Yong Beom; Yun, Seong Hyeon; Kim, Hee Cheol; Lee, Woo Yong

    2012-01-01

    Tubular colonic duplication presenting in adults is rare and difficult to diagnose preoperatively. Only a few cases have been reported in the literature. We report a case of a 29-year-old lady presenting with a long history of chronic constipation, abdominal mass and repeated episodes of abdominal pain. The abdominal-pelvic computed tomography scan showed segmental bowel wall thickening thought to be small bowel, and dilatation with stasis of intraluminal content. The provisional diagnosis was small bowel duplication. She was scheduled for single port laparoscopic resection. However, a T-shaped tubular colonic duplication at sigmoid colon was found intraoperatively. Resection of the large T-shaped tubular colonic duplication containing multiple impacted large fecaloma and primary anastomosis was performed. There was no perioperative complication. We report, herein, the case of a T-shaped tubular colonic duplication at sigmoid colon in an adult who was successfully treated through mini-laparotomy assisted by single port laparoscopic surgery. PMID:22403754

  6. Duplicated collecting system of a kidney complicated with hydronephrosis - diagnostic methods review: A case report

    International Nuclear Information System (INIS)

    Osmanski, P.; Plucinska, I.; Calka, K.; Kedzierski, B.; Jazwiec, P.

    2008-01-01

    Duplicated collecting system of a kidney occurs in 1.7-4.2% of the population. It is a complex, unilateral or bilateral, congenital abnormality of the pyelocalyceal system and the ureter. The 2 ureters fuse to form a single ureteral orifice or empty separately into the bladder (ureter duplex). Duplicated collecting systems with complete ureteric duplication may lead to developing vesicoureteral reflux, hydronephrosis, and urinary infection. This article presents a case of a 49-year-old woman with duplicated collecting system and hydronephrosis in the upper pole. The anomaly was diagnosed using urography, ultrasonography and computed tomography examination.The best method for diagnostics of the duplicated pyelocalyceal system complicated by hydronephrosis is computed tomography examination, especially multislice computed tomography. The authors present also the options for therapy (author)

  7. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  8. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  9. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  10. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  11. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  12. Static, Lightweight Includes Resolution for PHP

    NARCIS (Netherlands)

    M.A. Hills (Mark); P. Klint (Paul); J.J. Vinju (Jurgen)

    2014-01-01

    htmlabstractDynamic languages include a number of features that are challenging to model properly in static analysis tools. In PHP, one of these features is the include expression, where an arbitrary expression provides the path of the file to include at runtime. In this paper we present two

  13. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  14. Nutrient intake of working women in Bangkok, Thailand, as studied by total food duplicate method.

    Science.gov (United States)

    Matsuda-Inoguchi, N; Shimbo, S; Zhang, Z W; Srianujata, S; Banjong, O; Chitchumroonchokchai, C; Watanabe, T; Nakatsuka, H; Higashikawa, K; Ikeda, M

    2000-03-01

    To establish a general view of food habits in Thailand, and to make a quantitative assessment of rice dependency of Thai people. Cross-sectional study. Community. 52 non-smoking and non-habitually drinking adult women in Bangkok participated in the study. The participants offered 24 h food duplicates and peripheral blood samples, and underwent clinical examination including anthropometry. The duplicates were subjected to nutritional evaluation taking advantage of the Thai food composition tables (FCTs), and analyzed for eight nutrient elements by inductively coupled plasma mass spectrometry (ICP-MS). The participants took 1630 kcal from 55 g protein (63% from animal sources), 57 g lipid (mostly from vegetable oil), and 224 g carbohydrate (60% from rice) daily. Nutrient intake at lunch was as large as that at dinner. About a half of the women had insufficient energy intake (ie 120%). Protein intake was sufficient in most cases, whereas lipid intake was in excess in more than a half of the women. Ca, Fe, Mg, Zn and possibly P intakes were below the RDA values in many participants. FCT-based estimates agreed well with the ICP-MS measures in cases of Fe and Ca but tended to be greater than the measures by 50% with regard to P. Lunch as substantial as dinner for Thai urbanites. There was a marked dependency on rice as an energy source. Whereas protein intake is generally sufficient, the intake of Ca (and to a lesser extent Fe) was insufficient in a majority of the study participants. Dai-ichi Mutual Life Insurance, Japan; the Ministry of Health and Welfare, the government of Japan.

  15. Restriction of the Patau syndrome to duplication of 13q22{yields}q.32 and possible role of interphase nuclear structure

    Energy Technology Data Exchange (ETDEWEB)

    Helali, A.N.; Jafolla, A.K.; Oumsiych, M.B. [Duke Univ. Medical Center, Durham, NC (United States)

    1994-09-01

    A 10-year-old white male presented with mild microcephaly, slight growth and psychomotor retardation, soft fleshy ears, and normal facial features except for thin lips. No other significant anomalies were reported except for tethered cord discovered at age 8 years. The karyotype was found to be 46,XY,der(18)t(13;18)(q32;p11.32)pat. The mild phenotype appears to be primarily due to the duplication of 13q32{yields}qter. None of the cardinal features of trisomy 13 are found in cases of duplication of bands 13q22 to qter. This case shows that Patau syndrome phenotype does not originate by duplication of 13q32{yields}qter and may thus be restricted to 13q22 to 13q32. The variability in phenotypes points to an alternative explanation to the classical one of additive and interactive gene effects. This model involves effects of changes in chromosome position in the interphase nucleus on gene expression.

  16. Duplicate Address Detection Table in IPv6 Mobile Networks

    Science.gov (United States)

    Alisherov, Farkhod; Kim, Taihoon

    In IP networks, each computer or communication equipment needs an IP address. To supply enough IP addresses, the new Internet protocol IPv6 is used in next generatoion mobile communication. Although IPv6 improves the existing IPv4 Internet protocol, Duplicate Address Detection (DAD) mechanism may consume resources and suffer from long delay. DAD is used to ensure whether the IP address is unique or not. When a mobile node performs an inter-domain handoff, it will first generate a new IP and perform a DAD procedure. The DAD procedure not only wastes time but also increases the signaling load on Internet. In this paper, the author proposes a new DAD mechanism to speed up the DAD procedure. A DAD table is created in access or mobility routers in IP networks and record all IP addresses of the area. When a new IP address needs to perform DAD, it can just search in the DAD table to confirm the uniqueness of the address.

  17. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  19. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  20. Detection and analysis of ancient segmental duplications in mammalian genomes.

    Science.gov (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A

    2018-05-07

    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  1. Evaluation of a patient with classical Ehlers-Danlos syndrome due to a 9q34 duplication affecting COL5A1.

    Science.gov (United States)

    Kuroda, Yukiko; Ohashi, Ikuko; Naruto, Takuya; Ida, Kazumi; Enomoto, Yumi; Saito, Toshiyuki; Nagai, Jun-Ichi; Kurosawa, Kenji

    2018-03-09

    Ehlers-Danlos syndrome classical type is a connective tissue disorder characterized by skin hyperextensibility, atrophic scarring, and joint hypermobility. The condition typically results from mutations in COL5A1 or COL5A2 leading to the functional haploinsufficiency. Here, we report of a 24-year-old male with mild intellectual disability, dysmorphic features, and a phenotype consistent with Ehlers-Danlos syndrome classical type. A copy number variant-calling algorithm from panel sequencing data identified the deletions exons 2-11 and duplications of exons 12-67 within COL5A1. Array comparative genomic hybridization confirmed a 94 kb deletion at 9q34.3 involving exons 2-11 of COL5A1, and a 3.4 Mb duplication at 9q34.3 involving exons 12-67 of COL5A1. © 2018 Japanese Teratology Society.

  2. An LMNB1 Duplication Caused Adult-Onset Autosomal Dominant Leukodystrophy in Chinese Family: Clinical Manifestations, Neuroradiology and Genetic Diagnosis

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-07-01

    Full Text Available Autosomal dominant adult-onset demyelinating leukodystrophy (ADLD is a very rare neurological disorder featured with late onset, slowly progressive central nervous system demyelination. Duplication or over expression of the lamin B1 (LMNB1 gene causes ADLD. In this study, we undertook a comprehensive clinical evaluation and genetic detection for a Chinese family with ADLD. The proband is a 52-year old man manifested with autonomic abnormalities, pyramidal tract dysfunction. MRI brain scan identified bilateral symmetric white matter (WM hyper-intensities in periventricular and semi-oval WM, cerebral peduncles and middle cerebellar peduncles. The proband has a positive autosomal dominant family history with similar clinical manifestations with a trend of genetic anticipation. In order to understand the genetic cause of the disease in this family, target exome capture based next generation sequencing has been done, but no causative variants or possibly pathogenic variants has been identified. However, Multiplex ligand-dependent probe amplification (MLPA showed whole duplication of LMNB1 gene which is co-segregated with the disease phenotype in this family. This is the first genetically confirmed LMNB1 associated ADLD pedigree from China.

  3. Pattern of Duplicate Presentations at National Hematology-Oncology Meetings: Influence of the Pharmaceutical Industry.

    Science.gov (United States)

    Ramchandren, Radhakrishnan; Schiffer, Charles A

    2016-03-01

    The major large US hematology-oncology meetings sponsored by the American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) have specific guidelines in place discouraging submission of scientific information presented previously at other meetings. Nonetheless, duplicate submissions are frequent. The incidence and motivations for duplicate hematologic presentations and the influence of the pharmaceutical industry on this process have not been thoroughly analyzed. Therefore, were viewed four consecutive ASH and ASCO meetings to assess the frequency of duplicate abstract presentations. All abstracts presented at ASCO2010 in the area of malignant hematology were compared with abstracts from ASCO and ASH 2009 and ASH 2010, and funding sources were reviewed. More than half (54%) of all abstracts submitted to ASCO 2010 acknowledged pharmaceutical company support. Almost one third (31%) of ASCO 2010 abstracts were resubmitted in the 2-year time period, and it was notable that a high fraction (75%) of these duplicate abstracts had pharmaceutical industry sponsorship, compared with 42% of the abstracts that were submitted only once. Despite current guidelines prohibiting duplicate abstract presentation, a substantial proportion (31%) of abstracts at large international hematology-oncology meetings are duplicative, with potential negative consequences. In addition, a disproportionate percentage of the duplicate abstracts rely on pharmaceutical industry support (75%), suggesting that marketing strategies may be a motivation for some of these repetitive submissions.

  4. [Partial facial duplication (a rare diprosopus): Case report and review of the literature].

    Science.gov (United States)

    Es-Seddiki, A; Rkain, M; Ayyad, A; Nkhili, H; Amrani, R; Benajiba, N

    2015-12-01

    Diprosopus, or partial facial duplication, is a very rare congenital abnormality. It is a rare form of conjoined twins. Partial facial duplication may be symmetric or not and may involve the nose, the maxilla, the mandible, the palate, the tongue and the mouth. A male newborn springing from inbred parents was admitted at his first day of life for facial deformity. He presented with hypertelorism, 2 eyes, a tendency to nose duplication (flatted large nose, 2 columellae, 2 lateral nostrils separated in the midline by a third deformed hole), two mouths and a duplicated maxilla. Laboratory tests were normal. The cranio-facial CT confirmed the maxillary duplication. This type of cranio-facial duplication is a rare entity with about 35 reported cases in the literature. Our patient was similar to a rare case of living diprosopus reported by Stiehm in 1972. Diprosopus is often associated with abnormalities of the gastrointestinal tract, the central nervous system, the cardiovascular and respiratory systems and with a high incidence of cleft lip and palate. Surgical treatment consists in the resection of the duplicated components. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  6. Penile duplication and two anal openings; report of a very rare case.

    Science.gov (United States)

    Bakheet, Mohamed Abdel Al M; Refaei, Mohammad

    2012-03-01

    Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. A 21 days old Egyptian neonate is reported with complete penile duplication and two scrotums with each one carrying two palpable testes. Both penises have normal shaft with normally located meatus. Clear urine voids from both meati spontaneously. The child had also a fold of redundant skin about 4×5 cm at the anal region in which two separate anal openings are present. In rectal examination we found two normal anuses passing stool spontaneously. Ascending (voiding) cystourethrography revealed two penises with two separate meatuses and one bladder from which the two urethras go out separately. Intravenous pyelogram (IVP) revealed two normal kidneys and ureters. Barium study revealed duplication of rectum and colon, otherwise normal GIT. In our review of the literature, we did not come across any other case of this variety of the penile duplication and congenital presence of two anuses. Unfortunately the patient expired before any surgical correction.

  7. Multidetector row computed tomography and ultrasound characteristics of caudal vena cava duplication in dogs.

    Science.gov (United States)

    Bertolini, Giovanna; Diana, Alessia; Cipone, Mario; Drigo, Michele; Caldin, Marco

    2014-01-01

    Caudal vena cava duplication has been rarely reported in small animals. The purpose of this retrospective study was to describe characteristics of duplicated caudal vena cava in a large group of dogs. Computed tomography (CT) and ultrasound databases from two hospitals were searched for canine reports having the diagnosis "double caudal vena cava." One observer reviewed CT images for 71 dogs and two observers reviewed ultrasound images for 21 dogs. In all CT cases, the duplication comprised two vessels that were bilaterally symmetrical and approximately the same calibre (similar to Type I complete duplication in humans). In all ultrasound cases, the duplicated caudal vena cava appeared as a distinct vessel running on the left side of the abdominal segment of the descending aorta and extending from the left common iliac vein to the left renal vein. The prevalence of caudal vena cava duplication was 0.46% for canine ultrasound studies and 2.08% for canine CT studies performed at these hospitals. Median body weight for affected dogs was significantly lower than that of unaffected dogs (P dogs, caudal vena cava duplication should be differentiated from other vascular anomalies when planning surgeries and for avoiding misdiagnoses. © 2014 American College of Veterinary Radiology.

  8. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  9. Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy

    Directory of Open Access Journals (Sweden)

    van Ommen Gert-Jan B

    2007-07-01

    Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.

  10. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  11. JCE Feature Columns

    Science.gov (United States)

    Holmes, Jon L.

    1999-05-01

    The Features area of JCE Online is now readily accessible through a single click from our home page. In the Features area each column is linked to its own home page. These column home pages also have links to them from the online Journal Table of Contents pages or from any article published as part of that feature column. Using these links you can easily find abstracts of additional articles that are related by topic. Of course, JCE Online+ subscribers are then just one click away from the entire article. Finding related articles is easy because each feature column "site" contains links to the online abstracts of all the articles that have appeared in the column. In addition, you can find the mission statement for the column and the email link to the column editor that I mentioned above. At the discretion of its editor, a feature column site may contain additional resources. As an example, the Chemical Information Instructor column edited by Arleen Somerville will have a periodically updated bibliography of resources for teaching and using chemical information. Due to the increase in the number of these resources available on the WWW, it only makes sense to publish this information online so that you can get to these resources with a simple click of the mouse. We expect that there will soon be additional information and resources at several other feature column sites. Following in the footsteps of the Chemical Information Instructor, up-to-date bibliographies and links to related online resources can be made available. We hope to extend the online component of our feature columns with moderated online discussion forums. If you have a suggestion for an online resource you would like to see included, let the feature editor or JCE Online (jceonline@chem.wisc.edu) know about it. JCE Internet Features JCE Internet also has several feature columns: Chemical Education Resource Shelf, Conceptual Questions and Challenge Problems, Equipment Buyers Guide, Hal's Picks, Mathcad

  12. New features in MEDM

    International Nuclear Information System (INIS)

    Evans, K. Jr.

    1999-01-01

    MEDM, which is derived from Motif Editor and Display Manager, is the primary graphical interface to the EPICS control system. This paper describes new features that have been added to MEDM in the last two years. These features include new editing capabilities, a PV Info dialog box, a means of specifying limits and precision, a new implementation of the Cartesian Plot, new features for several objects, new capability for the Related Display, help, a user-configurable Execute Menu, reconfigured start-up options, and availability for Windows 95/98/NT. Over one hundred bugs have been fixed, and the program is quite stable and in extensive use

  13. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  14. Giant T-shaped duplication of the transverse colon. A case report.

    Science.gov (United States)

    Trotovsek, Blaz; Hribernik, Marija; Gvardijancic, Diana; Jelenc, Franc

    2006-01-01

    A case of long diverticular colonic duplication producing acute abdominal pain in a 6-year-old girl is presented. Physical examination showed no signs of acute abdomen at the initial presentation. After a pain-free interval, there was a sudden onset of severe abdominal pain and a large tumor in the lower abdomen was observed. A plain x-ray showed an enormously dilated colonic pouch filled with gas. Excision of the T-shaped duplication and small part of the transverse colon was successful. Because of extensive fibrotic changes in the colon near the opening of duplication, a resection margin of at least 2 cm is recommended.

  15. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    Energy Technology Data Exchange (ETDEWEB)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P. [Service de Neuroradiologie, Hopital Roger Salengro, CHRU Lille (France); Rouland, V. [Service de Neonatologie, Hopital Roger Salengro, CHRU Lille (France); Francke, J.P. [Departement d`Anatomie, Faculte de Medicine, Universite de Lille (France)

    1998-05-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.) With 2 figs., 3 refs.

  16. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    International Nuclear Information System (INIS)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P.; Rouland, V.; Francke, J.P.

    1998-01-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.)

  17. Scintigraphic detection of 'yo-yo' phenomenon in incomplete ureteric duplication

    International Nuclear Information System (INIS)

    Chu, Winnie C.W.; Chan, Kam-wing; Metreweli, Constantine

    2003-01-01

    'Yo-yo' reflux in an incompletely duplicated renal system was demonstrated on 99m Tc-mercaptoacetyltriglycine (MAG3) renal scintigraphy in a 7-year-old girl presenting with low-grade fever and pyelonephritis. Incomplete duplication and a bifid renal pelvis, which may be seen in up to 4% of the North American population, occasionally causes symptoms because of recurrent urinary tract infection or loin pain. 99m Tc-MAG3 renal scintigraphy can demonstrate 'yo-yo' reflux in patients with incomplete renal duplication and should be considered in cases with unexplained loin pain, even if 99m Tc-dimercaptosuccinic acid (DMSA) renal scintigraphy is normal. (orig.)

  18. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases.

    Science.gov (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E

    2000-03-13

    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  19. Anal canal duplication and triplication: a rare entity with different presentations.

    Science.gov (United States)

    Palazon, P; Julia, V; Saura, L; de Haro, I; Bejarano, M; Rovira, C; Tarrado, X

    2017-05-01

    Anal canal duplication (ACD) is the rarest of gastrointestinal duplications. Few cases have been reported. Most cases present as an opening in the midline, posterior to the normal anus. The aim of our revision is to contribute with eight new cases, some of them with unusual presentations: five presented as the typical form, one with a perianal nodule, and two presented as two separate orifices (anal canal triplication). Complete excision was performed in all patients with no complications. ACD is the most distal and the least frequent digestive duplication. Its treatment should be surgical excision, to avoid complications such as abscess, fistulization, or malignization. Anal canal triplication has never been described before.

  20. Can the US shale revolution be duplicated in Europe?

    International Nuclear Information System (INIS)

    Saussay, Aurelien

    2015-04-01

    Over the past decade, the rapid increase in shale gas and shale oil production in the United States has profoundly changed energy markets in North America, and has led to a significant decrease in American natural gas prices. The possible existence of large shale deposits in Europe, mainly in France, Poland and the United Kingdom, has fostered speculation on whether the 'shale revolution', and its accompanying macro-economic impacts, could be duplicated in Europe. However, a number of uncertainties, notably geological, technological and regulatory, make this possibility unclear. We present a techno-economic model, SHERPA (Shale Exploitation and Recovery Projection and Analysis), to analyze the main determinants of the profitability of shale wells and plays. We calibrate our model using production data from the leading American shale plays. We use SHERPA to estimate three shale gas production scenarios exploring different sets of geological and technical hypotheses for the largest potential holder of shale gas deposits in Europe, France. Even considering that the geology of the potential French shale deposits is favorable to commercial extraction, we find that under assumptions calibrated on U.S. production data, natural gas could be produced at a high breakeven price of $8.6 per MMBtu, and over a 45 year time-frame have a net present value of $19.6 billion - less than 1% of 2012 French GDP. However, the specificities of the European context, notably high deposit depth and stricter environmental regulations, could increase drilling costs and further decrease this low profitability. We find that a 40% premium over American drilling costs would make shale gas extraction uneconomical. Absent extreme well productivity, it appears very difficult for shale gas extraction to have an impact on European energy markets comparable to the American shale revolution. (author)

  1. Featuring animacy

    Directory of Open Access Journals (Sweden)

    Elizabeth Ritter

    2015-01-01

    Full Text Available Algonquian languages are famous for their animacy-based grammatical properties—an animacy based noun classification system and direct/inverse system which gives rise to animacy hierarchy effects in the determination of verb agreement. In this paper I provide new evidence for the proposal that the distinctive properties of these languages is due to the use of participant-based features, rather than spatio-temporal ones, for both nominal and verbal functional categories (Ritter & Wiltschko 2009, 2014. Building on Wiltschko (2012, I develop a formal treatment of the Blackfoot aspectual system that assumes a category Inner Aspect (cf. MacDonald 2008, Travis 1991, 2010. Focusing on lexical aspect in Blackfoot, I demonstrate that the classification of both nouns (Seinsarten and verbs (Aktionsarten is based on animacy, rather than boundedness, resulting in a strikingly different aspectual system for both categories. 

  2. Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

    Science.gov (United States)

    Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

    2008-03-01

    Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

  3. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  4. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  5. The complete mitochondrial genome of the enigmatic bigheadedturtle (Platysternon): description of unusual genomic features and thereconciliation of phylogenetic hypotheses based on mitochondrial andnuclear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Parham, James F.; Feldman, Chris R.; Boore, Jeffrey L.

    2005-12-28

    The big-headed turtle (Platysternon megacephalum) from east Asia is the sole living representative of a poorly-studied turtle lineage (Platysternidae). It has no close living relatives, and its phylogenetic position within turtles is one of the outstanding controversies in turtle systematics. Platysternon was traditionally considered to be close to snapping turtles (Chelydridae) based on some studies of its morphology and mitochondrial (mt) DNA, however, other studies of morphology and nuclear (nu) DNA do not support that hypothesis. We sequenced the complete mt genome of Platysternon and the nearly complete mt genomes of two other relevant turtles and compared them to turtle mt genomes from the literature to form the largest molecular dataset used to date to address this issue. The resulting phylogeny robustly rejects the placement of Platysternon with Chelydridae, but instead shows that it is a member of the Testudinoidea, a diverse, nearly globally-distributed group that includes pond turtles and tortoises. We also discovered that Platysternon mtDNA has large-scale gene rearrangements and possesses two, nearly identical, control regions, features that distinguish it from all other studied turtles. Our study robustly determines the phylogenetic placement of Platysternon and provides a well-resolved outline of major turtle lineages, while demonstrating the significantly greater resolving power of comparing large amounts of mt sequence over that of short fragments. Earlier phylogenies placing Platysternon with chelydrids required a temporal gap in the fossil record that is now unnecessary. The duplicated control regions and gene rearrangements of the Platysternon mt DNA probably resulted from the duplication of part of the genome and then the subsequent loss of redundant genes. Although it is possible that having two control regions may provide some advantage, explaining why the control regions would be maintained while some of the duplicated genes were eroded

  6. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  7. Craniofacial duplication (diprosopus): report of a case with a review of the literature.

    Science.gov (United States)

    Amr, S S; Hammouri, M F

    1995-01-01

    A case of craniofacial duplication (diprosopus) is presented. Details on this rare form of conjoined twins are described, and the proposed theories of its embryogenesis are discussed with brief review of the pertinent literature.

  8. Role of computed tomography in oesophageal duplications. Report of two cases

    International Nuclear Information System (INIS)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M.

    1995-01-01

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs

  9. Constitutional Tandem Duplication of 9q34 that Truncates EHMT1 in a Child with Ganglioglioma

    Science.gov (United States)

    Cheung, Hannah C.; Yatsenko, Svetlana A.; Kadapakkam, Meena; Legay, Hélène; Su, Jack; Lupski, James R.; Plon, Sharon E.

    2011-01-01

    Point mutations of EHMT1 or deletions and duplications of chromosome 9q34.3 are found in patients with variable neurologic and developmental disorders. Here, we present a child with congenital cataract, developmental and speech delay who developed a metastatic ganglioglioma with progression to anaplastic astrocytoma. Molecular analysis identified a novel constitutional tandem duplication in 9q34.3 with breakpoints in intron 1 of TRAF2 and intron 16 of EHMT1 generating a fusion transcript predicted to encode a truncated form of EHMT1. The ganglioglioma showed complex chromosomal aberrations with further duplication of the dup9q34. Thus, this unique tandem 9q34.3 duplication may impact brain tumor formation. PMID:21681934

  10. MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.

    Science.gov (United States)

    Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S

    2012-04-01

    Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

  11. 48 CFR 1852.208-81 - Restrictions on Printing and Duplicating.

    Science.gov (United States)

    2010-10-01

    ..., presswork, duplicating, silk screen processes, binding, microform, and the end items of such processes and... one sheet, size 8-1/2×11 inches (215×280 mm), one side only, and one color ink. (d) This clause does...

  12. Bilateral inferior vena cava filter insertion in a patient with duplication of the infrarenal vena cava.

    LENUS (Irish Health Repository)

    Leong, S

    2010-06-19

    BACKGROUND: Inferior vena cava (IVC) filter insertion is a commonly performed procedure for indications such as recurrent pulmonary emboli or contraindication to anticoagulation. Symptomatic duplication of the IVC is exceedingly rare with only a handful of cases being described in the literature. AIM: We report an unusual case of a patient with symptomatic duplication of the IVC. RESULT: A 53-year-old woman presented at our hospital for resection of a cerebral metastasis from a non-small cell lung cancer following a recent diagnosis of bilateral lower limb deep venous thrombosis. This required perioperative reversal of anticoagulation and IVC filter insertion. Conventional venography performed during filter insertion documented the existence of a duplicated IVC. CONCLUSION: We present a case of a symptomatic duplication of the IVC requiring filter insertion. We review the developmental anatomy of the IVC along with the diagnostic findings and management strategies available.

  13. Epicardial oesophageal duplication with hiatal hernia in a case of Turner's syndrome

    International Nuclear Information System (INIS)

    Tamburrini, O.; Cigliano, S.; Esposito, G.; Cucchiara, S.

    1983-01-01

    The authors of this paper report the first case of epicardial oesophageal duplication causing hiatal hernia in a patient afflicted with Turner's syndrome, and they discuss its possible etiology. (orig.)

  14. Retroperitoneal duplication cyst with a fistulous tract to the vagina: a case report.

    Science.gov (United States)

    Filmar, Gilad A; Lotze, Peter M; Fisher, Hilaire W

    2012-01-01

    To describe a rare case of a retroperitoneal duplication cyst that fistulized to the vagina. Case description and discussion of a patient found to have an intestinal duplication cyst. A patient presented for a laparoscopic hysterectomy because of menorrhagia and a fibroid uterus. She also complained of recurrent urinary tract infections (UTIs) and a vaginal discharge. A retroperitoneal intestinal duplication cyst that fistulized to the vagina and caused her recurrent UTIs was identified. Surgical resection of the cyst resolved her complaint of recurrent UTIs. Retroperitoneal intestinal duplication cysts are rare congenital anomalies with vague clinical manifestations. The finding of a fistulous communication to the vagina originating from such a structure can be associated with recurrent UTIs.

  15. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  16. 9 CFR 201.28 - Duplicates of bonds or equivalents to be filed with Regional Supervisors.

    Science.gov (United States)

    2010-01-01

    ... duplicates of all endorsements, amendments, riders, indemnity agreements, and other attachments thereto, and photographically reproduced copies of any letter of credit or amendment thereto, shall be filed with the Regional...

  17. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  18. Duplicate Recording of Contracts in the Mechanization of Contract Administration Services System

    National Research Council Canada - National Science Library

    Lane, F

    1996-01-01

    ... in more than one of the system's data bases. We also evaluated whether the Mechanization of Contract Administration Services system had adequate controls to detect and prevent duplicate contract payments, and whether database errors...

  19. Volvulus U-Shaped transverse colonic duplication: Report of a case and literature review

    Directory of Open Access Journals (Sweden)

    Ruankha Bilommi

    2017-05-01

    Full Text Available Tubular duplication of the colon is very rare especially in adulthood, because it is frequently symptomatic earlier in newborn life, so only few cases are reported in literature. Several theories are proposed to explain the onset and the evolution of gut malformations as the aberrant lumen recanalization or the diverticular theory, the alteration of the lateral closure of the embryonal disk or finally the dorsal protrusion of the yolk-sac for herniation or adhesion to the ectoderm for an abnormality of the longitudinal line, but none clarifies the exact genesis of duplication [1–3]. U Shaped transverse colonic duplication with volvulus has never been reported before and very rare in condition in gastrointestinal duplication.

  20. The conversion of centrioles to centrosomes: essential coupling of duplication with segregation

    OpenAIRE

    Wang, Won-Jing; Soni, Rajesh Kumar; Uryu, Kunihiro; Bryan Tsou, Meng-Fu

    2011-01-01

    Centrioles are self-reproducing organelles that form the core structure of centrosomes or microtubule-organizing centers (MTOCs). However, whether duplication and MTOC organization reflect innate activities of centrioles or activities acquired conditionally is unclear. In this paper, we show that newly formed full-length centrioles had no inherent capacity to duplicate or to organize pericentriolar material (PCM) but acquired both after mitosis through a Plk1-dependent modification that occur...