WorldWideScience

Sample records for fast red kb

  1. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    The spectacular increase in productivity of dairy cattle has been accompanied by a decline in fertility. It is assumed that this reduction is due to the negative energy balance of high producing cows. We herein describe the dissection of a fertility QTL in Nordic Red cattle to a 660-Kb deletion...

  2. Bioremediation of acid fast red dye by Streptomyces globosus under ...

    African Journals Online (AJOL)

    Two different azo dyes known as acid fast red (AFR) and Congo red (CR) were examined for their decolorization by five strains of actinomycetes (Streptomyces globosus, Streptomyces alanosinicus, Streptomyces ruber, Streptomyces gancidicus, and Nocardiopsis aegyptia) under shake and static conditions. Streptomyces ...

  3. KB WOT Fisheries 2017

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and advance the expertise needed to carry out the statutory obligations in fisheries monitoring and advice of The Netherlands. The contents of the KB WOT Fisheries programme for 2017 reflects the scientific and management needs of the WOT

  4. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle: Additional Evidence for the Common Occurrence of Balancing Selection in Livestock

    Science.gov (United States)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole; Iso-Touru, Terhi; Guldbrandtsen, Bernt; Karim, Latifa; Nielsen, Ulrik Sander; Panitz, Frank; Aamand, Gert Pedersen; Schulman, Nina; Georges, Michel; Vilkki, Johanna; Lund, Mogens Sandø; Druet, Tom

    2014-01-01

    In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated. PMID:24391517

  5. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle: additional evidence for the common occurrence of balancing selection in livestock.

    Directory of Open Access Journals (Sweden)

    Naveen Kumar Kadri

    2014-01-01

    Full Text Available In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated.

  6. Fast and Simple Forensic Red Pen Ink Analysis Using Ultra-Performance Liquid Chromatography (UPLC)

    International Nuclear Information System (INIS)

    Lee, L.C.; Ying, S.L.; Wan Nur Syazwani Wan Mohamad Fuad; Ab Aziz Ishak; Khairul Osman

    2016-01-01

    Ultra-performance liquid chromatography (UPLC) is more effective than high performance liquid chromatography in terms of analysis speed and sensitivity. This paper presents a feasibility study on forensic red pen inks analysis using UPLC. A total of 12 varieties of red ball point pen inks were purchased from selected stationary shop. For each variety, four different individual pens were sampled to provide intra-variability within a particular variety of pen. The proposed approach is very simple that it only involved limited analysis step and chemicals. A total of 144 chromatograms were obtained from red ink entries extracted with 1.5 mL 80 % (v/v) acetonitrile. Peaks originated from pen inks were determined by comparing the chromatograms of both blank paper and blank solvent against that of ink samples. Subsequently, one-way ANOVA was conducted to discriminate all 66 possible pairs for red pen inks. Results showed that the proposed approach giving discriminating power of 95.45 %. The outcome of the study indicates that UPLC could be a fast and simple approach to red ball point pen inks analysis. (author)

  7. Fast and sensitive detection of ochratoxin A in red wine by nanoparticle-enhanced SPR.

    Science.gov (United States)

    Karczmarczyk, Aleksandra; Reiner-Rozman, Ciril; Hageneder, Simone; Dubiak-Szepietowska, Monika; Dostálek, Jakub; Feller, Karl-Heinz

    2016-09-21

    Herein, we present a fast and sensitive biosensor for detection of Ochratoxin A (OTA) in a red wine that utilizes gold nanoparticle-enhanced surface plasmon resonance (SPR). By combining an indirect competitive inhibition immunoassay and signal enhancement by secondary antibodies conjugated with gold nanoparticles (AuNPs), highly sensitive detection of low molecular weight compounds (such as OTA) was achieved. The reported biosensor allowed for OTA detection at concentrations as low as 0.75 ng mL(-1) and its limit of detection was improved by more than one order of magnitude to 0.068 ng mL(-1) by applying AuNPs as a signal enhancer. The study investigates the interplay of size of AuNPs and affinity of recognition elements affecting the efficiency of the signal amplification strategy based on AuNP. Furthermore, we observed that the presence of polyphenolic compounds in wine samples strongly interferes with the affinity binding on the surface. To overcome this limitation, a simple pre-treatment of the wine sample with the binding agent poly(vinylpyrrolidone) (PVP) was successfully applied. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Harming body as a red line for Islamic fasting (ahead of publication

    Directory of Open Access Journals (Sweden)

    Mahdi Ebrahimi

    2014-12-01

    Conclusion: Medical science can determine the effects and consequences of thirst and hunger in the specific hours of the month of Ramadan. According to the religious perspective, it has been emphasized that fasting is for maintaining man’s health, and the conditions in which there is the probability of harmfulness for man’s health due to fasting, man shouldn’t fast. As a result, medical science can determine the interval of fasting.

  9. Effect of acute and chronic moderate red or white wine consumption on fasted and postprandial lipemia in the rat.

    Science.gov (United States)

    Daher, Costantine F; Slaiby, Rita; Haddad, Najib; Boustany, Karim; Baroody, George M

    2006-06-01

    The effects of acute and chronic (10 wk) red or white wine consumption on fasted and postprandial lipemia in the rat model are reported. Fasted rats, in the acute study, were loaded intragastrically with 5 ml of an olive oil emulsion (30% w/v) in the presence or absence of wine (8% v/v ethanol), and either mesenteric lymph or blood was collected 3 h postprandially. Animals in the chronic study received either red or white wine in drinking water for a period of 10 wk (3% v/v ethanol). Blood samples were collected from animals in either the fasted state or after fat-wine loading. Postprandially, wine delayed gastric emptying, reduced lymph triacylglycerol (TAG) secretion concomitantly with increased number and decreased chylomicron (CM) size, and increased plasma TAG and CM concentrations. Phospholipid and cholesterol contents of CM, but not very-low-density lipoprotein (VLDL), were increased, indicating enhanced liver bile secretion; however, a significant increase in plasma VLDL concentration was observed. In the chronic study, a wine-fat load resulted in increased high-density lipoprotein (HDL) cholesterol concentration and less pronounced postprandial hypertriglyceridemia and hyperchylomicronemia. In the fasted state, plasma TAG and total apolipoprotein B concentrations were not modified in these animals, and an increase in HDL and a decrease in low-density lipoprotein (LDL)/HDL cholesterol ratios were observed. No liver function or intestinal lipid absorption impairment was observed. In conclusion, unlike binge drinking, chronic moderate wine consumption appears to have a cardioprotective effect in the fasted state, an effect attenuated by the observed temporary postprandial hyperchylomicronemia and hypertriglyceridemia resulting from a direct effect of alcohol on CM size and number.

  10. Fasting and postprandial serum bile acid concentrations in 10 healthy female red-eared terrapins (Trachemys scripta elegans).

    Science.gov (United States)

    Knotkova, Z; Dorrestein, G M; Jekl, V; Janouskova, J; Knotek, Z

    2008-10-25

    The fasting and postprandial serum concentrations of bile acids and other blood constituents were measured in a group of 10 clinically healthy, female, six-year-old captive red-eared terrapins (Trachemys scripta elegans). The terrapins were housed in a temperate room and maintained in four aquaria in which the water temperature ranged from 24 to 27 degrees C and the temperature above the basking site ranged from 27 to 30 degrees C. The serum concentrations of bile acids were measured four times in a period of five months, and at the second sampling the fasting and two postprandial (after 24 and 48 hours) serum concentrations of total protein, albumin, glucose, uric acid, cholesterol, triglycerides, alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase, and bile acids were determined. Coelioscopy revealed vitellogenic and previtellogenic follicles on the ovaries of all the terrapins, and eggs with calcified shells were detected in two of them. The livers were mostly pink to deep yellow in colour, with sharp edges, a smooth serosal surface, distinct large superficial vessels, and multifocal melanin deposits. Liver biopsies revealed fine, more or less oil red O-positive lipid droplets in all the hepatocytes, but in none of the cases was it considered to be pathological lipidosis. The mean (sd) bile acid concentrations ranged from 7.35 (4.52) to 10.04 (7.40) micromol/l. The fasting and postprandial concentrations were 3.1 (2.3), 4.5 (5.4) (24 hours) and 2.2 (1.5) (48 hours) micromol/l. High concentrations between 27.6 and 66.6 micromol/l were associated with lipaemia. There were no significant differences between the biochemical profiles of the fasting and postprandial serum samples.

  11. Application of adsorptive stripping voltammetry to the simultaneous determination of bismuth and copper in the presence of nuclear fast red

    International Nuclear Information System (INIS)

    Gholivand, M.B.; Romiani, A.A.

    2006-01-01

    A sensitive and selective method for the simultaneous determination of copper and bismuth by adsorptive stripping was developed using nuclear fast red (2-anthracenesulfonic acid, 4-amino-9,10-dihydro-1,3-dihydroxy-9,10-dioxo-, monosodium salt) as selective complexing agent onto hanging mercury drop electrode. In a single scan both metals gave peaks that were distinctly separated by 85 mV allowing their determination in the presence of each other. Optimal analytical conditions were found to be: nuclear fast red concentration of 80 μM, pH of 2.8 and adsorptive potential of -300 mV versus Ag/AgCl. With accumulation time of 180 s the peaks currents are proportional to concentration of copper and bismuth over the 1-100 and 5-60 ng mL -1 range with detection limits of 0.2 and 1.2 ng mL -1 , respectively. The procedure was applied to simultaneous determination of copper and bismuth in some real samples

  12. Rescue Emergency Drone (RED) for Fast Response to Medical Emergencies Due to Traffic Accidents

    DEFF Research Database (Denmark)

    Mehmood, Saqib; Kristensen, Anders Schmidt; Ahmed, Shakeel

    2017-01-01

    of inflicted persons can be reduced significantly. Smart and innovative technologies can play a pivotal role to respond faster to traffic crash emergencies comparing conventional means of transportation. For instance, Rescue Emergency Drone (RED) can provide faster and real-time crash site risk assessment...

  13. Fast core rotation in red-giant stars as revealed by gravity-dominated mixed modes

    NARCIS (Netherlands)

    Beck, P.G.; Montalban, J.; Kallinger, T.; De Ridder, J.; Aerts, C.; García, R.A.; Hekker, S.; Dupret, M.-A.; Mosser, B.; Eggenberger, P.; Stello, D.; Elsworth, Y.; Frandsen, S.; Carrier, F.; Hillen, M.; Gruberbauer, M.; Christensen-Dalsgaard, J.; Miglio, A.; Valentini, M.; Bedding, T.R.; Kjeldsen, H.; Girouard, F.R.; Hall, J.R.; Ibrahim, K.A.

    2012-01-01

    When the core hydrogen is exhausted during stellar evolution, the central region of a star contracts and the outer envelope expands and cools, giving rise to a red giant. Convection takes place over much of the star's radius. Conservation of angular momentum requires that the cores of these stars

  14. Capsaicin induces cell cycle arrest and apoptosis in human KB cancer cells.

    Science.gov (United States)

    Lin, Chia-Han; Lu, Wei-Cheng; Wang, Che-Wei; Chan, Ya-Chi; Chen, Mu-Kuan

    2013-02-25

    Capsaicin, a pungent phytochemical in a variety of red peppers of the genus Capsicum, has shown an anti-proliferative effect on various human cancer cell lines. In contrast, capsaicin has also been considered to promote the growth of cancer cells. Thus, the effects of capsaicin on various cell types need to be explored. The anti-proliferative effects of capsaicin on human KB cancer cells are still unknown. Therefore, we examined the viability, cell cycle progression, and factors associated with apoptosis in KB cells treated with capsaicin. The cell proliferation/viability and cytotoxicity of KB cells exposed to capsaicin were determined by a sulforhodamine B colorimetric assay and trypan blue exclusion. Apoptosis was detected by Hoechst staining and confirmed by western blot analysis of poly-(ADP-ribose) polymerase cleavage. Cell cycle distribution and changes of the mitochondrial membrane potential were analyzed by flow cytometry. Furthermore, the expression of caspase 3, 8 and 9 was evaluated by immunoblotting. We found that treatment of KB cells with capsaicin significantly reduced cell proliferation/viability and induced cell death in a dose-dependent manner compared with that in the untreated control. Cell cycle analysis indicated that exposure of KB cells to capsaicin resulted in cell cycle arrest at G2/M phase. Capsaicin-induced growth inhibition of KB cells appeared to be associated with induction of apoptosis. Moreover, capsaicin induced disruption of the mitochondrial membrane potential as well as activation of caspase 9, 3 and poly-(ADP-ribose) polymerase in KB cells. Our data demonstrate that capsaicin modulates cell cycle progression and induces apoptosis in human KB cancer cells through mitochondrial membrane permeabilization and caspase activation. These observations suggest an anti-cancer activity of capsaicin.

  15. Spectrophotometric determination of nitrite based on its catalytic effect on the reaction of nuclear fast red and potassium bromate

    Directory of Open Access Journals (Sweden)

    HASSAN ZAVVAR MOUSAVI

    2009-08-01

    Full Text Available A highly selective and sensitive catalytic spectrophotometric method was developed for the determination of nitrite in water samples. The method is based on its catalytic effect on the nuclear fast red–potassium bromate redox reaction in acidic medium. The reaction was followed spectrophotometrically by measuring the change in the absorbance at 518 nm of nuclear fast red 5 min after initiation of the reaction. In this study, the experimental parameters were optimized and the effects of other cations and anions on the determination of nitrite were examined. The calibration graph was linear in the range 2.0–45 µg mL-1 of nitrite. The relative standard deviations for the determination of 15 and 30 µg mL-1 of nitrite were 3.1 and 1.75 %, respectively (n = 8. The detection limit calculated from three times the standard deviation of the blank 3Sb was 0.7 µg mL-1. The method was successfully applied to the determination of nitrite in spiked tap, natural and wastewater samples.

  16. FAST

    DEFF Research Database (Denmark)

    Zuidmeer-Jongejan, Laurian; Fernandez-Rivas, Montserrat; Poulsen, Lars K.

    2012-01-01

    ABSTRACT: The FAST project (Food Allergy Specific Immunotherapy) aims at the development of safe and effective treatment of food allergies, targeting prevalent, persistent and severe allergy to fish and peach. Classical allergen-specific immunotherapy (SIT), using subcutaneous injections with aqu...

  17. ARMed SPHINCS computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.; Cheng, C.-M.; Chung, K.-M.; Persiano, G.; Yang, B.-Y.

    2016-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on an embedded microprocessor with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41KB signature on an ARM Cortex

  18. ARMed SPHINCS : computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.

    2015-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on a "very small device" with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41\\,KB signature on an ARM Cortex M3

  19. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  20. Economic design in a long-distance migrating molluscivore: how fast-fuelling red knots in Bohai Bay, China, get away with small gizzards.

    Science.gov (United States)

    Yang, Hong-Yan; Chen, Bing; Ma, Zhi-Jun; Hua, Ning; van Gils, Jan A; Zhang, Zheng-Wang; Piersma, Theunis

    2013-10-01

    We carried out an observational and experimental study to decipher how resource characteristics, in interaction with the predator's phenotype, constrain a fitness-determining performance measure, i.e. refuelling in a migrant bird. Two subspecies of red knot (Calidris canutus rogersi and C. c. piersmai) use northern Bohai Bay, Yellow Sea, China, for the final prebreeding stopover, during their 10,000-15,000 km long migrations between wintering and breeding areas. Here, they feed on small bivalves, especially 2-7 mm long Potamocorbula laevis. With an average stay of 29 days, and the need to store 80 g of fat for the onward flights to high-Arctic breeding grounds, red knots need to refuel fast. Using existing knowledge, we expected them to achieve this on the basis of (1) prey with high flesh to shell mass ratios, (2) large gizzards to crush the ingested molluscs, or (3) a combination of the two. Rejecting all three predictions, we found that red knots staging in Bohai Bay had the smallest gizzards on record (4.9 ± 0.8 g, mean ± s.e.m., N = 27), and also found that prey quality of P. laevis is much lower than predicted for the measured gizzard size (i.e. 1.3 rather than the predicted 4.5 kJ g(-1) dry shell mass, DM(shell)). The estimated handling time of P. laevis (0.2 s) is much shorter than the observed time between two prey ingestions (0.7 s), indicating that prey handling time is no constraint. Based on field observations of dropping rates and on indoor digestion trails, the shell processing rate was estimated at 3.9 mg DM(shell) s(-1), i.e. three times higher the rate previously predicted for red knots eating as fast as they can with the measured gizzard size. This is explained by the small and easily crushed P. laevis enabling high processing rates. As P. laevis also occurred in high densities, the metabolizable energy intake rate of red knots with small gizzards at 5 J s(-1) was as high as at northward staging sites elsewhere in the world. Currently

  1. Korean Red Ginseng Improves Glucose Control in Subjects with Impaired Fasting Glucose, Impaired Glucose Tolerance, or Newly Diagnosed Type 2 Diabetes Mellitus

    OpenAIRE

    Bang, Hyangju; Kwak, Jung Hyun; Ahn, Hyeon Yeong; Shin, Dong Yeob; Lee, Jong Ho

    2014-01-01

    This study was designed to evaluate the effect of Korean red ginseng (KRG) supplementation on glucose control in subjects with impaired fasting glucose (IFG), impaired glucose tolerance (IGT), or newly diagnosed type 2 diabetes mellitus (T2DM). The study was a 12-week randomized, double-blinded, placebo-controlled (5 g of KRG [n=21] or placebo [n=20] in tablet form) trial. Glucose-related biomarkers, including serum and whole blood levels of glucose, insulin, and C-peptide, were measured by 2...

  2. Red Phosphorus Nanodots on Reduced Graphene Oxide as a Flexible and Ultra-Fast Anode for Sodium-Ion Batteries.

    Science.gov (United States)

    Liu, Yihang; Zhang, Anyi; Shen, Chenfei; Liu, Qingzhou; Cao, Xuan; Ma, Yuqiang; Chen, Liang; Lau, Christian; Chen, Tian-Chi; Wei, Fei; Zhou, Chongwu

    2017-06-27

    Sodium-ion batteries offer an attractive option for potential low cost and large scale energy storage due to the earth abundance of sodium. Red phosphorus is considered as a high capacity anode for sodium-ion batteries with a theoretical capacity of 2596 mAh/g. However, similar to silicon in lithium-ion batteries, several limitations, such as large volume expansion upon sodiation/desodiation and low electronic conductance, have severely limited the performance of red phosphorus anodes. In order to address the above challenges, we have developed a method to deposit red phosphorus nanodots densely and uniformly onto reduced graphene oxide sheets (P@RGO) to minimize the sodium ion diffusion length and the sodiation/desodiation stresses, and the RGO network also serves as electron pathway and creates free space to accommodate the volume variation of phosphorus particles. The resulted P@RGO flexible anode achieved 1165.4, 510.6, and 135.3 mAh/g specific charge capacity at 159.4, 31878.9, and 47818.3 mA/g charge/discharge current density in rate capability test, and a 914 mAh/g capacity after 300 deep cycles in cycling stability test at 1593.9 mA/g current density, which marks a significant performance improvement for red phosphorus anodes for sodium-ion chemistry and flexible power sources for wearable electronics.

  3. Application of dispersive solid-phase extraction and ultra-fast liquid chromatography-tandem quadrupole mass spectrometry in food additive residue analysis of red wine.

    Science.gov (United States)

    Chen, Xiao-Hong; Zhao, Yong-Gang; Shen, Hao-Yu; Jin, Mi-Cong

    2012-11-09

    A novel and effective dispersive solid-phase extraction (dSPE) procedure with rapid magnetic separation using ethylenediamine-functionalized magnetic polymer as an adsorbent was developed. The new procedure had excellent clean-up ability for the selective removal of the matrix in red wine. An accurate, simple, and rapid analytical method using ultra-fast liquid chromatography-tandem quadrupole mass spectrometry (UFLC-MS/MS) for the simultaneous determination of nine food additives (i.e., acesulfame, saccharin, sodium cyclamate, aspartame, benzoic acid, sorbic acid, stevioside, dehydroacetic acid, and neotame) in red wine was also used and validated. Recoveries ranging from 78.5% to 99.2% with relative standard deviations ranging from 0.46% to 6.3% were obtained using the new method. All target compounds showed good linearities in the tested range with correlation coefficients (r) higher than 0.9993. The limits of quantification for the nine food additives were between 0.10 μg/L and 50.0 μg/L. The proposed dSPE-UFLC-MS/MS method was successfully applied in the food-safety risk monitoring of real red wine in Zhejiang Province, China. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  4. Thermal performance measurements on ATLAS-SCT KB forward modules

    CERN Document Server

    Donegà, M; D'Onofrio, M; Ferrère, D; Hirt, C; Ikegami, Y; Kohriki, T; Kondo, T; Lindsay, S; Mangin-Brinet, M; Niinikoski, T O; Pernegger, H; Perrin, E; Taylor, G; Terada, S; Unno, Y; Wallny, R; Weber, M

    2003-01-01

    The thermal design of the KB module is presented. A Finite Elements Analysis (FEA) has been used to finalize the module design. The thermal performance of an outer irradiated KB module has been measured at different cooling conditions. The thermal runaway of the module has been measured. The FEA model has been compared with the measurements and has been used to predict the thermal performance in a realistic SCT scenario.

  5. Wear Fast, Die Young: More Worn Teeth and Shorter Lives in Iberian Compared to Scottish Red Deer.

    Science.gov (United States)

    Pérez-Barbería, F J; Carranza, J; Sánchez-Prieto, C

    2015-01-01

    Teeth in Cervidae are permanent structures that are not replaceable or repairable; consequently their rate of wear, due to the grinding effect of food and dental attrition, affects their duration and can determine an animal's lifespan. Tooth wear is also a useful indicator of accumulative life energy investment in intake and mastication and their interactions with diet. Little is known regarding how natural and sexual selection operate on dental structures within a species in contrasting environments and how these relate to life history traits to explain differences in population rates of tooth wear and longevity. We hypothesised that populations under harsh environmental conditions should be selected for more hypsodont teeth while sexual selection may maintain similar sex differences within different populations. We investigated the patterns of tooth wear in males and females of Iberian red deer (Cervus elaphus hispanicus) in Southern Spain and Scottish red deer (C. e. scoticus) across Scotland, that occur in very different environments, using 10343 samples from legal hunting activities. We found higher rates of both incisor and molar wear in the Spanish compared to Scottish populations. However, Scottish red deer had larger incisors at emergence than Iberian red deer, whilst molars emerged at a similar size in both populations and sexes. Iberian and Scottish males had earlier tooth depletion than females, in support of a similar sexual selection process in both populations. However, whilst average lifespan for Iberian males was 4 years shorter than that for Iberian females and Scottish males, Scottish males only showed a reduction of 1 year in average lifespan with respect to Scottish females. More worn molars were associated with larger mandibles in both populations, suggesting that higher intake and/or greater investment in food comminution may have favoured increased body growth, before later loss of tooth efficiency due to severe wear. These results

  6. Modulation of NF-KB in rescued irradiated cells

    International Nuclear Information System (INIS)

    Lam, R.K.K.; Fung, Y.K.; Han, W.; Li, L.; Chiu, S.K.; Cheng, S.H.; Yu, K.N.

    2015-01-01

    Studies by different groups on the rescue effect, where unirradiated bystander cells mitigated the damages in the irradiated cells, since its discovery by the authors' group in 2011 were first reviewed. The properties of the rescue effect were then examined using a novel experimental set-up to physically separate the rescue signals from the bystander signals. The authors' results showed that the rescue effect was mediated through activation of the nuclear factor-KB (NF-KB) response pathway in the irradiated cells, and that the NF-KB activation inhibitor BAy -1 1-7082 did not affect the activation of this response pathway in the irradiated cells induced by direct irradiation. (authors)

  7. Proposed Application of Fast Fourier Transform in Near Infra Red Based Non Invasive Blood Glucose Monitoring System

    Science.gov (United States)

    Jenie, R. P.; Iskandar, J.; Kurniawan, A.; Rustami, E.; Syafutra, H.; Nurdin, N. M.; Handoyo, T.; Prabowo, J.; Febryarto, R.; Rahayu, M. S. K.; Damayanthi, E.; Rimbawan; Sukandar, D.; Suryana, Y.; Irzaman; Alatas, H.

    2017-03-01

    Worldwide emergence of glycaemic status related health disorders, such as diabetes and metabolic syndrome, is growing in alarming rate. The objective was to propose new methods for non invasive blood glucose level measurement system, based on implementation of Fast Fourier Transform methods. This was an initial-lab-scale-research. Data on non invasive blood glucose measurement are referred from Scopus, Medline, and Google Scholar, from 2011 until 2016, and was used as design references, combined with in house verification. System was developed in modular fashion, based on aforementioned compiled references. Several preliminary tests to understand relationship between LED and photo-diode responses have been done. Several references were used as non invasive blood glucose measurement tools design basis. Solution is developed in modular fashion. we have proven different sensor responses to water and glucose. Human test for non invasive blood glucose level measurement system is needed.

  8. Ultra-fast all-optical plasmonic switching in near infra-red spectrum using a Kerr nonlinear ring resonator

    Science.gov (United States)

    Nurmohammadi, Tofiq; Abbasian, Karim; Yadipour, Reza

    2018-03-01

    In this paper, an all-optical plasmonic switch based on metal-insulator-metal (MIM) nanoplasmonic waveguide with a Kerr nonlinear ring resonator is introduced and studied. Two-dimensional simulations utilizing the finite-difference time-domain algorithm are used to demonstrate an apparent optical bistability and significant switching mechanisms (in enabled-low condition: T(ON/OFF) =21.9 and in enabled-high condition: T(ON/OFF) =24.9) of the signal light arisen by altering the pump-light intensity. The proposed all-optical switching demonstrates femtosecond-scale feedback time (90 fs) and then ultra-fast switching can be achieved. The offered all-optical switch may recognize potential significant applications in integrated optical circuits.

  9. Strike fast, strike hard: the red-throated caracara exploits absconding behavior of social wasps during nest predation.

    Science.gov (United States)

    McCann, Sean; Moeri, Onour; Jones, Tanya; Scott, Catherine; Khaskin, Grigori; Gries, Regine; O'Donnell, Sean; Gries, Gerhard

    2013-01-01

    Red-throated Caracaras Ibycter americanus (Falconidae) are specialist predators of social wasps in the Neotropics. It had been proposed that these caracaras possess chemical repellents that allow them to take the brood of wasp nests without being attacked by worker wasps. To determine how caracaras exploit nests of social wasps and whether chemical repellents facilitate predation, we: (1) video recorded the birds attacking wasp nests; (2) analyzed surface extracts of the birds' faces, feet, and feathers for potential chemical repellents; and (3) inflicted mechanical damage on wasp nests to determine the defensive behavior of wasps in response to varying levels of disturbance. During caracara predation events, two species of large-bodied wasps mounted stinging attacks on caracaras, whereas three smaller-bodied wasp species did not. The "hit-and-run" predation tactic of caracaras when they attacked nests of large and aggressive wasps reduced the risk of getting stung. Our data reveal that the predation strategy of caracaras is based on mechanical disturbance of, and damage to, target wasp nests. Caracara attacks and severe experimental disturbance of nests invariably caused wasps to abscond (abandon their nests). Two compounds in caracara foot extracts [sulcatone and iridodial] elicited electrophysiological responses from wasp antennae, and were also present in defensive secretions of sympatric arboreal-nesting Azteca ants. These compounds appear not to be wasp repellents but to be acquired coincidentally by caracaras when they perch on trees inhabited with Azteca ants. We conclude that caracara predation success does not depend on wasp repellents but relies on the absconding response that is typical of swarm-founding polistine wasps. Our study highlights the potential importance of vertebrate predators in the ecology and evolution of social wasps.

  10. The KB WOT Fisheries Programme carried out in 2015

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is established to maintain and develop the expertise needed to carry out the statutory obligations of the Netherlands in fisheries monitoring and advice. It is also a flexible program which responds to changes over time in WOT requirements, fisheries management and

  11. Mapping autonomously replicating sequence elements in a 73-kb ...

    Indian Academy of Sciences (India)

    Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...

  12. EST data - RED | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...st.zip File URL: ftp://ftp.biosciencedbc.jp/archive/red/LATEST/red_est.zip File size: 629 KB Simple search U...ase Database Description Download License Update History of This Database Site Policy | Contact Us EST data - RED | LSDB Archive ...

  13. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  14. Crystal structure and thermal behavior of KB3O6

    International Nuclear Information System (INIS)

    Bubnova, R.S.; Fundamenskij, V.S.; Filatov, S.K.; Polyakova, I.G.

    2004-01-01

    The structure of potassium triborate prepared in metastable state by crystallization from melt at ∼ 800 deg C was studied by the method of X-ray diffraction analysis. It was ascertained that KB 3 O 6 belongs to monoclinic crystal system, space group P2 1 /c, a = 9.319(1), b = 6.648(1), c = 21.094(2) A, β = 94.38(1) deg, Z = 12. The compound is referred to a new structural type. Anion of the structure is a single boron-oxygen frame formed by three independent rigid triborate rings of [B 3 O 5 ] - , each of them consisting of two BO 3 triangles and BO 4 tetrahedron. Phase transformations during KB 3 O 6 heating up to 800 deg C, as well as thermal expansion in the range of 20-650 deg C, were studied [ru

  15. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  16. The simplest possible design for a KB microfocus mirror system?

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Scott, S. M.; Hawkins, D. M.; Fabrizi, F.; Moser, B.; Nisbet, G.; Sutter, J. P. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Harwin, R. C. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Department of Physics, Cavendish Laboratory, JJ Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Harwin, W. S. [School of Systems Engineering, University of Reading, Whiteknights, Reading, Berkshire, RG6 6AH (United Kingdom)

    2016-07-27

    We report a design for a Kirkpatrick-Baez (KB) microfocussing mirror system. The main components are described, with emphasis on a ‘tripod’ manipulator, where we outline the required coordinate transformation calculations. The merit of this device lies in its simplicity of design, minimal degrees of freedom, and speed and ease of setup on a beamline. Test results and an example of the mirrors in use on Diamond Beamline I16, showing a high-resolution polar domain map of KTiOPO{sub 4} with a spot size of 1.25 µm × 1.5 µm, are presented.

  17. Composition and size of Apollo asteroid 1984 KB

    Science.gov (United States)

    Bell, Jeffrey F.; Hawke, B. Ray; Brown, Robert Hamilton

    1988-01-01

    The Class S object-typifying spectral signatures of olivine, pyroxene, and NiFe metal are noted in the present reflection spectra and thermal-emission radiometric data for the earth orbit-crossing Apollo object, 1984KB; a surface material akin to the rare lodranite meteorites. While the Class S object identification is strengthened by standard asteroid thermal model's indication of an about 0.7-km radius, and albedo of about 0.16, which is inconsistent with the IR spectrum, is obtained by an analysis of the same thermal data with a bare-rock thermal model. The object must have a significant regolith despite its small size.

  18. KB WOT Fisheries 2013 - Maintaining Excellence and Innvovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Beek, van F.A.

    2013-01-01

    Het KB programma voor Visserijonderzoek onderhoudt en ontwikkelt de expertise, die nodig is om de WOT voor de visserij uit te voeren. De inhoud van het KB WOT-programma voor 2013 weerspiegelt de recente discussies tussen IMARES, CVO en EZ over de toekomstige richting van het onderzoek. De KB

  19. Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

    Science.gov (United States)

    Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

    2016-03-01

    The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

  20. Ultra-fast liquid chromatography coupled with electrospray ionization time-of-flight mass spectrometry for the rapid phenolic profiling of red maple (Acer rubrum) leaves.

    Science.gov (United States)

    Li, Chunting; Seeram, Navindra P

    2018-03-07

    The red maple (Acer rubrum) species is economically important to North America because of its sap, which is used to produce maple syrup. In addition, various other red maple plant parts, including leaves, were used as a traditional medicine by the Native Americans. Currently, red maple leaves are being used for nutraceutical and cosmetic applications but there are no published analytical methods for comprehensive phytochemical characterization of this material. Herein, a rapid and sensitive method using liquid chromatography with electrospray ionization time-of-flight tandem mass spectrometry was developed to characterize the phenolics in a methanol extract of red maple leaves and a proprietary phenolic-enriched red maple leaves extract (Maplifa™). Time-of-flight mass spectrometry and tandem mass spectrometry experiments led to the identification of 106 phenolic compounds in red maples leaves with the vast majority of these compounds also detected in Maplifa™. The compounds included 68 gallotannins, 25 flavonoids, gallic acid, quinic acid, catechin, epicatechin, and nine other gallic acid derivatives among which 11 are potentially new and 75 are being reported from red maple for the first time. The developed method to characterize red maple leaves phenolics is rapid and highly sensitive and could aid in future standardization and quality control of this botanical ingredient. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Sakharov at KB-11. The path of a genius

    International Nuclear Information System (INIS)

    Ilkaev, Radii I

    2012-01-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined. (conferences and symposia)

  2. Sakharov at KB-11. The path of a genius

    Science.gov (United States)

    Ilkaev, Radii I.

    2012-02-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined.

  3. HINT-KB: The human interactome knowledge base

    KAUST Repository

    Theofilatos, Konstantinos A.

    2012-01-01

    Proteins and their interactions are considered to play a significant role in many cellular processes. The identification of Protein-Protein interactions (PPIs) in human is an open research area. Many Databases, which contain information about experimentally and computationally detected human PPIs as well as their corresponding annotation data, have been developed. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://150.140.142.24:84/Default.aspx) which is a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, estimates a set of features of interest and computes a confidence score for every candidate protein interaction using a modern computational hybrid methodology. © 2012 IFIP International Federation for Information Processing.

  4. Mirror profile optimization for nano-focusing KB mirror

    International Nuclear Information System (INIS)

    Zhang Lin; Baker, Robert; Barrett, Ray; Cloetens, Peter; Dabin, Yves

    2010-01-01

    A KB focusing mirror width profile has been optimized to achieve nano-focusing for the nano-imaging end-station ID22NI at the ESRF. The complete mirror and flexure bender assembly has been modeled in 3D with finite element analysis using ANSYS. Bender stiffness, anticlastic effects and geometrical non-linear effects have been considered. Various points have been studied: anisotropy and crystal orientation, stress in the mirror and bender, actuator resolution and the mirror-bender adhesive bonding... Extremely high performance of the mirror is expected with residual slope error smaller than 0.6 μrad, peak-to-valley, compared to the bent slope of 3000 μrad.

  5. SAFOD Brittle Microstructure and Mechanics Knowledge Base (BM2KB)

    Science.gov (United States)

    Babaie, Hassan A.; Broda Cindi, M.; Hadizadeh, Jafar; Kumar, Anuj

    2013-07-01

    Scientific drilling near Parkfield, California has established the San Andreas Fault Observatory at Depth (SAFOD), which provides the solid earth community with short range geophysical and fault zone material data. The BM2KB ontology was developed in order to formalize the knowledge about brittle microstructures in the fault rocks sampled from the SAFOD cores. A knowledge base, instantiated from this domain ontology, stores and presents the observed microstructural and analytical data with respect to implications for brittle deformation and mechanics of faulting. These data can be searched on the knowledge base‧s Web interface by selecting a set of terms (classes, properties) from different drop-down lists that are dynamically populated from the ontology. In addition to this general search, a query can also be conducted to view data contributed by a specific investigator. A search by sample is done using the EarthScope SAFOD Core Viewer that allows a user to locate samples on high resolution images of core sections belonging to different runs and holes. The class hierarchy of the BM2KB ontology was initially designed using the Unified Modeling Language (UML), which was used as a visual guide to develop the ontology in OWL applying the Protégé ontology editor. Various Semantic Web technologies such as the RDF, RDFS, and OWL ontology languages, SPARQL query language, and Pellet reasoning engine, were used to develop the ontology. An interactive Web application interface was developed through Jena, a java based framework, with AJAX technology, jsp pages, and java servlets, and deployed via an Apache tomcat server. The interface allows the registered user to submit data related to their research on a sample of the SAFOD core. The submitted data, after initial review by the knowledge base administrator, are added to the extensible knowledge base and become available in subsequent queries to all types of users. The interface facilitates inference capabilities in the

  6. The clinical significance of HER-2 and NF-KB expression in gastric cancer.

    Science.gov (United States)

    Li, Xiaogai; Tu, Jiancheng; Zhang, Di; Xu, Zhigao; Yang, Guifang; Gong, Lingling; Yu, Mingxia

    2013-09-01

    To investigate the expression of human epidermal growth factor 2 (HER-2) and Nuclear factor-Kb (NF-KB) in gastric cancer, and the relation of these two parameters with stage, grade and metastasis of gastric cancer. The serum level of HER-2 in 75 gastric cancer patients and control participants were determined by enzyme-linked immunosorbent assay (ELISA) kits. Expression of HER-2 and NF-KB protein were detected by immunohistochemical staining (SP method) of paraffin-embedded tissues in 75 tumors (observed group) and 22 normal gastric specimens. The clinical pathological data was statistically analyzed. Serum HER-2 level were significantly increased in study group compared with those in the control group (pKB in the observed group was 24.00% (18/75) and 62.67% (47/75) respectively. The expression of HER-2 and NF-KB were not correlated with age and gender, but with stage, grade and metastasis (pKB was correlated with tumor size (pKB had a positive rate of 94.44% (17/18), but a positive rate of 52.63% (30/57) when HER-2 was negative. Expression of NF-KB in gastric cancer tissue was correlated with HER-2 expression (X2 = 8.514, pKB in gastric cancer tissue is correlated with HER-2 expression, and they may play a very important role in the progress of gastric cancer.

  7. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    Science.gov (United States)

    Doherty, Ben; Lawlor, Denise; Gillet, Jean-Pierre; Gottesman, Michael; O'Leary, John J; Stordal, Britta

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer. A Taqman low-density array was used to characterize the expression of 380 genes previously associated with chemoresistance. Identified pathways were further analyzed using cytotoxicity assays, metabolomics and western blots. KB-8-5-11 cells were sensitive to CuSO4 and the glutathione inhibitor buthionine sulphoximine. Expression of ATPase, Cu(2+) transporting alpha (ATP7A) and ATP7B were decreased at the protein and gene levels respectively in KB-8-5-11. KB-8-5-11 had decreased gene expression of glutathione S-transferase pi 1 (GSTP1), GSTA4 and GSTK1. Cisplatin treatment significantly lowered total cellular glutathione in parental KB-3-1 cells. Glutathione also tended to be lower in KB-8-5-11 cells compared to KB-3-1 cells. KB-8-5-11 cells have alterations in their copper transporters and glutathione metabolism, contributing to their cisplatin-sensitive phenotype.

  8. Mid infra-red hyper-spectral imaging with bright super continuum source and fast acousto-optic tuneable filter for cytological applications

    International Nuclear Information System (INIS)

    Farries, Mark; Ward, Jon; Valle, Stefano; Stephens, Gary; Moselund, Peter; Van der Zanden, Koen; Napier, Bruce

    2015-01-01

    Mid-IR imaging spectroscopy has the potential to offer an effective tool for early cancer diagnosis. Current development of bright super-continuum sources, narrow band acousto-optic tunable filters and fast cameras have made feasible a system that can be used for fast diagnosis of cancer in vivo at point of care. The performance of a proto system that has been developed under the Minerva project is described. (paper)

  9. Economic design in a long-distance migrating molluscivore: how fast-fuelling red knots in Bohai Bay, China, get away with small gizzards

    NARCIS (Netherlands)

    Yang, H.-Y.; Ma, Z.-J.; Hua, N.; van Gils, J.A.; Zhang, Z.-W.; Piersma, T.

    2013-01-01

    We carried out an observational and experimental study to decipher how resource characteristics, in interaction with the predator's phenotype, constrain a fitness-determining performance measure, i.e. refuelling in a migrant bird. Two subspecies of red knot (Calidris canutus rogersi and C. c.

  10. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    LENUS (Irish Health Repository)

    Doherty, Ben

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer.

  11. KB WOT Fisheries 2018: maintaining excellence and innovation in fisheries research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and develop expertise needed to carry out the Dutch statutory obligations in fisheries monitoring and advice. The KB WOT Fisheries programme developed for 2018 reflects the scientific and management needs of the WOT fisheries programme. The

  12. KB WOT Fisheries 2014 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2013-01-01

    The KB WOT Fisheries programme is fundamental to the maintenance and development of expertise needed to carry out the statutory obligations of the Dutch WOT Fisheries monitoring and advice. The structure of the KB WOT Fisheries programme 2014 is a result of discussions on the research direction and

  13. KB WOT Fisheries 2015 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2015-01-01

    The KB WOT Fisheries programme is essential to the maintenance and development of the expertise which are needed for the Dutch statutory obligations in fisheries monitoring and advice. The contents of the KB WOT Fisheries programme for 2015 reflects the needs of the research developments the WOT

  14. [Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].

    Science.gov (United States)

    Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao

    2016-01-04

    From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.

  15. Radiative transfer in disc galaxies - V. The accuracy of the KB approximation

    Science.gov (United States)

    Lee, Dukhang; Baes, Maarten; Seon, Kwang-Il; Camps, Peter; Verstocken, Sam; Han, Wonyong

    2016-12-01

    We investigate the accuracy of an approximate radiative transfer technique that was first proposed by Kylafis & Bahcall (hereafter the KB approximation) and has been popular in modelling dusty late-type galaxies. We compare realistic galaxy models calculated with the KB approximation with those of a three-dimensional Monte Carlo radiative transfer code SKIRT. The SKIRT code fully takes into account of the contribution of multiple scattering whereas the KB approximation calculates only single scattered intensity and multiple scattering components are approximated. We find that the KB approximation gives fairly accurate results if optically thin, face-on galaxies are considered. However, for highly inclined (I ≳ 85°) and/or optically thick (central face-on optical depth ≳1) galaxy models, the approximation can give rise to substantial errors, sometimes, up to ≳40 per cent. Moreover, it is also found that the KB approximation is not always physical, sometimes producing infinite intensities at lines of sight with high optical depth in edge-on galaxy models. There is no `simple recipe' to correct the errors of the KB approximation that is universally applicable to any galaxy models. Therefore, it is recommended that the full radiative transfer calculation be used, even though it is slower than the KB approximation.

  16. Establishment and characterization of arsenic trioxide resistant KB/ATO cells.

    Science.gov (United States)

    Zhang, Yun-Kai; Dai, Chunling; Yuan, Chun-Gang; Wu, Hsiang-Chun; Xiao, Zhijie; Lei, Zi-Ning; Yang, Dong-Hua; Le, X Chris; Fu, Liwu; Chen, Zhe-Sheng

    2017-09-01

    Arsenic trioxide (ATO) is used as a chemotherapeutic agent for the treatment of acute promyelocytic leukemia. However, increasing drug resistance is reducing its efficacy. Therefore, a better understanding of ATO resistance mechanism is required. In this study, we established an ATO-resistant human epidermoid carcinoma cell line, KB/ATO, from its parental KB-3-1 cells. In addition to ATO, KB/ATO cells also exhibited cross-resistance to other anticancer drugs such as cisplatin, antimony potassium tartrate, and 6-mercaptopurine. The arsenic accumulation in KB/ATO cells was significantly lower than that in KB-3-1 cells. Further analysis indicated that neither application of P-glycoprotein inhibitor, breast cancer resistant protein (BCRP) inhibitor, or multidrug resistance protein 1 (MRP1) inhibitor could eliminate ATO resistance. We found that the expression level of ABCB6 was increased in KB/ATO cells. In conclusion, ABCB6 could be an important factor for ATO resistance in KB/ATO cells. The ABCB6 level may serve as a predictive biomarker for the effectiveness of ATO therapy.

  17. Simple and fast method for iron determination in white and red wines using dispersive liquid-liquid microextraction and ultraviolet-visible spectrophotometry.

    Science.gov (United States)

    Maciel, Juliana V; Soares, Bruno M; Mandlate, Jaime S; Picoloto, Rochele S; Bizzi, Cezar A; Flores, Erico M M; Duarte, Fabio A

    2014-08-20

    This work reports the development of a method for Fe extraction in white and red wines using dispersive liquid-liquid microextraction (DLLME) and determination by ultraviolet-visible spectrophotometry. For optimization of the DLLME method, the following parameters were evaluated: type and volume of dispersive (1300 μL of acetonitrile) and extraction (80 μL of C(2)Cl(4)) solvents, pH (3.0), concentration of ammonium pyrrolidinedithiocarbamate (APDC, 500 μL of 1% m/v APDC solution), NaCl concentration (not added), and extraction time. The calibration curve was performed using the analyte addition method, and the limit of detection and relative standard deviation were 0.2 mg L(-1) and below 7%, respectively. The accuracy was evaluated by comparison of results obtained after Fe determination by graphite furnace atomic absorption spectrometry, with agreement ranging from 94 to 105%. The proposed method was applied for Fe determination in white and red wines with concentrations ranging from 1.3 to 4.7 mg L(-1).

  18. KB425796-A, a novel antifungal antibiotic produced by Paenibacillus sp. 530603.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The novel antifungal macrocyclic lipopeptidolactone, KB425796-A (1), was isolated from the fermentation broth of bacterial strain 530603, which was identified as a new Paenibacillus species based on morphological and physiological characteristics, and 16S rRNA sequences. KB425796-A (1) was isolated as white powder by solvent extraction, HP-20 and ODS-B column chromatography, and lyophilization, and was determined to have the molecular formula C79H115N19O18. KB425796-A (1) showed antifungal activities against Aspergillus fumigatus and the micafungin-resistant infectious fungi Trichosporon asahii, Rhizopus oryzae, Pseudallescheria boydii and Cryptococcus neoformans.

  19. Analysis of employee benefits in Factoring KB, a.s.v

    OpenAIRE

    Vachoušek, Stanislav

    2011-01-01

    The main objective of this work is to analyze employee benefits - benefits of Factoring KB, a.s. The theoretical part of the generally specifies the basic concepts related to employee benefits needed to cope with the analytical part. The content of this section is primarily a system of employee benefits, classification of employee benefits, tax savings and marginally trends in providing benefits. The analytical part is devoted exclusively to Factoring KB, there is an analysis of employee bene...

  20. Paradoxical effects of KB-R7943 on arrhythmogenicity in a chronic myocardial infarction rabbit model.

    Science.gov (United States)

    Chang, Po-Cheng; Wo, Hung-Ta; Lee, Hui-Ling; Wen, Ming-Shien; Chou, Chung-Chuan

    2015-07-01

    Na(+)/Ca(2+) exchanger blockade has been reported to be anti-arrhythmic in different models. The effects of KB-R7943, a Na(+)/Ca(2+) exchanger blocker, on arrhythmogenesis in hearts with chronic myocardial infarction (MI) remain unclear. Dual voltage and intracellular Ca(2+) (Cai) optical mapping was performed in nine rabbit hearts with chronic MI and four control hearts. Electrophysiology studies including inducibility of ventricular tachyarrhythmias, ventricular fibrillation dominant frequency, action potential, Cai alternans, Cai decay, and conduction velocity were performed. The same protocol was repeated in the presence of KB-R7943 (0.5, 1, and 5μM) after the baseline studies. KB-R7943 was effective in suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias in hearts with chronic MI. Surprisingly, KB-R7943 increased the inducibility of ventricular tachyarrhythmias in a dose-dependent manner (11%, 11%, 22%, and 56% at baseline and with 0.5, 1, and 5μM KB-R7943, respectively, p=0.02). Optical mapping analysis revealed that the underlying mechanisms of the induced ventricular tachyarrhythmias were probably spatially discordant alternans with wave breaks and rotors. Further analysis showed that KB-R7943 significantly enhanced both action potential (p=0.033) and Cai (p=0.001) alternans, prolonged Cai decay (tau value) in a dose-dependent manner (p=0.004), and caused heterogeneous conduction delay especially at peri-infarct zones during rapid burst pacing. In contrast, KB-R7943 had insignificant effects in control hearts. In this chronic MI rabbit model, KB-R7943 has contrasting effects on arrhythmogenesis, suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias, but enhancing the inducibility of tachyarrhythmias. The mechanism is probably the enhanced spatially discordant alternans because of prolonged Cai decay and heterogeneous conduction delay. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier

  1. The UniProtKB/Swiss-Prot knowledgebase and its Plant Proteome Annotation Program.

    Science.gov (United States)

    Schneider, Michel; Lane, Lydie; Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Bougueleret, Lydie; Bairoch, Amos

    2009-04-13

    The UniProt knowledgebase, UniProtKB, is the main product of the UniProt consortium. It consists of two sections, UniProtKB/Swiss-Prot, the manually curated section, and UniProtKB/TrEMBL, the computer translation of the EMBL/GenBank/DDBJ nucleotide sequence database. Taken together, these two sections cover all the proteins characterized or inferred from all publicly available nucleotide sequences. The Plant Proteome Annotation Program (PPAP) of UniProtKB/Swiss-Prot focuses on the manual annotation of plant-specific proteins and protein families. Our major effort is currently directed towards the two model plants Arabidopsis thaliana and Oryza sativa. In UniProtKB/Swiss-Prot, redundancy is minimized by merging all data from different sources in a single entry. The proposed protein sequence is frequently modified after comparison with ESTs, full length transcripts or homologous proteins from other species. The information present in manually curated entries allows the reconstruction of all described isoforms. The annotation also includes proteomics data such as PTM and protein identification MS experimental results. UniProtKB and the other products of the UniProt consortium are accessible online at www.uniprot.org.

  2. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  3. [Effects of metformin on human oral cancer KB cell proliferation and apoptosis in vitro].

    Science.gov (United States)

    Wang, Fang; Xu, Jincheng; Xia, Fei; Liu, Zhe; Zhao, Surong; Liu, Hao; Jiang, Zhiwen

    2014-02-01

    To investigate the effects of metformin on the proliferation and apoptosis of human oral cancer cell line KB in vitro. Human oral cancer cell line KB was exposed to different doses of metformin (0, 1.25, 2.5, 5, 10, and 20 mmol/L), and the changes in cell viability were detected using MTT assay. Colony formation of the cells was observed following an 8-day metformin exposure. The changes in mitochondrial membrane potential were measured by JC-1 assay, and PI staining was used to observe the cell apoptosis. Western blotting was employed to detect the changes in the protein expressions of GRP78 and activated caspase-3. Metformin exposure caused time- and dose-dependent suppression of KB cell proliferation, and exposure to 5 mmol/L metformin for 24, 48 and 72 h resulted in cell survival rates of 68.0%, 36.9%, and 14.5%, respectively. Metformin significantly inhibited KB cell colony formation. Exposure of the cells to increased concentrations of metformin gradually increased the apoptotic rate and decreased mitochondrial membrane potential. Metformin caused an initial up-regulation followed by a down-regulation of GRP78 expression in KB cells and increased the expression of activated caspase-3. Metformin can inhibit the proliferation and induce apoptosis of KB cells, the mechanism of which may involve the activation of the mitochondrial apoptotic pathway and endoplasmic reticulum stress.

  4. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Red giants seismology

    Science.gov (United States)

    Mosser, B.; Samadi, R.; Belkacem, K.

    2013-11-01

    The space-borne missions CoRoT and Kepler are indiscreet. With their asteroseismic programs, they tell us what is hidden deep inside the stars. Waves excited just below the stellar surface travel throughout the stellar interior and unveil many secrets: how old is the star, how big, how massive, how fast (or slow) its core is dancing. This paper intends to paparazze the red giants according to the seismic pictures we have from their interiors.

  6. Inhibition of the cardiac inward rectifier potassium currents by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Alekseeva, Eugenia I; Vornanen, Matti

    2013-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, KB-R7943 is shown to be a potent blocker of several ion currents including inward and delayed rectifier K(+) currents of cardiomyocytes. To further characterize KB-R7943 as a blocker of the cardiac inward rectifiers we compared KB-R7943 sensitivity of the background inward rectifier (IK1) and the carbacholine-induced inward rectifier (IKACh) currents in mammalian (Rattus norvegicus; rat) and fish (Carassius carassius; crucian carp) cardiac myocytes. The basal IK1 of ventricular myocytes was blocked with apparent IC50-values of 4.6×10(-6) M and 3.5×10(-6) M for rat and fish, respectively. IKACh was almost an order of magnitude more sensitive to KB-R7943 than IK1 with IC50-values of 6.2×10(-7) M for rat and 2.5×10(-7) M for fish. The fish cardiac NCX current was half-maximally blocked at the concentration of 1.9-3×10(-6) M in both forward and reversed mode of operation. Thus, the sensitivity of three cardiac currents to KB-R7943 block increases in the order IK1~INCXrectifier potassium currents, in particular IKACh, should be taken into account when interpreting the data with this inhibitor from in vivo and in vitro experiments in both mammalian and fish models. © 2013.

  7. The redesigned Forensic Research/Reference on Genetics-knowledge base, FROG-kb.

    Science.gov (United States)

    Kidd, Kenneth K; Soundararajan, Usha; Rajeevan, Haseena; Pakstis, Andrew J; Moore, Katherine N; Ropero-Miller, Jeri D

    2018-03-01

    The Forensic Resource/Reference on Genetics-knowledge base (FROG-kb) web site was introduced in 2011 and in the five years since the previous publication ongoing research into how the database can better serve forensics has resulted in extensive redesign of the database interface and functionality. Originally designed as a prototype to support forensic use of single nucleotide polymorphisms (SNPs), FROG-kb provides a freely accessible web interface that facilitates forensic practice and can be useful for teaching and research. Based on knowledge gained through its use, the web interface has been redesigned for easier navigation through the multiple components. The site also has functional enhancements, extensive new documentation, and new reference panels of SNPs with new curated data. FROG-kb focuses on single nucleotide polymorphisms (SNPs) and provides reference population data for several published panels of individual identification SNPs (IISNPs) and several published panels of ancestry inference SNPs (AISNPs). For each of the various marker panels with reference population data, FROG-kb calculates random match probabilities (RMP) and relative likelihoods of ancestry for a user-entered genotype profile (either completely or partially specified). Example genotype profiles are available and the User's Manual presents interpretation guidelines for the calculations. The extensive documentation along with ongoing updates makes FROG-kb a comprehensive tool in facilitating use of SNPs in forensic practice and education. An overview of the new FROG-kb with examples and material explaining the results of its use are presented here. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  8. A low-delay 8 Kb/s backward-adaptive CELP coder

    Science.gov (United States)

    Neumeyer, L. G.; Leblanc, W. P.; Mahmoud, S. A.

    1990-01-01

    Code excited linear prediction coding is an efficient technique for compressing speech sequences. Communications quality of speech can be obtained at bit rates below 8 Kb/s. However, relatively large coding delays are necessary to buffer the input speech in order to perform the LPC analysis. A low delay 8 Kb/s CELP coder is introduced in which the short term predictor is based on past synthesized speech. A new distortion measure that improves the tracking of the formant filter is discussed. Formal listening tests showed that the performance of the backward adaptive coder is almost as good as the conventional CELP coder.

  9. Pressure derivatives of elastic moduli of fused quartz to 10 kb

    Science.gov (United States)

    Peselnick, L.; Meister, R.; Wilson, W.H.

    1967-01-01

    Measurements of the longitudinal and shear moduli were made on fused quartz to 10 kb at 24??5??C. The anomalous behavior of the bulk modulus K at low pressure, ???K ???P 0, at higher pressures. The pressure derivative of the rigidity modulus ???G ???P remains constant and negative for the pressure range covered. A 15-kb hydrostatic pressure vessel is described for use with ultrasonic pulse instrumentation for precise measurements of elastic moduli and density changes with pressure. The placing of the transducer outside the pressure medium, and the use of C-ring pressure seals result in ease of operation and simplicity of design. ?? 1967.

  10. Study on the effect of paclitaxel nanostructure lipid carrier cooperated with radiation on the KB Cells

    International Nuclear Information System (INIS)

    Liu Min; Li Zhihui; Xu Yujie

    2011-01-01

    Objective: To investigate the cytotoxicity effect of paclitaxel nanostructure lipid carrier (TAX-NLC) cooperated with radiation treatment on the KB cells. Methods: The cytotoxicity effect of TAX-NLC compared with free paclitaxel (TAX) on the KB cells was measured by MTT assay, and the cell cycle distribution was analyzed by flow cytometry. Results: The cytotoxicity effect of TAX-NLC was stronger than that of the free TAX. And the cooperative effect between the TAX-NLC and ionized radiation were observed, the cooperative effect of TAX-NLC was stronger than that of the free TAX. Flow cytometric analysis indicated that the rearrangement of cell cycle in KB cells were induced by TAX-NLC. The more G2/M phase cells were observed in KB cells treated by TAX-NLC compared with free TAX. The effect of TAX-NLC in the rearrangement of cell cycle was stronger than that of the free TAX. Conclusion: The cytotoxicity effect of TAX-NLC is stronger than that of the free TAX. And the cooperative effect of TAX-NLC is stronger than that of the free TAX. (authors)

  11. Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry

  12. Report of the KB-WOT fisheries programme carried out in 2007

    NARCIS (Netherlands)

    Dickey-Collas, M.; Beek, van F.A.

    2008-01-01

    This report documents the activities of the KB WOT fisheries programme in 2007. It gives the results, products and documents the experienced gained by staff through the programme. It also shows how the individual projects fit into the research priority areas of WOT fisheries programme for 2007. The

  13. Identification and characterization of survivin-derived H-2Kb-restricted CTL epitopes

    DEFF Research Database (Denmark)

    Hofmann, Uta B; Voigt, Heike; Andersen, Mads H

    2009-01-01

    for potential binding K(b)-restricted octamer peptide epitopes. Two epitopes, which bind strongly to K(b), were selected to test their immunogenicity in vivo. Spleen cells from mice vaccinated by intradermal injection of mature DC pulsed with these peptides displayed reactivity to the respective epitopes...

  14. Introducing the Forensic Research/Reference on Genetics knowledge base, FROG-kb.

    Science.gov (United States)

    Rajeevan, Haseena; Soundararajan, Usha; Pakstis, Andrew J; Kidd, Kenneth K

    2012-09-01

    Online tools and databases based on multi-allelic short tandem repeat polymorphisms (STRPs) are actively used in forensic teaching, research, and investigations. The Fst value of each CODIS marker tends to be low across the populations of the world and most populations typically have all the common STRP alleles present diminishing the ability of these systems to discriminate ethnicity. Recently, considerable research is being conducted on single nucleotide polymorphisms (SNPs) to be considered for human identification and description. However, online tools and databases that can be used for forensic research and investigation are limited. The back end DBMS (Database Management System) for FROG-kb is Oracle version 10. The front end is implemented with specific code using technologies such as Java, Java Servlet, JSP, JQuery, and GoogleCharts. We present an open access web application, FROG-kb (Forensic Research/Reference on Genetics-knowledge base, http://frog.med.yale.edu), that is useful for teaching and research relevant to forensics and can serve as a tool facilitating forensic practice. The underlying data for FROG-kb are provided by the already extensively used and referenced ALlele FREquency Database, ALFRED (http://alfred.med.yale.edu). In addition to displaying data in an organized manner, computational tools that use the underlying allele frequencies with user-provided data are implemented in FROG-kb. These tools are organized by the different published SNP/marker panels available. This web tool currently has implemented general functions possible for two types of SNP panels, individual identification and ancestry inference, and a prediction function specific to a phenotype informative panel for eye color. The current online version of FROG-kb already provides new and useful functionality. We expect FROG-kb to grow and expand in capabilities and welcome input from the forensic community in identifying datasets and functionalities that will be most helpful

  15. Biomarkers’ Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM

    Directory of Open Access Journals (Sweden)

    Gretchen L. W. Heavner

    2018-02-01

    Full Text Available Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1TM, including several reductive dehalogenases (RDases and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR as a targeted approach for quantifying transcript copies in the KB-1TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10−12 to 5.9 × 10−10 microelectron equivalents per cell per hour (μeeq/cell∙h. Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA and the hydrogenase HupL (R2 = 0.83 and 0.88, respectively, but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1TM. Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1TM. The addition of oxygen induced cell stress that caused respiration

  16. Biomarkers' Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM.

    Science.gov (United States)

    Heavner, Gretchen L W; Mansfeldt, Cresten B; Debs, Garrett E; Hellerstedt, Sage T; Rowe, Annette R; Richardson, Ruth E

    2018-02-08

    Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR) rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC) containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1 TM , including several reductive dehalogenases (RDases) and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs) and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR) as a targeted approach for quantifying transcript copies in the KB-1 TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1 TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10 -12 to 5.9 × 10 -10 microelectron equivalents per cell per hour (μeeq/cell∙h). Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA) and the hydrogenase HupL (R² = 0.83 and 0.88, respectively), but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1 TM . Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1 TM . The addition of oxygen induced cell stress that caused respiration rates

  17. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    2014-01-01

    In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the nega......In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due...

  18. UniProtKB amid the turmoil of plant proteomics research

    Directory of Open Access Journals (Sweden)

    Michel eSchneider

    2012-12-01

    Full Text Available The UniProt knowledgebase (UniProtKB provides a single, centralized, authoritative resource for protein sequences and functional information. The majority of its records is based on automatic translation of coding sequences (CDS provided by submitters at the time of initial deposition to the nucleotide sequence databases (INSDC. More and more frequently, only the raw sequence of a complete genome is deposited to the nucleotide sequence databases and the gene model predictions and annotations are kept in separate, specialized model organism databases (MODs. In order to be able to provide the complete proteome of model organisms, UniProtKB had to implement pipelines for import of protein sequences from Ensembl and EnsemblGenomes.A single genome can be the target of several unrelated sequencing projects and the final assembly and gene model predictions may diverge quite significantly. In addition, several cultivars of the same species are often sequenced -1001 Arabidopsis cultivars are currently under way- and the resulting proteomes are far from being identical. Therefore, one challenge for UniProtKB is to store and organize these data in a convenient way and to clearly defined reference proteomes that should be made available to users. Manual annotation is one of the landmarks of the Swiss-Prot section of UniProtKB. Besides adding functional annotation, curators are checking, and often correcting, gene model predictions. For plants, this task is limited to Arabidopsis thaliana and Oryza sativa subsp japonica. Proteomics data providing experimental evidences confirming the existence of proteins or identifying sequence features such as post translational modifications are also imported into UniProtKB records and the knowledgebase is cross-referenced to numerous proteomics resources.

  19. Fabrication of nested elliptical KB mirrors using profile coating for synchrotron radiation X-ray focusing

    International Nuclear Information System (INIS)

    Liu Chian; Ice, G.E.; Liu, W.; Assoufid, L.; Qian, J.; Shi, B.; Khachatryan, R.; Wieczorek, M.; Zschack, P.; Tischler, J.Z.

    2012-01-01

    This paper describes fabrication methods used to demonstrate the advantages of nested or Montel optics for micro/nanofocusing of synchrotron X-ray beams. A standard Kirkpatrick-Baez (KB) mirror system uses two separated elliptical mirrors at glancing angles to the X-ray beam and sequentially arranged at 90° to each other to focus X-rays successively in the vertical and horizontal directions. A nested KB mirror system has the two mirrors positioned perpendicular and side-by-side to each other. Compared to a standard KB mirror system, Montel optics can focus a larger divergence and the mirrors can have a shorter focal length. As a result, nested mirrors can be fabricated with improved demagnification factor and ultimately smaller focal spot, than with a standard KB arrangement. The nested system is also more compact with an increased working distance, and is more stable, with reduced complexity of mirror stages. However, although Montel optics is commercially available for laboratory X-ray sources, due to technical difficulties they have not been used to microfocus synchrotron radiation X-rays, where ultra-precise mirror surfaces are essential. The main challenge in adapting nested optics for synchrotron microfocusing is to fabricate mirrors with a precise elliptical surface profile at the very edge where the two mirrors meet and where X-rays scatter. For example, in our application to achieve a sub-micron focus with high efficiency, a surface figure root-mean-square (rms) error on the order of 1 nm is required in the useable area along the X-ray footprint with a ∼0.1 mm-diameter cross section. In this paper we describe promising ways to fabricate precise nested KB mirrors using our profile coating technique and inexpensive flat Si substrates.

  20. Growth characteristics of Lactobacillus brevis KB290 in the presence of bile.

    Science.gov (United States)

    Kimoto-Nira, Hiromi; Suzuki, Shigenori; Suganuma, Hiroyuki; Moriya, Naoko; Suzuki, Chise

    2015-10-01

    Live Lactobacillus brevis KB290 have several probiotic activities, including immune stimulation and modulation of intestinal microbial balance. We investigated the adaptation of L. brevis KB290 to bile as a mechanism of intestinal survival. Strain KB290 was grown for 5 days at 37 °C in tryptone-yeast extract-glucose (TYG) broth supplemented with 0.5% sodium acetate (TYGA) containing 0.15%, 0.3%, or 0.5% bile. Growth was determined by absorbance at 620 nm or by dry weight. Growth was enhanced as the broth's bile concentration increased. Bile-enhanced growth was not observed in TYG broth or with xylose or fructose as the carbon source, although strain KB290 could assimilate these sugars. Compared with cells grown without bile, cells grown with bile had twice the cell yield (dry weight) and higher hydrophobicity, which may improve epithelial adhesion. Metabolite analysis revealed that bile induced more lactate production by glycolysis, thus enhancing growth efficiency. Scanning electron microscopy revealed that cells cultured without bile for 5 days in TYGA broth had a shortened rod shape and showed lysis and aggregation, unlike cells cultured for 1 day; cells grown with bile for 5 days had an intact rod shape and rarely appeared damaged. Cellular material leakage through autolysis was lower in the presence of bile than in its absence. Thus lysis of strain KB290 cells cultured for extended periods was suppressed in the presence of bile. This study provides new role of bile and sodium acetate for retaining an intact cell shape and enhancing cell yield, which are beneficial for intestinal survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. In vitro Cytotoxicity, Pharmacokinetics, Tissue Distribution, and Metabolism of Small-Molecule Protein Kinase D Inhibitors, kb-NB142-70 and kb-NB165-09, in Mice bearing Human Cancer Xenografts

    Science.gov (United States)

    Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.

    2012-01-01

    Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699

  2. Product (RED)

    DEFF Research Database (Denmark)

    Ponte, Stefano

    2011-01-01

    ) and the consumers who buy iconic brand products to help ‘distant others’. While in many other forms of causumerism, labels or certification systems ‘prove’ that a product is just, in RED, aid celebrities provide the proof. From the consumer point of view both labels and celebrities provide a similar simplification...... of complex social, economic, and environmental processes. At the same time, we argue that there are important distinctions as well—labels and certifications are ultimately about improving the conditions of production, whereas RED is about accepting existing production and trade systems and donating......(PRODUCT)RED™ (hereafter RED) is a cobranding initiative launched in 2006 by the aid celebrity Bono to raise money from product sales to support The Global Fund to Fight AIDS, Tuberculosis and Malaria. In this paper we argue that RED is shifting the boundaries of ‘causumerism’ (shopping...

  3. Improving Mineral Nutrition of Micropropagated Red Raspberry

    Science.gov (United States)

    In vitro propagation is important for fast multiplication of a wide range of nursery crops, including red raspberry. The variation in genetic background of the many red raspberry cultivars makes it difficult to successfully use one growth medium for all. Although most cultivars will grow on Murashig...

  4. Kirkpatrick-Baez (KB) and Lobster Eye (LE) Optics for Astronomical and Laboratory Applications

    International Nuclear Information System (INIS)

    Hudec, R.; Hudec, R.

    2010-01-01

    Most of grazing incidence (reflective) X-ray imaging systems used in astronomy and in other (laboratory) applications are based on the Wolter 1 (or modified) arrangement. But there were proposed also other designs and configurations, which are considered for future applications for both in laboratory and (finitely) in space. The Kirkpatrick-Baez (KB) lenses as well as various types of Lobster-Eye (LE) optics and MCP/Micropore optics serve as an example. Analogously to Wolter lenses, the X-rays are mostly reflected twice in these systems to create focal images. The KB systems have already found wide usage in laboratory and synchrotron, both application are reviewed and discussed in detail in this paper. While this paper focuses on future possible applications of non-Wolter grazing incidence systems in space and astronomy, we also discuss in detail applications in other areas of science, where (in contrary to astronomy) some of these systems have demonstrated their advantages

  5. Alignment of KB mirrors with at-wavelength metrology tool simulated using SRW

    Science.gov (United States)

    Idir, Mourad; Rakitin, Maksim; Gao, Bo; Xue, Junpeng; Huang, Lei; Chubar, Oleg

    2017-08-01

    Synchrotron Radiation Workshop (SRW) is a powerful synchrotron radiation simulation tool and has been widely used at synchrotron facilities all over the world. During the last decade, many types of X-ray wavefront sensors have been developed and used. In this work, we present our recent effort on the development of at-wavelength metrology simulation based on SRW mainly focused on the Hartmann Wavefront Sensor (HWS). Various conditions have been studied to verify that the simulated HWS is performing as expected in terms of accuracy. This at-wavelength metrology simulation tool is then used to align KB mirrors by minimizing the wavefront aberrations. We will present our optimization process to perform an `in situ' alignment using conditions as close as possible to the real experiments (KB mirrors with different levels of figure errors or different misalignment geometry).

  6. Structural basis for hijacking of human ACBD3 and PI4KB proteins by picornaviruses

    Czech Academy of Sciences Publication Activity Database

    Klíma, Martin; Chalupská, Dominika; Rozycki, B.; Humpolíčková, Jana; Smola, Miroslav; Horová, Vladimíra; Hexnerová, Rozálie; Veverka, Václav; Toth, D.; Balla, T.; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 129 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR(CZ) GJ17-07058Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : picornavirus * ACBD3 * PI4KB Subject RIV: CE - Biochemistry

  7. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    OpenAIRE

    Shen, Yue; Wang, Yun; Chen, Tai; Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synI...

  8. Red Sirius

    Energy Technology Data Exchange (ETDEWEB)

    Martynov, D Ya

    1976-01-01

    A hypothesis is proposed explaining the assumption that Sirius changed its colour from red in the second century to pale blue in the tenth century A.D. The hypothesis is based on the possibility of transformation of a Sirius satellite (Sirius B) from a red giant in the past to a white dwarf in the present. Such a transformation would have been accompanied by an explosion of Sirius B, which is clearly visible from the Earth. The fact that the increase in Sirius brightness by 4-5 units is not reflected in historical chronicles is attributed to the degradation of sciences in Europe in 4-10 centuries.

  9. Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

    Science.gov (United States)

    Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

    2018-06-13

    MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

  10. Identification of MHC class I H-2 Kb/Db-restricted immunogenic peptides derived from retinal proteins

    DEFF Research Database (Denmark)

    Wang, Mingjun; Bai, Fang; Pries, Mette

    2006-01-01

    PURPOSE: To identify H-2 Kb/Db-binding immunogenic peptides derived from retinal proteins. METHODS: Computer-based prediction was used to identify potentially H-2 Kb/Db-binding peptides derived from the interphotoreceptor retinol-binding protein (IRBP), soluble retinal antigen (S...... on day 21 after immunization with IRBP or IRBP and the immunogenic peptides. RESULTS: All the 21 predicted peptides were found to upregulate expression of H-2 Kb/Db on RMA-S cells. Five peptides, the two IRBP-derived peptides IRBP89-96 and IRBP(101-108), and the three PEDF-derived peptides, PEDF389....... The immunogenic peptides alone did not induce inflammation in the eyes, but they could enhance severity of uveitis induced by IRBP. CONCLUSIONS: Five of 21 H-2 Kb/Db-binding retinal protein-derived peptides were found to be immunogenic, suggesting that these peptides could function as autoantigenic epitopes...

  11. Aloin Inhibits Interleukin (IL)-1β-Stimulated IL-8 Production in KB Cells.

    Science.gov (United States)

    Na, Hee Sam; Song, Yu Ri; Kim, Seyeon; Heo, Jun-Young; Chung, Hae-Young; Chung, Jin

    2016-06-01

    Interleukin (IL)-1β, which is elevated in oral diseases including gingivitis, stimulates epithelial cells to produce IL-8 and perpetuate inflammatory responses. This study investigates stimulatory effects of salivary IL-1β in IL-8 production and determines if aloin inhibits IL-1β-stimulated IL-8 production in epithelial cells. Saliva was collected from volunteers to determine IL-1β and IL-8 levels. Samples from volunteers were divided into two groups: those with low and those with high IL-1β levels. KB cells were stimulated with IL-1β or saliva with or without IL-1 receptor agonist or specific mitogen-activated protein kinase (MAPK) inhibitors. IL-8 production was measured by enzyme-linked immunosorbent assay (ELISA). MAPK protein expression involved in IL-1β-induced IL-8 secretion was detected by Western blot. KB cells were pretreated with aloin, and its effect on IL-1β-induced IL-8 production was examined by ELISA and Western blot analysis. Saliva with high IL-1β strongly stimulated IL-8 production in KB cells, and IL-1 receptor agonist significantly inhibited IL-8 production. Low IL-1β-containing saliva did not increase IL-8 production. IL-1β treatment of KB cells induced activation of MAPK signaling molecules as well as nuclear factor-kappa B. IL-1β-induced IL-8 production was decreased by p38 and extracellular signal-regulated kinase (ERK) inhibitor treatment. Aloin pretreatment inhibited IL-1β-induced IL-8 production in a dose-dependent manner and inhibited activation of the p38 and ERK signaling pathway. Finally, aloin pretreatment also inhibited saliva-induced IL-8 production. Results indicated that IL-1β in saliva stimulates epithelial cells to produce IL-8 and that aloin effectively inhibits salivary IL-1β-induced IL-8 production by mitigating the p38 and ERK pathway. Therefore, aloin may be a good candidate for modulating oral inflammatory diseases.

  12. Cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror

    International Nuclear Information System (INIS)

    Yuan Sheng; Goldberg, Kenneth A.; Yashchuk, Valeriy V.; Celestre, Richard; McKinney, Wayne R.; Morrison, Gregory; Macdougall, James; Mochi, Iacopo; Warwick, Tony

    2011-01-01

    At the Advanced Light Source (ALS), we are developing broadly applicable, high-accuracy, in-situ, at-wavelength wavefront slope measurement techniques for Kirkpatrick-Baez (KB) mirror nano-focusing. In this paper, we report an initial cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror. This cross-check provides a validation of the in-situ shearing interferometry, currently under development at the ALS.

  13. OC-2-KB: A software pipeline to build an evidence-based obesity and cancer knowledge base.

    Science.gov (United States)

    Lossio-Ventura, Juan Antonio; Hogan, William; Modave, François; Guo, Yi; He, Zhe; Hicks, Amanda; Bian, Jiang

    2017-11-01

    Obesity has been linked to several types of cancer. Access to adequate health information activates people's participation in managing their own health, which ultimately improves their health outcomes. Nevertheless, the existing online information about the relationship between obesity and cancer is heterogeneous and poorly organized. A formal knowledge representation can help better organize and deliver quality health information. Currently, there are several efforts in the biomedical domain to convert unstructured data to structured data and store them in Semantic Web knowledge bases (KB). In this demo paper, we present, OC-2-KB (Obesity and Cancer to Knowledge Base), a system that is tailored to guide the automatic KB construction for managing obesity and cancer knowledge from free-text scientific literature (i.e., PubMed abstracts) in a systematic way. OC-2-KB has two important modules which perform the acquisition of entities and the extraction then classification of relationships among these entities. We tested the OC-2-KB system on a data set with 23 manually annotated obesity and cancer PubMed abstracts and created a preliminary KB with 765 triples. We conducted a preliminary evaluation on this sample of triples and reported our evaluation results.

  14. VenomKB, a new knowledge base for facilitating the validation of putative venom therapies.

    Science.gov (United States)

    Romano, Joseph D; Tatonetti, Nicholas P

    2015-11-24

    Animal venoms have been used for therapeutic purposes since the dawn of recorded history. Only a small fraction, however, have been tested for pharmaceutical utility. Modern computational methods enable the systematic exploration of novel therapeutic uses for venom compounds. Unfortunately, there is currently no comprehensive resource describing the clinical effects of venoms to support this computational analysis. We present VenomKB, a new publicly accessible knowledge base and website that aims to act as a repository for emerging and putative venom therapies. Presently, it consists of three database tables: (1) Manually curated records of putative venom therapies supported by scientific literature, (2) automatically parsed MEDLINE articles describing compounds that may be venom derived, and their effects on the human body, and (3) automatically retrieved records from the new Semantic Medline resource that describe the effects of venom compounds on mammalian anatomy. Data from VenomKB may be selectively retrieved in a variety of popular data formats, are open-source, and will be continually updated as venom therapies become better understood.

  15. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  16. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene; Saidi, Rabie; Hoehndorf, Robert; Martin, Maria J.; Solovyev, Victor

    2016-01-01

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  17. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene

    2016-07-08

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  18. Apoptosis-Inducing Effect of Three Medicinal Plants on Oral Cancer Cells KB and ORL-48

    Directory of Open Access Journals (Sweden)

    Mohd Zabidi Majid

    2014-01-01

    Full Text Available Brucea javanica, Azadirachta indica, and Typhonium flagelliforme are medicinal plants commonly used to treat conditions associated with tumour formation. This study aimed to determine the antiproliferative activity of these plants extracts on KB and ORL-48 oral cancer cell lines and to suggest their mode of cell death. The concentration producing 50% cell inhibition (IC50 was determined and the activity was examined under an inverted microscope. Immunohistochemistry fluorescent staining method (TUNEL was performed to indicate the mechanism of cell death and the fragmented DNA band pattern produced was obtained for verification. Compared to Azadirachta sp. and Typhonium sp., the antiproliferative activity of Brucea sp. extract was the most potent on both KB and ORL-48 cells with IC50 of 24.37 ± 1.75 and 6.67 ± 1.15 µg/mL, respectively. Signs of cell attrition were observed 24 hr after treatment. Green fluorescent spots indicating cell death by apoptosis were observed in images of both cells following treatment with all the three extracts. DNA fragments harvested from Brucea-treated cells produced bands in a ladder pattern suggesting the apoptotic effect of the extract. It is thus concluded that Brucea sp. extract exhibited cytotoxic activity on ORL-48 cells and their action mechanism is via apoptosis.

  19. Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.

    Science.gov (United States)

    Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E

    1999-01-20

    JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA. Copyright 1999

  20. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway

    Science.gov (United States)

    KIM, JAE-SUNG; PARK, MI-RA; LEE, SOOK-YOUNG; KIM, DO KYOUNG; MOON, SUNG-MIN; KIM, CHUN SUNG; CHO, SEUNG SIK; YOON, GOO; IM, HEE-JEONG; YOU, JAE-SEEK; OH, JI-SU; KIM, SU-GWAN

    2014-01-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 μM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico-A-induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and −3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico-A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer. PMID:24337492

  1. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Mi-Ra; Lee, Sook-Young; Kim, Do Kyoung; Moon, Sung-Min; Kim, Chun Sung; Cho, Seung Sik; Yoon, Goo; Im, Hee-Jeong; You, Jae-Seek; Oh, Ji-Su; Kim, Su-Gwan

    2014-02-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 µM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico‑A‑induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and -3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico‑A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer.

  2. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  3. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  4. The Half-Life of the HSV-1 1.5 kb LAT Intron is similar to the half-Life of the 2.0 kb LAT Intron

    Science.gov (United States)

    Brinkman, Kerry K.; Mishra, Prakhar; Fraser, Nigel W.

    2013-01-01

    Herpes Simplex Virus type 1 (HSV-1) establishes a latent infection in the sensory neurons of the peripheral nervous system of humans. Although about 80 genes are expressed during the lytic cycle of the virus infection, essentially only one gene is expressed during the latent cycle. This gene is known as the latency associated transcript (LAT) and it appears to play a role in the latency cycle through an anti-apoptotic function in the 5’ end of the gene and miRNA encoded along the length of the transcript which down regulate some of the viral immediate early (IE) gene products. The LAT gene is about 8.3 kb long and consists of two exons separated by an unusual intron. The intron between the exons consists of two nested introns. This arrangement of introns has been called a twintron. Furthermore, the larger (2 kb) intron has been shown to be very stable. In this study we measure the stability of the shorter 1.5 kb nested intron and find its half-life is similar to the longer intron. This was achieved by deleting the 0.5 kb overlapping intron from a plasmid construct designed to express the LAT transcript from a tet-inducible promoter, and measuring the half-life of the 1.5 kb intron in tissue culture cells. This finding supports the hypothesis that it is the common branch-point region of these nested introns that is responsible for their stability. PMID:23335177

  5. Phylogeography, salinity adaptations and metabolic potential of the Candidate Division KB1 Bacteria based on a partial single cell genome.

    Directory of Open Access Journals (Sweden)

    Lisa M Nigro

    2016-08-01

    Full Text Available Deep-sea hypersaline anoxic basins (DHABs and other hypersaline environments contain abundant and diverse microbial life that has adapted to these extreme conditions. The bacterial Candidate Division KB1 represents one of several uncultured groups that has been consistently observed in hypersaline microbial diversity studies. Here we report the phylogeography of KB1, its phylogenetic relationships to Candidate Division OP1 Bacteria, and its potential metabolic and osmotic stress adaptations based on a partial single cell amplified genome (SAG of KB1 from Orca Basin, the largest hypersaline seafloor brine basin in the Gulf of Mexico. Our results are consistent with the hypothesis – previously developed based on 14C incorporation experiments with mixed-species enrichments from Mediterranean seafloor brines - that KB1 has adapted its proteins to elevated intracellular salinity, but at the same time KB1 apparently imports glycine betaine; this compatible solute is potentially not limited to osmoregulation but could also serve as a carbon and energy source.

  6. STUDI NILAI ANAK, JUMLAH ANAK YANG DIINGINKAN, DAN KEIKUTSERTAAN ORANG TUA DALAM PROGRAM KB

    Directory of Open Access Journals (Sweden)

    Hartoyo Hartoyo

    2011-01-01

    Full Text Available  This research was to analyze the correlation between mother and family characteristics with value of children and the influence factors of demand for children and involvement of parent in family planning programme. This research involved 60 families who be acceptor and non-acceptor KB that were selected randomly. Mother’s age had significant correlation with power and influence dimension, working status of mother had significant correlation with stimulation and fun dimension and morality dimension, mother’s education had significant correlation with morality dimension, the number of living children had significant correlation with adult status and social identity dimension and economic utility and security in old age dimension. Moreover, family size variable had significant positive influence to demand for children. Beside that, age of mother’s first marriage and difference of the number of living children with demand for children had significant positive influence to participating family in family planning programme. 

  7. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    Science.gov (United States)

    Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni; Mitchell, Leslie A.; Luo, Zhouqing; Fan, Yanqun; Zhou, Baojin; Wen, Bo; Tan, Fengji; Wang, Yujia; Zi, Jin; Xie, Zexiong; Li, Bingzhi; Yang, Kun; Richardson, Sarah M.; Jiang, Hui; French, Christopher E.; Nieduszynski, Conrad A.; Koszul, Romain; Marston, Adele L.; Yuan, Yingjin; Wang, Jian; Bader, Joel S.; Dai, Junbiao; Boeke, Jef D.; Xu, Xun; Cai, Yizhi; Yang, Huanming

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synII is mainly caused by the deletion of 13 tRNAs. By both complementation assays and SCRaMbLE, we targeted and debuged the origin of a growth defect at 37°C in glycerol medium, which is related to misregulation of the HOG response. Despite the subtle differences, the synII strain shows highly consistent biological processes comparable to the native strain. PMID:28280153

  8. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  9. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  10. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  11. The reverse-mode NCX1 activity inhibitor KB-R7943 promotes prostate cancer cell death by activating the JNK pathway and blocking autophagic flux.

    Science.gov (United States)

    Long, Zhou; Chen, BaiJun; Liu, Qian; Zhao, Jiang; Yang, ZhenXing; Dong, XingYou; Xia, LiuBin; Huang, ShengQuan; Hu, XiaoYan; Song, Bo; Li, LongKun

    2016-07-05

    We explored the effects of KB-R7943, an inhibitor of reverse-mode NCX1 activity, in prostate cancer (PCa). NCX1 was overexpressed in PCa tissues and cell lines, and higher NCX1 levels were associated higher PCa grades. At concentrations greater than 10 μM, KB-R7943 dose-dependently decreased PC3 and LNCaP cell viability. KB-R7943 also increased cell cycle G1/S phase arrest and induced apoptosis in PC3 cells. KB-R7943 increased autophagosome accumulation in PCa cells as indicated by increases in LC3-II levels and eGFP-LC3 puncta. Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux. KB-R7943 induced autophagosome accumulation mainly by downregulating the PI3K/AKT/m-TOR pathway and upregulating the JNK pathway. In xenograft experiments, KB-R7943 inhibited tumor growth. Combined treatment with KB-R7943 and an autophagy inhibitor inhibited growth and increased apoptosis. These results indicate that KB-R7943 promotes cell death in PCa by activating the JNK signaling pathway and blocking autophagic flux.

  12. NcoI dimorphic site located 8kb 3' to the human apolipoprotein AIV (APOA4) gene

    Energy Technology Data Exchange (ETDEWEB)

    Coleman, R T; Malloy, M J; Kane, J P; Frossard, P M

    1988-02-11

    pA4C3 a 0.5kb fragment from the 3' end of the human apolipoprotein AIV cDNA was isolated from a human intestine cDNA library and cloned into the EcoRI site of the plasmid pUC18. NcoI (CCATGG) (New England Biolabs) detects a single two-allele polymorphism with a band at either 18.6kb or at 12.6kb. The human apolipoprotein AI-CIII-AIV gene complex has been assigned to the long arm of chromosome 11 by Southern blot analysis of human-Chinese hamster cell hybrids. Co-dominant segregation was demonstrated in one family of six individuals.

  13. Fluorescent Inhibitors as Tools To Characterize Enzymes: Case Study of the Lipid Kinase Phosphatidylinositol 4-Kinase IIIβ (PI4KB).

    Science.gov (United States)

    Humpolickova, Jana; Mejdrová, Ivana; Matousova, Marika; Nencka, Radim; Boura, Evzen

    2017-01-12

    The lipid kinase phosphatidylinositol 4-kinase IIIβ (PI4KB) is an essential host factor for many positive-sense single-stranded RNA (+RNA) viruses including human pathogens hepatitis C virus (HCV), Severe acute respiratory syndrome (SARS), coxsackie viruses, and rhinoviruses. Inhibitors of PI4KB are considered to be potential broad-spectrum virostatics, and it is therefore critical to develop a biochemical understanding of the kinase. Here, we present highly potent and selective fluorescent inhibitors that we show to be useful chemical biology tools especially in determination of dissociation constants. Moreover, we show that the coumarin-labeled inhibitor can be used to image PI4KB in cells using fluorescence-lifetime imaging microscopy (FLIM) microscopy.

  14. Na+/Ca2+ exchange inhibitor, KB-R7943, attenuates contrast-induced acute 
kidney injury.

    Science.gov (United States)

    Yang, Dingwei; Yang, Dingping; Jia, Ruhan; Tan, Jin

    2013-01-01

    Intracellular Ca2+ overload is considered to be a key factor in contrast-induced acute kidney injury (CI-AKI). The Na+/Ca2+ exchanger (NCX) system is one of the main pathways of intracellular Ca2+ overload. We investigated the effects of KB-R7943, an inhibitor of the reverse mode of NCX, on CI-AKI in a rat model. Rats were divided into control group, CI-AKI group and pretreatment groups (with KB-R7943 dose of 5 or 10 mg/kg). CI-AKI was induced by diatrizoate administration in rats with cholesterol-supplemented diet for 8 weeks. Renal function and renal hemodynamics were determined 1 day following contrast medium administration. Renal histopathology was observed by light microscope. Renal tubular apoptosis was examined by TUNEL. Renal endothelin-1 (ET-1) was measured by radioimmunoassay. Renal malondialdehyde (MDA) and catalase (CAT) were measured as oxidative markers. Levels of serum creatinine (Scr), renal ET-1, MDA and CAT, and resistance index (RI) of renal blood vessels increased significantly in CI-AKI rats. The 
increases in Scr and RI of renal blood vessels induced by diatrizoate were suppressed significantly and 
dose-dependently by pretreatment with KB-R7943. Histopathological and TUNEL results showed that 
the contrast medium-induced severe renal tubular 
necrosis and apoptosis were significantly and dose-dependently attenuated by KB-R7943. KB-R7943 significantly suppressed the increment of renal ET-1 content and MDA and CAT level induced by contrast medium administration. Activation of the reverse mode of NCX, followed by ET-1 overproduction and increased oxidative stress, seems to play an important role in the pathogenesis of CI-AKI. The inhibitor of the reverse mode of NCX, KB-R7943, has renoprotective effects on CI-AKI.

  15. Chemoresistance to 5-FU inhibited by 635 nm LED irradiation in CD133+ KB cell line.

    Science.gov (United States)

    Kim, Donghwi; Park, Mineon; Jang, Hyunwoong; Hyun, Hoon; Lim, Wonbong

    2018-01-01

    Consistent with cancer stem cell theory, a small fraction of cancer cells, described as cancer stem cells (CSCs), may promote tumor recurrence and anti-cancer drug resistance. Therefore, much effort has been devoted to the development of CSC targeted therapy to vanquish drug resistance. In this study, we have investigated the effect of multiple light-emitting diode (LED) irradiation treatments with conventional anti-cancer drugs on CSC-like oral cancer cells that acquired stemness by ectopic over expression of CD133. To evaluate combined LED irradiation anti-cancer drug effects, we investigated the chemosensitizing effect of 635 nm irradiation on 5-fluorouracil (5FU)-treated KB CD133+ and KB Vec cells, interrogating the underlying molecular mechanisms associated with stemness and apoptosis that are responsible for chemopreventive activity. In addition, combination therapy with LED irradiation and 5-FU treatment was carried out in KB CD133+ and KB Vec cell-inoculated mouse models. LED irradiation of 635 nm inhibited CSC-like properties consistent with a decrease in OCT4 and NANOG protein expression, reducing colony-forming ability. In addition, LED irradiation enhanced 5-FU-induced cytotoxicity and improved 5-FU chemosensitivity in KB CD133+ via enhancement of apoptosis. These findings were validated in vivo, wherein LED irradiation combined with 5-FU treatment inhibited tumor growth in KB CD133+ -inoculated mice. Collectively, our results provide novel evidence for 635 nm irradiation-induced 5-FU chemosensitization of CSC in oral cancer. In addition, this research highlights that 635 nm LED irradiation may serve as an adjunct treatment to conventional chemotherapeutic drugs in patients with oral cancer.

  16. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

    Science.gov (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

    2016-01-01

    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  17. Melting relations in the Fe-rich portion of the system FeFeS at 30 kb pressure

    Science.gov (United States)

    Brett, R.; Bell, P.M.

    1969-01-01

    The melting relations of FeFeS mixtures covering the composition range from Fe to Fe67S33 have been determined at 30 kb pressure. The phase relations are similar to those at low pressure. The eutectic has a composition of Fe72.9S27.1 and a temperature of 990??C. Solubility of S in Fe at elevated temperatures at 30 kb is of the same order of magnitude as at low pressure. Sulfur may have significantly lowered the melting point of iron in the upper mantle during the period of coalescence of metal prior to core formation in the primitive earth. ?? 1969.

  18. PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

    Science.gov (United States)

    Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

    2016-10-06

    With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most

  19. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    Science.gov (United States)

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  20. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    FluKB is a knowledge-based system focusing on data and analytical tools for influenza vaccine discovery. The main goal of FluKB is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune...... responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  1. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Science.gov (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  2. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  3. Analysis of gene and protein name synonyms in Entrez Gene and UniProtKB resources

    KAUST Repository

    Arkasosy, Basil

    2013-05-11

    Ambiguity in texts is a well-known problem: words can carry several meanings, and hence, can be read and interpreted differently. This is also true in the biological literature; names of biological concepts, such as genes and proteins, might be ambiguous, referring in some cases to more than one gene or one protein, or in others, to both genes and proteins at the same time. Public biological databases give a very useful insight about genes and proteins information, including their names. In this study, we made a thorough analysis of the nomenclatures of genes and proteins in two data sources and for six different species. We developed an automated process that parses, extracts, processes and stores information available in two major biological databases: Entrez Gene and UniProtKB. We analysed gene and protein synonyms, their types, frequencies, and the ambiguities within a species, in between data sources and cross-species. We found that at least 40% of the cross-species ambiguities are caused by names that are already ambiguous within the species. Our study shows that from the six species we analysed (Homo Sapiens, Mus Musculus, Arabidopsis Thaliana, Oryza Sativa, Bacillus Subtilis and Pseudomonas Fluorescens), rice (Oriza Sativa) has the best naming model in Entrez Gene database, with low ambiguities between data sources and cross-species.

  4. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-12-18

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

    Science.gov (United States)

    Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

    1992-05-01

    Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

  6. Reactive oxygen species are crucial for hydroxychavicol toxicity toward KB epithelial cells.

    Science.gov (United States)

    Jeng, J H; Wang, Y J; Chang, W H; Wu, H L; Li, C H; Uang, B J; Kang, J J; Lee, J J; Hahn, L J; Lin, B R; Chang, M C

    2004-01-01

    Betel quid (BQ) chewing shows a strong correlation to the incidence of oral submucous fibrosis (OSF), leukoplakia and oral cancer. BQ contains mainly areca nut, lime, Piper betle leaf (PBL) and the inflorescence of P. betle (IPB). Hydroxychavicol (4-allyl-catechol, HC), as a major phenolic compound in PBL and IPB, is shown to induce oxidative stress, glutathione (GSH) depletion and cell cycle deregulation. Using bivariate BrdU/PI flow cytometry, KB cells in DNA synthesis (S phase) are shown to be sensitive to the toxic effect of HC and show cell cycle arrest and apoptosis following exposure to 0.1 and 0.3 mM HC. HC-induced apoptosis and cell cycle arrest are associated with mitochondrial membrane potential (delta Psim) depolarization as revealed by a decrease in rhodamine fluorescence. N-acetyl-L-cysteine (1 mM), superoxide dismutase (100 U/ml) and catalase (1000 U/ml) were effective in prevention of HC-induced GSH depletion (as indicated by chloromethylfluorescein fluorescence), reactive oxygen species (ROS) production (by dichlorofluorescein fluorescence), cell cycle arrest and apoptosis. However, dimethylthiourea (2 mM), neocuproine (1 mM), 1,10-phenanthroline (200 microM) and desferrioxamine (0.5 mM) showed little effect on HC-induced cell changes. HC elevated the cellular and mitochondrial GSH levels at moderate concentrations (0.05-0.1 mM), whereas at a concentration of 0.3 mM, inhibitory effects were noted. These results indicate that HC consumption may be associated with BQ-chewing-related oral mucosal diseases via GSH depletion, ROS production, mitochondrial dysfunction, cell cycle disturbance and the induction of apoptosis. These events are related to the production of superoxide radicals and hydrogen peroxide.

  7. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  8. Protective effect of Na(+)/Ca (2+) exchange blocker KB-R7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rats.

    Science.gov (United States)

    Lv, Yan; Ren, Yongkui; Sun, Lufan; Wang, Shaojun; Wei, Minjie; Jia, Dalin

    2013-06-01

    Reverse-mode activation of the Na(+)/Ca(2+) exchanger (NCX) during reperfusion following ischemia contributes to Ca(2+) overload and cardiomyocyte injury. KB-R7943, a selective reverse-mode NCX inhibitor, reduces lethal reperfusion injury under non-ischemic conditions. However, the effectiveness of this compound under ischemic conditions is unclear. In the present study, we studied the effects of KB-R7943 in an animal model of hyperlipidemia. We further assessed whether the K ATP (+) channels are involved in potential protective mechanisms of KB-R7943. Twelve rats were fed normal chow, while 48 animals were fed a high cholesterol diet. The hearts from the control and hypercholesterolemic rats were subjected to 25 min of global ischemia followed by a 120-min reperfusion. Before this, hearts from hypercholesterolemic rats either received no intervention (cholesterol control group) or were pre-treated with 1 μM KB-R7943 and 0.3 μM of K ATP (+) blocker glibenclamide or glibenclamide alone. The infarction sizes (triphenyltetrazolium assay) were 35 ± 5.0 % in the control group, 46 ± 8.7 % in the cholesterol control group (p KB-R7943 group (p KB-R7943 and glibenclamide group, and 47 ± 8.5 % in the glibenclamide group (p KB-R7943 attenuated the magnitude of cell apoptosis (p KB-R7943 reduces the infarction size and apoptosis in hyperlipidemic animals through the activation of K ATP (+) channels.

  9. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  10. Fast reactors

    International Nuclear Information System (INIS)

    Vasile, A.

    2001-01-01

    Fast reactors have capacities to spare uranium natural resources by their breeding property and to propose solutions to the management of radioactive wastes by limiting the inventory of heavy nuclei. This article highlights the role that fast reactors could play for reducing the radiotoxicity of wastes. The conversion of 238 U into 239 Pu by neutron capture is more efficient in fast reactors than in light water reactors. In fast reactors multi-recycling of U + Pu leads to fissioning up to 95% of the initial fuel ( 238 U + 235 U). 2 strategies have been studied to burn actinides: - the multi-recycling of heavy nuclei is made inside the fuel element (homogeneous option); - the unique recycling is made in special irradiation targets placed inside the core or at its surroundings (heterogeneous option). Simulations have shown that, for the same amount of energy produced (400 TWhe), the mass of transuranium elements (Pu + Np + Am + Cm) sent to waste disposal is 60,9 Kg in the homogeneous option and 204.4 Kg in the heterogeneous option. Experimental programs are carried out in Phenix and BOR60 reactors in order to study the feasibility of such strategies. (A.C.)

  11. Fast ejendom

    DEFF Research Database (Denmark)

    Pagh, Peter

    Bogen omfatter en gennemgang af lovgivning, praksis og teori vedrørende køb af fast ejendom og offentligretlig og privatretlig regulering. Bogen belyser bl.a. de privatretlige emner: købers misligholdelsesbeføjelser, servitutter, naboret, hævd og erstatningsansvar for miljøskader samt den...

  12. Receptor-mediated targeting of 67Ga-Deferoxamine-Folate to folate-receptor-positive human kb tumor xenografts

    International Nuclear Information System (INIS)

    Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.

    1999-01-01

    The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical

  13. Deletion of 2.7 kb near HOXD3 in an Arabian horse with occipitoatlantoaxial malformation.

    Science.gov (United States)

    Bordbari, M H; Penedo, M C T; Aleman, M; Valberg, S J; Mickelson, J; Finno, C J

    2017-06-01

    In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM. © 2017 Stichting International Foundation for Animal Genetics.

  14. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  15. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  16. Paracetamol - toxicity and microbial utilization. Pseudomonas moorei KB4 as a case study for exploring degradation pathway.

    Science.gov (United States)

    Żur, Joanna; Wojcieszyńska, Danuta; Hupert-Kocurek, Katarzyna; Marchlewicz, Ariel; Guzik, Urszula

    2018-09-01

    Paracetamol, a widely used analgesic and antipyretic drug, is currently one of the most emerging pollutants worldwide. Besides its wide prevalence in the literature only several bacterial strains able to degrade this compound have been described. In this study, we isolated six new bacterial strains able to remove paracetamol. The isolated strains were identified as the members of Pseudomonas, Bacillus, Acinetobacter and Sphingomonas genera and characterized phenotypically and biochemically using standard methods. From the isolated strains, Pseudomonas moorei KB4 was able to utilize 50 mg L -1 of paracetamol. As the main degradation products, p-aminophenol and hydroquinone were identified. Based on the measurements of specific activity of acyl amidohydrolase, deaminase and hydroquinone 1,2-dioxygenase and the results of liquid chromatography analyses, we proposed a mechanism of paracetamol degradation by KB4 strain under co-metabolic conditions with glucose. Additionally, toxicity bioassays and the influence of various environmental factors, including pH, temperature, heavy metals at no-observed-effective-concentrations, and the presence of aromatic compounds on the efficiency and mechanism of paracetamol degradation by KB4 strain were determined. This comprehensive study about paracetamol biodegradation will be helpful in designing a treatment systems of wastewaters contaminated with paracetamol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Ornithine aminotransferase (OAT): recombination between an X-linked OAT sequence (7.5 kb) and the Norrie disease locus.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Spence, M A; Cortessis, V; Sparkes, R S; Kivlin, J D; Mohandas, T; Inana, G

    1990-01-01

    A human ornithine aminotransferase (OAT) locus has been mapped to the Xp11.2, as has the Norrie disease locus. We used a cDNA probe to investigate a 3-generation UCLA family with Norrie disease; a 4.2-kb RFLP was detected and a maximum lod score of 0.602 at zero recombination fraction was calculated. We used the same probe to study a second multigeneration family with Norrie disease from Utah. A different RFLP of 7.5 kb in size was identified and a recombinational event between the OAT locus represented by this RFLP and the disease loci was observed. Linkage analysis of these two loci in this family revealed a maximum load score of 1.88 at a recombination fraction of 0.10. Although both families have affected members with the same disease, the lod scores are reported separately because the 4.2- and 7.5-kb RFLPs may represent two different loci for the X-linked OAT.

  18. Red blood cell production

    Science.gov (United States)

    ... bone marrow of bones. Stem cells in the red bone marrow called hemocytoblasts give rise to all of the formed elements in blood. If a hemocytoblast commits to becoming a cell called a proerythroblast, it will develop into a new red blood cell. The formation of a red blood ...

  19. KB-R7943, a plasma membrane Na(+)/Ca(2+) exchanger inhibitor, blocks opening of the mitochondrial permeability transition pore.

    Science.gov (United States)

    Wiczer, Brian M; Marcu, Raluca; Hawkins, Brian J

    2014-01-31

    The isothiourea derivative, KB-R7943, inhibits the reverse-mode of the plasma membrane sodium/calcium exchanger and protects against ischemia/reperfusion injury. The mechanism through which KB-R7943 confers protection, however, remains controversial. Recently, KB-R7943 has been shown to inhibit mitochondrial calcium uptake and matrix overload, which may contribute to its protective effects. While using KB-R7943 for this purpose, we find here no evidence that KB-R7943 directly blocks mitochondrial calcium uptake. Rather, we find that KB-R7943 inhibits opening of the mitochondrial permeability transition pore in permeabilized cells and isolated liver mitochondria. Furthermore, we find that this observation correlates with protection against calcium ionophore-induced mitochondrial membrane potential depolarization and cell death, without detrimental effects to basal mitochondrial membrane potential or complex I-dependent mitochondrial respiration. Our data reveal another mechanism through which KB-R7943 may protect against calcium-induced injury, as well as a novel means to inhibit the mitochondrial permeability transition pore. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. The protective effect of Na+/Ca2+ exchange blocker kb-r7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rat.

    Science.gov (United States)

    Ren, Yongkui; Deng, Liju; Cai, Yunfei; Lv, Yan; Jia, Dalin

    2014-11-01

    KB-R7943 reduces lethal reperfusion injury under normal conditions, but its effectiveness under certain pathological states is in dispute. In the present study, we sought to determine the effect of KB-R7943 in hyperlipidemic animals and assess if the K ATP (+) are involved in the protective mechanisms. In group 1 (G1), isolated rat hearts underwent 25 min global ischemia (GI) and 120 min reperfusion (R). In group 2 (G2), G1 was repeated but the animals were subjected to a 1.5 % cholesterol-enriched diet during 6 weeks (hypercholesterolemic animals). In group 3 (G3), G2 was repeated but 1 μM KB-R7943 was added to the perfusate for 10 min from the start of reperfusion. In group 4 (G4), G3 was repeated, and glibenclamide (K ATP (+) , blocker, 0.3 μM) was administered. The infarct size was measured by triphenyltetrazolium. The infarct size was 35 ± 5.0 % in G1 and 46 ± 8.7 % in G2 (P KB-R7943 reduced the infarct size (28.6 ± 3.3 % in G3 vs. G2, P KB-R7943 attenuated apoptotic cell (G3 vs. G2, P KB-R7943. Thus, diet-induced hypercholesterolemia enhances myocardial injury; KB-R7943 reduces infarct size and apoptosis in hyperlipidemic animals through the activation of K(+)ATP channels.

  1. [Effect of smokers'sera on Porphyromonas gingivalis internalizing KB cells and the expression of matrix metalloproteinase-1, -9 and tissue inhibitor of metalloproteinase-1].

    Science.gov (United States)

    Wang, Hongyan; Tan, Lisi; Liu, Junchao; Li, Qian; Pan, Yaping; Zhong, Ming

    2014-01-01

    To investigate the effects of serum from smoking individuals or non-smoking individuals with periodontitis on Porphyromonas gingivalis (Pg) internalizing KB cells, and the expression of matrix metalloproteinase(MMP)-1, MMP-9, tissue inhibitor of metalloproteinase-1 (TIMP-1) in the culture supernatant of KB cells. The venous blood of 20 periodontitis patients' (10 smoking and 10 non-smoking) was extracted under the informed consent and centrifuged for serum. The smoking-individual serum (Y group) and non-smoking-individual (N group) serum were added to the model of Pg internalizing KB cells for 12 hours, plated on brain-heart infusion (BHI) and incubated anaerobically at 37 °C for 5 days. The colony forming units (CFU) of cell-invasive bacteria were estimated by colony counting. MMP-1, MMP-9 and TIMP-1 protein levels in culture supernatant were determined by enzyme-linked immunosorbent assay(ELISA) in the two groups following co-culture of Pg with KB cells for 12 hours. The CFU were (11.2 ± 1.1)×10(4), (12.6 ± 1.2)×10(4), (44.7 ± 1.3)×10(4) CFU/ml when adding 200, 400, 800 µl Y-group serum to the model of Pg co-culture with KB cells and when the serum was extracted from N group, the CFU were (33.6 ± 1.4)×10(4),(38.9 ± 1.1)×10(4), (11.2 ± 1.2)×10(4) CFU/ml respectively. When 200, 400, 800 µl Y group-serum was added to co-culture fluid of Pg internalizing KB cells, the concentrations of MMP-1 secreted from KB cells were (107.2 ± 21.5), (165.9 ± 20.2), (434.4 ± 48.0) µg/L respectively, the concentrations of MMP-9 were (3.99 ± 0.29), (4.21 ± 0.61), (5.62 ± 0.47) µg/L respectively, the concentrations of TIMP-1 were (401.3 ± 12.7), (418.3 ± 28.5), (637.3 ± 37.3) µg/L. When the serum (200, 400, 800 µl) extracted from N group, the concentration of MMP-1 and MMP-9 secreted by KB cell were (77.6 ± 10.8), (84.7 ± 10.2) and (98.2 ± 9.7) µg/L and (3.84 ± 0.52), (4.02 ± 0.68), (4.25 ± 0.37) µg/L, respectively. The concentration of TIMP-1 were

  2. Fast tomosynthesis

    International Nuclear Information System (INIS)

    Klotz, E.; Linde, R.; Tiemens, U.; Weiss, H.

    1978-01-01

    A system has been constructed for fast tomosynthesis, whereby X-ray photographs are made of a single layer of an object. Twenty five X-ray tubes illuminate the object simultaneously at different angles. The resulting coded image is decoded by projecting it with a pattern of lenses that have the same form as the pattern of X-ray tubes. The coded image is optically correlated with the pattern of the sources. The scale of this can be adjusted so that the desired layer of the object is portrayed. Experimental results of its use in a hospital are presented. (C.F.)

  3. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D

    2018-03-01

    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  4. Constitutive Activation of NF-KB in Prostate Carcinoma Cells Through a Positive Feedback Loop: Implication of Inducible IKK-Related Kinase (IKKi)

    National Research Council Canada - National Science Library

    Budunova, Irina V

    2005-01-01

    The overall goal of this project is to understand the role of inducible IKK-related kinase IKKi in constitutive activation of anti-apoptotic transcription factor NF-KB prostate carcinoma (PC) cells...

  5. The effect of Lactobacillus brevis KB290 against irritable bowel syndrome: a placebo-controlled double-blind crossover trial

    Directory of Open Access Journals (Sweden)

    Murakami Katsumi

    2012-08-01

    Full Text Available Abstract Background Irritable bowel syndrome (IBS is a functional disorder of the digestive tract that causes chronic abdominal symptoms. We evaluated the effects of Lactobacillus brevis KB290 (KB290, which has been demonstrated to be effective at improving bowel movements and the composition of intestinal microflora, on IBS symptoms. Methods We performed a placebo control double-blind cross matched trial. Thirty-five males and females (aged 6 years and above who had been diagnosed with IBS according to the Rome III criteria were divided into 2 groups, and after a 4-week pre-trial observation period, they were administered test capsules containing KB290 or placebo for 4 weeks (consumption period I. Then, the capsule administration was suspended for 4 weeks in both groups (washout period, before the opposite capsules were administered for a further 4 weeks (consumption period II. Fecal samples were collected on the first day of the pre-consumption observation period, the last day of consumption period I, the last day of the washout period, and the last day of consumption period II. In addition, the subjects’ IBS symptoms and quality of life (QOL and any adverse events that they experienced were evaluated. Results No significant difference in IBS symptoms was noted among the various periods. However, the mean QOL scores were improved during the test capsule consumption. The frequencies of watery and mushy feces were significantly lower in the test capsule consumption period than during the pre-consumption observation period, and the frequency of abdominal pain was significantly reduced in the test capsule consumption period compared with the other periods. The frequency of the genus Bifidobacterium was significantly higher, and that of the genus Clostridium was significantly lower, after the test capsule consumption than after the placebo consumption. The frequencies of the genera Lactobacillus, Bacteroides, and Enterococcus were also

  6. MicroRNA-205 suppresses the oral carcinoma oncogenic activity via down-regulation of Axin-2 in KB human oral cancer cell.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Sun-Young; Lee, Seul Ah; Park, Min-Gyeong; Yu, Sun-Kyoung; Lee, Myoung-Hwa; Park, Mi-Ra; Kim, Su-Gwan; Oh, Ji-Su; Lee, Sook-Young; Kim, Chun Sung; Kim, Heung-Joong; Chun, Hong Sung; Kim, Jin-Soo; Moon, Sung-Min; Kim, Do Kyung

    2014-02-01

    MicroRNA (miRNA) is a small noncoding RNA molecule, 19-25 nucleotides in length, which regulates several pathways including cell development, cell proliferation, carcinogenesis, apoptosis, etc. In this study, the over-expression of microRNA-205 (miR-205) increased the number of apoptotic cells by at least 4 times compared to the control. In addition, over-expressed miRNA in KB oral cancer cells triggered apoptosis via the caspase cascade, including the cleavage of caspase-9, caspase-7, caspase-3, and PARP. Flow cytometry showed that apoptotic cell death was increased significantly by 35.33% in KB oral cancer cells with over-expressed miR-205 compared to the control. The microarray data showed that axis inhibitor protein 2 (Axin2) was down-regulated in KB oral cancer cells transfected with miR-205. In addition, Axin2 was down-regulated by approximately 50% by over-expressed miR-205 at both the mRNA and protein levels. Interestingly, Axin2 was up-regulated in KB oral cancer compared to human normal oral keratinocytes. Furthermore, the cell cytotoxicity and apoptotic population of KB oral cancer cells were increased significantly after Axin2 siRNA transfection. These results suggest that Axin2 is might be as potential oncogene in KB oral cancer cells. The luciferase assay showed that over-expressed miR-205 in KB oral cancer cells suppressed AXIN2 expression through an interaction with its own binding site at AXIN2 3'UTR (64-92). These results suggest that miR-205 is a novel anti-oncogenic miRNA in KB oral cancer cells, and may have potential applications in oral cancer therapy.

  7. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  8. Umbelliferone arrest cell cycle at G0/G1 phase and induces apoptosis in human oral carcinoma (KB) cells possibly via oxidative DNA damage.

    Science.gov (United States)

    Vijayalakshmi, Annamalai; Sindhu, Ganapathy

    2017-08-01

    Umbelliferone (UMB) has widespread pharmacological activity, comprising anti-inflammatory, anti-oxidant, anti-genotoxic and anti-immunomodulatory but the anticancer activity remains unknown in human oral carcinoma (HOC) KB cells. MTT assay determinations was revealed that treatment of KB cells with UMB, prevent and reduce the cell proliferation with the IC 50 - 200μM as well as induces loss of cell viability, morphology change and internucleosomal DNA fragmentation in a concentration dependent manner. Acridine orange and ethidium bromide dual staining assay established that UMB induced apoptosis in KB cells in a dose dependent manner. Alkaline comet assay determination revealed UMB has the potential to increase oxidative DNA damage in KB cells through DNA tail formation significantly (pKB cells. Similarly, we observed increased DNA damage stimulated apoptotic morphological changes in UMB treated cells. Taken together, the present study suggests that UMB exhibits anticancer effect on KB cell line with the increased generation of intracellular ROS, triggered oxidative stress mediated depolarization of mitochondria, which contributes cell death via DNA damage as well as cell cycle arrest at G0/G1 phase. The results have also provided us insight in the pharmacological backgrounds for the potential use of UMB, to target divergent pathways of cell survival and cell death. To conclude UMB could develop as a novel candidate for cancer chemoprevention and therapy, which is our future focus and to develop a connectivity map between in vivo and in vitro activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Inquiring into Red/Red Inquiring

    Directory of Open Access Journals (Sweden)

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  10. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  11. Effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer.

    Science.gov (United States)

    Shen, Shan; Tang, Jingxia

    2017-08-01

    The present study describes the effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer. Oral cancer is twice as common in men than women. More than 90% of oral cancers in men and 85% in women are linked to lifestyle and environmental factors. PPP2R2B methylation may be associated with survival and prognosis in patients with gliomas. In tumor cell proliferation and apoptosis, the mechanism of PPP2R2B remains unclear. In the present study, we found that PPP2R2B expression of H1299 cells is significantly decreased after being treated by GA-13315. KB cells were isolated from patients with oral cancer and treated with GA-13315 (5 µM). Cells without GA-13315 treatment served as the control group. An MTT experiment was performed to detect the post-treatment cell growth between the groups. A flow cytometry was used to detect cell apoptosis. Western blot analysis and quantitative polymerase chain reaction methods were used for detecting the expression of PPP2R2B. Compared with the control group, the cell proliferation of the treatment group slowed after being treated with GA-13315. The difference was statistically significant (Poral cancer were weakened after being treated by GA-13315. GA-13315 can accelerate the apoptosis of oral cancer cells and presents a dose correlation. The biological effect is exerted through the decrease of PPP2R2B.

  12. Effect of surface charge and agglomerate degree of magnetic iron oxide nanoparticles on KB cellular uptake in vitro.

    Science.gov (United States)

    Ge, Yuqing; Zhang, Yu; Xia, Jingguang; Ma, Ming; He, Shiying; Nie, Fang; Gu, Ning

    2009-10-15

    We synthesized three types of magnetic iron oxide nanoparticles (MNPs), which were meso-2,3-dimercaptosuccinic acid (DMSA) coated MNPs (DMSA@MNPs, 17.3+/-4.8 nm, negative charge), chitosan (CS) coated MNPs (CS@MNPs, 16.5+/-6.1 nm, positive charge) and magnetic nanoparticles agglomerates, formed by electronic aggregation between DMSA@MNPs and CS (CS-DMSA@MNPs, 85.7+/-72.9 nm, positive charge) respectively. The interactions of these MNPs with Oral Squamous Carcinoma Cell KB were investigated. The results showed that cellular uptakes of MNPs were on the dependence of incubation time, nanoparticles concentration and nanoparticles properties such as surface charge, size, etc. The cellular uptake was enhanced with the increase of incubation time and nanoparticles concentration. Although all MNPs could enter to cells, we observed apparent differences in the magnitude of nanoparticles uptaken. The cellular uptake of CS-DMSA@MNPs by KB cells was the highest and that of DMSA@MNPs was the lowest among the three types of MNPs. The same conclusions were drawn via the reduction of water proton relaxation times T(2)(*), resulting from the different iron load of labeled cells using a 1.5T clinical MR imager. The finding of this study will have implications in the chemical design of nanomaterials for biomedical applications.

  13. Red mud characterization using nuclear analytical techniques

    International Nuclear Information System (INIS)

    Obhodas, J.; Sudac, D.; Matjacic, L.; Valkovic, V.

    2011-01-01

    Red mud is a toxic waste left as a byproduct in aluminum production Bayer process. Since it contains significant concentrations of other chemical elements interesting for industry, including REE, it is also potential secondary ore source. Recent events in some countries have shown that red mud presents a serious environmental hazard if not properly stored. The subject of our study is the red mud from an ex-aluminum plant in Obrovac, Croatia, left from processing of bauxite mined during late 70's and early 80's at the eastern Adriatic coast and since than stored in open concrete basins for more than 30 years. We have used energy dispersive x-ray fluorescence analysis (both tube and radioactive source excitation), fast neutron activation analysis and passive gamma spectrometry to identify a number of elements present in the red mud, their concentration levels and radioactivity in the red mud. The high concentrations of Al, Si, Ca, Ti and Fe have been measured. Chemical elements Sc, Cr, Mn, Co, Ni, Cu, Zn, Ga, As, Se, Br, Y, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Pb, Th and U were found in lower concentrations. No significant levels of radioactivity have been measured. (authors)

  14. FastStats: Births -- Method of Delivery

    Science.gov (United States)

    ... 1990–2013 [PDF – 423 KB] Primary Cesarean Delivery Rates, by State: Results From the Revised Birth Certificate, 2006–2012 [PDF – 274 KB] Related Links Vital Statistics downloadable public use data files American College of ...

  15. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  16. Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region

    Directory of Open Access Journals (Sweden)

    Pan Hui-Juan

    2007-09-01

    Full Text Available Abstract Background Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes. Results A giant panda BAC library consisting of 205,800 clones has been constructed. The average insert size was calculated to be 97 kb based on the examination of 174 randomly selected clones, indicating that the giant panda library contained 6.8-fold genome equivalents. Screening of the library with 16 giant panda PCR primer pairs revealed 6.4 positive clones per locus, in good agreement with an expected 6.8-fold genomic coverage of the library. Based on this BAC library, we constructed a contig map of the giant panda MHC class II region from BTNL2 to DAXX spanning about 650 kb by a three-step method: (1 PCR-based screening of the BAC library with primers from homologous MHC class II gene loci, end sequences and BAC clone shotgun sequences, (2 DNA sequencing validation of positive clones, and (3 restriction digest fingerprinting verification of inter-clone overlapping. Conclusion The identifications of genes and genomic regions of interest are greatly favored by the availability of this giant panda BAC library. The giant panda BAC library thus provides a useful platform for physical mapping, genome sequencing or complex analysis of targeted genomic regions. The 650 kb sequence-ready BAC contig map of the giant panda MHC class II region from BTNL2 to DAXX, verified by the three-step method, offers a

  17. KB-R7943, an inhibitor of the reverse Na+/Ca2+ exchanger, blocks N-methyl-D-aspartate receptor and inhibits mitochondrial complex I

    Science.gov (United States)

    Brustovetsky, Tatiana; Brittain, Matthew K; Sheets, Patrick L; Cummins, Theodore R; Pinelis, Vsevolod; Brustovetsky, Nickolay

    2011-01-01

    BACKGROUND AND PURPOSE An isothiourea derivative (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea methane sulfonate (KB-R7943), a widely used inhibitor of the reverse Na+/Ca2+ exchanger (NCXrev), was instrumental in establishing the role of NCXrev in glutamate-induced Ca2+ deregulation in neurons. Here, the effects of KB-R7943 on N-methyl-D-aspartate (NMDA) receptors and mitochondrial complex I were tested. EXPERIMENTAL APPROACH Fluorescence microscopy, electrophysiological patch-clamp techniques and cellular respirometry with Seahorse XF24 analyzer were used with cultured hippocampal neurons; membrane potential imaging, respirometry and Ca2+ flux measurements were made in isolated rat brain mitochondria. KEY RESULTS KB-R7943 inhibited NCXrev with IC50= 5.7 ± 2.1 µM, blocked NMDAR-mediated ion currents, and inhibited NMDA-induced increase in cytosolic Ca2+ with IC50= 13.4 ± 3.6 µM but accelerated calcium deregulation and mitochondrial depolarization in glutamate-treated neurons. KB-R7943 depolarized mitochondria in a Ca2+-independent manner. Stimulation of NMDA receptors caused NAD(P)H oxidation that was coupled or uncoupled from ATP synthesis depending on the presence of Ca2+ in the bath solution. KB-R7943, or rotenone, increased NAD(P)H autofluorescence under resting conditions and suppressed NAD(P)H oxidation following glutamate application. KB-R7943 inhibited 2,4-dinitrophenol-stimulated respiration of cultured neurons with IC50= 11.4 ± 2.4 µM. With isolated brain mitochondria, KB-R7943 inhibited respiration, depolarized organelles and suppressed Ca2+ uptake when mitochondria oxidized complex I substrates but was ineffective when mitochondria were supplied with succinate, a complex II substrate. CONCLUSIONS AND IMPLICATIONS KB-R7943, in addition to NCXrev, blocked NMDA receptors in cultured hippocampal neurons and inhibited complex I in the mitochondrial respiratory chain. These findings are critical for the correct interpretation of experimental

  18. Bioremediation of acid fast red dye by Streptomyces globosus under ...

    African Journals Online (AJOL)

    Administrator

    2011-04-25

    Apr 25, 2011 ... Azo dyes are widely used in industries, such as textiles, paper, plastics ... processes have received increasing interest owing to their cost effectiveness and environmental friendliness. (Mabrouk and ... hydrolytic enzymes . In addition it .... A trial for using potato peels for more economic biomass production.

  19. Fast Convolution Module (Fast Convolution Module)

    National Research Council Canada - National Science Library

    Bierens, L

    1997-01-01

    This report describes the design and realisation of a real-time range azimuth compression module, the so-called 'Fast Convolution Module', based on the fast convolution algorithm developed at TNO-FEL...

  20. Antiproliferative activity of flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the MCF7, KB, and NIH/3T3 cell lines.

    Science.gov (United States)

    Nedel, Fernanda; Begnini, Karine; Carvalho, Pedro Henrique de Azambuja; Lund, Rafael Guerra; Beira, Fátima T A; Del Pino, Francisco Augusto B

    2012-11-01

    This study assessed the antiproliferative effect in vitro of the flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the human breast adenocarcinoma (MCF-7), human mouth epidermal carcinoma (KB), and mouse embryonic fibroblast (NIH 3T3) cell lines, using sulforhodamine B (SRB) assay. A cell density of 2×10(4)/well was seeded in 96-well plates, and samples at different concentrations ranging from 10 to 500 mg/mL were tested. The optical density was determined in an ELISA multiplate reader (Thermo Plate TP-Reader). Results demonstrated that the hexane extract presented antiproliferative activity against both the tumor cell lines KB and MCF-7, presenting a GI(50) (MCF-7=13.09 mg/mL), TGI (KB=37.76 mg/mL), and IL(50) (KB=291.07 mg/mL). Also, the hexane extract presented antiproliferative activity toward NIH 3T3 cells GI(50) (183.65 mg/mL), TGI (280.54 mg/mL), and IL(50) (384.59 mg/mL). The results indicate that the flower hexane extract obtained from M. spicata associated with M. rotundifolia presents an antineoplastic activity against KB and MCF-7, although an antiproliferative effect at a high concentration of the extract was observed toward NIH 3T3.

  1. Next generation red teaming

    CERN Document Server

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  2. FAST: FAST Analysis of Sequences Toolbox

    Directory of Open Access Journals (Sweden)

    Travis J. Lawrence

    2015-05-01

    Full Text Available FAST (FAST Analysis of Sequences Toolbox provides simple, powerful open source command-line tools to filter, transform, annotate and analyze biological sequence data. Modeled after the GNU (GNU’s Not Unix Textutils such as grep, cut, and tr, FAST tools such as fasgrep, fascut, and fastr make it easy to rapidly prototype expressive bioinformatic workflows in a compact and generic command vocabulary. Compact combinatorial encoding of data workflows with FAST commands can simplify the documentation and reproducibility of bioinformatic protocols, supporting better transparency in biological data science. Interface self-consistency and conformity with conventions of GNU, Matlab, Perl, BioPerl, R and GenBank help make FAST easy and rewarding to learn. FAST automates numerical, taxonomic, and text-based sorting, selection and transformation of sequence records and alignment sites based on content, index ranges, descriptive tags, annotated features, and in-line calculated analytics, including composition and codon usage. Automated content- and feature-based extraction of sites and support for molecular population genetic statistics makes FAST useful for molecular evolutionary analysis. FAST is portable, easy to install and secure thanks to the relative maturity of its Perl and BioPerl foundations, with stable releases posted to CPAN. Development as well as a publicly accessible Cookbook and Wiki are available on the FAST GitHub repository at https://github.com/tlawrence3/FAST. The default data exchange format in FAST is Multi-FastA (specifically, a restriction of BioPerl FastA format. Sanger and Illumina 1.8+ FastQ formatted files are also supported. FAST makes it easier for non-programmer biologists to interactively investigate and control biological data at the speed of thought.

  3. Melting relations and elemental distribution of portion of the system Fe-S-Si-O to 32 KB with planetary application

    Science.gov (United States)

    Huang, W. L.

    1980-01-01

    The melting relations and distribution of K and Cs in portions of the system was determined at high pressures. Ferrosilite is stable as a primary phase at high pressures because of the incongruent melting of ferrosilite to quartz plus liquid and the boundary between the one and two liquid fields on the joint Fe(1-x) O-FeS-SiO2 shifts away from silica with increasing pressures. Potassium K was found to have limited solubility in metal sulfide liquids at pressures up to 45 kb. The speculation that K may dissolve significantly in metal-metal sulfide liquids after undergoing first order isomorphic transition was tested by determining the distribution of Cs between sulfide and silicate liquids as an analogy to K. At 45 kb, 1400 C and 27 kb, 1300 C only limited amounts of Cs were detected in quench sulfide liquids even at pressures beyond the isomorphic transition of Cs.

  4. Astrophysics of Red Supergiants

    Science.gov (United States)

    Levesque, Emily M.

    2017-12-01

    'Astrophysics of Red Supergiants' is the first book of its kind devoted to our current knowledge of red supergiant stars, a key evolutionary phase that is critical to our larger understanding of massive stars. It provides a comprehensive overview of the fundamental physical properties of red supergiants, their evolution, and their extragalactic and cosmological applications. It serves as a reference for researchers from a broad range of fields (including stellar astrophysics, supernovae, and high-redshift galaxies) who are interested in red supergiants as extreme stages of stellar evolution, dust producers, supernova progenitors, extragalactic metallicity indicators, members of massive binaries and mergers, or simply as compelling objects in their own right. The book is accessible to a range of experience levels, from graduate students up to senior researchers.

  5. red flour beetle

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-01

    Dec 1, 2009 ... 2Institute of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan. 3Department of ... most important energy source around the globe ... T. castaneum (red flour beetle) samples were collected from rice.

  6. RED-ML

    DEFF Research Database (Denmark)

    Xiong, Heng; Liu, Dongbing; Li, Qiye

    2017-01-01

    using diverse RNA-seq datasets, we have developed a software tool, RED-ML: RNA Editing Detection based on Machine learning (pronounced as "red ML"). The input to RED-ML can be as simple as a single BAM file, while it can also take advantage of matched genomic variant information when available...... accurately detect novel RNA editing sites without relying on curated RNA editing databases. We have also made this tool freely available via GitHub . We have developed a highly accurate, speedy and general-purpose tool for RNA editing detection using RNA-seq data....... With the availability of RED-ML, it is now possible to conveniently make RNA editing a routine analysis of RNA-seq. We believe this can greatly benefit the RNA editing research community and has profound impact to accelerate our understanding of this intriguing posttranscriptional modification process....

  7. Red Emitting Phenyl-Polysiloxane Based Scintillators for Neutron Detection

    International Nuclear Information System (INIS)

    Dalla Palma, Matteo; Quaranta, Alberto; Marchi, Tommaso; Gramegna, Fabiana; Cinausero, Marco; Carturan, Sara; Collazuol, Gianmaria

    2013-06-01

    In this work, the performances of new red emitting phenyl- substituted polysiloxane based scintillators are described. Three dyes were dispersed in a phenyl-polysiloxane matrix in order to shift the scintillation wavelength towards the red part of the visible spectrum. PPO, Lumogen Violet (BASF) and Lumogen Red (BASF) were mixed to the starting resins with different wt. % and the analysis of the different samples was performed by means of fluorescence measurements. The scintillation yield to alpha particles at the different dye ratios was monitored by detecting either the full spectrum or the red part of the emitted light. Finally, thin red scintillators with selected compositions were coupled to Avalanche Photodiode sensors, which are usually characterized by higher efficiency in the red part of the spectrum. An increased light output of about 17% has been obtained comparing the red scintillators to standard blue emitting systems. Preliminary results on the detection of fast neutrons with the APD-red scintillator system are also presented. (authors)

  8. Combination of Aloe vera and xenograft induction on decreasing of NF-kb of tooth extraction socket preservation in Cavia cobaya

    Directory of Open Access Journals (Sweden)

    Utari Kresnoadi

    2014-03-01

    Full Text Available Background: Tooth extraction can naturally cause inflammation triggering osteoclast proliferation and alveolar bone resorption. Preservation of the tooth extraction sockets is needed for patients in order to reduce alveolar bone resorption risks. Aloe vera is known to have anthraquinones components, namely Aloin, Aloe emedin, and barbaloin, considered as anti-inflammation. Therefore, to overcome the inflammation, the role of NF-kb is very significant to decrease nuclear factor kappa b (NF-kb. As a result, inflammation risks will be decreased. Purpose: The study was aimed to determine the induction effect of combination of Aloe vera and XCB into tooth extraction sockets to reduce inflammation by reducing NF-kb expression, osteoclasts and osteoblasts. Methods: Forty-eight Cavia cobaya were divided into eight groups, each group consisted of six animals. The mandibular incisors of those Cavia cobaya were extracted and induced with either PEG, XCB, Aloe vera, or the combination of Aloe vera + XCB. Those animals were sacrificed on day 7 and day 30 after the extraction. Then immunohistochemical and histopathology examinations were conducted to observe NF-kb expression, osteoblasts and osteoclasts. Results: It was known that in group induced with the combination of Aloe vera and xenograft concelous bovine, the growth of osteoblasts was high, while NF-kb expression and osteoclasts reduced. Conclusion: It can be concluded that the induction of the combination of Aloe vera and XCB into the tooth extraction sockets can reduce NF-kb expression and osteoclast, as a result, alveolar bone resorption risks decrease, and osteoblast increase.Latar belakang: Trauma mekanis akibat pencabutan gigi asli menyebabkan keradangan. Keradangan memicu proliferasi osteoklas sehingga menyebabkan resorpsi tulang alveolararis. Pada pembuatan gigi tiruan, resorpsi tulang alveolar yang terjadi, sangat tidak diinginkan, sebab resorpsi tulang alveolar mengurangi keberhasilan

  9. Effects of taxol and ionizing radiation on cytotoxicity and prostaglandin production in KB, RPMI-2650, SW-13 and L929

    International Nuclear Information System (INIS)

    Lee, Keon Il; Yoo, Dong Soo

    1998-01-01

    The author evaluated the effects of taxol, a microtubular inhibitor, as a possible radiation sensitizer and the production of prostaglandins on three human cancer cell lines (KB, RPMI-2650 and SW-13) and one murine cell line (L929). Each cell line was divided into four groups (control, taxol only, radiation only and combination of taxol and radiation). The treatment consisted of a single irradiation of 10 Gy and graded doses (5, 50, 100, 200, 300, 500 nM) of taxol for a 24-h period. The cytotoxicity of taxol alone was measured at 1 day after (1-day group) and 4 days after (4-day group) the treatment. The survival ratio of cell was analyzed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyl tetrazolium bromide) test. Prostaglandins (PGE2 and PGI2) were measured in the culture medium by a radioimmunoassay. The results obtained were as follows ; 1. There was a significantly in creased cytotoxicity of KB cells in 4-day group than those in 1-day group. There was a high correlation between doses of taxol and cell viability in both groups (1-day group R=0.82741, 4-day group R=0.84655). 2. There was a significantly increased cytotoxicity of RPMI-2650 cells treated with high concentration of taxol in 4-day group than those in 1-day group. Also there was a high correlation between doses of taxol and cell viability in 4-day group (R=0.93917). 3. There was a significantly increased cytotoxicity of SW-13 cell treated with high concentration of taxol in 4-day group than those in 1-day group. However no high correlation was observed between doses of taxol and cell viability in both groups (1-day group R=0.46362, 4-day group R=0.65425). 4. There was a significantly increased cytotoxicity of L929 cells treated with low concentration of taxol in 4-day group than those in 1-day group. At the same time, there was a low correlation between doses of taxol and cell viability in both groups (1-day group R=0.34237, 4-day group R=0.23381). 5. In 1-day group of L929 cells, higher

  10. Fasting and rheumatic diseases

    OpenAIRE

    Mohammad Hassan Jokar

    2015-01-01

    Fasting is one of the important religious practices of Muslims, in which the individuals abstain from eating and drinking from dawn to sunset. Fasting is not obligatory or even not allowed, in case it causes health problems to the fasting individual. Rheumatic diseases are a major group of chronic diseases which can bring about numerous problems while fasting. The aim of this article is to review the impact of Islamic fasting on rheumatic patients, based on the scientific evidences.

  11. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  12. A potential contributory role for ciliary dysfunction in the 16p11.2 600 kb BP4-BP5 pathology

    NARCIS (Netherlands)

    Migliavacca, Eugenia; Golzio, Christelle; Männik, Katrin; Blumenthal, Ian; Oh, Edwin C.; Harewood, Louise; Kosmicki, Jack A.; Loviglio, Maria Nicla; Giannuzzi, Giuliana; Hippolyte, Loyse; Maillard, Anne M.; Alfaiz, Ali Abdullah; Witwicki, Robert; Didelot, Gérard; Van Der Werf, Ilse; Alfaiz, Ali A.; Zazhytska, Marianna; Chrast, Jacqueline; Macé, Aurélien; Bergmann, Sven; Kutalik, Zoltan; Siffredi, Vanessa; Zufferey, Flore; Martinet, Danielle; Bena, Frédérique; Rauch, Anita; Bouquillon, Sonia; Delobel, Bruno; Boute, Odile; Duban-Bedu, Bénédicte; Le Caignec, Cédric; Isidor, Bertrand; Chiesa, Jean; Keren, Boris; Gilbert-Dussardier, Brigitte; Touraine, Renaud; Campion, Dominique; Thambo, Caroline Rooryck; Mathieu-Dramard, Michèle; Plessis, Ghislaine; Kooy, Frank; Peeters, Hilde; Ounap, Katrin; Vulto-Van Silfhout, Anneke T.; De Vries, Bert B.; Van Binsbergen, Ellen; Nordgren, Ann; Mucciolo, Mafalda; Renieri, Alessandra; Rajcan-Separovic, Evica; Philipps, John A.; Ellis, Richard J.; Van Haelst, Mieke M.; Andrieux, Joris; Gusella, James F.; Daly, Mark J.; Beckmann, Jacques S.; Jacquemont, Sébastien; Talkowski, Michael E.; Katsanis, Nicholas; Reymond, Alexandre

    2015-01-01

    The 16p11.2 600 kb copy-number variants (CNVs) are associated with mirror phenotypes on BMI, head circumference, and brain volume and represent frequent genetic lesions in autism spectrum disorders (ASDs) and schizophrenia. Here we interrogated the transcriptome of individuals carrying reciprocal

  13. UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bansal, Parit; Bridge, Alan J; Poux, Sylvain; Bougueleret, Lydie; Xenarios, Ioannis

    2016-01-01

    The Universal Protein Resource (UniProt, http://www.uniprot.org ) consortium is an initiative of the SIB Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI) and the Protein Information Resource (PIR) to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB), updated every 4 weeks, and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc).The Swiss-Prot section of the UniProt KnowledgeBase (UniProtKB/Swiss-Prot) contains publicly available expertly manually annotated protein sequences obtained from a broad spectrum of organisms. Plant protein entries are produced in the frame of the Plant Proteome Annotation Program (PPAP), with an emphasis on characterized proteins of Arabidopsis thaliana and Oryza sativa. High level annotations provided by UniProtKB/Swiss-Prot are widely used to predict annotation of newly available proteins through automatic pipelines.The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry. We will also present some of the tools and databases that are linked to each entry.

  14. Chronic myeloid leukemia may be associated with several bcr-abl transcripts including the acute lymphoid leukemia-type 7 kb transcript

    NARCIS (Netherlands)

    Selleri, L.; von Lindern, M.; Hermans, A.; Meijer, D.; Torelli, G.; Grosveld, G.

    1990-01-01

    In the majority of Philadelphia (Ph)-positive chronic myeloid leukemia (CML) patients, the c-abl gene is fused to the bcr gene, resulting in the transcription of an 8.5 kb chimeric bcr-abl mRNA, which is translated into a p210bcr-abl fusion protein. In about 50% of the Ph-positive acute lymphoid

  15. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    Science.gov (United States)

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. 3,3′,4,4′,5-Pentachlorobiphenyl Inhibits Drug Efflux Through P-Glycoprotein in KB-3 Cells Expressing Mutant Human P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujise

    2004-01-01

    Full Text Available The effects on the drug efflux of 3,3′,4,4′,5-pentachlorobiphenyl (PCB-126, the most toxic of all coplanar polychlorinated biphenyls (Co-PCBs, were examined in KB-3 cells expressing human wild-type and mutant P-glycoprotein in which the 61st amino acid was substituted for serine or phenylalanine (KB3-Phe61. In the cells expressing P-glycoproteins, accumulations of vinblastine and colchicine decreased form 85% to 92% and from 62% to 91%, respectively, and the drug tolerances for these chemicals were increased. In KB3-Phe61, the decreases in drug accumulation were inhibited by adding PCB-126 in a way similar to that with cyclosporine A: by adding 1 μM PCB-126, the accumulations of vinblastine and colchicine increased up to 3.3- and 2.3-fold, respectively. It is suggested that PCB-126 decreased the drug efflux by inhibiting the P-glycoprotein in KB3-Phe61. Since there were various P-glycoproteins and many congeners of Co-PCBs, this inhibition has to be considered a new cause of the toxic effects of Co-PCBs.

  17. Male infertility is significantly associated with multiple deletions in an 8.7-kb segment of sperm mtDNA in Pakistan.

    Science.gov (United States)

    Mughal, Irfan Afzal; Irfan, Asma; Jahan, Sarwat; Hameed, Abdul

    2017-06-12

    This study aimed to find a link between sperm mitochondrial DNA mutations and male infertility in Pakistan. DNA from semen samples was extracted and amplified by PCR using 7.8-kb deletion-specific primers. The PCR products were separated on agarose gel, visualized under UV-illumination, and then photographed. The results were genotyped and the data were analyzed using SPSS. Deletion analysis of the 8.7-kb fragment by long PCR revealed multiple deletions. The frequency of deletion was much higher in infertile groups as compared to the control group. Further, on comparison between different subtypes of infertile groups, the deletions were highest in the oligoasthenoteratozoospermia (OAT) group. The statistical analysis of case and control groups showed a significant association of the 8.7-kb deletion with human male infertile groups (P = 0.031), and particularly a very significant association with the OAT subgroup (P = 0.019). A significant association has been found between human male infertility and mtDNA deletions in an 8.7-kb segment of sperm mtDNA in a Pakistani population.

  18. One-step FPLC-size-exclusion chromatography procedure for purification of rDMBT1 6 kb with increased biological activity

    DEFF Research Database (Denmark)

    Tuttolomondo, Martina; Hansen, Pernille Lund; Mollenhauer, Jan

    2018-01-01

    from saliva or produced in vitro and purified by a multistep affinity purification procedure using bacteria, followed by FPLC. Here, we compared a simple, one-step FPLC-SEC protocol for purification of recombinant DMBT1 6 kb, with that of the standard bacteria affinity purification-based protocol. Our...

  19. A method for sensible heat flux model parameterization based on radiometric surface temperature and environmental factors without involving the parameter KB-1

    Science.gov (United States)

    Zhuang, Qifeng; Wu, Bingfang; Yan, Nana; Zhu, Weiwei; Xing, Qiang

    2016-05-01

    Sensible heat flux is a key component of land-atmosphere interaction. In most parameterizations it is calculated with surface-air temperature differences and total aerodynamic resistance to heat transfer (Rae) that is related to the KB-1 parameter. Suitable values are hard to obtain since KB-1 is related both to canopy characteristics and environmental conditions. In this paper, a parameterize method for sensible heat flux over vegetated surfaces (maize field and grass land in the Heihe river basin of northwest China) was proposed based on the radiometric surface temperature, surface resistance (Rs) and vapor pressures (saturated and actual) at the surface and the atmosphere above the canopy. A biophysics-based surface resistance model was revised to compute surface resistance with several environmental factors. The total aerodynamic resistance to heat transfer is directly calculated by combining the biophysics-based surface resistance and vapor pressures. One merit of this method is that the calculation of KB-1 can be avoided. The method provides a new way to estimate sensible heat flux over vegetated surfaces and its performance compares well to the LAS measured sensible heat and other empirical or semi-empirical KB-1 based estimations.

  20. Fast Neutron Radiation Effects on Bacillus Subtili

    International Nuclear Information System (INIS)

    Chen Xiaoming; Zhang Jianguo; Chu Shijin; Ren Zhenglong; Zheng Chun; Yang Chengde; Tan Bisheng

    2009-01-01

    To examine the sterilizing effect and mechanism of neutron radiation, Bacillus subtilis var. niger. strain (ATCC 9372) spores were irradiated with the fast neutron from the Chinese fast burst reactor II(CFBR-II). The plate-count results indicated that the D 10 value was 384.6 Gy with a neutron radiation dose rate of 7.4 Gy/min. The rudimental catalase activity of the spores declined obviously with the increase in the radiation dose. Meanwhile, under the scanning electron microscope, no visible influence of the neutron radiation on the spore configuration was detected even if the dose was increased to 4 kGy. The content and distribution of DNA double-strand breaks induced by neutron radiation at different doses were measured and quantified by pulsed-field gel electrophoresis (PFGE). Further analysis of the DNA release percentage (PR), the DNA breakage level (L), and the average molecular weight, indicated that DNA fragments were obviously distributed around the 5 kb regions at different radiation doses, which suggests that some points in the DNA molecule were sensitive to neutron radiation. Both PR and L varied regularly to some extent with the increase in radiation dose. Thus neutron radiation has a high sterilization power, and can induce falling enzyme activity and DNA breakage in Bacillus subtilis spores

  1. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  2. Dual AAV Gene Therapy for Duchenne Muscular Dystrophy with a 7-kb Mini-Dystrophin Gene in the Canine Model.

    Science.gov (United States)

    Kodippili, Kasun; Hakim, Chady H; Pan, Xiufang; Yang, Hsiao T; Yue, Yongping; Zhang, Yadong; Shin, Jin-Hong; Yang, N Nora; Duan, Dongsheng

    2018-03-01

    Dual adeno-associated virus (AAV) technology was developed in 2000 to double the packaging capacity of the AAV vector. The proof of principle has been demonstrated in various mouse models. Yet, pivotal evidence is lacking in large animal models of human diseases. Here we report expression of a 7-kb canine ΔH2-R15 mini-dystrophin gene using a pair of dual AAV vectors in the canine model of Duchenne muscular dystrophy (DMD). The ΔH2-R15 minigene is by far the most potent synthetic dystrophin gene engineered for DMD gene therapy. We packaged minigene dual vectors in Y731F tyrosine-modified AAV-9 and delivered to the extensor carpi ulnaris muscle of a 12-month-old affected dog at the dose of 2 × 10 13 viral genome particles/vector/muscle. Widespread mini-dystrophin expression was observed 2 months after gene transfer. The missing dystrophin-associated glycoprotein complex was restored. Treatment also reduced muscle degeneration and fibrosis and improved myofiber size distribution. Importantly, dual AAV therapy greatly protected the muscle from eccentric contraction-induced force loss. Our data provide the first clear evidence that dual AAV therapy can be translated to a diseased large mammal. Further development of dual AAV technology may lead to effective therapies for DMD and many other diseases in human patients.

  3. Immobilization of Cellulase from Bacillus subtilis UniMAP-KB01 on Multi-walled Carbon Nanotubes for Biofuel Production

    Science.gov (United States)

    Naresh, Sandrasekaran; Hoong Shuit, Siew; Kunasundari, Balakrishnan; Hoo Peng, Yong; Qi, Hwa Ng; Teoh, Yi Peng

    2018-03-01

    Bacillus subtilis UniMAP-KB01, a cellulase producer was isolated from Malaysian mangrove soil. Through morphological identification it was observed that the B. subtilis appears to be in rod shaped and identified as a gram positive bacterium. Growth profile of isolated B. subtilis was established by measuring optical density (OD) at 600 nm for every 1 hour intervals. Polymath software was employed to plot the growth profile and the non-linear plot established gave the precision value of linear regression, R2 of 0.9602, root mean square deviation (RMSD) of 0.0176 and variance of 0.0025. The hydrolysis capacity testing revealed the cellulolytic index of 2.83 ± 0.46 after stained with Gram’s Iodine. The harvested crude enzyme after 24 hours incubation in carboxymethylcellulose (CMC) broth at 45°C and 100 RPM, was tested for enzyme activity. Through Filter Paper Assay (FPA), the cellulase activity was calculated to be 0.05 U/mL. The hydrolysis capacity testing and FPA shown an acceptable value for thermophilic bacterial enzyme activity. Thus, this isolated strain reasoned to be potential for producing thermostable cellulase which will be immobilized onto multi-walled carbon nanotubes and the cellulolytic activity will be characterized for biofuel production.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Effects of pregnancy and fasting on muscle glucose utilization in the rabbit.

    Science.gov (United States)

    Hauguel, S; Leturque, A; Gilbert, M; Girard, J

    1988-05-01

    The effects of fasting on maternal glucose metabolism were investigated in nonpregnant and 29-day pregnant conscious rabbits. Pregnancy decreased the glucose metabolic index by 60% in maternal red postural muscles. Fasting induced similar modifications in nonpregnant rabbits and exaggerated the changes observed in fed pregnant animals. These data suggest that the decreased glucose utilization by maternal red muscles observed during pregnancy and fasting is related to the increase in circulating fat-derived substrates, because the fall in plasma insulin concentration is a specific adaptation to fasting.

  6. KB23 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  7. KB21 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  8. Clover, Red (Trifolium pretense)

    Science.gov (United States)

    Genetic modification of plants by the insertion of transgenes can be a powerful experimental approach to answer basic questions about gene product function. This technology can also be used to make improved crop varieties for use in the field. To apply this powerful tool to red clover, an important ...

  9. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  10. Whole transcriptomic and proteomic analyses of an isogenic M. tuberculosis clinical strain with a naturally occurring 15 Kb genomic deletion.

    Directory of Open Access Journals (Sweden)

    Carla Duncan

    Full Text Available Tuberculosis remains one of the most difficult to control infectious diseases in the world. Many different factors contribute to the complexity of this disease. These include the ability of the host to control the infection which may directly relate to nutritional status, presence of co-morbidities and genetic predisposition. Pathogen factors, in particular the ability of different Mycobacterium tuberculosis strains to respond to the harsh environment of the host granuloma, which includes low oxygen and nutrient availability and the presence of damaging radical oxygen and nitrogen species, also play an important role in the success of different strains to cause disease. In this study we evaluated the impact of a naturally occurring 12 gene 15 Kb genomic deletion on the physiology and virulence of M. tuberculosis. The strains denominated ON-A WT (wild type and ON-A NM (natural mutant were isolated from a previously reported TB outbreak in an inner city under-housed population in Toronto, Canada. Here we subjected these isogenic strains to transcriptomic (via RNA-seq and proteomic analyses and identified several gene clusters with differential expression in the natural mutant, including the DosR regulon and the molybdenum cofactor biosynthesis genes, both of which were found in lower abundance in the natural mutant. We also demonstrated lesser virulence of the natural mutant in the guinea pig animal model. Overall, our findings suggest that the ON-A natural mutant is less fit to cause disease, but nevertheless has the potential to cause extended transmission in at-risk populations.

  11. HCUP Fast Stats

    Data.gov (United States)

    U.S. Department of Health & Human Services — HCUP Fast Stats provides easy access to the latest HCUP-based statistics for health information topics. HCUP Fast Stats uses visual statistical displays in...

  12. Fast food (image)

    Science.gov (United States)

    Fast foods are quick, reasonably priced, and readily available alternatives to home cooking. While convenient and economical for a busy lifestyle, fast foods are typically high in calories, fat, saturated fat, ...

  13. Fast food tips (image)

    Science.gov (United States)

    ... challenge to eat healthy when going to a fast food place. In general, avoiding items that are deep ... challenge to eat healthy when going to a fast food place. In general, avoiding items that are deep ...

  14. Physiology of Ramadan fasting

    OpenAIRE

    Shokoufeh Bonakdaran

    2016-01-01

    Considering the emphasis of Islam on the importance of fasting, Muslims attempt to fast from dawn until sunset during the holy month of Ramadan. Fasting is associated with several benefits for normal and healthy individuals. However, it could pose high risks to the health of diabetic patients due to certain physiological changes. This study aimed to compare the physiological changes associated with fasting in healthy individuals and diabetic patients during Ramadan. Furthermore, we reviewed t...

  15. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Becher, Naja; Gjørup, Vibike; Christensen, Rikke

    2012-01-01

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  16. Cordyceps militaris Fraction induces apoptosis and G2/M Arrest via c-Jun N-Terminal kinase signaling pathway in oral squamous carcinoma KB Cells.

    Science.gov (United States)

    Xie, Wangshi; Zhang, Zhang; Song, Liyan; Huang, Chunhua; Guo, Zhongyi; Hu, Xianjing; Bi, Sixue; Yu, Rongmin

    2018-01-01

    Cordyceps militaris fraction (CMF) has been shown to possess in vitro antitumor activity against human chronic myeloid leukemia K562 cells in our previous research. The in vitro inhibitory activities of CMF on the growth of KB cells were evaluated by viability assay. The apoptotic and cell cycle influences of CMF were detected by 4',6-diamidino-2-phenylindole staining and flow cytometry assay. The expression of different apoptosis-associated proteins and cell cycle regulatory proteins was examined by Western blot assay. The nuclear localization of c-Jun was observed by fluorescence staining. The objective of this study was to investigate the antiproliferative effect of CMF as well as the mechanism underlying the apoptosis and cell cycle arrest it induces in KB cells. CMF suppressed KB cells' proliferation in a dose- and time-dependent manner. Flow cytometric analysis indicated that CMF induced G2/M cell cycle arrest and apoptosis. Western blot analysis revealed that CMF induced caspase-3, caspase-9, and PARP cleavages, and increased the Bax/Bcl-2 ratio. CMF also led to increased expression of p21, decreased expression of cyclin B1, mitotic phosphatase cdc25c, and mitotic kinase cdc2, as well as unchanged expression of p53. In addition, CMF stimulated c-Jun N-terminal kinases (JNK) protein phosphorylations, resulting in upregulated expression of c-Jun and nuclear localization of c-Jun. Pretreatment with JNK inhibitor SP600125 suppressed CMF-induced apoptosis and G2/M arrest. CMF is capable of modulating c-Jun caspase and Bcl-2 family proteins through JNK-dependent apoptosis, which results in G2/M phase arrest in KB cells. CMF could be developed as a promising candidate for the new antitumor agents. CMF exhibited strong anticancer activity against oral squamous carcinoma KB cellsCMF inhibited KB cells' proliferation via induction of apoptosis and G2/M cell cycle arrestCMF activated JNK signaling pathway and promoted the nuclear localization of c-JunCMF regulated the

  17. The prototype fast reactor

    International Nuclear Information System (INIS)

    Broomfield, A.M.

    1985-01-01

    The paper concerns the Prototype Fast Reactor (PFR), which is a liquid metal cooled fast reactor power station, situated at Dounreay, Scotland. The principal design features of a Fast Reactor and the PFR are given, along with key points of operating history, and health and safety features. The role of the PFR in the development programme for commercial reactors is discussed. (U.K.)

  18. The fast reactor

    International Nuclear Information System (INIS)

    1980-02-01

    The subject is discussed as follows: brief description of fast reactors; advantage in conserving uranium resources; experience, in UK and elsewhere, in fast reactor design, construction and operation; safety; production of plutonium, security aspects; consideration of future UK fast reactor programme. (U.K.)

  19. Ramadan, fasting and pregnancy

    DEFF Research Database (Denmark)

    Ahmed, Urfan Zahoor; Lykke, Jacob Alexander

    2014-01-01

    In Islam, the month of Ramadan is a period of fasting lasting 29 or 30 days. Epidemiological studies among Muslims in Denmark have not been conducted, but studies show, that fasting among pregnant Muslim women is common. Fasting does not increase the risk of growth restriction or preterm delivery...

  20. Skin quality in red potatoes

    Science.gov (United States)

    Attractive appearance is a highly desirable characteristic of fresh market red-skinned potatoes. The ideal red potato has a rich, uniform, deep red color. Color fading, netting, browning, and discoloration caused by skinning and disease decrease marketability and may reduce profits to growers and pa...

  1. Red alder potential in Alaska

    Science.gov (United States)

    Allen Brackley; David Nicholls; Mike Hannan

    2010-01-01

    Over the past several decades, red alder has established itself as a commercially important species in the Pacific Northwest. Once considered a weed species, red alder now commands respect within many markets, including furniture, architectural millwork, and other secondary manufactured products. Although red alder's natural range extends to southeast Alaska, an...

  2. Is Red Heavier Than Yellow Even for Blind?

    Science.gov (United States)

    Barilari, Marco; de Heering, Adélaïde; Crollen, Virginie; Collignon, Olivier; Bottini, Roberto

    2018-01-01

    Across cultures and languages, people find similarities between the products of different senses in mysterious ways. By studying what is called cross-modal correspondences, cognitive psychologists discovered that lemons are fast rather than slow, boulders are sour, and red is heavier than yellow. Are these cross-modal correspondences established via sensory perception or can they be learned merely through language? We contribute to this debate by demonstrating that early blind people who lack the perceptual experience of color also think that red is heavier than yellow but to a lesser extent than sighted do.

  3. The remarkable Red Rectangle: A Stairway to Heaven?

    Science.gov (United States)

    2004-05-01

    HD 44179 Nebula hi-res Size hi-res: 865 Kb Credits: NASA/ESA, Hans Van Winckel (Catholic University of Leuven, Belgium) and Martin Cohen (University of California) The HD 44179 nebula, known as the 'Red Rectangle.' This image, taken with the NASA/ESA Hubble Space Telescope, reveals startling new details of one of the most unusual nebulae known in our galaxy. Catalogued as HD 44179, this nebula is more commonly called the 'Red Rectangle' because of its unique shape and colour as seen with ground-based telescopes. Hubble has revealed a wealth of new features in the Red Rectangle that cannot be seen by ground-based telescopes looking through Earth’s turbulent atmosphere. Details of the Hubble study were published in the April 2004 issue of The Astronomical Journal. HD 44179 Nebula hi-res Size hi-res: 1289 Kb Credits: ESA and Vincent Icke (Leiden University, the Netherlands) Simulating the Red Rectangle The NASA/ESA Hubble Space Telescope has revealed a wealth of new features in the Red Rectangle that cannot be seen with ground-based telescopes looking through the Earth’s turbulent atmosphere. Whereas the origins of many of the features in this dying star still remain hidden or even outright mysterious, some are well explained by theorists like the Dutch scientist Vincent Icke from Leiden University in the Netherlands. In 1981 Vincent Icke and collaborators showed that a spherical gas ejection from a dying star hitting a dust torus would give rise to shocks that can produce cone-like outflows similar to the two cones seen in the Hubble image. Meteorologists produce weather forecasts by advanced calculations of temperatures, pressures, velocities and densities for the air masses in our atmosphere and, to some degree, theorists like Icke are doing exactly the same for objects in space. Whether modelling the weather in the Earth’s atmosphere or the processes in distant gaseous nebulae, scientists calculate the motion of the gas by using a complicated set of

  4. Ramadan, fasting and pregnancy

    DEFF Research Database (Denmark)

    Ahmed, Urfan Zahoor; Lykke, Jacob Alexander

    2014-01-01

    In Islam, the month of Ramadan is a period of fasting lasting 29 or 30 days. Epidemiological studies among Muslims in Denmark have not been conducted, but studies show, that fasting among pregnant Muslim women is common. Fasting does not increase the risk of growth restriction or preterm delivery......, but there are reports of decreased foetal movements. Furthermore, the fasting may have long-term health consequences for the offspring, especially when they reach their middle age. According to Islam and the interpretation, pregnant and breast-feeding women are allowed to postpone the fasting of the month of Ramadan...

  5. Ramadan, faste og graviditet

    DEFF Research Database (Denmark)

    Ahmed, Urfan Zahoor; Lykke, Jacob Alexander

    2014-01-01

    In Islam, the month of Ramadan is a period of fasting lasting 29 or 30 days. Epidemiological studies among Muslims in Denmark have not been conducted, but studies show, that fasting among pregnant Muslim women is common. Fasting does not increase the risk of growth restriction or preterm delivery......, but there are reports of decreased foetal movements. Furthermore, the fasting may have long-term health consequences for the offspring, especially when they reach their middle age. According to Islam and the interpretation, pregnant and breast-feeding women are allowed to postpone the fasting of the month of Ramadan...

  6. Multiplicar la red

    Directory of Open Access Journals (Sweden)

    John Young

    2015-01-01

    Full Text Available La tecnología comunicacional nos ha conducido precipitadamente a una existencia completamente nueva. En la carrera por crear una sociedad sustentable, una "red de redes mundiales" de computadoras personales que puedan ofrecer la primera esperanza real de acelerar ampliamente las comunicaciones. Las redes computacionales no solo sirven como un sistema de comunicación interactivo, rápido sino también como una herramienta de investigación de poderes insospechados.

  7. Identification of herpes simplex virus type 1 proteins encoded within the first 1.5 kb of the latency-associated transcript.

    Science.gov (United States)

    Henderson, Gail; Jaber, Tareq; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-09-01

    Expression of the first 1.5 kb of the latency-associated transcript (LAT) that is encoded by herpes simplex virus type 1 (HSV-1) is sufficient for wild-type (wt) levels of reactivation from latency in small animal models. Peptide-specific immunoglobulin G (IgG) was generated against open reading frames (ORFs) that are located within the first 1.5 kb of LAT coding sequences. Cells stably transfected with LAT or trigeminal ganglionic neurons of mice infected with a LAT expressing virus appeared to express the L2 or L8 ORF. Only L2 ORF expression was readily detected in trigeminal ganglionic neurons of latently infected mice.

  8. Identification of two small RNAs within the first 1.5-kb of the herpes simplex virus type 1-encoded latency-associated transcript.

    Science.gov (United States)

    Peng, Weiping; Vitvitskaia, Olga; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2008-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected neurons. In the rabbit or mouse ocular models of infection, expression of the first 1.5 kb of LAT coding sequences is sufficient for and necessary for wild-type levels of spontaneous reactivation from latency. The antiapoptosis functions of LAT, which maps to the same 1.5 kb of LAT, are important for the latency-reactivation cycle because replacement of LAT with other antiapoptosis genes (the baculovirus IAP gene or the bovine herpesvirus type 1 latency-related gene) restores wild-type levels of reactivation to a LAT null mutant. A recent study identified a micro-RNA within LAT that can inhibit apoptosis (Gupta et al, Nature 442: 82-85). In this study, the authors analyzed the first 1.5 kb of LAT for additional small RNAs that may have regulatory functions. Two LAT-specific small RNAs were detected in productively infected human neuroblastoma cells within the first 1.5 kb of LAT, in a region that is important for inhibiting apoptosis. Although these small RNAs possess extensive secondary structure and a stem-loop structure, bands migrating near 23 bases were not detected suggesting these small RNAs are not true micro-RNAs. Both of the small LAT-specific RNAs have the potential to base pair with the ICP4 mRNA. These two small LAT RNAs may play a role in the latency-reactivation cycle by reducing apoptosis and/or by reducing ICP4 RNA expression.

  9. Induction of necrosis and apoptosis to KB cancer cells by sanguinarine is associated with reactive oxygen species production and mitochondrial membrane depolarization

    International Nuclear Information System (INIS)

    Chang, M.-C.; Chan, C.-P.; Wang, Y.-J.; Lee, P.-H.; Chen, L.-I; Tsai, Y.-L.; Lin, B.-R.; Wang, Y.-L.; Jeng, J.-H.

    2007-01-01

    Sanguinarine is a benzopheanthridine alkaloid present in the root of Sanguinaria canadensis L. and Chellidonium majus L. In this study, sanguinarine (2 and 3 μM) exhibited cytotoxicity to KB cancer cells by decreasing MTT reduction to 83% and 52% of control after 24-h of exposure. Sanguinarine also inhibited the colony forming capacity (> 52-58%) and growth of KB cancer cells at concentrations higher than 0.5-1 μM. Short-term exposure to sanguinarine (> 0.5 μM) effectively suppressed the adhesion of KB cells to collagen and fibronectin (FN). Sanguinarine (2 and 3 μM) induced evident apoptosis as indicated by an increase in sub-G0/G1 populations, which was detected after 6-h of exposure. Only a slight increase in cells arresting in S-phase and G2/M was noted. Induction of KB cell apoptosis and necrosis by sanguinarine (2 and 3 μM) was further confirmed by Annexin V-PI dual staining flow cytometry and the presence of DNA fragmentation. The cytotoxicity by sanguinarine was accompanied by an increase in production of reactive oxygen species (ROS) and depolarization of mitochondrial membrane potential as indicated by single cell flow cytometric analysis of DCF and rhodamine fluorescence. NAC (1 and 3 mM) and catalase (2000 U/ml) prevented the sanguinarine-induced ROS production and cytotoxicity, whereas dimethylthiourea (DMT) showed no marked preventive effect. These results suggest that sanguinarine has anticarcinogenic properties with induction of ROS production and mitochondrial membrane depolarization, which mediate cancer cell death

  10. CLCNKB mutations causing mild Bartter syndrome profoundly alter the pH and Ca2+ dependence of ClC-Kb channels.

    Science.gov (United States)

    Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

    2014-09-01

    ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.

  11. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  12. The 29.5 kb APOBEC3B Deletion Polymorphism Is Not Associated with Clinical Outcome of Breast Cancer.

    Science.gov (United States)

    Liu, Jingjing; Sieuwerts, Anieta M; Look, Maxime P; van der Vlugt-Daane, Michelle; Meijer-van Gelder, Marion E; Foekens, John A; Hollestelle, Antoinette; Martens, John W M

    2016-01-01

    Increased APOBEC3B mRNA levels are associated with a hypermutator phenotype and poor prognosis in ER-positive breast cancer patients. In addition, a 29.5 kb deletion polymorphism of APOBEC3B, resulting in an APOBEC3A-B hybrid transcript, has been associated with an increased breast cancer risk and the hypermutator phenotype. Here we evaluated whether the APOBEC3B deletion polymorphism also associates with clinical outcome of breast cancer. Copy number analysis was performed by quantitative PCR (qPCR) in primary tumors of 1,756 Dutch breast cancer patients. The APOBEC3B deletion was found in 187 patients of whom 16 carried a two-copy deletion and 171 carried a one-copy deletion. The prognostic value of the APOBEC3B deletion for the natural course of the disease was evaluated among 1,076 lymph-node negative (LNN) patients who did not receive adjuvant systemic treatment. No association was found between APOBEC3B copy number values and the length of metastasis-free survival (MFS; hazard ratio (HR) = 1.00, 95% confidence interval (CI) = 0.90-1.11, P = 0.96). Subgroup analysis by ER status also did not reveal an association between APOBEC3B copy number values and the length of MFS. The predictive value of the APOBEC3B deletion was assessed among 329 ER-positive breast cancer patients who received tamoxifen as the first-line therapy for recurrent disease and 226 breast cancer patients who received first-line chemotherapy for recurrent disease. No association between APOBEC3B copy number values and the overall response rate (ORR) to either tamoxifen (odds ratio (OR) = 0.88, 95% CI = 0.69-1.13, P = 0.31) or chemotherapy (OR = 0.97, 95% CI = 0.71-1.33, P = 0.87) was found. Thus, in contrast to APOBEC3B mRNA levels, the APOBEC3B deletion polymorphism has neither a prognostic nor a predictive value for breast cancer patients. Although a correlation exists between APOBEC3B copy number and mRNA expression, it is relatively weak. This suggests that other mechanisms exist that may

  13. FACTOR NUCLEAR kB (NF-kB: SIGNALOSOMA Y SU IMPORTANCIA EN ENFERMEDADES INFLAMATORIAS Y CÁNCER

    Directory of Open Access Journals (Sweden)

    Nancy P. Echeverry R.L

    2008-04-01

    Full Text Available El factor nuclear kB (NF-kB es un dímero constituido por proteínas de la familia Rel. El NF-kB se encuentra en el citoplasma unido a proteínas inhibidoras (IkB. Las IkB son fosforiladas por diferentes cinasas que hacen parte del signalosoma como las cinasas de IKKa e IKKb y el modulador esencial de NF-kB (NEMO, la proteína cinasa activadora de mitosis (MAPK o p38 y la cinasa inductora de NF-kB (NIK. Estas cinasas al ser activadas por señales dependientes de citocinas y luz ultravioleta, fosforilan las IkB provocando su ubiquitinación, su degradación por proteosoma y la subsecuente liberación y translocación al núcleo de NF-kB. Recientemente se le ha dado una gran importancia al NF-kB en la vía de señalización desencadenada por estrés oxidativo, estrés genotóxico y daño en el DNA. A diferencia de la vía denominada clásica, en esta ruta ocurre una SUMOilación de NEMO y translocación al núcleo. En el núcleo NEMO interactúa con la proteína de la ataxia telangiectasia mutada (ATM activada en respuesta a modificaciones en la cromatina y daño en el DNA. El complejo ATM/NEMO es translocado al citoplasma donde la ATM fosforila a las IKK llevando a la ubiquitinación y posterior liberación de NF-kB que es translocado al núcleo. NF-kB desencadena procesos de supervivencia incluyendo el aumento de la transcripción de enzimas antioxidantes como la superóxido dismutasa, catalasa y glutatión. Estas enzimas participan en el control de los niveles de especies reactivas de oxígeno en la célula. La sobreactivación de NF-kB se relaciona con inflamación y cáncer. En la actualidad se desarrolla una búsqueda de fármacos que actúen sobre moléculas del signalosoma de NF-kB, no sólo para el manejo de enfermedades inflamatorias sino también para el uso durante el tratamiento de tumores resistentes a radio y quimioterapia.

  14. HLA-C -35kb expression SNP is associated with differential control of β-HPV infection in squamous cell carcinoma cases and controls.

    Directory of Open Access Journals (Sweden)

    Karin A Vineretsky

    Full Text Available A single nucleotide polymorphism (SNP 35 kb upstream of the HLA-C gene is associated with HLA-C expression, and the high expressing genotype (CC has been associated with HIV-I control. HLA-C is unique among the classical MHC class I molecules for its role in the control of viral infections and recognition of abnormal or missing self. This immunosurveillance is central to the pathogenesis of non-melanoma skin cancer (NMSC, and of squamous cell carcinoma (SCC in particular. While sun exposure is a major risk factor for these cancers, cutaneous infections with genus β-HPV have been implicated in the development of SCC. We hypothesized that the high expression HLA-C genotype is associated with β-HPV infections. Therefore, we investigated the association between β-HPV serology and the -35 kb SNP (rs9264942 in a population-based case-control study of 510 SCC cases and 608 controls. Among controls, the high expression -35 kb SNP genotype (CC reduced the likelihood of positive serology for multiple (≥2 β-HPV infections (OR = 0.49, 95% CI: 0.25-0.97, and β-HPV species 2 infection (OR = 0.43, 95% CI: 0.23-0.79. However, no association with β-HPV status was observed among SCC cases. Our findings suggest that underlying immunogenotype plays an important role in differential control of β-HPV in SCC cases and controls.

  15. C-RED One and C-RED2: SWIR high-performance cameras using Saphira e-APD and Snake InGaAs detectors

    Science.gov (United States)

    Gach, Jean-Luc; Feautrier, Philippe; Stadler, Eric; Clop, Fabien; Lemarchand, Stephane; Carmignani, Thomas; Wanwanscappel, Yann; Boutolleau, David

    2018-02-01

    After the development of the OCAM2 EMCCD fast visible camera dedicated to advanced adaptive optics wavefront sensing, First Light Imaging moved to the SWIR fast cameras with the development of the C-RED One and the C-RED 2 cameras. First Light Imaging's C-RED One infrared camera is capable of capturing up to 3500 full frames per second with a subelectron readout noise and very low background. C-RED One is based on the last version of the SAPHIRA detector developed by Leonardo UK. This breakthrough has been made possible thanks to the use of an e-APD infrared focal plane array which is a real disruptive technology in imagery. C-RED One is an autonomous system with an integrated cooling system and a vacuum regeneration system. It operates its sensor with a wide variety of read out techniques and processes video on-board thanks to an FPGA. We will show its performances and expose its main features. In addition to this project, First Light Imaging developed an InGaAs 640x512 fast camera with unprecedented performances in terms of noise, dark and readout speed based on the SNAKE SWIR detector from Sofradir. The camera was called C-RED 2. The C-RED 2 characteristics and performances will be described. The C-RED One project has received funding from the European Union's Horizon 2020 research and innovation program under grant agreement N° 673944. The C-RED 2 development is supported by the "Investments for the future" program and the Provence Alpes Côte d'Azur Region, in the frame of the CPER.

  16. Pyramidatine (Z88) Sensitizes Vincristine-Resistant Human Oral Cancer (KB/VCR) Cells to Chemotherapeutic Agents by Inhibition of P-glycoprotein.

    Science.gov (United States)

    Liu, Zulong; Zhu, Hengrui; Qu, Shijin; Tang, Lisha; Cao, Lihuan; Yu, Wenbo; Yang, Xianmei; Jiang, Songmin; Zhu, Dayuan; Tan, Changheng; Yu, Long

    2018-01-01

    Multi-drug resistance (MDR) remains a major impediment in cancer therapy. A major goal for scientists is to discover more effective compounds that are able to circumvent MDR and simultaneously have minimal adverse side effects. In the present study, we aim to determine the anti-MDR effects of pyramidatine (Z88), a cinnamic acid-derived bisamide compound isolated from the leaves of Aglaia perviridis, on KB/VCR (vincristineresistant human oral cancer cells) and MCF-7/ADR (adriamycin-resistant human breast adenocarcinoma) cells. Cell viability and average resistant fold (RF) of Z88 were examined by Cell Counting Kit-8 (CCK-8) assay. Flow cytometry, western blot, RT-PCR, Rhodamine 123 accumulation assay and P-glycoprotein (P-gp) ATPase assay were used to demonstrate the anti-MDR activity and mechanism of Z88. The average RF of Z88 is 0.09 and 0.51 in KB/VCR and MCF-7/ADR cells. A CCK-8 assay showed that Z88 could enhance the cytotoxicity of VCR toward KB/VCR cells. A FACS analysis revealed that Z88 could enhance the VCR-induced apoptosis as well as G2/M arrest in a dose-dependent manner in KB/VCR cells. Western blot results showed that the expression levels of PARP, Bax, and cyclin B1 all increased after treatment with 0.2 µmol/L (µM) of VCR combined with 10 µM of Z88 for 24 h in KB/VCR cells. Z88 also could enhance the accumulation of rhodamine 123. Further studies showed that Z88 could inhibit the verapamil stimulated Pgp ATPase activity. Additionally, qPCR detection and western blot assays revealed that Z88 could decrease the expression of P-gp at both RNA and protein level. Z88 exerted potent anti-MDR activity in vitro and its mechanisms are associated with dualinhibition of the function and expression of P-gp. These findings encourage efforts to develop more effective reversal agents to circumvent MDR based on Z88. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Glaucarubinone sensitizes KB cells to paclitaxel by inhibiting ABC transporters via ROS-dependent and p53-mediated activation of apoptotic signaling pathways.

    Science.gov (United States)

    Karthikeyan, Subburayan; Hoti, Sugeerappa Laxmanappa; Nazeer, Yasin; Hegde, Harsha Vasudev

    2016-07-05

    Multidrug resistance (MDR) is considered to be the major contributor to failure of chemotherapy in oral squamous cell carcinoma (SCC). This study was aimed to explore the effects and mechanisms of glaucarubinone (GLU), one of the major quassinoids from Simarouba glauca DC, in potentiating cytotoxicity of paclitaxel (PTX), an anticancer drug in KB cells. Our data showed that the administration of GLU pre-treatment significantly enhanced PTX anti-proliferative effect in ABCB1 over-expressing KB cells. The Rh 123 drug efflux studies revealed that there was a significant transport function inhibition by GLU-PTX treatment. Interestingly, it was also found that this enhanced anticancer efficacy of GLU was associated with PTX-induced cell arrest in the G2/M phase of cell cycle. Further, the combined treatment of GLU-PTX had significant decrease in the expression levels of P-gp, MRPs, and BCRP in resistant KB cells at both mRNA and protein levels. Furthermore, the combination treatments showed significant reactive oxygen species (ROS) production, chromatin condensation and reduced mitochondrial membrane potential in resistant KB cells. The results from DNA fragmentation analysis also demonstrated the GLU induced apoptosis in KB cells and its synergy with PTX. Importantly, GLU and/or PTX triggered apoptosis through the activation of pro-apoptotic proteins such as p53, Bax, and caspase-9. Our findings demonstrated for the first time that GLU causes cell death in human oral cancer cells via the ROS-dependent suppression of MDR transporters and p53-mediated activation of the intrinsic mitochondrial pathway of apoptosis. Additionally, the present study also focussed on investigation of the protective effect of GLU and combination drugs in human normal blood lymphocytes. Normal blood lymphocytes assay indicated that GLU is able to induce selective toxicity in cancer cells and in silico molecular docking studies support the choice of GLU as ABC inhibitor to enhance PTX efficacy

  18. The fast breeder reactor

    International Nuclear Information System (INIS)

    Collier, J.

    1990-01-01

    The arguments for and against the fast breeder reactor are debated. The case for the fast reactor is that the world energy demand will increase due to increasing population over the next forty years and that the damage to the global environment from burning fossil fuels which contribute to the greenhouse effect. Nuclear fission is the only large scale energy source which can achieve a cut in the use of carbon based fuels although energy conservation and renewable sources will also be important. Fast reactors produce more energy from uranium than other types of (thermal) reactors such as AGRs and PWRs. Fast reactors would be important from about 2020 onwards especially as by then many thermal reactors will need to be replaced. Fast reactors are also safer than normal reactors. The arguments against fast reactors are largely economic. The cost, especially the capital cost is very high. The viability of the technology is also questioned. (UK)

  19. The fast breeder reactor

    International Nuclear Information System (INIS)

    Davis, D.A.; Baker, M.A.W.; Hall, R.S.

    1990-01-01

    Following submission of written evidence, the Energy Committee members asked questions of three witnesses from the Central Electricity Generating Board and Nuclear Electric (which will be the government owned company running nuclear power stations after privatisation). Both questions and answers are reported verbatim. The points raised include where the responsibility for the future fast reactor programme should lie, with government only or with private enterprise or both and the viability of fast breeder reactors in the future. The case for the fast reactor was stated as essentially strategic not economic. This raised the issue of nuclear cost which has both a construction and a decommissioning element. There was considerable discussion as to the cost of building a European Fast reactor and the cost of the electricity it would generate compared with PWR type reactors. The likely demand for fast reactors will not arrive for 20-30 years and the need to build a fast reactor now is questioned. (UK)

  20. The expressions of NF-kb and TGFb-1 on odontoblast-like cells of human dental pulp injected with propolis extracts

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2014-03-01

    Full Text Available Background: Propolis is known to have beneficial effects, namely anti- bacterial, anti-viral, anti-inflammatory, antioxidant, and immunomodulatory. Propolis extracts with anti-inflammatory properties are expected to be useful in treating inflamed pulp tissue with a diagnosis of reversible pulpitis. The inflammation of pulp tissue is caused by bacteria, namely Lactobacillus acidophilus. This research used odontoblast like cells derived from pulp tissue of human third molars. Odontoblast like cells exposed to Lactobacillus achidophilus were used as a model of proinflammatory cytokine signaling. This research examined the effects of propolis extracts on odontoblast like cells exposed to Lactobacillus acidophilus. Purpose: This research was aimed to determine the effectiveness of propolis extracts on the activities of odontoblast-like cells exposed to Lactobacillus acidophillus by measuring the expressions of NFkb and TGF- b1. Methods: First, pulp odontoblast cultures were derived from human dental pulp tissues of impacted third molars removed by using digestion method. Next, odontoblast-like cells exposed to inactive Lactobacillus acidophilus bacteria were given propolis extract. Finally, the activities of odontoblast-like cells were monitored by measuring the expressions of NF-kb and TGFb-1 with immunocytochemistry technique. Results: A decline NF-kb expression and on increase of TGFb-1 expression on odontoblast like cells exposed to inactive Lactobacillus acidophilus. Conclusion: Propolis extracts inhibit the expression of NF-kb, and increase the expression of TGF-b1 in pulp odontoblast-like cells exposed to inactive Lactobacillus acidophillus.Latar belakang: Propolis dilaporkan mempunyai efek menguntungkan yaitu bersifat anti bakteri, anti virus, anti inflamasi, anti oksidan, dan imunomodulator. Ekstrak propolis dengan sifat anti inflamasi diharapkan bermanfaat untuk mengobati jaringan pulpa yang mengalami inflamasi dengan diagnosis pulpitis

  1. RedNemo

    DEFF Research Database (Denmark)

    Alkan, Ferhat; Erten, Cesim

    2017-01-01

    is their erroneous nature; they contain false-positive interactions and usually many more false-negatives. Recently, several computational methods have been proposed for network reconstruction based on topology, where given an input PPI network the goal is to reconstruct the network by identifying false...... material including source code, useful scripts, experimental data and the results are available at http://webprs.khas.edu.tr/∼cesim/Red Nemo. tar.gz CONTACT: cesim@khas.edu.tr Supplementary information: Supplementary data are available at Bioinformatics online....

  2. Deep Red (Profondo Rosso)

    CERN Multimedia

    Cine Club

    2015-01-01

    Wednesday 29 April 2015 at 20:00 CERN Council Chamber    Deep Red (Profondo Rosso) Directed by Dario Argento (Italy, 1975) 126 minutes A psychic who can read minds picks up the thoughts of a murderer in the audience and soon becomes a victim. An English pianist gets involved in solving the murders, but finds many of his avenues of inquiry cut off by new murders, and he begins to wonder how the murderer can track his movements so closely. Original version Italian; English subtitles

  3. Red DirCom

    Directory of Open Access Journals (Sweden)

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  4. Fast reactors worldwide

    International Nuclear Information System (INIS)

    Hall, R.S.; Vignon, D.

    1985-01-01

    The paper concerns the evolution of fast reactors over the past 30 years, and their present status. Fast reactor development in different countries is described, and the present position, with emphasis on cost reduction and collaboration, is examined. The French development of the fast breeder type reactor is reviewed, and includes: the acquisition of technical skills, the search for competitive costs and the spx2 project, and more advanced designs. Future prospects are also discussed. (U.K.)

  5. Fast breeder reactors

    International Nuclear Information System (INIS)

    Heinzel, V.

    1975-01-01

    The author gives a survey of 'fast breeder reactors'. In detail the process of breeding, the reasons for the development of fast breeders, the possible breeder reactors, the design criteria, fuels, cladding, coolant, and safety aspects are reported on. Design data of some experimental reactors already in operation are summarized in stabular form. 300 MWe Prototype-Reactors SNR-300 and PFR are explained in detail and data of KWU helium-cooled fast breeder reactors are given. (HR) [de

  6. Fast wave current drive

    International Nuclear Information System (INIS)

    Goree, J.; Ono, M.; Colestock, P.; Horton, R.; McNeill, D.; Park, H.

    1985-07-01

    Fast wave current drive is demonstrated in the Princeton ACT-I toroidal device. The fast Alfven wave, in the range of high ion-cyclotron harmonics, produced 40 A of current from 1 kW of rf power coupled into the plasma by fast wave loop antenna. This wave excites a steady current by damping on the energetic tail of the electron distribution function in the same way as lower-hybrid current drive, except that fast wave current drive is appropriate for higher plasma densities

  7. Red - take a closer look.

    Directory of Open Access Journals (Sweden)

    Vanessa L Buechner

    Full Text Available Color research has shown that red is associated with avoidance of threat (e.g., failure or approach of reward (e.g., mating depending on the context in which it is perceived. In the present study we explored one central cognitive process that might be involved in the context dependency of red associations. According to our theory, red is supposed to highlight the relevance (importance of a goal-related stimulus and correspondingly intensifies the perceivers' attentional reaction to it. Angry and happy human compared to non-human facial expressions were used as goal-relevant stimuli. The data indicate that the color red leads to enhanced attentional engagement to angry and happy human facial expressions (compared to neutral ones - the use of non-human facial expressions does not bias attention. The results are discussed with regard to the idea that red induced attentional biases might explain the red-context effects on motivation.

  8. Listening to Red

    Directory of Open Access Journals (Sweden)

    Sinazo Mtshemla

    Full Text Available Following a distinction John Mowitt draws between hearing (and phonics, and listening (and sonics, this article argues that the dominant notion of listening to sound was determined by the disciplinary framework of South African history and by the deployment of a cinematic documentary apparatus, both of which have served to disable the act of listening. The conditions of this hearing, and a deafness to a reduced or bracketed listening (Chion via Schaeffer that would enable us to think the post in post-apartheid differently, is thus at the centre of our concerns here. We stage a series of screenings of expected possible soundtracks for Simon Gush's film and installation Red, simultaneously tracking the ways that sound - and particularly music and dialogue - can be shown to hold a certain way of thinking both the political history of South Africa and the politics of South African history. We conclude by listening more closely to hiss and murmur in the soundtrack to Red and suggest this has major implications for considering ways of thinking and knowing.

  9. Fast food purchasing and access to fast food restaurants: a multilevel analysis of VicLANES

    Science.gov (United States)

    Thornton, Lukar E; Bentley, Rebecca J; Kavanagh, Anne M

    2009-01-01

    Background While previous research on fast food access and purchasing has not found evidence of an association, these studies have had methodological problems including aggregation error, lack of specificity between the exposures and outcomes, and lack of adjustment for potential confounding. In this paper we attempt to address these methodological problems using data from the Victorian Lifestyle and Neighbourhood Environments Study (VicLANES) – a cross-sectional multilevel study conducted within metropolitan Melbourne, Australia in 2003. Methods The VicLANES data used in this analysis included 2547 participants from 49 census collector districts in metropolitan Melbourne, Australia. The outcome of interest was the total frequency of fast food purchased for consumption at home within the previous month (never, monthly and weekly) from five major fast food chains (Red Rooster, McDonalds, Kentucky Fried Chicken, Hungry Jacks and Pizza Hut). Three measures of fast food access were created: density and variety, defined as the number of fast food restaurants and the number of different fast food chains within 3 kilometres of road network distance respectively, and proximity defined as the road network distance to the closest fast food restaurant. Multilevel multinomial models were used to estimate the associations between fast food restaurant access and purchasing with never purchased as the reference category. Models were adjusted for confounders including determinants of demand (attitudes and tastes that influence food purchasing decisions) as well as individual and area socio-economic characteristics. Results Purchasing fast food on a monthly basis was related to the variety of fast food restaurants (odds ratio 1.13; 95% confidence interval 1.02 – 1.25) after adjusting for individual and area characteristics. Density and proximity were not found to be significant predictors of fast food purchasing after adjustment for individual socio-economic predictors

  10. Fast food purchasing and access to fast food restaurants: a multilevel analysis of VicLANES.

    Science.gov (United States)

    Thornton, Lukar E; Bentley, Rebecca J; Kavanagh, Anne M

    2009-05-27

    While previous research on fast food access and purchasing has not found evidence of an association, these studies have had methodological problems including aggregation error, lack of specificity between the exposures and outcomes, and lack of adjustment for potential confounding. In this paper we attempt to address these methodological problems using data from the Victorian Lifestyle and Neighbourhood Environments Study (VicLANES) - a cross-sectional multilevel study conducted within metropolitan Melbourne, Australia in 2003. The VicLANES data used in this analysis included 2547 participants from 49 census collector districts in metropolitan Melbourne, Australia. The outcome of interest was the total frequency of fast food purchased for consumption at home within the previous month (never, monthly and weekly) from five major fast food chains (Red Rooster, McDonalds, Kentucky Fried Chicken, Hungry Jacks and Pizza Hut). Three measures of fast food access were created: density and variety, defined as the number of fast food restaurants and the number of different fast food chains within 3 kilometres of road network distance respectively, and proximity defined as the road network distance to the closest fast food restaurant.Multilevel multinomial models were used to estimate the associations between fast food restaurant access and purchasing with never purchased as the reference category. Models were adjusted for confounders including determinants of demand (attitudes and tastes that influence food purchasing decisions) as well as individual and area socio-economic characteristics. Purchasing fast food on a monthly basis was related to the variety of fast food restaurants (odds ratio 1.13; 95% confidence interval 1.02 - 1.25) after adjusting for individual and area characteristics. Density and proximity were not found to be significant predictors of fast food purchasing after adjustment for individual socio-economic predictors. Although we found an independent

  11. Fast food purchasing and access to fast food restaurants: a multilevel analysis of VicLANES

    Directory of Open Access Journals (Sweden)

    Kavanagh Anne M

    2009-05-01

    Full Text Available Abstract Background While previous research on fast food access and purchasing has not found evidence of an association, these studies have had methodological problems including aggregation error, lack of specificity between the exposures and outcomes, and lack of adjustment for potential confounding. In this paper we attempt to address these methodological problems using data from the Victorian Lifestyle and Neighbourhood Environments Study (VicLANES – a cross-sectional multilevel study conducted within metropolitan Melbourne, Australia in 2003. Methods The VicLANES data used in this analysis included 2547 participants from 49 census collector districts in metropolitan Melbourne, Australia. The outcome of interest was the total frequency of fast food purchased for consumption at home within the previous month (never, monthly and weekly from five major fast food chains (Red Rooster, McDonalds, Kentucky Fried Chicken, Hungry Jacks and Pizza Hut. Three measures of fast food access were created: density and variety, defined as the number of fast food restaurants and the number of different fast food chains within 3 kilometres of road network distance respectively, and proximity defined as the road network distance to the closest fast food restaurant. Multilevel multinomial models were used to estimate the associations between fast food restaurant access and purchasing with never purchased as the reference category. Models were adjusted for confounders including determinants of demand (attitudes and tastes that influence food purchasing decisions as well as individual and area socio-economic characteristics. Results Purchasing fast food on a monthly basis was related to the variety of fast food restaurants (odds ratio 1.13; 95% confidence interval 1.02 – 1.25 after adjusting for individual and area characteristics. Density and proximity were not found to be significant predictors of fast food purchasing after adjustment for individual socio

  12. Red Teaming: Past and Present

    National Research Council Canada - National Science Library

    Longbine, David F

    2008-01-01

    .... Key aspects of the Army red teaming definition are its emphasis on independent thinking, challenging organizational thinking, incorporating alternative perspectives, and incorporating alternative analysis...

  13. Fast multichannel analyser

    Energy Technology Data Exchange (ETDEWEB)

    Berry, A; Przybylski, M M; Sumner, I [Science Research Council, Daresbury (UK). Daresbury Lab.

    1982-10-01

    A fast multichannel analyser (MCA) capable of sampling at a rate of 10/sup 7/ s/sup -1/ has been developed. The instrument is based on an 8 bit parallel encoding analogue to digital converter (ADC) reading into a fast histogramming random access memory (RAM) system, giving 256 channels of 64 k count capacity. The prototype unit is in CAMAC format.

  14. A fast multichannel analyser

    International Nuclear Information System (INIS)

    Berry, A.; Przybylski, M.M.; Sumner, I.

    1982-01-01

    A fast multichannel analyser (MCA) capable of sampling at a rate of 10 7 s -1 has been developed. The instrument is based on an 8 bit parallel encoding analogue to digital converter (ADC) reading into a fast histogramming random access memory (RAM) system, giving 256 channels of 64 k count capacity. The prototype unit is in CAMAC format. (orig.)

  15. International red meat trade.

    Science.gov (United States)

    Brester, Gary W; Marsh, John M; Plain, Ronald L

    2003-07-01

    The maturation of the US beef and pork markets and increasing consumer demands for convenience, safety, and nutrition suggests that the beef and pork industries must focus on product development and promotion. New marketing arrangements are developing that help coordinate production with consumer demands. The relative high levels of incomes in the United States are likely to increase the demands for branded products rather than increase total per capita consumption. Foreign markets represent the greatest opportunity for increased demand for commodity beef and pork products. Increasing incomes in developing countries will likely allow consumers to increase consumption of animal-source proteins. Real prices of beef and pork have declined substantially because of sagging domestic demand and increasing farm-level production technologies. Increasing US beef and pork exports have obviated some of the price declines. Pork attained a net export position from a quantity perspective in 1995. The United States continues to be a net importer of beef on a quantity basis but is close to becoming a net exporter in terms of value. By-products continue to play a critical role in determining the red meat trade balance and producer prices. The United States, however, must continue to become cost, price, and quality competitive with other suppliers and must secure additional market access if it is to sustain recent trade trends. Several trade tensions remain in the red meat industry. For example, mandated COOL will undoubtedly have domestic and international effects on the beef and pork sectors. Domestically, uncertainty regarding consumer demand responses or quality perceptions regarding product origin, as well as added processor-retailer costs will be nontrivial. How these factors balance out in terms of benefits versus costs to the industry is uncertain. From an international perspective, some beef and pork export suppliers to the United States could view required labeling as a

  16. Islamic Fasting and Diabetes

    Directory of Open Access Journals (Sweden)

    Fereidoun Azizi

    2013-07-01

    Full Text Available The aim of this article is to review health-related aspects of Ramadan fasting in normal individuals and diabetics. During fasting days of Ramadan, glucose homeostasis is maintained by meal taken bepore dawn and by liver glycogen stores. Changes in serum lipids are variable and defend on the quality and quantity of food consumption and changes in weight. Compliant, well controlled type 2 diabetics may observe Ramadan fasting; but fasting is not recommended for type 1, non complaint, poorly controlled and pregnant diabetics. Although Ramadan fasting is safe for all healthy individuals and well controlled diabetics, those with uncontrolled diabetics and diabetics with complications should consult physicians and follow scientific recommendations.

  17. Fast Spectrum Reactors

    CERN Document Server

    Todd, Donald; Tsvetkov, Pavel

    2012-01-01

    Fast Spectrum Reactors presents a detailed overview of world-wide technology contributing to the development of fast spectrum reactors. With a unique focus on the capabilities of fast spectrum reactors to address nuclear waste transmutation issues, in addition to the well-known capabilities of breeding new fuel, this volume describes how fast spectrum reactors contribute to the wide application of nuclear power systems to serve the global nuclear renaissance while minimizing nuclear proliferation concerns. Readers will find an introduction to the sustainable development of nuclear energy and the role of fast reactors, in addition to an economic analysis of nuclear reactors. A section devoted to neutronics offers the current trends in nuclear design, such as performance parameters and the optimization of advanced power systems. The latest findings on fuel management, partitioning and transmutation include the physics, efficiency and strategies of transmutation, homogeneous and heterogeneous recycling, in addit...

  18. Fast ejendom III

    DEFF Research Database (Denmark)

    Munk-Hansen, Carsten

    Bogen er det tredje bind af tre planlagte bind om fast ejendom: I Overdragelsen, II Bolighandlen og III Ejerbeføjelsen. Fremstillingens giver et grundigt overblik over centrale områder af en omfattende regulering af fast ejendom, med angivelse af litteratur, hvor læseren kan søge yderligere...... oplysning. En ejer af fast ejendom er på særdeles mange områder begrænset i sin råden sammenlignet med ejeren af et formuegode i almindelighed. Fremstillingen tager udgangspunkt i ejerens perspektiv (fremfor samfundets eller myndighedernes). Både den privatretlige og offentligretlige regulering behandles......, eksempelvis ejendomsdannelsen, servitutter, naboretten, hævd, zoneinddelingen, den fysiske planlægning, beskyttelse af natur, beskyttelse af kultur, forurening fra fast ejendom, erstatning for forurening, jordforurening, ekspropriation, byggeri og adgang til fast ejendom....

  19. Fast fission phenomena

    International Nuclear Information System (INIS)

    Gregoire, Christian.

    1982-03-01

    Experimental studies of fast fission phenomena are presented. The paper is divided into three parts. In the first part, problems associated with fast fission processes are examined in terms of interaction potentials and a dynamic model is presented in which highly elastic collisions, the formation of compound nuclei and fast fission appear naturally. In the second part, a description is given of the experimental methods employed, the observations made and the preliminary interpretation of measurements suggesting the occurence of fast fission processes. In the third part, our dynamic model is incorporated in a general theory of the dissipative processes studied. This theory enables fluctuations associated with collective variables to be calculated. It is applied to highly inelastic collisions, to fast fission and to the fission dynamics of compound nuclei (for which a schematic representation is given). It is with these calculations that the main results of the second part can be interpreted [fr

  20. Preventing blue ocean from turning into red ocean: A case study of a room escape game

    OpenAIRE

    Gündüz, Şafak

    2018-01-01

    The weariness of competitive business environment has made it one of the hot topics of recent business management literature to find ways to escape from the intense Red Ocean by creating a Blue Ocean where there is no competition. Rene and Mauborgne’s Blue Ocean Strategy (2004) provides a reasonable solution for this issue. Blue Ocean Strategy studies demonstrate that every blue ocean will eventually turn red due to fast entries into the market and the literature leaves a gap in understanding...

  1. Pulsating red variables

    International Nuclear Information System (INIS)

    Whitelock, P.A.

    1990-01-01

    The observational characteristics of pulsating red variables are reviewed with particular emphasis on the Miras. These variables represent the last stage in the evolution of stars on the Asymptotic Giant Branch (AGB). A large fraction of the IRAS sources in the Bulge are Mira variables and a subset of these are also OH/IR sources. Their periods range up to 720 days, though most are between 360 and 560 days. At a given period those stars with the highest pulsation amplitudes have the highest mass-loss rates; this is interpreted as evidence for a causal connection between mass-loss and pulsation. It is suggested that once an AGB star has become a Mira it will evolve with increasing pulsation amplitude and mass-loss, but with very little change of luminosity or logarithmic period. 26 refs

  2. The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

    Science.gov (United States)

    Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

    2014-06-01

    The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

  3. Putative dopamine agonist (KB220Z) attenuates lucid nightmares in PTSD patients: role of enhanced brain reward functional connectivity and homeostasis redeeming joy.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L; Simpatico, Thomas; Gold, Mark S

    2015-06-01

    Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid "bad dreams" remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient's regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies.

  4. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

    Science.gov (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

    1998-08-01

    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  5. Fine Mapping Suggests that the Goat Polled Intersex Syndrome and the Human Blepharophimosis Ptosis Epicanthus Syndrome Map to a 100-kb Homologous Region

    OpenAIRE

    Schibler, Laurent; Cribiu, Edmond P.; Oustry-Vaiman, Anne; Furet, Jean-Pierre; Vaiman, Daniel

    2000-01-01

    To clone the goat Polled Intersex Syndrome (PIS) gene(s), a chromosome walk was performed from six entry points at 1q43. This enabled 91 BACs to be recovered from a recently constructed goat BAC library. Six BAC contigs of goat chromosome 1q43 (ICC1–ICC6) were thus constructed covering altogether 4.5 Mb. A total of 37 microsatellite sequences were isolated from this 4.5-Mb region (16 in this study), of which 33 were genotyped and mapped. ICC3 (1500 kb) was shown by genetic analysis to encompa...

  6. Identification of a 3.0-kb Major Recombination Hotspot in Patients with Sotos Syndrome Who Carry a Common 1.9-Mb Microdeletion

    Science.gov (United States)

    Visser, Remco; Shimokawa, Osamu; Harada, Naoki; Kinoshita, Akira; Ohta, Tohru; Niikawa, Norio; Matsumoto, Naomichi

    2005-01-01

    Sotos syndrome (SoS) is a congenital dysmorphic disorder characterized by overgrowth in childhood, distinctive craniofacial features, and mental retardation. Haploinsufficiency of the NSD1 gene owing to either intragenic mutations or microdeletions is known to be the major cause of SoS. The common ∼2.2-Mb microdeletion encompasses the whole NSD1 gene and neighboring genes and is flanked by low-copy repeats (LCRs). Here, we report the identification of a 3.0-kb major recombination hotspot within these LCRs, in which we mapped deletion breakpoints in 78.7% (37/47) of patients with SoS who carry the common microdeletion. The deletion size was subsequently refined to 1.9 Mb. Sequencing of breakpoint fragments from all 37 patients revealed junctions between a segment of the proximal LCR (PLCR-B) and the corresponding region of the distal LCR (DLCR-2B). PLCR-B and DLCR-2B are the only directly oriented regions, whereas the remaining regions of the PLCR and DLCR are in inverted orientation. The PLCR, with a size of 394.0 kb, and the DLCR, with a size of of 429.8 kb, showed high overall homology (∼98.5%), with an increased sequence similarity (∼99.4%) within the 3.0-kb breakpoint cluster. Several recombination-associated motifs were identified in the hotspot and/or its vicinity. Interestingly, a 10-fold average increase of a translin motif, as compared with the normal distribution within the LCRs, was recognized. Furthermore, a heterozygous inversion of the interval between the LCRs was detected in all fathers of the children carrying a deletion in the paternally derived chromosome. The functional significance of these findings remains to be elucidated. Segmental duplications of the primate genome play a major role in chromosomal evolution. Evolutionary study showed that the duplication of the SoS LCRs occurred 23.3–47.6 million years ago, before the divergence of Old World monkeys. PMID:15580547

  7. KB-R7943 reduces 4-aminopyridine-induced epileptiform activity in adult rats after neuronal damage induced by neonatal monosodium glutamate treatment.

    Science.gov (United States)

    Hernandez-Ojeda, Mariana; Ureña-Guerrero, Monica E; Gutierrez-Barajas, Paola E; Cardenas-Castillo, Jazmin A; Camins, Antoni; Beas-Zarate, Carlos

    2017-05-09

    Neonatal monosodium glutamate (MSG) treatment triggers excitotoxicity and induces a degenerative process that affects several brain regions in a way that could lead to epileptogenesis. Na + /Ca 2+ exchangers (NCX1-3) are implicated in Ca 2+ brain homeostasis; normally, they extrude Ca 2+ to control cell inflammation, but after damage and in epilepsy, they introduce Ca 2+ by acting in the reverse mode, amplifying the damage. Changes in NCX3 expression in the hippocampus have been reported immediately after neonatal MSG treatment. In this study, the expression level of NCX1-3 in the entorhinal cortex (EC) and hippocampus (Hp); and the effects of blockade of NCXs on the seizures induced by 4-Aminopyridine (4-AP) were analysed in adult rats after neonatal MSG treatment. KB-R7943 was applied as NCXs blocker, but is more selective to NCX3 in reverse mode. Neonatal MSG treatment was applied to newborn male rats at postnatal days (PD) 1, 3, 5, and 7 (4 g/kg of body weight, s.c.). Western blot analysis was performed on total protein extracts from the EC and Hp to estimate the expression level of NCX1-3 proteins in relative way to the expression of β-actin, as constitutive protein. Electrographic activity of the EC and Hp were acquired before and after intracerebroventricular (i.c.v.) infusion of 4-AP (3 nmol) and KB-R7943 (62.5 pmol), alone or in combination. All experiments were performed at PD60. Behavioural alterations were also recorder. Neonatal MSG treatment significantly increased the expression of NCX3 protein in both studied regions, and NCX1 protein only in the EC. The 4-AP-induced epileptiform activity was significantly higher in MSG-treated rats than in controls, and KB-R7943 co-administered with 4-AP reduced the epileptiform activity in more prominent way in MSG-treated rats than in controls. The long-term effects of neonatal MSG treatment include increases on functional expression of NCXs (mainly of NCX3) in the EC and Hp, which seems to contribute to

  8. Decadal trends in Red Sea maximum surface temperature.

    Science.gov (United States)

    Chaidez, V; Dreano, D; Agusti, S; Duarte, C M; Hoteit, I

    2017-08-15

    Ocean warming is a major consequence of climate change, with the surface of the ocean having warmed by 0.11 °C decade -1 over the last 50 years and is estimated to continue to warm by an additional 0.6 - 2.0 °C before the end of the century 1 . However, there is considerable variability in the rates experienced by different ocean regions, so understanding regional trends is important to inform on possible stresses for marine organisms, particularly in warm seas where organisms may be already operating in the high end of their thermal tolerance. Although the Red Sea is one of the warmest ecosystems on earth, its historical warming trends and thermal evolution remain largely understudied. We characterized the Red Sea's thermal regimes at the basin scale, with a focus on the spatial distribution and changes over time of sea surface temperature maxima, using remotely sensed sea surface temperature data from 1982 - 2015. The overall rate of warming for the Red Sea is 0.17 ± 0.07 °C decade -1 , while the northern Red Sea is warming between 0.40 and 0.45 °C decade -1 , all exceeding the global rate. Our findings show that the Red Sea is fast warming, which may in the future challenge its organisms and communities.

  9. Decadal trends in Red Sea maximum surface temperature

    KAUST Repository

    Chaidez, Veronica

    2017-08-09

    Ocean warming is a major consequence of climate change, with the surface of the ocean having warmed by 0.11 °C decade-1 over the last 50 years and is estimated to continue to warm by an additional 0.6 - 2.0 °C before the end of the century1. However, there is considerable variability in the rates experienced by different ocean regions, so understanding regional trends is important to inform on possible stresses for marine organisms, particularly in warm seas where organisms may be already operating in the high end of their thermal tolerance. Although the Red Sea is one of the warmest ecosystems on earth, its historical warming trends and thermal evolution remain largely understudied. We characterized the Red Sea\\'s thermal regimes at the basin scale, with a focus on the spatial distribution and changes over time of sea surface temperature maxima, using remotely sensed sea surface temperature data from 1982 - 2015. The overall rate of warming for the Red Sea is 0.17 ± 0.07 °C decade-1, while the northern Red Sea is warming between 0.40 and 0.45 °C decade-1, all exceeding the global rate. Our findings show that the Red Sea is fast warming, which may in the future challenge its organisms and communities.

  10. Decadal trends in Red Sea maximum surface temperature

    KAUST Repository

    Chaidez, Veronica; Dreano, Denis; Agusti, Susana; Duarte, Carlos M.; Hoteit, Ibrahim

    2017-01-01

    Ocean warming is a major consequence of climate change, with the surface of the ocean having warmed by 0.11 °C decade-1 over the last 50 years and is estimated to continue to warm by an additional 0.6 - 2.0 °C before the end of the century1. However, there is considerable variability in the rates experienced by different ocean regions, so understanding regional trends is important to inform on possible stresses for marine organisms, particularly in warm seas where organisms may be already operating in the high end of their thermal tolerance. Although the Red Sea is one of the warmest ecosystems on earth, its historical warming trends and thermal evolution remain largely understudied. We characterized the Red Sea's thermal regimes at the basin scale, with a focus on the spatial distribution and changes over time of sea surface temperature maxima, using remotely sensed sea surface temperature data from 1982 - 2015. The overall rate of warming for the Red Sea is 0.17 ± 0.07 °C decade-1, while the northern Red Sea is warming between 0.40 and 0.45 °C decade-1, all exceeding the global rate. Our findings show that the Red Sea is fast warming, which may in the future challenge its organisms and communities.

  11. Volume tables for red alder.

    Science.gov (United States)

    Floyd A. Johnson; R. M. Kallander; Paul G. Lauterbach

    1949-01-01

    The increasing importance of red alder as a commercial species in the Pacific Northwest has prompted the three agencies listed above to pool their tree measurement data for the construction of standard regional red alder volume tables. The tables included here were based on trees from a variety of sites and form classes. Approximately one quarter of the total number of...

  12. Skeleton decay in red cedar

    Science.gov (United States)

    Kevin T. Smith; Jessie A. Glaeser

    2013-01-01

    Eastern red cedar (Juniperus virginiana) is a common tree species throughout the eastern United States and the Great Plains. Although “cedar” is in the common name, the scientifc name shows a botanical kinship to the juniper species of the American southwest. Red cedar can survive and thrive within a broad range of soil conditions, seasonal...

  13. Fast Breeder Reactor studies

    International Nuclear Information System (INIS)

    Till, C.E.; Chang, Y.I.; Kittel, J.H.; Fauske, H.K.; Lineberry, M.J.; Stevenson, M.G.; Amundson, P.I.; Dance, K.D.

    1980-07-01

    This report is a compilation of Fast Breeder Reactor (FBR) resource documents prepared to provide the technical basis for the US contribution to the International Nuclear Fuel Cycle Evaluation. The eight separate parts deal with the alternative fast breeder reactor fuel cycles in terms of energy demand, resource base, technical potential and current status, safety, proliferation resistance, deployment, and nuclear safeguards. An Annex compares the cost of decommissioning light-water and fast breeder reactors. Separate abstracts are included for each of the parts

  14. Fast track-hoftealloplastik

    DEFF Research Database (Denmark)

    Hansen, Torben Bæk; Gromov, Kirill; Kristensen, Billy B

    2017-01-01

    Fast-track surgery implies a coordinated perioperative approach aimed at reducing surgical stress and facilitating post-operative recovery. The fast-track programme has reduced post-operative length of stay and has led to shorter convalescence with more rapid functional recovery and decreased...... morbidity and mortality in total hip arthroplasty. It should now be a standard total hip arthroplasty patient pathway, but fine tuning of the multiple factors in the fast-track pathway is still needed in patients with special needs or high comorbidity burden....

  15. Fast Breeder Reactor studies

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.; Kittel, J.H.; Fauske, H.K.; Lineberry, M.J.; Stevenson, M.G.; Amundson, P.I.; Dance, K.D.

    1980-07-01

    This report is a compilation of Fast Breeder Reactor (FBR) resource documents prepared to provide the technical basis for the US contribution to the International Nuclear Fuel Cycle Evaluation. The eight separate parts deal with the alternative fast breeder reactor fuel cycles in terms of energy demand, resource base, technical potential and current status, safety, proliferation resistance, deployment, and nuclear safeguards. An Annex compares the cost of decommissioning light-water and fast breeder reactors. Separate abstracts are included for each of the parts.

  16. FastStats: Measles

    Science.gov (United States)

    ... Women’s Health State and Territorial Data Reproductive Health Contraceptive Use Infertility Reproductive Health Notice Regarding FastStats Mobile ... measles, mumps, rubella: 91.9% (2015) Percent of adolescents aged 13-17 years vaccinated against measles, mumps, ...

  17. Fast neutrons dosimetry

    International Nuclear Information System (INIS)

    Rzyski, B.M.

    1977-01-01

    A proton recoil technique has been developed for inducing thermoluminescence with incident fast neutrons. CaF 2 was used as the TL phosphor, and cane sugar and polyethylene were used as proton radiators. The phosphor and the hydrogeneous material powders were well mixed, encapsulated in glass tubes and exposed to Am-Be sources, resulting in recoils from incident fast neutrons of energy between 0,25 and 11,25 MeV. The intrinsic response of pure CaF 2 to fast neutrons without a hydrogeneous radiator was checked by using LiF (TLD-700). Glow curves were recorded from room temperature up to 350 0 C after different doses of neutrons and gamma rays of 60 Co. First collision dose due to fast neutrons in tissue like materials such as cane sugar and polyethylene was also calculated [pt

  18. Dounreay fast reactor

    International Nuclear Information System (INIS)

    Maclennan, R.; Eggar, T.; Skeet, T.

    1992-01-01

    The short debate which followed a private notice question asking for a statement on Government policy on the future of the European fast breeder nuclear research programme is reported verbatim. In response to the question, the Minister for Energy said that the Government had decided in 1988 that the Dounreay prototype fast reactor would close in 1994. That decision had been confirmed. Funding of fast breeder research and development beyond 1993 is not a priority as commercialization is not expected until well into the next century. Dounreay will be supported financially until 1994 and then for its subsequent decommissioning and reprocessing of spent fuel. The debate raised issues such as Britain losing its lead in fast breeder research, loss of jobs and the Government's nuclear policy in general. However, the Government's position was that the research had reached a stage where it could be left and returned to in the future. (UK)

  19. CMS Fast Facts

    Data.gov (United States)

    U.S. Department of Health & Human Services — CMS has developed a new quick reference statistical summary on annual CMS program and financial data. CMS Fast Facts includes summary information on total program...

  20. Brug af faste vendinger

    DEFF Research Database (Denmark)

    Bergenholtz, Henning; Bjærge, Esben

    Ordbogen indelholder tekstproduktionsangivelser til ca. 17.000 idiomer, ordsprog, bevingede ord og andre faste vendinger. Det drejer sig bl.a. om angivelser til betydningen, grammatik, kollokationer, eksempler, synonymer og antonymer....

  1. Isolation of a 97-kb minimal essential MHC B locus from a new reverse-4D BAC library of the golden pheasant.

    Directory of Open Access Journals (Sweden)

    Qing Ye

    Full Text Available The bacterial artificial chromosome (BAC system is widely used in isolation of large genomic fragments of interest. Construction of a routine BAC library requires several months for picking clones and arraying BACs into superpools in order to employ 4D-PCR to screen positive BACs, which might be time-consuming and laborious. The major histocompatibility complex (MHC is a cluster of genes involved in the vertebrate immune system, and the classical avian MHC-B locus is a minimal essential one, occupying a 100-kb genomic region. In this study, we constructed a more effective reverse-4D BAC library for the golden pheasant, which first creates sub-libraries and then only picks clones of positive sub-libraries, and identified several MHC clones within thirty days. The full sequencing of a 97-kb reverse-4D BAC demonstrated that the golden pheasant MHC-B locus contained 20 genes and showed good synteny with that of the chicken. The notable differences between these two species were the numbers of class II B loci and NK genes and the inversions of the TAPBP gene and the TAP1-TAP2 region. Furthermore, the inverse TAP2-TAP1 was unique in the golden pheasant in comparison with that of chicken, turkey, and quail. The newly defined genomic structure of the golden pheasant MHC will give an insight into the evolutionary history of the avian MHC.

  2. Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study

    Science.gov (United States)

    Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth

    2014-01-01

    Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

  3. The interaction of parsing rules and argument – Predicate constructions: implications for the structure of the Grammaticon in FunGramKB

    Directory of Open Access Journals (Sweden)

    María del Carmen Fumero Pérez

    2017-07-01

    Full Text Available The Functional Grammar Knowledge Base (FunGramKB, (Periñán-Pascual and Arcas-Túnez 2010 is a multipurpose lexico-conceptual knowledge base designed to be used in different Natural Language Processing (NLP tasks. It is complemented with the ARTEMIS (Automatically Representing Text Meaning via an Interlingua–based System application, a parsing device linguistically grounded on Role and Reference Grammar (RRG that transduces natural language fragments into their corresponding grammatical and semantic structures. This paper unveils the different phases involved in its parsing routine, paying special attention to the treatment of argumental constructions. As an illustrative case, we will follow all the steps necessary to effectively parse a For-Benefactive structure within ARTEMIS. This methodology will reveal the necessity to distinguish between Kernel constructs and L1-constructions, since the latter involve a modification of the lexical template of the verb. Our definition of L1-constructions leads to the reorganization of the catalogue of FunGramKB L1-constructions, formerly based on Levin’s (1993 alternations. Accordingly, a rearrangement of the internal configuration of the L1-Constructicon within the Grammaticon is proposed.

  4. The human interactome knowledge base (hint-kb): An integrative human protein interaction database enriched with predicted protein–protein interaction scores using a novel hybrid technique

    KAUST Repository

    Theofilatos, Konstantinos A.

    2013-07-12

    Proteins are the functional components of many cellular processes and the identification of their physical protein–protein interactions (PPIs) is an area of mature academic research. Various databases have been developed containing information about experimentally and computationally detected human PPIs as well as their corresponding annotation data. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://biotools.ceid.upatras.gr/hint-kb/), a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, cal-culatesasetoffeaturesofinterest and computesaconfidence score for every candidate protein interaction. This confidence score is essential for filtering the false positive interactions which are present in existing databases, predicting new protein interactions and measuring the frequency of each true protein interaction. For this reason, a novel machine learning hybrid methodology, called (Evolutionary Kalman Mathematical Modelling—EvoKalMaModel), was used to achieve an accurate and interpretable scoring methodology. The experimental results indicated that the proposed scoring scheme outperforms existing computational methods for the prediction of PPIs.

  5. Super-resolution imaging of a 2.5 kb non-repetitive DNA in situ in the nuclear genome using molecular beacon probes

    Science.gov (United States)

    Ni, Yanxiang; Cao, Bo; Ma, Tszshan; Niu, Gang; Huo, Yingdong; Huang, Jiandong; Chen, Danni; Liu, Yi; Yu, Bin; Zhang, Michael Q; Niu, Hanben

    2017-01-01

    High-resolution visualization of short non-repetitive DNA in situ in the nuclear genome is essential for studying looping interactions and chromatin organization in single cells. Recent advances in fluorescence in situ hybridization (FISH) using Oligopaint probes have enabled super-resolution imaging of genomic domains with a resolution limit of 4.9 kb. To target shorter elements, we developed a simple FISH method that uses molecular beacon (MB) probes to facilitate the probe-target binding, while minimizing non-specific fluorescence. We used three-dimensional stochastic optical reconstruction microscopy (3D-STORM) with optimized imaging conditions to efficiently distinguish sparsely distributed Alexa-647 from background cellular autofluorescence. Utilizing 3D-STORM and only 29–34 individual MB probes, we observed 3D fine-scale nanostructures of 2.5 kb integrated or endogenous unique DNA in situ in human or mouse genome, respectively. We demonstrated our MB-based FISH method was capable of visualizing the so far shortest non-repetitive genomic sequence in 3D at super-resolution. DOI: http://dx.doi.org/10.7554/eLife.21660.001 PMID:28485713

  6. Fasting and Urinary Stones

    Directory of Open Access Journals (Sweden)

    Ali Shamsa

    2013-11-01

    Full Text Available Introduction: Fasting is considered as one of the most important practices of Islam, and according to Prophet Mohammad, fasting is obligatory upon Muslims. The aim of this study is to evaluate the effects of fasting on urinary stones. Materials and Methods: Very few studies have been carried out on urinary stones and the effect of Ramadan fasting. The sources of the present study are Medline and articles presented by local and Muslim researchers. Meanwhile, since we are acquainted with three well-known researchers in the field of urology, we contacted them via email and asked for their professional opinions. Results: The results of studies about the relationship of urinary stones and their incidence in Ramadan are not alike, and are even sometimes contradictory. Some believe that increased incidence of urinary stones in Ramadan is related not to fasting, but to the rise of weather temperature in hot months, and an increase in humidity. Conclusion: Numerous biological and behavioral changes occur in people who fast in Ramadan and some researchers believe that urinary stone increases during this month.

  7. Romantic red: red enhances men's attraction to women.

    Science.gov (United States)

    Elliot, Andrew J; Niesta, Daniela

    2008-11-01

    In many nonhuman primates, the color red enhances males' attraction to females. In 5 experiments, the authors demonstrate a parallel effect in humans: Red, relative to other achromatic and chromatic colors, leads men to view women as more attractive and more sexually desirable. Men seem unaware of this red effect, and red does not influence women's perceptions of the attractiveness of other women, nor men's perceptions of women's overall likeability, kindness, or intelligence. The findings have clear practical implications for men and women in the mating game and, perhaps, for fashion consultants, product designers, and marketers. Furthermore, the findings document the value of extending research on signal coloration to humans and of considering color as something of a common language, both within and across species. (c) 2008 APA, all rights reserved.

  8. Effects of Hull Scratching, Soaking, and Boiling on Antinutrients in Japanese Red Sword Bean (Canavalia gladiata).

    Science.gov (United States)

    Une, Satsuki; Nonaka, Koji; Akiyama, Junich

    2016-10-01

    The effects of hull processing, soaking, and boiling on the content or activity of antinutrients in the red sword bean (RSB; Canavalia gladiata) were investigated. RSB seeds were compared with kidney bean (KB; Phaseolus vulgaris) seeds that are starch based and often used as processed products in Japan. RSB seeds had higher weight, thicker hull, and higher protein content, but lower moisture content compared with KB seeds. Because of the strong and thick hull, the relative water absorption of untreated RSB seeds was very low after soaking. Seeds were soaked after dehulling, scratching, and roasting. The results showed that hull scratching was the optimal method for increasing water absorption during soaking compared with dehulling and roasting. After soaking, the water used for soaking was discarded, since it had a high content of polyphenols and bitter taste, and RSB seeds were boiled in fresh water for 20, 40, and 60 min. The results showed that polyphenol and tannin contents, antioxidant activity, and hemagglutinating activity, as well as maltase, sucrase, and trypsin inhibitor activities in scratched RSB seeds decreased significantly after boiling compared with those in raw seeds, whereas amylase inhibitor activity showed no significant change. Overall, it was concluded that the combination of hull scratching, soaking, and boiling in fresh water can reduce thermal-stable or sensitive antinutrients in RSB and thus, significantly improve its nutritional value. © 2016 Institute of Food Technologists®.

  9. Red meat intake, insulin resistance, and markers of endothelial function among Iranian women.

    Science.gov (United States)

    Barak, Farzaneh; Falahi, Ebrahim; Keshteli, Ammar Hassanzadeh; Yazdannik, Ahmadreza; Saneei, Parvane; Esmaillzadeh, Ahmad

    2015-02-01

    Few data, with conflicting findings, are available linking red meat consumption to indicators of insulin resistance and endothelial dysfunction. This study aimed to investigate the association of red meat consumption with insulin resistance and endothelial dysfunction among a sample of female nurses in Isfahan, Iran. This cross-sectional study was carried out among 420 female nurses who were selected by a multistage cluster random sampling method. Usual dietary intakes were assessed using a validated food frequency questionnaire. Red meat intake was calculated by summing up the consumption of all kinds of red meat in foods and processed meat in sausages and fast foods. To measure serum concentrations of adhesion molecules and glycemic indexes, a fasting blood sample was taken. After adjustment for potential confounders, high red meat intake was significantly associated with higher fasting plasma glucose, homeostasis model assessment of insulin resistance, and lower quantitative insulin sensitivity check index. Although high red meat intake was significantly associated with higher serum insulin levels and lower homeostasis model assessment of beta-cell function in the crude model, after controlling for BMI, the association was no longer significant. Red meat consumption was associated with high concentrations of E-selectin, soluble vascular cell adhesion molecule-1 (sVCAM-1), and soluble intercellular adhesion molecule-1 (sICAM-1) after adjustment for different potential confounders. We found that increased red meat intake was associated with high concentrations of plasma endothelial dysfunction biomarkers and abnormal glucose homeostasis among Iranian women. Prospective studies are required to confirm these findings. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Biological oceanography of the red oceanic system

    Science.gov (United States)

    Theil, Hjalmar; Weikert, Horst

    plankton was Oceans employing exactly the same methods. In the Red Sea, respiration and ETS activity were found to be high but standing stocks and biomasses were low; the reverse was observed in the Arctic and the Atlantic. We believe that this difference in the ratio of respiration to biomass is determined by the great contrasts in the temperatures of the environments studied: Arctic -1.5°C, Atlantic 2°C, Red Sea 21.5°C. Independent of the species' adaptations to their environment this temperature influence will apply to all the living components of the ecosystem. Hence for Red Sea organisms maintenance costs are comparatively high, which greatly reduces their production potential. 7. Thus the oceanic ecosystem of the Red Sea can be summarised as follows: Primary production is low throughout most of the year and throughout most of the entire basin, and consequently so is secondary production (zooplankton). In subsurface waters, high maintenance costs reduces energy for investments in growth and reproduction. In addition degradation of organic matter is so fast in the upper layers that the standing stock in the intermediate layers is reduced and particle transport to greater depth in the central graben greatly restricted. The low abundance and biomass of the deep-sea plankton and benthos in the Red Sea is readily explained by the low availability of food and the high metabolic demands created by the unique high in situ temperature.

  11. Red Yeast Rice: An Introduction

    Science.gov (United States)

    ... rice are used in food products in Chinese cuisine, including Peking duck. Others have been sold as ... Medicine . 2010;170(19):1722–1727. Halbert SC, French B, Gordon RY, et al. Tolerability of red ...

  12. Fast breeder reactors

    International Nuclear Information System (INIS)

    Waltar, A.E.; Reynolds, A.B.

    1981-01-01

    This book describes the major design features of fast breeder reactors and the methods used for their design and analysis. The foremost objective of this book is to fulfill the need for a textbook on Fast Breeder Reactor (FBR) technology at the graduate level or the advanced undergraduate level. It is assumed that the reader has an introductory understanding of reactor theory, heat transfer, and fluid mechanics. The book is expected to be used most widely for a one-semester general course on fast breeder reactors, with the extent of material covered to vary according to the interest of the instructor. The book could also be used effectively for a two-quarter or a two-semester course. In addition, the book could serve as a text for a course on fast reactor safety since many topics other than those appearing in the safety chapters relate to FBR safety. Methodology in fast reactor design and analysis, together with physical descriptions of systems, is emphasized in this text more than numerical results. Analytical and design results continue to change with the ongoing evolution of FBR design whereas many design methods have remained fundamentally unchanged for a considerable time

  13. Fast reactor programme

    International Nuclear Information System (INIS)

    Plakman, J.C.

    1982-01-01

    This progress report summarizes the fast reactor research carried out by ECN during the period covering the year 1980. This research is mainly concerned with the cores of sodium-cooled breeders, in particular the SNR-300, and its related safety aspects. It comprises six items: A programme to determine relevant nuclear data of fission- and corrosion-products; A fuel performance programme comprising in-pile cladding failure experiments and a study of the consequences of loss-of-cooling and overpower; Basic research on fuel; Investigation of the changes in the mechanical properties of austenitic stainless steel DIN 1.4948 due to fast neutron doses, this material has been used in the manufacture of the reactor vessel and its internal components; Study of aerosols which could be formed at the time of a fast reactor accident and their progressive behaviour on leaking through cracks in the concrete containment; Studies on heat transfer in a sodium-cooled fast reactor core. As fast breeders operate at high power densities, an accurate knowledge of the heat transfer phenomena under single-phase and two-phase conditions is sought. (Auth.)

  14. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    Directory of Open Access Journals (Sweden)

    Egger JI

    2014-03-01

    Full Text Available Jos I M Egger,1–3 Willem M A Verhoeven,1,4 Wim Verbeeck,5 Nicole de Leeuw61Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Donders Institute for Brain, Cognition and Behaviour, Radboud University Nijmegen, Nijmegen, the Netherlands; 3Behavioural Science Institute, Radboud University Nijmegen, Nijmegen, the Netherlands; 4Erasmus University Medical Centre, Department of Psychiatry, Rotterdam, the Netherlands; 5Vincent van Gogh Institute for Psychiatry, Centre for Autism and ADHD, Venray, the Netherlands; 6Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the NetherlandsAbstract: The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of approximately 600 kb (BP4–BP5 that includes the SH2B1 gene that is reported to be causative for morbid obesity. This more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12.2p11.2 region, which includes the so-called atypical 16p11.2 BP2–BP3 deletion (approximately 220 kb presenting with developmental delay, behavioral problems and mild facial dysmorphisms. Here, an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features. Extensive neuropsychological examination demonstrated rigid thinking, anxious beliefs, and ideas of reference in the presence of normal intelligence. Microarray analysis demonstrated a de novo 970 kb 16p11.2 BP1–BP4 microdeletion that can be regarded as explanatory for his behavioral profile. It is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and

  15. "Congo" red: out of Africa?

    Science.gov (United States)

    Steensma, D P

    2001-02-01

    Congo red is the essential histologic stain for demonstrating the presence of amyloidosis in fixed tissues. To the best of my knowledge, nothing has been written about why the stain is named "Congo." To understand the etymology and history of the Congo red histologic stain. Primary sources were consulted extensively, including 19th-century corporate documents, newspapers, legal briefs, patents, memoirs, and scientific papers. Sources were obtained from multiple university libraries and German corporate archives. To Europeans in 1885, the word Congo evoked exotic images of far-off central Africa known as The Dark Continent. The African Congo was also a political flashpoint during the Age of Colonialism. "Congo" red was introduced in Berlin in 1885 as the first of the economically lucrative direct textile dyes. A patent on Congo red was filed by the AGFA Corporation of Berlin 3 weeks after the conclusion of the well-publicized Berlin West Africa Conference. During these important diplomatic talks, German Chancellor Otto von Bismarck presided over a discussion of free trade issues in the Congo River basin. A challenge to AGFA's Congo red patent led to a precedent-setting decision in intellectual property law. The Congo red stain was named "Congo" for marketing purposes by a German textile dyestuff company in 1885, reflecting geopolitical current events of that time.

  16. The fast breeder reactor

    International Nuclear Information System (INIS)

    Patterson, W.

    1990-01-01

    The author criticises the United Kingdom Atomic Energy Authority's fast breeder reactor programme in his evidence to the House of Commons Select Committee on Energy in January 1990. He argues for power generation by renewable means and greater efficiency in the use rather than in the generation of electricity. He refutes the arguments for nuclear power on the basis of reduced global warming as he claims support technology produces significant amounts of carbon dioxide in any case. Serious doubts are raised about the costs of a fast breeder reactor programme compared to, say, generation by pressurised water reactors. The idea of a uranium scarcity in several decades is also refuted. The reliability of fast breeder reactor technology is called into question. He argues against reprocessing plutonium for economic, health and safety reasons. (UK)

  17. The fast code

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, L.N.; Wilson, R.E. [Oregon State Univ., Dept. of Mechanical Engineering, Corvallis, OR (United States)

    1996-09-01

    The FAST Code which is capable of determining structural loads on a flexible, teetering, horizontal axis wind turbine is described and comparisons of calculated loads with test data are given at two wind speeds for the ESI-80. The FAST Code models a two-bladed HAWT with degrees of freedom for blade bending, teeter, drive train flexibility, yaw, and windwise and crosswind tower motion. The code allows blade dimensions, stiffnesses, and weights to differ and models tower shadow, wind shear, and turbulence. Additionally, dynamic stall is included as are delta-3 and an underslung rotor. Load comparisons are made with ESI-80 test data in the form of power spectral density, rainflow counting, occurrence histograms, and azimuth averaged bin plots. It is concluded that agreement between the FAST Code and test results is good. (au)

  18. Fast harmonic field mapper

    International Nuclear Information System (INIS)

    Au, R.; Fowler, M.; Hanawa, H.; Riedel, J.; Qua, Z.G.

    1984-01-01

    In early 1983 it was decided to mount coils on arms separated by 120 degrees and buck them out so that the third harmonic dphi/dt component would be cancelled and thus the first and second field harmonics could be very accurately measured. The original intention was to do as others had done, namely, use fast ADC's to read the voltages, and computer process the result to get the Fourier components. However, because of the 100 to 1 dynamic range of the fast ADC's and the likelihood that noise would be a problem, the authors decided to do things differently. Using a fast Fourier transform analyzer was considered, but this instrument is very expensive, so they decided to use a completely electronic analog approach: The authors decided to use active bandpass filters to render the harmonic components

  19. Fast beam radiofrequency spectroscopy

    International Nuclear Information System (INIS)

    Pipkin, F.M.

    1983-01-01

    The combination of a fast atom or ion beam derived from a small accelerator with radiofrequency spectroscopy methods provides a powerful method for measuring the fine structure of atomic and molecular systems. The fast beam makes possible measurements in which two separated oscillatory fields are used to obtain resonance lines whose widths are less than the natural line width due to the lifetimes of the states. The separated oscillatory field lines have, in addition, a number of features which make possible measurements with greater precision and less sensitivity to systematic errors. The fast beam also makes accessible multiple photon radiofrequency transitions whose line width is intrinsically narrower than that of the single photon transitions and which offer great potential for high precision measurements. This report focuses on the techniques and their promise. Recent measurements of the fine structure of H and He + are used as illustrations

  20. The fast breeder reactor

    International Nuclear Information System (INIS)

    Keck, O.

    1984-01-01

    Nowadays the fast-breeder reactor is a negative symbol of advanced technology which is getting out of control and, due to its complexity, is incomprehensible for politicians and therefore by-passes the established order. The author lists the most important decisions over state aid to the fast-breeder-reactors up until the mid-seventies and uses documents from the appropriate advisory bodies as reference. He was also aided by interviews with those directly involved with the project. The empirical facts forces us to discard our traditional view of the relationship between state and industry with regard to advanced technology. The author explains that it is impossible to find any economic value in the fast-breeder reactor. The insight gained through this project allows him to draw conclusions which apply to all aspects of state aid to advanced technology. (orig.) [de

  1. Adopting preoperative fasting guidelines.

    Science.gov (United States)

    Anderson, Megan; Comrie, Rhonda

    2009-07-01

    In 1999, the American Society of Anesthesiologists adopted preoperative fasting guidelines to enhance the quality and efficiency of patient care. Guidelines suggest that healthy, non-pregnant patients should fast six hours from solids and two hours from liquids. Although these guidelines are in place, studies suggest that providers are still using the blanket statement "NPO after midnight" without regard to patient characteristics, the procedure, or the time of the procedure. Using theory to help change provider's beliefs may help make change more successful. Rogers' Theory of Diffusion of Innovations can assist in changing long-time practice by laying the groundwork for an analysis of the benefits and disadvantages of proposed changes, such as changes to fasting orders, while helping initiate local protocols instead of additional national guidelines.

  2. The 0.3-kb fragment containing the R-U5-5'leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA.

    Science.gov (United States)

    Choo, Yeng Cheng; Seki, Yohei; Machinaga, Akihito; Ogita, Nobuo; Takase-Yoden, Sayaka

    2013-04-19

    A neuropathogenic variant of Friend murine leukemia virus (Fr-MLV) clone A8 induces spongiform neurodegeneration when infected into neonatal rats. Studies with chimeras constructed from the A8 virus and the non-neuropathogenic Fr-MLV clone 57 identified a 0.3-kb KpnI-AatII fragment containing a R-U5-5'leader sequence as an important determinant for inducing spongiosis, in addition to the env gene of A8 as the primary determinant. This 0.3-kb fragment contains a 17-nucleotide difference between the A8 and 57 sequences. We previously showed that the 0.3-kb fragment influences expression levels of Env protein in both cultured cells and rat brain, but the corresponding molecular mechanisms are not well understood. Studies with expression vectors constructed from the full-length proviral genome of Fr-MLV that incorporated the luciferase (luc) gene instead of the env gene found that the vector containing the A8-0.3-kb fragment yielded a larger amount of spliced luc-mRNA and showed higher expression of luciferase when compared to the vector containing the 57-0.3-kb fragment. The amount of total transcripts from the vectors, the poly (A) tail length of their mRNAs, and the nuclear-cytoplasm distribution of luc-mRNA in transfected cells were also evaluated. The 0.3-kb fragment did not influence transcription efficiency, mRNA polyadenylation or nuclear export of luc-mRNA. Mutational analyses were carried out to determine the importance of nucleotides that differ between the A8 and 57 sequences within the 0.3-kb fragment. In particular, seven nucleotides upstream of the 5'splice site (5'ss) were found to be important in regulating the level of protein expression from spliced messages. Interestingly, these nucleotides reside within the stem-loop structure that has been speculated to limit the recognition of 5'ss. The 0.3-kb fragment containing the R-U5-5'leader sequence of Fr-MLV influences the level of protein expression from the spliced-mRNA by regulating the splicing

  3. Proton Fast Ignition

    International Nuclear Information System (INIS)

    Key, M H; Freeman, R R; Hatchett, S P; MacKinnon, A J; Patel, P K; Snavely, R A; Stephens, R B

    2006-04-01

    Fast ignition (FI) by a laser generated ballistically focused proton beam is a more recently proposed alternative to the original concept of FI by a laser generated beam of relativistic electrons. It has potential advantages in less complex energy transport into dense plasma. Recent successful target heating experiments motivate further investigation of the feasibility of proton fast ignition. The concept, the physics and characteristics of the proton beams, the recent experimental work on focusing of the beams and heating of solid targets and the overall prospects for proton FI are discussed

  4. Fast breeder project (PSB)

    International Nuclear Information System (INIS)

    1976-07-01

    Activities performed during the 1st quarter of 1976 at or on behalf of the Gesellschaft fuer Kernforschung mbH, Karlsruhe, within the framework of the Fast Breeder Project are given a survey. The following project subdivisions are dealt with: Fuel rod development; materials testing and developments; corrosion studies and coolant analyses; physical experiments; reactor theory; safety of fast breeders; instrumentation and signal processing for core monitoring; effects on the environment; sodium technology tests; thermodynamic and fluid flow tests in gas. (HR) [de

  5. Magnetically Assisted Fast Ignition

    OpenAIRE

    Wang, W.-M.; Gibbon, P.; Sheng, Z.-M.; Li, Y.-T.

    2015-01-01

    Fast ignition (FI) is investigated via integrated particle-in-cell simulation including both generation andtransport of fast electrons, where petawatt ignition lasers of 2 ps and compressed targets of a peak density of300 g cm−3 and areal density of 0.49 g cm−2 at the core are taken. When a 20 MG static magnetic field isimposed across a conventional cone-free target, the energy coupling from the laser to the core is enhancedby sevenfold and reaches 14%. This value even exceeds that obtained u...

  6. Fast neutron dosimetry

    International Nuclear Information System (INIS)

    DeLuca, P.M. Jr.; Pearson, D.W.

    1993-01-01

    Research concentrated on three major areas during the last twelve months: (1) investigations of energy fluence and absorbed dose measurements using crystalline and hot pressed TLD materials exposes to ultrasoft beams of photons, (2) fast neutron kerma factor measurements for several important elements as well as NE-213 scintillation material response function determinations at the intense ''white'' source available at the WNR facility at LAMPF, and (3) kerma factor ratio determinations for carbon and oxygen to A-150 tissue equivalent plastic at the clinical fast neutron radiation facility at Harper Hospital, Detroit, MI. Progress summary reports of these efforts are given in this report

  7. Moms og fast ejendom

    DEFF Research Database (Denmark)

    Edlund, Hans Henrik

    1999-01-01

    I artiklen gives et overblik over, hvorledes fast ejendom behandles momsmæssigt. Derfor findes en kort skitsering af reglerne for moms på byggearbejder, afgrænsningen mellem momspligtig og momsfri udlejning, muligheden for frivillig registrering af udlejning samt opgørelse af reguleringsforpligte......I artiklen gives et overblik over, hvorledes fast ejendom behandles momsmæssigt. Derfor findes en kort skitsering af reglerne for moms på byggearbejder, afgrænsningen mellem momspligtig og momsfri udlejning, muligheden for frivillig registrering af udlejning samt opgørelse af...

  8. Fast ejendom II

    DEFF Research Database (Denmark)

    Munk-Hansen, Carsten

    Fremstillingen påviser, at lov om forbrugerbeskyttelse ved erhvervelse af fast ejendom mv. lider af en række svagheder og at ankenævnspraksis bevæger sig væk fra retspraksis på en række områder.......Fremstillingen påviser, at lov om forbrugerbeskyttelse ved erhvervelse af fast ejendom mv. lider af en række svagheder og at ankenævnspraksis bevæger sig væk fra retspraksis på en række områder....

  9. A 725 kb deletion at 22q13.1 chromosomal region including SOX10 gene in a boy with a neurologic variant of Waardenburg syndrome type 2.

    Science.gov (United States)

    Siomou, Elisavet; Manolakos, Emmanouil; Petersen, Michael; Thomaidis, Loretta; Gyftodimou, Yolanda; Orru, Sandro; Papoulidis, Ioannis

    2012-11-01

    Waardenburg syndrome (WS) is a rare (1/40,000) autosomal dominant disorder resulting from melanocyte defects, with varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four clinical subtypes (WS1-S4). Six genes have been identified to be associated with the different subtypes of WS, among which SOX10, which is localized within the region 22q13.1. Lately it has been suggested that whole SOX10 gene deletions can be encountered when testing for WS. In this study we report a case of a 13-year-old boy with a unique de novo 725 kb deletion within the 22q13.1 chromosomal region, including the SOX10 gene and presenting clinical features of a neurologic variant of WS2. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  10. Habitability of planets around red dwarf stars.

    Science.gov (United States)

    Heath, M J; Doyle, L R; Joshi, M M; Haberle, R M

    1999-08-01

    Recent models indicate that relatively moderate climates could exist on Earth-sized planets in synchronous rotation around red dwarf stars. Investigation of the global water cycle, availability of photosynthetically active radiation in red dwarf sunlight, and the biological implications of stellar flares, which can be frequent for red dwarfs, suggests that higher plant habitability of red dwarf planets may be possible.

  11. Silvical characteristics of red maple (Acer rubrum)

    Science.gov (United States)

    Russell J. Hutnik; Harry W. Yawney

    1961-01-01

    Red maple (Acer rubrum L.) is also known as Carolina red maple, scarlet maple, soft maple, swamp maple, water maple, and white maple. Taxonomists recognize several varieties of red maple. The most common is Drummond red maple (Acer rubrum var. drummondii (Hook, & Arn.) Sarg.).

  12. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  13. PMS2 inactivation by a complex rearrangement involving an HERV retroelement and the inverted 100-kb duplicon on 7p22.1.

    Science.gov (United States)

    Vogt, Julia; Wernstedt, Annekatrin; Ripperger, Tim; Pabst, Brigitte; Zschocke, Johannes; Kratz, Christian; Wimmer, Katharina

    2016-11-01

    Biallelic PMS2 mutations are responsible for more than half of all cases of constitutional mismatch repair deficiency (CMMRD), a recessively inherited childhood cancer predisposition syndrome. The mismatch repair gene PMS2 is partly embedded within one copy of an inverted 100-kb low-copy repeat (LCR) on 7p22.1. In an individual with CMMRD syndrome, PMS2 was found to be homozygously inactivated by a complex chromosomal rearrangement, which separates the 5'-part from the 3'-part of the gene. The rearrangement involves sequences of the inverted 100-kb LCR and a human endogenous retrovirus element and may be associated with an inversion that is indistinguishable from the known inversion polymorphism affecting the ~0.7-Mb sequence intervening the LCR. Its formation is best explained by a replication-based mechanism (RBM) such as fork stalling and template switching/microhomology-mediated break-induced replication (FoSTeS/MMBIR). This finding supports the hypothesis that the inverted LCR can not only facilitate the formation of the non-allelic homologous recombination-mediated inversion polymorphism but it also promotes the occurrence of more complex rearrangements that can be associated with a large inversion, as well, but are mediated by a RBM. This further suggests that among the inversion polymorphism on 7p22.1, more complex rearrangements might be hidden. Furthermore, as the locus is embedded in a common fragile site (CFS) region, this rearrangement also supports the recently raised hypothesis that CFS sequence motifs may facilitate replication-based rearrangement mechanisms.

  14. Spherical α-MnO2 Supported on N-KB as Efficient Electrocatalyst for Oxygen Reduction in Al–Air Battery

    Directory of Open Access Journals (Sweden)

    Kui Chen

    2018-04-01

    Full Text Available Traditional noble metal platinum (Pt is regarded as a bifunctional oxygen catalyst due to its highly catalytic efficiency, but its commercial availability and application is often restricted by high cost. Herein, a cheap and effective catalyst mixed with α-MnO2 and nitrogen-doped Ketjenblack (N-KB (denoted as MnO2-SM150-0.5 is examined as a potential electrocatalyst in oxygen reduction reactions (ORR and oxygen evolution reactions (OER. This α-MnO2 is prepared by redox reaction between K2S2O8 and MnSO4 in acid conditions with a facile hydrothermal process (named the SM method. As a result, MnO2-SM150-0.5 exhibits a good catalytic performance for ORR in alkaline solution, and this result is comparable to a Pt/C catalyst. Moreover, this catalyst also shows superior durability and methanol tolerance compared with a Pt/C catalyst. It also displays a discharge voltage (~1.28 V at a discharge density of 50 mA cm−2 in homemade Al–air batteries that is higher than commercial 20% Pt/C (~1.19 V. The superior electrocatalytic performance of MnO2-SM150-0.5 could be attributed to its higher Mn3+/Mn4+ ratio and the synergistic effect between MnO2 and the nitrogen-doped KB. This study provides a novel strategy for the preparation of an MnO2-based composite electrocatalyst.

  15. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  16. [Preoperative fasting. An update].

    Science.gov (United States)

    Spies, C D; Breuer, J P; Gust, R; Wichmann, M; Adolph, M; Senkal, M; Kampa, U; Weissauer, W; Schleppers, A; Soreide, E; Martin, E; Kaisers, U; Falke, K J; Haas, N; Kox, W J

    2003-11-01

    In Germany the predominant standard of preoperative care for elective surgery is fasting after midnight, with the aim of reducing the risk of pulmonary aspiration. However, for the past several years the scientific evidence supporting such a practice has been challenged. Experimental and clinical studies prove a reliable gastric emptying within 2 h suggesting that, particularly for limited intake of clear fluids up to 2 h preoperatively, there would be no increased risk for the patient. In addition, the general incidence of pulmonary aspiration during general anaesthesia (before induction, during surgery and during recovery) is extremely low, has a good prognosis and is more a consequence of insufficient airway protection and/or inadequate anaesthetic depth rather than due to the patient's fasting state. Therefore, primarily to decrease perioperative discomfort for patients, several national anaesthesia societies have changed their guidelines for preoperative fasting. They recommend a more liberal policy regarding per os intake of both liquid and solid food, with consideration of certain conditions and contraindications. The following article reviews the literature and gives an overview of the scientific background on which the national guidelines are based. The intention of this review is to propose recommendations for preoperative fasting regarding clear fluids for Germany as well.

  17. Integral Fast Reactor concept

    International Nuclear Information System (INIS)

    Till, C.E.; Chang, Y.I.

    1986-01-01

    The Integral Fast Reactor (IFR) is an innovative LMR concept, being developed at Argonne National Laboratory, that fully exploits the inherent properties of liquid metal cooling and metallic fuel to achieve breakthroughs in economics and inherent safety. This paper describes key features and potential advantages of the IFR concept, technology development status, fuel cycle economics potential, and future development path

  18. FastStats: Immunization

    Science.gov (United States)

    ... Women’s Health State and Territorial Data Reproductive Health Contraceptive Use Infertility Reproductive Health Notice Regarding FastStats Mobile ... 69 [PDF – 9.8 MB] Vaccination coverage among adolescents 13-17 years of age Health, United States, ...

  19. Integral Fast Reactor concept

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.

    1986-01-01

    The Integral Fast Reactor (IFR) is an innovative LMR concept, being developed at Argonne National Laboratory, that fully exploits the inherent properties of liquid metal cooling and metallic fuel to achieve breakthroughs in economics and inherent safety. This paper describes key features and potential advantages of the IFR concept, technology development status, fuel cycle economics potential, and future development path.

  20. Parallel Fast Legendre Transform

    NARCIS (Netherlands)

    Alves de Inda, M.; Bisseling, R.H.; Maslen, D.K.

    1998-01-01

    We discuss a parallel implementation of a fast algorithm for the discrete polynomial Legendre transform We give an introduction to the DriscollHealy algorithm using polynomial arithmetic and present experimental results on the eciency and accuracy of our implementation The algorithms were

  1. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Till, C.E.; Chang, Y.I.; Lineberry, M.J.

    1990-01-01

    Argonne National Laboratory, since 1984, has been developing the Integral Fast Reactor (IFR). This paper will describe the way in which this new reactor concept came about; the technical, public acceptance, and environmental issues that are addressed by the IFR; the technical progress that has been made; and our expectations for this program in the near term. 5 refs., 3 figs

  2. Viden om faste vendinger

    DEFF Research Database (Denmark)

    Bergenholtz, Henning; Bjærge, Esben

    2012-01-01

    Ordbogen indeholder ca. 17.000 idiomer, ordsprog, bevingede ord og andre faste vendinger, som der oplyses mest muligt om. Hertil hører oplysninger om betydningen, grammatik, kollokationer, synonymer, stil, ordforbindelsestype, etymologiske angivelser og andre baggrundsoplysninger, links til...

  3. Integral Fast Reactor Program

    International Nuclear Information System (INIS)

    Chang, Y.I.; Walters, L.C.; Laidler, J.J.; Pedersen, D.R.; Wade, D.C.; Lineberry, M.J.

    1993-06-01

    This report summarizes highlights of the technical progress made in the Integral Fast Reactor (IFR) Program in FY 1992. Technical accomplishments are presented in the following areas of the IFR technology development activities: (1) metal fuel performance, (2) pyroprocess development, (3) safety experiments and analyses, (4) core design development, (5) fuel cycle demonstration, and (6) LMR technology R ampersand D

  4. FAST goes underground

    International Nuclear Information System (INIS)

    Fridlund, P.S.

    1985-01-01

    The FAST-M Cost Estimating Model is a parametric model designed to determine the costs associated with mining and subterranean operations. It is part of the FAST (Freiman Analysis of Systems Techniques) series of parametric models developed by Freiman Parametric Systems, Inc. The rising cost of fossil fuels has created a need for a method which could be used to determine and control costs in mining and subterranean operations. FAST-M fills this need and also provides scheduling information. The model works equally well for a variety of situations including underground vaults for hazardous waste storage, highway tunnels, and mass transit tunnels. In addition, costs for above ground structures and equipment can be calculated. The input for the model may be on a macro or a micro level. This allows the model to be used at various stages in a project. On the macro level, only general conditions and specifications need to be known. On the micro level, the smallest details may be included. As with other FAST models, reference cases are used to more accurately predict costs and scheduling. This paper will address how the model can be used for a variety of subterranean purposes

  5. Fast Air Temperature Sensors

    DEFF Research Database (Denmark)

    Hendricks, Elbert

    1998-01-01

    The note documents briefly work done on a newly developed sensor for making fast temperature measurements on the air flow in the intake ports of an SI engine and in the EGR input line. The work reviewed has been carried out in close cooperation with Civ. Ing. Michael Føns, the author (IAU...

  6. Project fast breeder (PSB)

    International Nuclear Information System (INIS)

    1978-01-01

    The annual report of the fast breeder project (PSB) contains contributions of the participating institutes on the four subjects: 1) Development of oxidic fuel rods and materials for the SNR line, 2) Physics and safety investigations for the SNR line, 3) Carbidic fuel elements, and 4) Back-up solution with gaseous coolant. (HK) [de

  7. Fast ejendom, I

    DEFF Research Database (Denmark)

    Munk-Hansen, Carsten

    , værdiforringende forhold, der ligger uden for ejendommen og andre særlige tilfælde. Bogen uddyber andre emner omtalt i 1. udgave, eksempelvis erhvervelsesbetingelser, købsoptioner, ansvarsfraskrivelse, licitationssalg mv. Bogen er det første af tre planlagte bind om fast ejendom: I Overdragelsen, II Bolighandlen...

  8. Handel med fast ejendom

    DEFF Research Database (Denmark)

    Edlund, Hans Henrik

    Bogen tilstræber at give et overblik over nogle af de vigtigste generelle problemområder på markedet for ejendomshandel, der jo bliver mere og mere kompliceret. Værket er opdelt i følgende hovedafsnit: Ejendomsbegrebet. Indgåelse af aftale om salg af fast ejendom. Begrænsninger i adgangen til...

  9. Fast Harmonic Chirp Summation

    DEFF Research Database (Denmark)

    Nielsen, Jesper Kjær; Jensen, Tobias Lindstrøm; Jensen, Jesper Rindom

    2017-01-01

    -robust to noise, or very computationally inten- sive. In this paper, we propose a fast algorithm for the harmonic chirp summation method which has been demonstrated in the liter- ature to be accurate and robust to noise. The proposed algorithm is orders of magnitudes faster than previous algorithms which is also...

  10. Nanolensed Fast Radio Bursts

    Science.gov (United States)

    Eichler, David

    2017-12-01

    It is suggested that fast radio bursts can probe gravitational lensing by clumpy dark matter objects that range in mass from 10-3 M ⊙-102 M ⊙. They may provide a more sensitive probe than observations of lensings of objects in the Magellanic Clouds, and could find or rule out clumpy dark matter with an extended mass spectrum.

  11. ATLAS fast physics monitoring

    Indian Academy of Sciences (India)

    The ATLAS Collaboration has set up a framework to automatically process the rapidly growing dataset and produce performance and physics plots for the most interesting analyses. The system is designed to give fast feedback. The histograms are produced within hours of data reconstruction (2–3 days after data taking).

  12. Calorie count - fast food

    Science.gov (United States)

    ... GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Calorie count - fast food URL of this page: //medlineplus.gov/ency/patientinstructions/ ...

  13. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  14. Fast breeder reactor research

    International Nuclear Information System (INIS)

    1975-01-01

    Full text: The meeting was attended by 15 participants from seven countries and two international organizations. The Eighth Annual Meeting of the International Working Group on Fast Reactors (IWGFR) was attended by representatives from France, Fed. Rep. Germany, Italy, Japan, United Kingdom, Union of Soviet Socialist Republics and the United States of America - countries that have made significant progress in developing the technology and physics of sodium cooled fast reactors and have extensive national programmes in this field - as well as by representatives of the Commission of the European Communities and the IAEA. The design of fast-reactor power plants is a more difficult task than developing facilities with thermal reactors. Different reactor kinetics and dynamics, a hard neutron spectrum, larger integral doses of fuel and structural material irradiation, higher core temperatures, the use of an essentially novel coolant, and, as a result of all these factors, the additional reliability and safety requirements that are imposed on the planning and operation of sodium cooled fast reactors - all these factors pose problems that can be solved comprehensively only by countries with a high level of scientific and technical development. The exchange of experience between these countries and their combined efforts in solving the fundamental problems that arise in planning, constructing and operating fast reactors are promoting technical progress and reducing the relative expenditure required for various studies on developing and introducing commercial fast reactors. For this reason, the meeting concentrated on reviewing and discussing national fast reactor programmes. The situation with regard to planning, constructing and operating fast experimental and demonstration reactors in the countries concerned, the experience accumulated in operating them, the difficulties arising during operation and ways of over-coming them, the search for optimal designs for the power

  15. Synthesis and characterization of natural red dye from Caesalpinia sappan linn

    Energy Technology Data Exchange (ETDEWEB)

    Mulyanto, Subur, E-mail: subur.mulyanto@poltekba.ac.id [Graduate Program of Mechanical Engineering, SebelasMaret University, Jl. Ir. Sutami 36 A, Surakarta (Indonesia); Department of Mechanical Engineering, State Polytechnic of Balikpapan, Jl. Soekarno-Hatta Km.8 Balikpapan (Indonesia); Suyitno,, E-mail: suyitno@uns.ac.id; Rachmanto, Rendy Adhi, E-mail: rendy.ar@gmail.com; Hidayat, Lullus Lambang Govinda, E-mail: lulus-l@yahoo.com; Hadi, Syamsul, E-mail: syamsulhadi@ft.uns.ac.id [Department of Mechanical Engineering, SebelasMaret University, Jl. Ir. Sutami 36 A, Surakarta (Indonesia); Wibowo, Atmanto Heru, E-mail: aheruwibowo@yahoo.com [Department of Chemistry, SebelasMaret University, Jl. Ir. Sutami 36 A, Surakarta (Indonesia)

    2016-03-29

    The study reports the synthesis and characterization of natural red dye. The dyes were extracted from woods of Caesalpiniasappanlinn at varied temperatures of 70, 80, 90, and 100°C for three hours. The dry wood chips and water at a ratio of 6:1 were immersed in the reactor of 150 liters. The absorbance spectra of the natural red dyes were measured by ultra-violet-visible spectroscopy. Meanwhile, Fourier transform infrared spectroscopy was used to investigate the functional groups of the natural red dyes. In addition, the basic production cost was calculated and the fastness property towards cotton fabrics was investigated according to the Indonesia national standard of 105-C06:2010, 105-B01:2010, and 0288-2008. The results showed that the functional groups found the extracted red dyes indicated the complex bond of brazilein with peak absorbance at a wavelength of 538-540 nm. The extraction temperature also changed the functional group of brazilein. From the color, the absorbance peak, the functional groups, and the main production cost, the best parameter to synthesize the natural red dyes from Caesalpiniasappanlinn was at a temperature of 80°C for two hours. Moreover, the natural red dyes has the fastness to wash resistance, light resistance, and scrub resistance by 4-5, 4, and 3-4, respectively. However, further studies for synthesis the natural red dyes by using a continuous reactor are required to identify the naturally complex compounds in brazilein for improving the fastness properties and for reducing the cost.

  16. Synthesis and characterization of natural red dye from Caesalpinia sappan linn

    International Nuclear Information System (INIS)

    Mulyanto, Subur; Suyitno,; Rachmanto, Rendy Adhi; Hidayat, Lullus Lambang Govinda; Hadi, Syamsul; Wibowo, Atmanto Heru

    2016-01-01

    The study reports the synthesis and characterization of natural red dye. The dyes were extracted from woods of Caesalpiniasappanlinn at varied temperatures of 70, 80, 90, and 100°C for three hours. The dry wood chips and water at a ratio of 6:1 were immersed in the reactor of 150 liters. The absorbance spectra of the natural red dyes were measured by ultra-violet-visible spectroscopy. Meanwhile, Fourier transform infrared spectroscopy was used to investigate the functional groups of the natural red dyes. In addition, the basic production cost was calculated and the fastness property towards cotton fabrics was investigated according to the Indonesia national standard of 105-C06:2010, 105-B01:2010, and 0288-2008. The results showed that the functional groups found the extracted red dyes indicated the complex bond of brazilein with peak absorbance at a wavelength of 538-540 nm. The extraction temperature also changed the functional group of brazilein. From the color, the absorbance peak, the functional groups, and the main production cost, the best parameter to synthesize the natural red dyes from Caesalpiniasappanlinn was at a temperature of 80°C for two hours. Moreover, the natural red dyes has the fastness to wash resistance, light resistance, and scrub resistance by 4-5, 4, and 3-4, respectively. However, further studies for synthesis the natural red dyes by using a continuous reactor are required to identify the naturally complex compounds in brazilein for improving the fastness properties and for reducing the cost.

  17. Generation and characterization of a stable red fluorescent ...

    African Journals Online (AJOL)

    An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...

  18. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  19. DAVs: Red Edge and Outbursts

    Science.gov (United States)

    Luan, Jing

    2018-04-01

    As established by ground based surveys, white dwarfs with hydrogen atmospheres pulsate as they cool across the temperature range, 12500Kred edge is a two-decade old puzzle. Recently, Kepler discovered a number of cool DAVs exhibiting sporadic outbursts separated by days, each lasting several hours, and releasing \\sim 10^{33}-10^{34} {erg}. We provide quantitative explanations for both the red edge and the outbursts. The minimal frequency for overstable modes rises abruptly near the red edge. Although high frequency overstable modes exist below the red edge, their photometric amplitudes are generally too small to be detected by ground based observations. Nevertheless, these overstable parent modes can manifest themselves through nonlinear mode couplings to damped daughter modes which generate limit cycles giving rise to photometric outbursts.

  20. Fast Screening of Antibacterial Compounds from Fusaria

    Directory of Open Access Journals (Sweden)

    Teis Esben Sondergaard

    2016-11-01

    Full Text Available Bio-guided screening is an important method to identify bioactive compounds from fungi. In this study we applied a fast digital time-lapse microscopic method for assessment of the antibacterial properties of secondary metabolites from the fungal genus Fusarium. Here antibacterial effects could be detected for antibiotic Y, aurofusarin, beauvericin, enniatins and fusaric acid after six hours of cultivation. The system was then used in a bio-guided screen of extracts from 14 different Fusarium species, which had been fractionated by HPLC. In this screen, fractions containing the red pigments aurofusarin and bikaverin showed effects against strains of Lactobacillus and Bifidobacterium. The IC50 for aurofusarin against Lactobacillus acidophilus was 8 µM, and against Bifidobacterium breve it was 64 µM. Aurofusarin only showed an effect on probiotic bacteria, leading to the speculation that only health-promoting bacteria with a positive effect in the gut system are affected.

  1. Preoperative fasting times: Prescribed and actual fasting times at ...

    African Journals Online (AJOL)

    The current international guidelines for preoperative fasting for elective surgery are 6 ... to determine whether this policy was being followed and patients were being starved ..... recommended fasting time, so that autonomous patients take care.

  2. Charge exchange spectroscopy as a fast ion diagnostic on TEXTOR

    International Nuclear Information System (INIS)

    Delabie, E.; Jaspers, R. J. E.; Hellermann, M. G. von; Nielsen, S. K.; Marchuk, O.

    2008-01-01

    An upgraded charge exchange spectroscopy diagnostic has been taken into operation at the TEXTOR tokamak. The angles of the viewing lines with the toroidal magnetic field are close to the pitch angles at birth of fast ions injected by one of the neutral beam injectors. Using another neutral beam for active spectroscopy, injected counter the direction in which fast ions injected by the first beam are circulating, we can simultaneously measure a fast ion tail on the blue wing of the D α spectrum while the beam emission spectrum is Doppler shifted to the red wing. An analysis combining the two parts of the spectrum offers possibilities to improve the accuracy of the absolute (fast) ion density profiles. Fast beam modulation or passive viewing lines cannot be used for background subtraction on this diagnostic setup and therefore the background has to be modeled and fitted to the data together with a spectral model for the slowing down feature. The analysis of the fast ion D α spectrum obtained with the new diagnostic is discussed.

  3. Red Plague Control Plan (RPCP)

    Science.gov (United States)

    Cooke, Robert W.

    2010-01-01

    SCOPE: Prescribes the minimum requirements for the control of cuprous / cupric oxide corrosion (a.k.a. Red Plague) of silver-coated copper wire, cable, and harness assemblies. PURPOSE: Targeted for applications where exposure to assembly processes, environmental conditions, and contamination may promote the development of cuprous / cupric oxide corrosion (a.k.a. Red Plague) in silver-coated copper wire, cable, and harness assemblies. Does not exclude any alternate or contractor-proprietary documents or processes that meet or exceed the baseline of requirements established by this document. Use of alternate or contractor-proprietary documents or processes shall require review and prior approval of the procuring NASA activity.

  4. Red de senderos universitarios inteligentes

    OpenAIRE

    Ibarra-Berrocal, I.J.; Romero, J.; Pérez, J.

    2017-01-01

    Introducción: El Proyecto de red de senderos universitarios inteligentes UR se inspira en tres realidades, la red de senderos europeos ya existentes y su importancia en el fomento de la actividad deportiva y los hábitos saludables, la creciente importancia de la implantación, intercambio y difusión de políticas y planes de acción en materia de sostenibilidad ambiental en el ámbito universitario europeo, y por último, el uso y desarrollo de infraestructuras y aplicaciones, cada vez más impresc...

  5. Seguridad en una red universitaria

    OpenAIRE

    Bernal España, Juan Antonio

    2014-01-01

    Las redes de comunicaciones son muy importantes para las empresas. Se solicita una red de altas prestaciones que pueda llevar muchos sistemas sobre ella (cámaras de seguridad, video, voz, datos, SCADA, wifi). Ahora también necesitamos que la red sea segura. Cuando hablamos de seguridad no solo nos referimos a evitar ataques o virus, también hablamos de cómo puede afectarnos el incendio de un centro de proceso de datos. Basándonos en la ISO 27001:2013 daremos las principales pau...

  6. Nonlinear analysis of RED - a comparative study

    International Nuclear Information System (INIS)

    Jiang Kai; Wang Xiaofan; Xi Yugeng

    2004-01-01

    Random Early Detection (RED) is an active queue management (AQM) mechanism for routers on the Internet. In this paper, performance of RED and Adaptive RED are compared from the viewpoint of nonlinear dynamics. In particular, we reveal the relationship between the performance of the network and its nonlinear dynamical behavior. We measure the maximal Lyapunov exponent and Hurst parameter of the average queue length of RED and Adaptive RED, as well as the throughput and packet loss rate of the aggregate traffic on the bottleneck link. Our simulation scenarios include FTP flows and Web flows, one-way and two-way traffic. In most situations, Adaptive RED has smaller maximal Lyapunov exponents, lower Hurst parameters, higher throughput and lower packet loss rate than that of RED. This confirms that Adaptive RED has better performance than RED

  7. Nonlinear analysis of RED - a comparative study

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Kai; Wang Xiaofan E-mail: xfwang@sjtu.edu.cn; Xi Yugeng

    2004-09-01

    Random Early Detection (RED) is an active queue management (AQM) mechanism for routers on the Internet. In this paper, performance of RED and Adaptive RED are compared from the viewpoint of nonlinear dynamics. In particular, we reveal the relationship between the performance of the network and its nonlinear dynamical behavior. We measure the maximal Lyapunov exponent and Hurst parameter of the average queue length of RED and Adaptive RED, as well as the throughput and packet loss rate of the aggregate traffic on the bottleneck link. Our simulation scenarios include FTP flows and Web flows, one-way and two-way traffic. In most situations, Adaptive RED has smaller maximal Lyapunov exponents, lower Hurst parameters, higher throughput and lower packet loss rate than that of RED. This confirms that Adaptive RED has better performance than RED.

  8. Inorganic component of saliva during fasting and after fast break

    OpenAIRE

    Samad, Rasmidar

    2016-01-01

    Oral health is closely related to salivary components. Saliva consists of water, inorganic and organic materials. Fasting changes one???s meal and drinking time that in turn can affect the environment in oral cavity, including inorganic componenet of saliva. The purpose of this study is to determine the inorganic component of saliva during fasting and after fast break.

  9. Fast Flux Test Facility

    International Nuclear Information System (INIS)

    Munn, W.I.

    1981-01-01

    The Fast Flux Test Facility (FFTF), located on the Hanford site a few miles north of Richland, Washington, is a major link in the chain of development required to sustain and advance Liquid Metal Fast Breeder Reactor (LMFBR) technology in the United States. This 400 MWt sodium cooled reactor is a three loop design, is operated by Westinghouse Hanford Company for the US Department of Energy, and is the largest research reactor of its kind in the world. The purpose of the facility is three-fold: (1) to provide a test bed for components, materials, and breeder reactor fuels which can significantly extend resource reserves; (2) to produce a complete body of base data for the use of liquid sodium in heat transfer systens; and (3) to demonstrate inherent safety characteristics of LMFBR designs

  10. Fast radiographic systems

    International Nuclear Information System (INIS)

    Domanus, J.C.

    1984-08-01

    Industrial radiography can be performed with shorter exposure times, when instead of X-ray film with lead intensifying screens the radiographic paper with fluorescent screen is used. With paper radiography one can obtain lower material, equipment, and labor costs, shorter exposure and processing times, and easier radiation protection. The speed of the radiographic inspection can also be increased by the use of fluorometallic intensifying screens together with a special brand of X-ray film. Before accepting either of the two fast radiographic systems one must be sure that they can produce radiographs of adequate image quality. Therefore an investigation was performed on that subject using ISO wire IQI's and ASTM penetrameters. The radiographic image quality was tested for aluminium and steel up to 30 mm thick using various brands of radiographic paper and X-ray film with fluorometallic screens and comparing them with fast X-ray films with lead screens. Both systems give satisfactory results. (author)

  11. Fast geometric algorithms

    International Nuclear Information System (INIS)

    Noga, M.T.

    1984-01-01

    This thesis addresses a number of important problems that fall within the framework of the new discipline of Computational Geometry. The list of topics covered includes sorting and selection, convex hull algorithms, the L 1 hull, determination of the minimum encasing rectangle of a set of points, the Euclidean and L 1 diameter of a set of points, the metric traveling salesman problem, and finding the superrange of star-shaped and monotype polygons. The main theme of all the work was to develop a set of very fast state-of-the-art algorithms that supersede any rivals in terms of speed and ease of implementation. In some cases existing algorithms were refined; for others new techniques were developed that add to the present database of fast adaptive geometric algorithms. What emerges is a collection of techniques that is successful at merging modern tools developed in analysis of algorithms with those of classical geometry

  12. The ELETTRA fast magnets

    International Nuclear Information System (INIS)

    Tommasini, D.

    1992-01-01

    The design of the fast magnets to be used to inject the electron beam into the 2 GeV storage ring Elettra is presented and discussed. Injection makes use of two types of fast magnets: the septa and the kickers. There are two identical septa magnets of the so called 'eddy current' type, which will be housed in a vacuum tank. The orbit bump is generated by four identical kicker magnets symmetrically placed around the mid-point of a single straight section: they will be in air with an internal vacuum chamber. Extensive electric and magnetic tests have been performed on prototypes, and the relevant results are presented and discussed. (author) 6 refs.; 6 figs.; 2 tabs

  13. Fast timing discriminator

    International Nuclear Information System (INIS)

    Lo, C.C.

    1977-01-01

    The processing of pulses with very fast risetimes for timing purposes involves many problems because of the large equivalent bandwidths involved. For pulses with risetimes in the 150 ps range (and full widths at half maximum (FWHM) of 400 ps) bandwidths in excess of 1GHz are required. Furthermore, these very narrow pulses with current amplitudes as small as 1 mA carry very small charges ( -12 coulomb), therefore, requiring very sensitive trigger circuits. The difficulty increases when timing characteristics in the picosecond range are sought especially when a wide input signal amplitude range causes a time-walk problem. The fast timing discriminator described has a time-walk of approximately +-75 ps over the input signal range from 80 mV to 3V. A schematic of the discriminator is included, and operation and performance are discussed

  14. Fast reactor database

    International Nuclear Information System (INIS)

    1996-02-01

    This publication contains detailed data on liquid metal cooled fast reactors (LMFRs), specifically plant parameters and design details. Each LMFR power plant is characterized by about 400 parameters, by design data and by relevant materials. The report provides general and detailed design characteristics including structural materials, data on experimental, demonstration, prototype and commercial size LMFRs. The focus is on practical issues that are useful to engineers, scientists, managers and university students and professors. The report includes updated information contained in IAEA previous publications on LMFR plant parameters: IWGRF/51 (1985) and IWGFR/80 (1991) and reflects experience gained from two consultants meetings held in Vienna (1993,1994). This compilation of data was produced by members of the IAEA International Working Group on Fast Reactors (IWGFR)

  15. Fast electrochemical actuator

    International Nuclear Information System (INIS)

    Uvarov, I V; Postnikov, A V; Svetovoy, V B

    2016-01-01

    Lack of fast and strong microactuators is a well-recognized problem in MEMS community. Electrochemical actuators can develop high pressure but they are notoriously slow. Water electrolysis produced by short voltage pulses of alternating polarity can overcome the problem of slow gas termination. Here we demonstrate an actuation regime, for which the gas pressure is relaxed just for 10 μs or so. The actuator consists of a microchamber filled with the electrolyte and covered with a flexible membrane. The membrane bends outward when the pressure in the chamber increases. Fast termination of gas and high pressure developed in the chamber are related to a high density of nanobubbles in the chamber. The physical processes happening in the chamber are discussed so as problems that have to be resolved for practical applications of this actuation regime. The actuator can be used as a driving engine for microfluidics. (paper)

  16. Bioavailability of trans-resveratrol from red wine in humans.

    Science.gov (United States)

    Vitaglione, Paola; Sforza, Stefano; Galaverna, Gianni; Ghidini, Cristiana; Caporaso, Nicola; Vescovi, Pier Paolo; Fogliano, Vincenzo; Marchelli, Rosangela

    2005-05-01

    Many in vitro studies demonstrated significant biological effects of trans-resveratrol. Thus, understanding the rate of intestinal absorption and metabolization in vivo of trans-resveratrol is the prerequisite to evaluate its potential health impact. Bioavailability studies mainly in animals or in humans using the pure compound at very high doses were performed. In this work, trans-resveratrol bioavailability from a moderate consumption of red wine in 25 healthy humans has been studied by three different experiments. The wine ingestion was associated to three different dietary approaches: fasting, a standard meal, a meal with high and low amount of lipids. Trans-resveratrol 3- and 4'-glucuronides were synthesized, purified, and characterized as pure standards. Bioavailability data were obtained by measuring the concentration of free, 3-glucuronide and 4'-glucuronide trans-resveratrol by high-performance liquid chromatography (HPLC), both with ultraviolet (UV) and mass spectrometry (MS) detection, in serum samples taken at different times after red wine administration. Free trans-resveratrol was found, in trace amounts, only in some serum samples collected 30 min after red wine ingestion while after longer times resveratrol glucuronides predominated. Trans-resveratrol bioavailability was shown to be independent from the meal or its lipid content. The finding in human serum of trans-resveratrol glucuronides, rather than the free form of the compound, with a high interindividual variability, raises some doubts about the health effects of dietary resveratrol consumption and suggests that the benefits associated to red wine consumption could be probably due to the whole antioxidant pool present in red wine.

  17. PHENIX Fast TOF

    Energy Technology Data Exchange (ETDEWEB)

    Soha, Aria [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Chiu, Mickey [Brookhaven National Lab. (BNL), Upton, NY (United States); Mannel, Eric [Brookhaven National Lab. (BNL), Upton, NY (United States); Stoll, Sean [Brookhaven National Lab. (BNL), Upton, NY (United States); Lynch, Don [Brookhaven National Lab. (BNL), Upton, NY (United States); Boose, Steve [Brookhaven National Lab. (BNL), Upton, NY (United States); Northacker, Dave [Brookhaven National Lab. (BNL), Upton, NY (United States); Alfred, Marcus [Howard Univ., Washington, DC (United States); Lindesay, James [Howard Univ., Washington, DC (United States); Chujo, Tatsuya [Univ. of Tsukuba (Japan); Inaba, Motoi [Univ. of Tsukuba (Japan); Nonaka, Toshihiro [Univ. of Tsukuba (Japan); Sato, Wataru [Univ. of Tsukuba (Japan); Sakatani, Ikumi [Univ. of Tsukuba (Japan); Hirano, Masahiro [Univ. of Tsukuba (Japan); Choi, Ihnjea [Univ. of Illinois, Urbana-Champaign, IL (United States)

    2014-01-15

    This is a technical scope of work (TSW) between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of PHENIX Fast TOF group who have committed to participate in beam tests to be carried out during the FY2014 Fermilab Test Beam Facility program. The goals for this test beam experiment are to verify the timing performance of the two types of time-of-flight detector prototypes.

  18. Fast diamond photoconductors

    International Nuclear Information System (INIS)

    Pochet, T.

    1993-01-01

    Preliminary results on the response of type Ib and IIa diamond photodetectors to fast laser pulse exposures at 265 and 530 nm are presented. The influence of the applied bias, the laser wavelengths and the light intensity on the detector sensitivity is studied. Also, recent measurements with 1.25 MeV gamma ray pulses are reported. (authors). 13 refs., 7 figs., 1 tab

  19. Integral fast reactor

    International Nuclear Information System (INIS)

    Chang, Y.I.

    1989-01-01

    The Integral Fast Reactor (IFR) is an innovative liquid metal reactor concept being developed at Argonne National Laboratory. It seeks to specifically exploit the inherent properties of liquid metal cooling and metallic fuel in a way that leads to substantial improvements in the characteristics of the complete reactor system. This paper describes the key features and potential advantages of the IFR concept, with emphasis on its safety characteristics

  20. Fast antihydrogen beam spectroscopy

    International Nuclear Information System (INIS)

    Neumann, R.

    1989-01-01

    The motivation for production and precision spectroscopy of antihydrogen atoms is outlined. An experimental configuration is considered, concerning laser-microwave spectroscopy of a fast hydrogen beam with characteristics similar to those of an antihydrogen beam emanating from an antiproton-positron overlap region in an antiproton storage ring. In particular, a possible experiment for the measurement of the ground state hyperfine structure splitting is described. (orig.)

  1. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Chang, Y.I.

    1988-01-01

    The Integral Fast Reactor (IFR) is an innovative liquid metal reactor concept being developed at Argonne National Laboratory. It seeks to specifically exploit the inherent properties of liquid metal cooling and metallic fuel in a way that leads to substantial improvements in the characteristics of the complete reactor system. This paper describes the key features and potential advantages of the IFR concept, with emphasis on its safety characteristics. 3 refs., 4 figs., 1 tab

  2. Effect of space allowance during transport and fasting or non-fasting during lairage on welfare indicators in Merino lambs

    Energy Technology Data Exchange (ETDEWEB)

    Cozar, A.; Rodriguez, A.I.; Garijo, P.; Calvo, L.; Vergara, H.

    2016-11-01

    A total of 72 male lambs of Merina breed were sampled in a 3×2 factorial design, testing three different space allowances treatment (SA) during transport [0.16 m2/animal (SAL; n=24); 0.20 m2/animal (SAM; n=24) and 0.30 m2/animal (SAH; n=24)] and two lairage treatments (TL) during 18 h previous slaughter [fasting (FAST; n=36) vs feeding (FEED; n=36)] on welfare physiological indicators. After transport, glucose and lactate dehydrogenase (LDH) were highest in SAM group and lowest in SAH one (p<0.05). SAL showed intermediate values for both parameters. SA did not affect the rest of the blood parameters studied. TL-FAST treatment decreased glucose values (p<0.001) while increased LDH (p<0.001). Fasting caused an increase (p<0.05) of Red Blood Cell Count values in SAM group. Feed deprivation did not affect cortisol or adrenaline values. Noradrenaline value was higher (p<0.001) in TL-FAST groups than in TL-FEED. In conclusion, under the conditions of this study, a range of space allowance during transport between 0.16 and 0.30 m2/lamb could be recommended without showing major changes on welfare physiological indicators; and feeding could be more appropriate than fasting during lairage. (Author)

  3. Fasting - the ultimate diet?

    Science.gov (United States)

    Johnstone, A M

    2007-05-01

    Adult humans often undertake acute fasts for cosmetic, religious or medical reasons. For example, an estimated 14% of US adults have reported using fasting as a means to control body weight and this approach has long been advocated as an intermittent treatment for gross refractory obesity. There are unique historical data sets on extreme forms of food restriction that give insight into the consequences of starvation or semi-starvation in previously healthy, but usually non-obese subjects. These include documented medical reports on victims of hunger strike, famine and prisoners of war. Such data provide a detailed account on how the body adapts to prolonged starvation. It has previously been shown that fasting for the biblical period of 40 days and 40 nights is well within the overall physiological capabilities of a healthy adult. However, the specific effects on the human body and mind are less clearly documented, either in the short term (hours) or in the longer term (days). This review asks the following three questions, pertinent to any weight-loss therapy, (i) how effective is the regime in achieving weight loss, (ii) what impact does it have on psychology? and finally, (iii) does it work long-term?

  4. ADT fast losses MD

    CERN Document Server

    Priebe, A; Dehning, B; Redaelli, S; Salvachua Ferrando, BM; Sapinski, M; Solfaroli Camillocci, M; Valuch, D

    2013-01-01

    The fast beam losses in the order of 1 ms are expected to be a potential major luminosity limitation for higher beam energies after the LHC long shutdown (LS1). Therefore a Quench Test is planned in the winter 2013 to estimate the quench limit in this timescale and revise the current models. This experiment was devoted to determination the LHC Transverse Damper (ADT) as a system for fast losses induction. A non-standard operation of the ADT was used to develop the beam oscillation instead of suppressing them. The sign flip method had allowed us to create the fast losses within several LHC turns at 450 GeV during the previous test (26th March 2012). Thus, the ADT could be potentially used for the studies of the UFO ("Unidentied Falling Object") impact on the cold magnets. Verification of the system capability and investigations of the disturbed beam properties were the main objectives of this MD. During the experiment, the pilot bunches of proton beam were excited independently in the horizontal and vertical ...

  5. Fast Light Optical Gyroscopes

    Science.gov (United States)

    Smith, David D.

    2015-01-01

    Next-generation space missions are currently constrained by existing spacecraft navigation systems which are not fully autonomous. These systems suffer from accumulated dead-reckoning errors and must therefore rely on periodic corrections provided by supplementary technologies that depend on line-of-sight signals from Earth, satellites, or other celestial bodies for absolute attitude and position determination, which can be spoofed, incorrectly identified, occluded, obscured, attenuated, or insufficiently available. These dead-reckoning errors originate in the ring laser gyros themselves, which constitute inertial measurement units. Increasing the time for standalone spacecraft navigation therefore requires fundamental improvements in gyroscope technologies. One promising solution to enhance gyro sensitivity is to place an anomalous dispersion or fast light material inside the gyro cavity. The fast light essentially provides a positive feedback to the gyro response, resulting in a larger measured beat frequency for a given rotation rate as shown in figure 1. Game Changing Development has been investing in this idea through the Fast Light Optical Gyros (FLOG) project, a collaborative effort which began in FY 2013 between NASA Marshall Space Flight Center (MSFC), the U.S. Army Aviation and Missile Research, Development, and Engineering Center (AMRDEC), and Northwestern University. MSFC and AMRDEC are working on the development of a passive FLOG (PFLOG), while Northwestern is developing an active FLOG (AFLOG). The project has demonstrated new benchmarks in the state of the art for scale factor sensitivity enhancement. Recent results show cavity scale factor enhancements of approx.100 for passive cavities.

  6. A putative autonomous 20.5 kb-CACTA transposon insertion in an F3'H allele identifies a new CACTA transposon subfamily in Glycine max

    Directory of Open Access Journals (Sweden)

    Vodkin Lila

    2008-12-01

    Full Text Available Abstract Background The molecular organization of very few genetically defined CACTA transposon systems have been characterized thoroughly as those of Spm/En in maize, Tam1 of Antirrhinum majus Candystripe1 (Cs1 from Sorghum bicolor and CAC1 from Arabidopsis thaliana, for example. To date, only defective deletion derivatives of CACTA elements have been described for soybean, an economically important plant species whose genome sequence will be completed in 2008. Results We identified a 20.5 kb insertion in a soybean flavonoid 3'-hydroxylase (F3'H gene representing the t* allele (stable gray trichome color whose origin traces to a single mutable chimeric plant displaying both tawny and gray trichomes. This 20.5 kb insertion has the molecular structure of a putative autonomous transposon of the CACTA family, designated Tgmt*. It encodes a large gene that was expressed in two sister isolines (T* and tm of the stable gray line (t* from which Tgmt* was isolated. RT-PCR derived cDNAs uncovered the structure of a large precursor mRNA as well as alternatively spliced transcripts reminiscent of the TNPA-mRNA generated by the En-1 element of maize but without sequence similarity to the maize TNPA. The larger mRNA encodes a transposase with a tnp2 and TNP1-transposase family domains. Because the two soybean lines expressing Tgmt* were derived from the same mutable chimeric plant that created the stable gray trichome t* allele line from which the element was isolated, Tgmt* has the potential to be an autonomous element that was rapidly inactivated in the stable gray trichome t* line. Comparison of Tgmt* to previously described Tgm elements demonstrated that two subtypes of CACTA transposon families exist in soybean based on divergence of their characteristic subterminal repeated motifs and their transposases. In addition, we report the sequence and annotation of a BAC clone containing the F3'H gene (T locus which was interrupted by the novel Tgmt* element

  7. Metabolic Effects of Intermittent Fasting.

    Science.gov (United States)

    Patterson, Ruth E; Sears, Dorothy D

    2017-08-21

    The objective of this review is to provide an overview of intermittent fasting regimens, summarize the evidence on the health benefits of intermittent fasting, and discuss physiological mechanisms by which intermittent fasting might lead to improved health outcomes. A MEDLINE search was performed using PubMed and the terms "intermittent fasting," "fasting," "time-restricted feeding," and "food timing." Modified fasting regimens appear to promote weight loss and may improve metabolic health. Several lines of evidence also support the hypothesis that eating patterns that reduce or eliminate nighttime eating and prolong nightly fasting intervals may result in sustained improvements in human health. Intermittent fasting regimens are hypothesized to influence metabolic regulation via effects on (a) circadian biology, (b) the gut microbiome, and (c) modifiable lifestyle behaviors, such as sleep. If proven to be efficacious, these eating regimens offer promising nonpharmacological approaches to improving health at the population level, with multiple public health benefits.

  8. Neighborhood fast food availability and fast food consumption.

    Science.gov (United States)

    Oexle, Nathalie; Barnes, Timothy L; Blake, Christine E; Bell, Bethany A; Liese, Angela D

    2015-09-01

    Recent nutritional and public health research has focused on how the availability of various types of food in a person's immediate area or neighborhood influences his or her food choices and eating habits. It has been theorized that people living in areas with a wealth of unhealthy fast-food options may show higher levels of fast-food consumption, a factor that often coincides with being overweight or obese. However, measuring food availability in a particular area is difficult to achieve consistently: there may be differences in the strict physical locations of food options as compared to how individuals perceive their personal food availability, and various studies may use either one or both of these measures. The aim of this study was to evaluate the association between weekly fast-food consumption and both a person's perceived availability of fast-food and an objective measure of fast-food presence - Geographic Information Systems (GIS) - within that person's neighborhood. A randomly selected population-based sample of eight counties in South Carolina was used to conduct a cross-sectional telephone survey assessing self-report fast-food consumption and perceived availability of fast food. GIS was used to determine the actual number of fast-food outlets within each participant's neighborhood. Using multinomial logistic regression analyses, we found that neither perceived availability nor GIS-based presence of fast-food was significantly associated with weekly fast-food consumption. Our findings indicate that availability might not be the dominant factor influencing fast-food consumption. We recommend using subjective availability measures and considering individual characteristics that could influence both perceived availability of fast food and its impact on fast-food consumption. If replicated, our findings suggest that interventions aimed at reducing fast-food consumption by limiting neighborhood fast-food availability might not be completely effective

  9. The Sclerotinia sclerotiorum Mating Type Locus (MAT) Contains a 3.6-kb Region That Is Inverted in Every Meiotic Generation

    Science.gov (United States)

    Maruthachalam, Karunakaran; Wu, Bo-Ming; Subbarao, Krishna V.

    2013-01-01

    Sclerotinia sclerotiorum is a fungal plant pathogen and the causal agent of lettuce drop, an economically important disease of California lettuce. The structure of the S. sclerotiorum mating type locus MAT has previously been reported and consists of two idiomorphs that are fused end-to-end as in other homothallics. We investigated the diversity of S. sclerotiorum MAT using a total of 283 isolates from multiple hosts and locations, and identified a novel MAT allele that differed by a 3.6-kb inversion and was designated Inv+, as opposed to the previously known S. sclerotiorum MAT that lacked the inversion and was Inv-. The inversion affected three of the four MAT genes: MAT1-2-1 and MAT1-2-4 were inverted and MAT1-1-1 was truncated at the 3’-end. Expression of MAT genes differed between Inv+ and Inv- isolates. In Inv+ isolates, only one of the three MAT1-2-1 transcript variants of Inv- isolates was detected, and the alpha1 domain of Inv+ MAT1-1-1 transcripts was truncated. Both Inv- and Inv+ isolates were self-fertile, and the inversion segregated in a 1∶1 ratio regardless of whether the parent was Inv- or Inv+. This suggested the involvement of a highly regulated process in maintaining equal proportions of Inv- and Inv+, likely associated with the sexual state. The MAT inversion region, defined as the 3.6-kb MAT inversion in Inv+ isolates and the homologous region of Inv- isolates, was flanked by a 250-bp inverted repeat on either side. The 250-bp inverted repeat was a partial MAT1-1-1 that through mediation of loop formation and crossing over, may be involved in the inversion process. Inv+ isolates were widespread, and in California and Nebraska constituted half of the isolates examined. We speculate that a similar inversion region may be involved in mating type switching in the filamentous ascomycetes Chromocrea spinulosa, Sclerotinia trifoliorum and in certain Ceratocystis species. PMID:23457637

  10. A Socio-Economic and Environmental Information Needs Knowledge Base (SEE-IN KB) in Support of SDG Implementation and Monitoring

    Science.gov (United States)

    Plag, H. P.; Jules-Plag, S.

    2016-12-01

    The UN Agenda 2030 has seventeen Sustainable Development Goals (SDGs) to be reach by 2030, which are detailed in 170 Targets. A monitioring framework of 240 SDG Indicators provides the metrics to measure progress towards these targets. The SDG Indicators are report cards for the progress towards the targets and a measure to assess potential impacts of policies and other means in support of SDG implementation. The Socio-Economic and Environmental Information Needs Knowledge Base (SEE-IN KB) collects information on objects such as user types, applications, observational requirements, a number of needs, societal goals and targets, indicators and indices, models, services, and datasets, as well as the interconnections between these objects, including links to Essential Variables (EVs). This enables gap analyses, prioritizations of Earth observations, and discovery of products and services meeting the information needs. "What if?" questions supports knowledge creation supporting the development of policies and activities to make progress towards the SDGs. Increasingly, user types, applications and requirements are linked to actual persons, models and datasets, respectively, and this allows both the social networking of providers and users and the execution of business processes. A core function of the SEE-IN KB is to facilitate the linkage of societal goals, targets, and indicators to EVs that need to be monitored in order to measure progress towards the targets. Applying a goal-based approach used to identify the EVs to the SDG Indicators revealed that some SDG Indicators require traditional Earth observations for quantification, while many of the EVs are related to the built environment. For many of the SDG Indicators, integration of socio-economic statistical data with environmental data, including in situ observations, is of importance. The goal-based approach was also applied to the SDG Targets, and this analysis showed that many of the Targets would benefit from

  11. Germination of red alder seed.

    Science.gov (United States)

    M.A. Radwan; D.S. DeBell

    1981-01-01

    Red alder seeds were collected from six locations throughout the natural range of the species. Each seed lot was obtained from a single tree, and the seeds were used to determine germination with and without stratification treatment. Irrespective of treatment, germination varied significantly (P

  12. Red light running camera assessment.

    Science.gov (United States)

    2011-04-01

    In the 2004-2007 period, the Mission Street SE and 25th Street SE intersection in Salem, Oregon showed relatively few crashes attributable to red light running (RLR) but, since a high number of RLR violations were observed, the intersection was ident...

  13. Red Teaming: Past and Present

    Science.gov (United States)

    2008-05-22

    cultural and ethnocentric bias, and a focus on fully exploring alternatives. The purpose of this monograph is to examine historical and...Planning and Orders Production, introduces red team principles into the army problem solving method.14 Additionally, TRADOC staffed and funded the...organization, incorporating alternative perspectives in an attempt to eliminate cultural and ethnocentric bias, and a focus on fully exploring

  14. The red-blue conundrum

    DEFF Research Database (Denmark)

    Nørtoft, Mikkel Johansen

    2017-01-01

    Plants from the Rubiaceae family (Rubia, Galium, and Asperula) are often grouped together as madder because they have been used for dyeing red since at least the Bronze Age. The English plant name madder can be traced through the Germanic language all the way back to Proto-Indo-European (PIE), as...

  15. Serum Lipid Profile: Fasting or Non-fasting?

    OpenAIRE

    Nigam, P. K.

    2010-01-01

    Serum lipid profile has now become almost a routine test. It is usually done in fasting state due to certain limitations in non-fasting serum sample. In the recent past efforts have been made to simplify blood sampling by replacing fasting lipid profile with non-fasting lipid profile. However, fasting specimen is preferred if cardiovascular risk assessment is based on total cholesterol, LDL cholesterol or non-HDL cholesterol. A lot has yet to be done in this area. Till then we have to believe...

  16. Hispanics in Fast Food Jobs.

    Science.gov (United States)

    Charner, Ivan; Fraser, Bryna Shore

    A study examined the employment of Hispanics in the fast-food industry. Data were obtained from a national survey of employees at 279 fast-food restaurants from seven companies in which 194 (4.2 percent) of the 4,660 respondents reported being Hispanic. Compared with the total sample, Hispanic fast-food employees were slightly less likely to be…

  17. Fast reactors: potential for power

    International Nuclear Information System (INIS)

    1983-02-01

    The subject is discussed as follows: basic facts about conventional and fast reactors; uranium economy; plutonium and fast reactors; cooling systems; sodium coolant; safety engineering; handling and recycling plutonium; safeguards; development of fast reactors in Britain and abroad; future progress. (U.K.)

  18. Structural analysis of phosphatidylinositol 4-kinase III beta (PI4KB) - 14-3-3 protein complex reveals internal flexibility and explains 14-3-3 mediated protection from degradation in vitro

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 200, č. 1 (2017), s. 36-44 ISSN 1047-8477 R&D Projects: GA ČR(CZ) GA17-05200S Institutional support: RVO:61388963 Keywords : lipid * kinase * PI4KB * 14-3-3 protein * phosphatidylinositol Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.767, year: 2016

  19. Rational design of novel highly potent and selective phosphatidylinositol 4-kinase III-beta (PI4KB) inhibitors as broad-spectrum antiviral agents and tools for chemical biology

    Czech Academy of Sciences Publication Activity Database

    Mejdrová, Ivana; Humpolíčková, Jana; Nencka, Radim; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 333 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR GJ15-21030Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : PI4KB * antivirals Subject RIV: CE - Biochemistry

  20. Comparative metagenomics of the Red Sea

    KAUST Repository

    Mineta, Katsuhiko

    2016-01-01

    started monthly samplings of the metagenomes in the Red Sea under KAUST-CCF project. In collaboration with Kitasato University, we also collected the metagenome data from the ocean in Japan, which shows contrasting features to the Red Sea. Therefore

  1. Nutrient Limitation in Central Red Sea Mangroves

    KAUST Repository

    Almahasheer, Hanan; Duarte, Carlos M.; Irigoien, Xabier

    2016-01-01

    Red Sea have characteristic heights of ~2 m, suggesting nutrient limitation. We assessed the nutrient status of mangrove stands in the Central Red Sea and conducted a fertilization experiment (N, P and Fe and various combinations thereof) on 4-week

  2. Identities of P2 and P3 Residues of H-2Kb-Bound Peptides Determine Mouse Ly49C Recognition.

    Directory of Open Access Journals (Sweden)

    Elsa A Marquez

    Full Text Available Ly49 receptors can be peptide selective in their recognition of MHC-I-peptide complexes, affording them a level of discrimination beyond detecting the presence or absence of specific MHC-I allele products. Despite this ability, little is understood regarding the properties that enable some peptides, when bound to MHC-I molecules, to support Ly49 recognition, but not others. Using RMA-S target cells expressing MHC-I molecules loaded with individual peptides and effector cells expressing the ectodomain of the inhibitory Ly49C receptor, we found that two adjacent amino acid residues, P2 and P3, both buried in the peptide binding groove of H-2Kb, determine mouse Ly49C specificity. If both are aliphatic residues, this is supportive. Whereas, small amino acids at P2 and aromatic amino acids at the P3 auxiliary anchor residue are detrimental to Ly49C recognition. These results resemble those with a rat Ly49 where the identity of a peptide anchor residue determines recognition, suggesting that dependence on specific peptide residues buried in the MHC-I peptide-binding groove may be fundamental to Ly49 peptide selectivity and recognition.

  3. Characterization of an Equine α-S2-Casein Variant Due to a 1.3 kb Deletion Spanning Two Coding Exons

    Science.gov (United States)

    Brinkmann, Julia; Koudelka, Tomas; Keppler, Julia K.; Tholey, Andreas; Schwarz, Karin; Thaller, Georg; Tetens, Jens

    2015-01-01

    The production and consumption of mare’s milk in Europe has gained importance, mainly based on positive health effects and a lower allergenic potential as compared to cows’ milk. The allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy species, much research has been conducted into the genetic variability of milk proteins, but the knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing from horse milk of mares with different genotypes. At the protein-level, we were able to show by SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually expressed. The comparison with published sequences of other equids revealed that the deletion has probably occurred before the ancestor of present-day asses and zebras diverged from the horse lineage. PMID:26444874

  4. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  5. Fifty Years in the Development of a Glutaminergic-Dopaminergic Optimization Complex (KB220) to Balance Brain Reward Circuitry in Reward Deficiency Syndrome: A Pictorial

    Science.gov (United States)

    Blum, K; Febo, M; Badgaiyan, RD

    2016-01-01

    Dopamine along with other chemical messengers like serotonin, cannabinoids, endorphins and glutamine, play significant roles in brain reward processing. There is a devastating opiate/opioid epidemicin the United States. According to the Centers for Disease Control and Prevention (CDC), at least 127 people, young and old, are dying every day due to narcotic overdose and alarmingly heroin overdose is on the rise. The Food and Drug Administration (FDA) has approved some Medication-Assisted Treatments (MATs) for alcoholism, opiate and nicotine dependence, but nothing for psychostimulant and cannabis abuse. While these pharmaceuticals are essential for the short-term induction of “psychological extinction,” in the long-term caution is necessary because their use favors blocking dopaminergic function indispensable for achieving normal satisfaction in life. The two institutions devoted to alcoholism and drug dependence (NIAAA & NIDA) realize that MATs are not optimal and continue to seek better treatment options. We review, herein, the history of the development of a glutaminergic-dopaminergic optimization complex called KB220 to provide for the possible eventual balancing of the brain reward system and the induction of “dopamine homeostasis.” This complex may provide substantial clinical benefit to the victims of Reward Deficiency Syndrome (RDS) and assist in recovery from iatrogenically induced addiction to unwanted opiates/opioids and other addictive behaviors. PMID:27840857

  6. A 590 kb deletion caused by non-allelic homologous recombination between two LINE-1 elements in a patient with mesomelia-synostosis syndrome.

    Science.gov (United States)

    Kohmoto, Tomohiro; Naruto, Takuya; Watanabe, Miki; Fujita, Yuji; Ujiro, Sae; Okamoto, Nana; Horikawa, Hideaki; Masuda, Kiyoshi; Imoto, Issei

    2017-04-01

    Mesomelia-synostoses syndrome (MSS) is a rare, autosomal-dominant, syndromal osteochondrodysplasia characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations due to a non-recurrent deletion at 8q13 that always encompasses two coding-genes, SULF1 and SLCO5A1. To date, five unrelated patients have been reported worldwide, and MMS was previously proposed to not be a genomic disorder associated with deletions recurring from non-allelic homologous recombination (NAHR) in at least two analyzed cases. We conducted targeted gene panel sequencing and subsequent array-based copy number analysis in an 11-year-old undiagnosed Japanese female patient with multiple congenital anomalies that included mesomelic limb shortening and detected a novel 590 Kb deletion at 8q13 encompassing the same gene set as reported previously, resulting in the diagnosis of MSS. Breakpoint sequences of the deleted region in our case demonstrated the first LINE-1s (L1s)-mediated unequal NAHR event utilizing two distant L1 elements as homology substrates in this disease, which may represent a novel causative mechanism of the 8q13 deletion, expanding the range of mechanisms involved in the chromosomal rearrangements responsible for MSS. © 2017 Wiley Periodicals, Inc.

  7. Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

    Science.gov (United States)

    Bai, Ying; Chen, Yibing; Kong, Xiangdong

    2018-02-02

    It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

  8. Fast reactors in nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Kazachkovskii, O

    1981-02-01

    The possible applications are discussed of fast reactor nuclear power plants. Basic differences are explained in fast and thermal reactors, mainly with a view to nuclear fuel utilization. Discussed in more detail are the problems of nuclear fuel reproduction and the nost important technical problems of fast reactors. Flow charts are shown of heat transfer for fast reactors BN-350 (loop design) and BN-600 (integral coolant circuit design). Main specifications are given for demonstration and power fast reactors in operation, under construction and in project-stage.

  9. Knowledge management in fast reactors

    International Nuclear Information System (INIS)

    Kuriakose, K.K.; Satya Murty, S.A.V.; Swaminathan, P.; Raj, Baldev

    2010-01-01

    This paper highlights the work that is being carried out in Knowledge Management of Fast Reactors at Indira Gandhi Centre for Atomic Research (IGCAR) including a few examples of how the knowledge acquired because of various incidents in the initial years has been utilized for the successful operation of Fast Breeder Test Reactor. It also briefly refers to the features of the IAEA initiative on the preservation of Knowledge in the area of Fast Reactors in the form of 'Fast Reactor Knowledge Organization System' (FR-KOS), which is based on a taxonomy for storage and mining of Fast Reactor Knowledge. (author)

  10. Computing the Dust Distribution in the Bow Shock of a Fast-moving, Evolved Star

    NARCIS (Netherlands)

    van Marle, A. -J; Meliani, Z.; Keppens, R.; Decin, L.

    2011-01-01

    We study the hydrodynamical behavior occurring in the turbulent interaction zone of a fast-moving red supergiant star, where the circumstellar and interstellar material collide. In this wind–interstellar-medium collision, the familiar bow shock, contact discontinuity, and wind termination shock

  11. Wood-plastic composites utilizing wood flours derived from fast- growing trees common to the midwest

    Science.gov (United States)

    There are several non- or under-utilized hardwood trees common to the Midwestern states. Wood flour (WF) derived from fast-growing Midwest trees (Osage orange, Black Locust and Red Mulberry) were evaluated as a source of bio-based fiber reinforcements. Wood plastic composites (WPC) of high density p...

  12. Fast photomultiplier ELUP 151

    International Nuclear Information System (INIS)

    Andreeva, L.I.; Belokon', V.A.; Krasin, E.V.

    1992-01-01

    High-velocity photomultiplier is described. The latter is recommended to be used in nuclear physics, plasma physics, nuclear medical diagnostics and at measurement of fast-occurring process parameters. Main specifications are as follows: range of spectral sensitivity - 0.2-0.7 μm; limit of dinamic characteristic linearity - up to 5A; dark current at +20 deg C ambient temperature - maximum 10-8A, time of anode pulse growth - maximum 8 ns; photocathode quantum yield in the maximum of spectral characteristic (λ max =380-420 nm) - 24-26%; supply voltage - 4-5 kV

  13. Fast neutron dosimetry

    International Nuclear Information System (INIS)

    DeLuca, P.M. Jr.; Pearson, D.W.

    1992-01-01

    This progress report concentrates on two major areas of dosimetry research: measurement of fast neutron kerma factors for several elements for monochromatic and white spectrum neutron fields and determination of the response of thermoluminescent phosphors to various ultra-soft X-ray energies and beta-rays. Dr. Zhixin Zhou from the Shanghai Institute of Radiation Medicine, People's Republic of China brought with him special expertise in the fabrication and use of ultra-thin TLD materials. Such materials are not available in the USA. The rather unique properties of these materials were investigated during this grant period

  14. The fast encryption package

    Science.gov (United States)

    Bishop, Matt

    1988-01-01

    The organization of some tools to help improve passwork security at a UNIX-based site is described along with how to install and use them. These tools and their associated library enable a site to force users to pick reasonably safe passwords (safe being site configurable) and to enable site management to try to crack existing passworks. The library contains various versions of a very fast implementation of the Data Encryption Standard and of the one-way encryption functions used to encryp the password.

  15. Fast breeder reactors

    International Nuclear Information System (INIS)

    Ollier, J.L.

    1987-01-01

    The first industrial-scale fast breeder reactor (FBR) is the Superphenix I at Crays-Melville. It was designed and built by Novatome, a French company, and Ansaldo, an Italian company. The advantages of FBRs are summarized. The status of Superphenix and the testing schedule is given. The stages in its power escalation in 1986 are given. The article is optimistic about the future for FBRs and expects FBRs to take over from PWRs at the beginning of the 21st Century. To achieve economic viability, European financial cooperation for the research and development programme is advocated. (UK)

  16. Sodium cooled fast reactor

    Energy Technology Data Exchange (ETDEWEB)

    Hokkyo, N; Inoue, K; Maeda, H

    1968-11-21

    In a sodium cooled fast neutron reactor, an ultrasonic generator is installed at a fuel assembly hold-down mechanism positioned above a blanket or fission gas reservoir located above the core. During operation of the reactor an ultrsonic wave of frequency 10/sup 3/ - 10/sup 4/ Hz is constantly transmitted to the core to resonantly inject the primary bubble with ultrasonic energy to thereby facilitate its growth. Hence, small bubbles grow gradually to prevent the sudden boiling of sodium if an accident occurs in the cooling system during operation of the reactor.

  17. Fast multichannel scaler

    International Nuclear Information System (INIS)

    Okayasu, T.; Takeuchi, S.; Nagai, S.

    1987-01-01

    A fast multichannel scaler achieving the minimum dwell time of 50 ns is described. The dead time due to memory cycle is eliminated by 4-phase operation of parallel-4 groups of counter RAMs. The MCS has 4 k channels in total. Differential nonlinearity is less than 0.4%. If an input pulse arrives near the channel boundary, it is caught temporarily for both channels and then sorted to go into a proper channel. Thus, the dead time near the channel boundary is also eliminated

  18. Red Assembly: the work remains

    Directory of Open Access Journals (Sweden)

    Leslie Witz

    Full Text Available This issue of Kronos is dedicated to Terry Flynn, assistant curator at the Ann Bryant Art Gallery, who was instrumental in the successful installing of 'Red Assembly' there in 2015. Friend, colleague, artist and inspiration. Hamba Kahle. The work that emerged from the encounter with Red, an art installation by Simon Gush and his collaborators, in the workshop 'Red Assembly', held in East London in August 2015, is assembled here in Kronos, the journal of southern African histories based at the University of the Western Cape, and previously in parallax, the cultural studies journal based at the University of Leeds published in May 2016. What is presented there and here is not simply more work, work that follows, or even additional works. Rather, it is the work that arises as a response to a question that structured our entire project: does Red, now also installed in these two journals, have the potential to call the discourse of history into question? This article responds to this question through several pairings: theft - gift; copy - rights; time - history; kronos - chronos. Here we identify a reversal in this installation of the gift into the commodity, and another with regard to conventional historical narratives which privilege the search for sources and origins. A difference between (the historian's search for origination and (the artist's originality becomes visible in a conversation between and over the historic and the artistic that does not simply try to rescue History by means of the work of art. It is in this sense that we invite the displacements, detours, and paths made possible through Simon Gush's Red, the 'Red Assembly' workshop and the work/gift of installation and parallaxing. To gesture beyond 'histories' is the provocation to which art is neither cause nor effect. Thinking with the work of art, that is, grasping thought in the working of art, has extended the sense of history's limit and the way the limit of history is

  19. Lineage II (Serovar 1/2a and 1/2c) Human Listeria monocytogenes Pulsed-Field Gel Electrophoresis Types Divided into PFGE Groups Using the Band Patterns Below 145.5 kb.

    Science.gov (United States)

    Lopez-Valladares, Gloria; Danielsson-Tham, Marie-Louise; Goering, Richard V; Tham, Wilhelm

    2017-01-01

    Among 504 clinical lineage II isolates of Listeria monocytogenes isolated during 1958-2010 in Sweden, 119 pulsed-field gel electrophoresis (PFGE) types (AscI) have been identified based on the number and distribution of all banding patterns in each DNA profile. In this study, these types were further divided into PFGE groups based on the configuration of small bands with sizes kb. The 504 isolates included 483 serovar 1/2a isolates distributed into 114 PFGE types and 21 serovar 1/2c isolates distributed into 9 PFGE types; these were further divided into 21 PFGE groups. PFGE group, that is, configuration of small bands below 145.5 kb, and serovars were correlated. L. monocytogenes isolates belonging to PFGE groups A, B, C, E, F, H, K, L, M, S, V, W, Y, and Ö-6 to Ö-12 shared serovar 1/2a, with one exception. PFGE group E also included two PFGE types sharing serovar 1/2c and four PFGE types belonging to either serovar 1/2a or 1/2c. Isolates belonging to PFGE group N shared serovar 1/2c. In contrast to lineage I isolates, small fragments kb were visible in all L. monocytogenes isolates belonging to lineage II. In the results from both the present and previous studies, the genomic region of small bands was genetically more conservative than in large bands. The distribution of these small bands established the relatedness of strains and defined a genetic marker for both lineages I and II, while also establishing their serogroup. The division of L. monocytogenes PFGE types into PFGE groups is advantageous as the profile of every new isolate can be identified easily and quickly through first studying the PFGE group affiliation of the isolate based on the smaller band patterns kb, and then identifying the PFGE type based on the band patterns >145.5 kb.

  20. Red alder: a state of knowledge.

    Science.gov (United States)

    Robert L. Deal; Constance A. Harrington

    2006-01-01

    In March 23-25, 2005, an international symposium on red alder was held at the University of Washington Center for Urban Horticulture in Seattle, WA. The symposium was entitled "Red alder: A State of Knowledge" and brought together regional experts to critically examine the economic, ecological and social values of red alder. The primary goal of the symposium...

  1. Red and green fluorescence from oral biofilms

    NARCIS (Netherlands)

    Volgenant, C.M.C.; Hoogenkamp, M.A.; Krom, B.P.; Janus, M.M.; ten Cate, J.M.; de Soet, J.J.; Crielaard, W.; van der Veen, M.H.

    2016-01-01

    Red and green autofluorescence have been observed from dental plaque after excitation by blue light. It has been suggested that this red fluorescence is related to caries and the cariogenic potential of dental plaque. Recently, it was suggested that red fluorescence may be related to gingivitis.

  2. N-Pyridineium-2-yl Darrow Red analogue: unique near-infrared lysosome-biomarker for the detection of cancer cells.

    Science.gov (United States)

    He, Dan-Dan; Liu, Wu; Sun, Ru; Fan, Chen; Xu, Yu-Jie; Ge, Jian-Feng

    2015-02-03

    The lysosome-targetable OFF-ON type pH sensor that does not emit at pH = 4.0 is adopted for the selective detection of cancer cells, and the acidity difference of lysosomes in cancer and normal cells is verified. Three pH probes based on Darrow Red derivatives were designed and prepared that were demonstrated to be lysosome-specific biomarkers with inducible emission at 580-850 nm by the comparable in cellular imaging assays using HeLa, KB, and V79 cells. Of these, a pyridineium-2-yl Darrow Red analogue with a pKa of 2.4 was found to be a lysosome tracker for cancer cells, it is a unique pH sensor for the optical identification and distinction of cancer cells from normal cells and has potential application as a fluorescent biomaker of cancer cells in in vitro assays.

  3. Fast delta Hadamard transform

    International Nuclear Information System (INIS)

    Fenimore, E.E.; Weston, G.S.

    1981-01-01

    In many fields (e.g., spectroscopy, imaging spectroscopy, photoacoustic imaging, coded aperture imaging) binary bit patterns known as m sequences are used to encode (by multiplexing) a series of measurements in order to obtain a larger throughput. The observed measurements must be decoded to obtain the desired spectrum (or image in the case of coded aperture imaging). Decoding in the past has used a technique called the fast Hadamard transform (FHT) whose chief advantage is that it can reduce the computational effort from N 2 multiplies of N log 2 N additions or subtractions. However, the FHT has the disadvantage that it does not readily allow one to sample more finely than the number of bits used in the m sequence. This can limit the obtainable resolution and cause confusion near the sample boundaries (phasing errors). Both 1-D and 2-D methods (called fast delta Hadamard transforms, FDHT) have been developed which overcome both of the above limitations. Applications of the FDHT are discussed in the context of Hadamard spectroscopy and coded aperture imaging with uniformly redundant arrays. Special emphasis has been placed on how the FDHT can unite techniques used by both of these fields into the same mathematical basis

  4. Fast Fourier transform telescope

    International Nuclear Information System (INIS)

    Tegmark, Max; Zaldarriaga, Matias

    2009-01-01

    We propose an all-digital telescope for 21 cm tomography, which combines key advantages of both single dishes and interferometers. The electric field is digitized by antennas on a rectangular grid, after which a series of fast Fourier transforms recovers simultaneous multifrequency images of up to half the sky. Thanks to Moore's law, the bandwidth up to which this is feasible has now reached about 1 GHz, and will likely continue doubling every couple of years. The main advantages over a single dish telescope are cost and orders of magnitude larger field-of-view, translating into dramatically better sensitivity for large-area surveys. The key advantages over traditional interferometers are cost (the correlator computational cost for an N-element array scales as Nlog 2 N rather than N 2 ) and a compact synthesized beam. We argue that 21 cm tomography could be an ideal first application of a very large fast Fourier transform telescope, which would provide both massive sensitivity improvements per dollar and mitigate the off-beam point source foreground problem with its clean beam. Another potentially interesting application is cosmic microwave background polarization.

  5. The integral fast reactor

    International Nuclear Information System (INIS)

    Till, C.E.

    1987-01-01

    On April 3rd, 1986, two dramatic demonstrations of the inherent capability of sodium-cooled fast reactors to survive unprotected loss of cooling accidents were carried out on the experimental sodium-cooled power reactor, EBR-II, on the Idaho site of Argonne National Laboratory. Transients potentially of the most serious kind, one an unprotected loss of flow, the other an unprotected loss of heat sink, both initiated from full power. In both cases the reactor quietly shut itself down, without damage of any kind. These tests were a part of the on-going development program at Argonne to develop an advanced reactor with significant new inherent safety characteristics. Called the Integral Fast Reactor, or IFR, the basic thrust is to develop everything that is needed for a complete nuclear power system - reactor, closed fuel cycle, and waste processing - as a single optimized entity, and, for simplicity in concept, as an integral part of a single plant. The particular selection of reactor materials emphasizes inherent safety characteristics and also makes possible a simplified closed fuel cycle and waste process improvements

  6. The integral fast reactor

    International Nuclear Information System (INIS)

    Till, C.E.

    1987-01-01

    On April 3rd, 1986, two demonstrations of the inherent capability of sodium-cooled fast reactors to survive unprotected loss of cooling accidents were carried out on the experimental sodium-cooled power reactor, EBR-II, on the Idaho site of Argonne National Laboratory. Transients potentially of the most serious kind, one an unprotected loss of flow, the other an unprotected loss of heat sink, both initiated from full power. In both cases the reactor quietly shut itself down, without damage of any kind. These tests were a part of the on-going development program at Argonne to develop an advanced reactor with significant new inherent safety characteristics. Called the integral fast reactor, or IFR, the basic thrust is to develop everything that is needed for a complete nuclear power system - reactor, closed fuel cycle, and waste processing - as a single optimized entity, and, for simplicity in concept, as an integral part of a single plant. The particular selection of reactor materials emphasizes inherent safety characteristics also makes possible a simplified close fuel cycle and waste process improvements. The paper describes the IFR concept, the inherent safety, tests, and status of IFR development today

  7. Diet-consumer nitrogen isotope fractionation for prolonged fasting arthropods.

    Science.gov (United States)

    Mizota, Chitoshi; Yamanaka, Toshiro

    2011-12-01

    Nitrogen acquisition for cellular metabolism during diapause is a primary concern for herbivorous arthropods. Analyses of naturally occurring stable isotopes of nitrogen help elucidate the mechanism. Relevant articles have cited (58 times up to mid-June 2011) anomalously elevated δ(15)N (per mil deviation of (15)N/(14)N, relative to atmospheric nitrogen=0 ‰) values (diet-consumer nitrogen isotope fractionation; up to 12 ‰) for a prolonged fasting raspberry beetle (Byturus tomentosus Degeer (Coleoptera: Byturidae)), which feeds on red raspberries (Rubus idaeus: δ(15)N= ~ +2 ‰). Biologists have hypothesised that extensive recycling of amino acid nitrogen is responsible for the prolonged fasting. Since this hypothesis was proposed in 1995, scientists have integrated biochemical and molecular knowledge to support the mechanism of prolonged diapausing of animals. To test the validity of the recycling hypothesis, we analysed tissue nitrogen isotope ratios for four Japanese arthropods: the shield bug Parastrachia japonensis Scott (Hemiptera: Cydnidae), the burrower bug Canthophorus niveimarginatus Scott (Hemiptera: Cydnidae), leaf beetle Gastrophysa atrocyanea Motschulsky (Coleoptera: Chrysomelidae) and the Japanese oak silkworm Antheraea yamamai (Lepidoptera: Saturniidae), all of which fast for more than 6 months as part of their life-history strategy. Resulting diet-consumer nitrogen isotope discrimination during fasting ranged from 0 to 7‰, as in many commonly known terrestrial arthropods. We conclude that prolonged fasting of arthropods does not always result in anomalous diet-consumer nitrogen isotope fractionation, since the recycling process is closed or nearly closed with respect to nitrogen isotopes.

  8. Software for fast cameras and image handling on MAST

    International Nuclear Information System (INIS)

    Shibaev, S.

    2008-01-01

    The rapid progress in fast imaging gives new opportunities for fusion research. The data obtained by fast cameras play an important and ever-increasing role in analysis and understanding of plasma phenomena. The fast cameras produce a huge amount of data which creates considerable problems for acquisition, analysis, and storage. We use a number of fast cameras on the Mega-Amp Spherical Tokamak (MAST). They cover several spectral ranges: broadband visible, infra-red and narrow band filtered for spectroscopic studies. These cameras are controlled by programs developed in-house. The programs provide full camera configuration and image acquisition in the MAST shot cycle. Despite the great variety of image sources, all images should be stored in a single format. This simplifies development of data handling tools and hence the data analysis. A universal file format has been developed for MAST images which supports storage in both raw and compressed forms, using either lossless or lossy compression. A number of access and conversion routines have been developed for all languages used on MAST. Two movie-style display tools have been developed-Windows native and Qt based for Linux. The camera control programs run as autonomous data acquisition units with full camera configuration set and stored locally. This allows easy porting of the code to other data acquisition systems. The software developed for MAST fast cameras has been adapted for several other tokamaks where it is in regular use

  9. Allergic reactions in red tattoos

    DEFF Research Database (Denmark)

    Hutton Carlsen, K; Køcks, M; Sepehri, M

    2016-01-01

    to be feasible for chemical analysis of red pigments in allergic reactions. Raman spectroscopy has a major potential for fingerprint screening of problematic tattoo pigments in situ in skin, ex vivo in skin biopsies and in tattoo ink stock products, thus, to eliminate unsafe ink products from markets.......AIM: The aim of this study was to assess the feasibility of Raman spectroscopy as a screening technique for chemical characterisation of tattoo pigments in pathologic reacting tattoos and tattoo ink stock products to depict unsafe pigments and metabolites of pigments. MATERIALS/METHODS: Twelve...... dermatome shave biopsies from allergic reactions in red tattoos were analysed with Raman spectroscopy (A 785-nm 300 mW diode laser). These were referenced to samples of 10 different standard tattoo ink stock products, three of these identified as the culprit inks used by the tattooist and thus by history...

  10. Red fox sightings in Rome

    Directory of Open Access Journals (Sweden)

    Bruno Cignini

    1997-12-01

    Full Text Available Abstract In this study preliminary data on the presence of Red fox in Rome (an area of 360 km² within the Rome ringroad. G.R.A. since 1980 are presented. The data were mapped on a UTM 1 sq. km. grid. Data were analysed and correlated, for each City district, with the prevalent environment (green, built-up, river-side areas and with the density of inhabitants.

  11. Resveratrol: Chemoprevention with red wine

    OpenAIRE

    Arısan, Elif Damla; Palavan-Ünsal, Narçin

    2007-01-01

    According to epidemiological studies, western diet has disadvantages because of cancer prevalence more than Mediterranean or Asia people who consume more vegetables and fruits. Resveratrol (trans-3,4,5-trihydroxystilbene) which is highly found in grapes, berries has received attention for its potential chemopreventive and antitumor effects in experimental systems. Because of high resveratrol content, researchers noted that red wine has multidimensional benefits for ...

  12. Islamic fasting and multiple sclerosis

    Science.gov (United States)

    2014-01-01

    Background Month-long daytime Ramadan fasting pose s major challenges to multiple sclerosis (MS) patients in Muslim countries. Physicians should have practical knowledge on the implications of fasting on MS. We present a summary of database searches (Cochrane Database of Systematic Reviews, PubMed) and a mini-symposium on Ramadan fasting and MS. In this symposium, we aimed to review the effect of fasting on MS and suggest practical guidelines on management. Discussion In general, fasting is possible for most stable patients. Appropriate amendment of drug regimens, careful monitoring of symptoms, as well as providing patients with available evidence on fasting and MS are important parts of management. Evidence from experimental studies suggests that calorie restriction before disease induction reduces inflammation and subsequent demyelination and attenuates disease severity. Fasting does not appear to have unfavorable effects on disease course in patients with mild disability (Expanded Disability Status Scale (EDSS) score ≤3). Most experts believed that during fasting (especially in summer), some MS symptoms (fatigue, fatigue perception, dizziness, spasticity, cognitive problems, weakness, vision, balance, gait) might worsen but return to normal levels during feasting. There was a general consensus that fasting is not safe for patients: on high doses of anti-convulsants, anti-spastics, and corticosteroids; with coagulopathy or active disease; during attacks; with EDSS score ≥7. Summary These data suggest that MS patients should have tailored care. Fasting in MS patients is a challenge that is directly associated with the spiritual belief of the patient. PMID:24655543

  13. Fast Food Jobs. National Study of Fast Food Employment.

    Science.gov (United States)

    Charner, Ivan; Fraser, Bryna Shore

    A study examined employment in the fast-food industry. The national survey collected data from employees at 279 fast-food restaurants from seven companies. Female employees outnumbered males by two to one. The ages of those fast-food employees in the survey sample ranged from 14 to 71, with fully 70 percent being in the 16- to 20-year-old age…

  14. Exploiting Semantic Search Methodologies to Analyse Fast Nuclear Reactor Nuclear Related Information

    International Nuclear Information System (INIS)

    Costantini, L.

    2016-01-01

    Full text: This paper describes an experiment to evaluate the outcomes of using the semantic search engine together with the entity extraction approach and the visualisation tools in large set of nuclear data related to fast nuclear reactors (FNR) documents originated from INIS database and the IAEA web publication. The INIS database has been used because is the larger collection of nuclear related data and a sub-set of it can be utilised to verify the efficiency and the effectiveness of this approach. In a nutshell, the goal of the study was to: 1) find and monitor documents dealing with FNR; 2) building knowledge base (KB) according to the FNR nuclear components and populate the KB with relevant documents; 3) communicate the conclusion of the analysis by utilising visualisation tools. The semantic search engine used in the case study has the capability to perform what is called evidential reasoning: accruing, weighing and evaluating the evidence to determinate a mathematical score for each article that measures its relevance to the subject of interest. This approach provides a means to differentiate between articles that closely meet the search criteria versus those less relevant articles. Tovek software platform was chosen for this case study. (author

  15. Materials analysis fast ions

    CERN Document Server

    Denker, A; Rauschenberg, J; Röhrich, J; Strub, E

    2006-01-01

    Materials analysis with ion beams exploits the interaction of ions with the electrons and nuclei in the sample. Among the vast variety of possible analytical techniques available with ion beams we will restrain to ion beam analysis with ion beams in the energy range from one to several MeV per mass unit. It is possible to use either the back-scattered projectiles (RBS – Rutherford Back Scattering) or the recoiled atoms itself (ERDA – Elastic Recoil Detection Analysis) from the elastic scattering processes. These techniques allow the simultaneous and absolute determination of stoichiometry and depth profiles of the detected elements. The interaction of the ions with the electrons in the sample produces holes in the inner electronic shells of the sample atoms, which recombine and emit X-rays characteristic for the element in question. Particle Induced X-ray Emission (PIXE) has shown to be a fast technique for the analysis of elements with an atomic number above 11.

  16. Fast multilevel radiative transfer

    International Nuclear Information System (INIS)

    Paletou, Frederic; Leger, Ludovick

    2007-01-01

    The vast majority of recent advances in the field of numerical radiative transfer relies on approximate operator methods better known in astrophysics as Accelerated Lambda-Iteration (ALI). A superior class of iterative schemes, in term of rates of convergence, such as Gauss-Seidel and successive overrelaxation methods were therefore quite naturally introduced in the field of radiative transfer by Trujillo Bueno and Fabiani Bendicho [A novel iterative scheme for the very fast and accurate solution of non-LTE radiative transfer problems. Astrophys J 1995;455:646]; it was thoroughly described for the non-LTE two-level atom case. We describe hereafter in details how such methods can be generalized when dealing with non-LTE unpolarised radiation transfer with multilevel atomic models, in monodimensional geometry

  17. Fast reactor programme

    International Nuclear Information System (INIS)

    Hoekstra, E.K.

    1976-11-01

    Estimated reactivity effects of fission products in the SNR-300 fast breeder are given. Neutron cross sections of 127 I and 129 I are also given. Results of the in-pile canning failure experiments on fuel pins R54-F35 and F39 are discussed. Sinter experiments using mixed UC-UN powders are reported. Results of tensile tests on high-dose and low-dose irradiated specimens of 18Cr1 1Ni stainless steel (DIN 1.4948) used in the SNR-300 reactor vessel are given. It is shown that the aerosol behaviour in condensing sodium vapour can be described by the same MADCA model developed for the decay of aerosols in condensing water vapour. Results of heat transfer measurements in the electrically heated 28-rod bundle under liquid-phase and subsequently under two-phase conditions are commented on

  18. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Till, C.E.

    1985-01-01

    During the past two years, scientists from Argonne have developed an advanced breeder reactor with a closed self contained fuel cycle. The Integral Fast Reactor (IFR) is a new reactor concept, adaptable to a variety of designs, that is based on a fuel cycle radically different from the CRBR line of breeder development. The essential features of the IFR are metal fuel, pool layout, and pyro- and electro-reprocessing in a facility integral with the reactor plant. The IFR shows promise to provide an inexhaustible, safe, economic, environmentally acceptable, and diversion resistant source of nuclear power. It shows potential for major improvement in all of the areas that have led to concern about nuclear power

  19. Dwarfism and Altered Craniofacial Development in Rabbits Is Caused by a 12.1 kb Deletion at the HMGA2 Locus.

    Science.gov (United States)

    Carneiro, Miguel; Hu, Dou; Archer, John; Feng, Chungang; Afonso, Sandra; Chen, Congying; Blanco-Aguiar, José A; Garreau, Hervé; Boucher, Samuel; Ferreira, Paula G; Ferrand, Nuno; Rubin, Carl-Johan; Andersson, Leif

    2017-02-01

    The dwarf phenotype characterizes the smallest of rabbit breeds and is governed largely by the effects of a single dwarfing allele with an incompletely dominant effect on growth. Dwarf rabbits typically weigh under 1 kg and have altered craniofacial morphology. The dwarf allele is recessive lethal and dwarf homozygotes die within a few days of birth. The dwarf phenotype is expressed in heterozygous individuals and rabbits from dwarf breeds homozygous for the wild-type allele are normal, although smaller when compared to other breeds. Here, we show that the dwarf allele constitutes a ∼12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene. HMGA2 has been frequently associated with variation in body size across species. Homozygotes for null alleles are viable in mice but not in rabbits and probably not in humans. RNA-sequencing analysis of rabbit embryos showed that very few genes (4-29 genes) were differentially expressed among the three HMGA2/dwarf genotypes, suggesting that dwarfism and inviability in rabbits are caused by modest changes in gene expression. Our results show that HMGA2 is critical for normal expression of IGF2BP2, which encodes an RNA-binding protein. Finally, we report a catalog of regions of elevated genetic differentiation between dwarf and normal-size rabbits, including LCORL-NCAPG, STC2, HOXD cluster, and IGF2BP2 Levels and patterns of genetic diversity at the LCORL-NCAPG locus further suggest that small size in dwarf breeds was enhanced by crosses with wild rabbits. Overall, our results imply that small size in dwarf rabbits results from a large effect, loss-of-function (LOF) mutation in HMGA2 combined with polygenic selection. Copyright © 2017 by the Genetics Society of America.

  20. Purification, gene cloning, and biochemical characterization of a β-glucosidase capable of hydrolyzing sesaminol triglucoside from Paenibacillus sp. KB0549.

    Directory of Open Access Journals (Sweden)

    Arun Nair

    Full Text Available The triglucoside of sesaminol, i.e., 2,6-O-di(β-D-glucopyranosyl-β-D- glucopyranosylsesaminol (STG, occurs abundantly in sesame seeds and sesame oil cake and serves as an inexpensive source for the industrial production of sesaminol, an anti-oxidant that displays a number of bioactivities beneficial to human health. However, STG has been shown to be highly resistant to the action of β-glucosidases, in part due to its branched-chain glycon structure, and these circumstances hampered the efficient utilization of STG. We found that a strain (KB0549 of the genus Paenibacillus produced a novel enzyme capable of efficiently hydrolyzing STG. This enzyme, termed PSTG, was a tetrameric protein consisting of identical subunits with an approximate molecular mass of 80 kDa. The PSTG gene was cloned on the basis of the partial amino acid sequences of the purified enzyme. Sequence comparison showed that the enzyme belonged to the glycoside hydrolase family 3, with significant similarities to the Paenibacillus glucocerebrosidase (63% identity and to Bgl3B of Thermotoga neapolitana (37% identity. The recombinant enzyme (rPSTG was highly specific for β-glucosidic linkage, and k cat and k cat/K m values for the rPSTG-catalyzed hydrolysis of p-nitrophenyl-β-glucopyraniside at 37°C and pH 6.5 were 44 s(-1 and 426 s(-1 mM(-1, respectively. The specificity analyses also revealed that the enzyme acted more efficiently on sophorose than on cellobiose and gentiobiose. Thus, rPSTG is the first example of a β-glucosidase with higher reactivity for β-1,2-glucosidic linkage than for β-1,4- and β-1,6-glucosidic linkages, as far as could be ascertained. This unique specificity is, at least in part, responsible for the enzyme's ability to efficiently decompose STG.

  1. Genetic mapping of the LOBED LEAF 1 (ClLL1) gene to a 127.6-kb region in watermelon (Citrullus lanatus L.).

    Science.gov (United States)

    Wei, Chunhua; Chen, Xiner; Wang, Zhongyuan; Liu, Qiyan; Li, Hao; Zhang, Yong; Ma, Jianxiang; Yang, Jianqiang; Zhang, Xian

    2017-01-01

    The lobed leaf character is a unique morphologic trait in crops, featuring many potential advantages for agricultural productivity. Although the majority of watermelon varieties feature lobed leaves, the genetic factors responsible for lobed leaf formation remain elusive. The F2:3 leaf shape segregating population offers the opportunity to study the underlying mechanism of lobed leaf formation in watermelon. Genetic analysis revealed that a single dominant allele (designated ClLL1) controlled the lobed leaf trait. A large-sized F3:4 population derived from F2:3 individuals was used to map ClLL1. A total of 5,966 reliable SNPs and indels were identified genome-wide via a combination of BSA and RNA-seq. Using the validated SNP and indel markers, the location of ClLL1 was narrowed down to a 127.6-kb region between markers W08314 and W07061, containing 23 putative ORFs. Expression analysis via qRT-PCR revealed differential expression patterns (fold-changes above 2-fold or below 0.5-fold) of three ORFs (ORF3, ORF11, and ORF18) between lobed and non-lobed leaf plants. Based on gene annotation and expression analysis, ORF18 (encoding an uncharacterized protein) and ORF22 (encoding a homeobox-leucine zipper-like protein) were considered as most likely candidate genes. Furthermore, sequence analysis revealed no polymorphisms in cDNA sequences of ORF18; however, two notable deletions were identified in ORF22. This study is the first report to map a leaf shape gene in watermelon and will facilitate cloning and functional characterization of ClLL1 in future studies.

  2. AISLAMIENTO DE CLONES CON ACTIVIDAD ENDO-b-1,4-GLUCANASA A PARTIR DE UN SEGMENTO DE ADN DE 13KB DE Clostridium sp IBUN22A

    Directory of Open Access Journals (Sweden)

    I. Roncancio-Sánchez

    2006-06-01

    Full Text Available La producción de combustibles, solventes y algunos productos químicos a partir de sustratos celulósicos usando microorganismos ofrece una ventaja frente a los de origen fósil. Un acercamiento prometedor ha sido la implementación de ingeniería genética utilizando genes de enzimas involucradas en la degradación de desechos celulósicos. En la última década se han generado bibliotecas genéticas para proveer enzimas celulolíticas, que hagan el proceso más rentable, lo cual permitiría aprovechar mejor residuos celulósicos disponibles. Este trabajo describe el aislamiento de dos fragmentos de ADN que expresan actividad endo-β-1,4-glucanasa, a partir de un segmento ADN de 13Kb (clon 02080-25 aislado de una biblioteca genómica de la cepa nativa Clostridium sp IBUN22A. El aislamiento de la región codificadora se realizó a través de pruebas de inducción de la actividad, análisis por restricción del segmento y de una sub-biblioteca con la enzima Sau3A I. 325 clones fueron obtenidos, de los cuales 271 tenían inserto. El tamizaje molecular de estos últimos mostró que siete clones presentaron tamaños entre 3500pb y 7000pb y el tamizaje enzimático con carboximetilcelulosa como sustrato permitió el aislamiento de los clones pBSh-37 y pBSh-26 con la actividad endo-β-1,4-glucanasa original, de tamaños de inserto de 627pb y 879pb respectivamente. Este trabajo es el punto de partida para el aislamiento de enzimas de alto potencial biotecnológico.

  3. Fast reactors and nonproliferation

    International Nuclear Information System (INIS)

    Orlov, V.V.

    1997-01-01

    1.Three aspects of nonproliferation relevant to nuclear power are: Pu buildup in NPP spent fuel cooling ponds (∼ 104 t in case of consumption of ∼ 107 t cheap uranium). Danger of illegal radiochemical extraction of Pu for weapons production; Pu extraction from NPP fuel at the plants available in nuclear countries, its burning along with weapon-grade Pu in NPP reactors or in special-purpose burners; increased hazard of nuclear weapons sprawl with breeders and closed fuel cycle technology spreading all over the world. 2.The latter is one of major obstacles to creation of large-scale nuclear power. 3.Nuclear power of the first stage using 235 U will be able to meet the demands of certain fuel-deficient countries and regions, replacing ∼ 5-10% of conventional fuels in the global consumption for a number of decades. 4.Fast reactors of the first generation and the currently employed fuel technology are far from exhausting their potential for solving economic problems and meeting the challenges of safety, radioactive waste and nonproliferation. Development of large-scale nuclear power will become an option accepted by society for solving energy problems in the following century, provided a breeder technology is elaborated and demonstrated in the next 15-20 years, which would comply with the totality of the following requirement: full internal Pu breeding deterministic elimination of severe accidents involving fuel damage and high radioactivity releases: fast runaway, loss of coolant, fires, steam and hydrogen explosions, etc.; reaching a balance between radioactive wastes disposed of and uranium mined in terms of radiation hazard; technology of closed fuel cycle preventing its use for Pu extraction and permitting physical protection from fuel thefts;economic competitiveness of nuclear power for most of countries and regions, i.e. primarily the cost of NPPs with fat reactors is to be below the cost of modern LWR plants, etc

  4. Development and improvement of measuring method for growth rate of intracellular symbiotic acid-fast bacteria using radioisotopes

    Energy Technology Data Exchange (ETDEWEB)

    Nakata, Noboru; Fukutomi, Yasuo [National Inst. for Leprosy Research, Higashimurayama, Tokyo (Japan)

    1997-02-01

    The aim of this research group was to investigate the factors which might mediate the growth of mycobacterium lepra and relate to its affinity to the nerve tissue. In this year, constructions of a mycobacterium smegmatis mutant having a high transform ability and a shuttle vector between E. coli and acid-fast bacteria was attempted. From the wild type of m. smegmatis, a highly transformable mutant was obtained and the rate of transformation of the mutant was ca. 10{sup 5} times higher than the parent. And two shuttle vectors for E. coli/acid-fast bacteria; pALKMZErO (6.2 kb) and pHSGM59 (5.4 kb) were constructed. Since the former was unstable in M. smegmatis, the latter vector was used for the following experiments. Expression of `cat` gene cloned by pHSGM59 was identified in M. smegmatis. Further, DNA library of M. leprae was prepared by the use of the vector. Approximately, 1 x 10{sup 4} transformed clones were obtained. The analysis of the plasmids recovered from the clones is under way. (M.N.)

  5. Development and improvement of measuring method for growth rate of intracellular symbiotic acid-fast bacteria using radioisotopes

    International Nuclear Information System (INIS)

    Nakata, Noboru; Fukutomi, Yasuo

    1997-01-01

    The aim of this research group was to investigate the factors which might mediate the growth of mycobacterium lepra and relate to its affinity to the nerve tissue. In this year, constructions of a mycobacterium smegmatis mutant having a high transform ability and a shuttle vector between E. coli and acid-fast bacteria was attempted. From the wild type of m. smegmatis, a highly transformable mutant was obtained and the rate of transformation of the mutant was ca. 10 5 times higher than the parent. And two shuttle vectors for E. coli/acid-fast bacteria; pALKMZErO (6.2 kb) and pHSGM59 (5.4 kb) were constructed. Since the former was unstable in M. smegmatis, the latter vector was used for the following experiments. Expression of 'cat' gene cloned by pHSGM59 was identified in M. smegmatis. Further, DNA library of M. leprae was prepared by the use of the vector. Approximately, 1 x 10 4 transformed clones were obtained. The analysis of the plasmids recovered from the clones is under way. (M.N.)

  6. Promotion and Fast Food Demand

    OpenAIRE

    Timothy J. Richards; Luis Padilla

    2009-01-01

    Many believe that fast food promotion is a significant cause of the obesity epidemic in North America. Industry members argue that promotion only reallocates brand shares and does not increase overall demand. We study the effect of fast food promotion on market share and total demand by estimating a discrete / continuous model of fast food restaurant choice and food expenditure that explicitly accounts for both spatial and temporal determinants of demand. Estimates are obtained using a unique...

  7. New fast reactor installation concept

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    The large size and complexity of fast reactor installations are emphasised and these difficulties will be increased with the advent of fast reactors of higher power. In this connection a new concept of fast reactor installation is described with a view to reducing the size of the installation and enabling most components, including even the primary vessel, to be constructed within the confines of a workshop. Full constructional details are given. (U.K.)

  8. Fast mixed spectrum reactor concept

    International Nuclear Information System (INIS)

    Kouts, H.J.C.; Fischer, G.J.; Cerbone, R.J.

    1979-04-01

    The Fast Mixed Spectrum Reactor is a highly promising concept for a fast reactor with improved features of proliferation resistance, and excellent utilization of uranium resources. In technology, it can be considered to be a branch of fast breeder development, though its operation and implications are different from those of FBR'S in important respects. Successful development programs are required in several areas to bring FMSR to reality, but the payoff from a successful program can be high

  9. Aerobic methanotrophic communities at the Red Sea brine-seawater interface

    Directory of Open Access Journals (Sweden)

    Rehab Z. Abdallah

    2014-09-01

    Full Text Available The central rift of the Red Sea contains 25 brine pools with different physicochemical conditions, dictating the diversity and abundance of the microbial community. Three of these pools, the Atlantis II, Kebrit and Discovery Deeps, are uniquely characterized by a high concentration of hydrocarbons. The brine-seawater interface, described as an anoxic-oxic (brine-seawater boundary, is characterized by a high methane concentration, thus favoring aerobic methane oxidation. The current study analyzed the aerobic free–living methane-oxidizing bacterial communities that potentially contribute to methane oxidation at the brine-seawater interfaces of the three aforementioned brine pools, using metagenomic pyrosequencing, 16S rRNA pyrotags and pmoA library constructs. The sequencing of 16S rRNA pyrotags revealed that these interfaces are characterized by high microbial community diversity. Signatures of aerobic methane-oxidizing bacteria were detected in the Atlantis II Interface (ATII-I and the Kebrit Deep Upper (KB-U and Lower (KB-L brine-seawater interfaces. Through phylogenetic analysis of pmoA, we further demonstrated that the ATII-I aerobic methanotroph community is highly diverse. We propose four ATII-I pmoA clusters. Most importantly, cluster 2 groups with marine methane seep methanotrophs, and cluster 4 represent a unique lineage of an uncultured bacterium with divergent alkane monooxygenases. Moreover, non-metric multidimensional scaling (NMDS based on the ordination of putative enzymes involved in methane metabolism showed that the Kebrit interface layers were distinct from the ATII-I and DD-I brine-seawater interfaces.

  10. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  11. Impact of Short-Term Intake of Red Wine and Grape Polyphenol Extract on the Human Metabolome

    NARCIS (Netherlands)

    Jacobs, D.M.; Fuhrmann, J.C.; Dorsten, van F.A.; Rein, D.; Peters, S.; Velzen, van E.J.J.; Hollebrands, B.; Draijer, R.; Duynhoven, van J.P.M.; Garczarek, U.

    2012-01-01

    Red wine and grape polyphenols are considered to promote cardiovascular health and are involved in multiple biological functions. Their overall impact on the human metabolome is not known. Therefore, exogenous and endogenous metabolic effects were determined in fasting plasma and 24 h urine from

  12. FastChem: An ultra-fast equilibrium chemistry

    Science.gov (United States)

    Kitzmann, Daniel; Stock, Joachim

    2018-04-01

    FastChem is an equilibrium chemistry code that calculates the chemical composition of the gas phase for given temperatures and pressures. Written in C++, it is based on a semi-analytic approach, and is optimized for extremely fast and accurate calculations.

  13. Influence of heating rate and temperature firing on the properties of bodies of red ceramic

    International Nuclear Information System (INIS)

    Silva, B.J. da; Goncalves, W.P.; Cartaxo, J.M.; Macedo, R.S.; Neves, G.A.; Santana, L.N.L.; Menezes, R.R.

    2011-01-01

    In the red ceramic industry, the firing is one of the main stages of the production process. There are two heating rates prevailing at this stage: the slow (traditional ceramics) and fast. The slow rate more used in Brazil, is considered delayed. This study aims to evaluate the influence of particle size and chemical composition of three mixture of clay, used in the manufacture of red ceramic products and to study the influence of the firing temperature on their technological properties. When subjected to heating rates slow and fast. Initially, the mixtures were characterized subsequently were extruded, dried and subjected to firing at temperatures of 900 and 1000 ° C with heating rates of 5, 20 and 30 °C/min. The results indicated that the chemical composition and particle size influenced significantly the technological properties and that the bodies obtained with the paste that had lower levels of flux showed better stability. (author)

  14. La red sobre trabajo infantil peligroso (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.

  15. Red giants: then and now

    Science.gov (United States)

    Faulkner, John

    Fred Hoyle's work on the structure and evolution of red giants, particularly his pathbreaking contribution with Martin Schwarzschild (Hoyle and Schwarzschild 1955), is both lauded and critically assessed. In his later lectures and work with students in the early 1960s, Hoyle presented more physical ways of understanding some of the approximations used, and results obtained, in that seminal paper. Although later ideas by other investigators will be touched upon, Hoyle's viewpoint - that low-mass red giants are essentially white dwarfs with a serious mass-storage problem - is still extremely fruitful. Over the years, I have further developed his method of attack. Relatively recently, I have been able to deepen and broaden the approach, finally extending the theory to provide a unifying treatment of the structure of low-mass stars from the main sequence though both the red-giant and horizontal-branch phases of evolution. Many aspects of these stars that had remained puzzling, even mysterious, for decades have now fallen into place, and some questions have been answered that were not even posed before. With low-mass red giants as the simplest example, this recent work emphasizes that stars, in general, may have at least two distinct but very important centres: (I) a geometrical centre, and (II) a separate nuclear centre, residing in a shell outside a zero-luminosity dense core for example. This two-centre perspective leads to an explicit, analytical, asymptotic theory of low-mass red-giant structure. It enables one to appreciate that the problem of understanding why such stars become red giants is one of anticipating a remarkable yet natural structural bifurcation that occurs in them. This bifurcation occurs because of a combination of known and understandable facts just summarized namely that, following central hydrogen exhaustion, a thin nuclear-burning shell does develop outside a more-or-less dense core. In the resulting theory, both ρsh/ρolinec and

  16. Iridotomy with red krypton laser.

    Science.gov (United States)

    Yassur, Y; David, R; Rosenblatt, I; Marmour, U

    1986-01-01

    Iridotomy with red krypton laser instead of blue-green argon laser was performed on 68 eyes with various types of angle-closure glaucoma. Patent iridotomy was obtained in all the eyes, mostly in one working session. In eight eyes secondary closure by pigment needed reopening with a few applications at the iridotomy site. There were no immediate or late complications of importance, the main advantage of the technique being the avoidance of the corneal epithelial and endothelial burns which commonly occur during argon laser iridotomy, particularly when the anterior chamber is shallow. PMID:3964628

  17. Fast pitch softball injuries.

    Science.gov (United States)

    Meyers, M C; Brown, B R; Bloom, J A

    2001-01-01

    The popularity of fast pitch softball in the US and throughout the world is well documented. Along with this popularity, there has been a concomitant increase in the number of injuries. Nearly 52% of cases qualify as major disabling injuries requiring 3 weeks or more of treatment and 2% require surgery. Interestingly, 75% of injuries occur during away games and approximately 31% of traumas occur during nonpositional and conditioning drills. Injuries range from contusions and tendinitis to ligamentous disorders and fractures. Although head and neck traumas account for 4 to 12% of cases, upper extremity traumas account for 23 to 47% of all injuries and up to 19% of cases involve the knee. Approximately 34 to 42% of injuries occur when the athlete collides with another individual or object. Other factors involved include the quality of playing surface, athlete's age and experience level, and the excessive physical demands associated with the sport. Nearly 24% of injuries involve base running and are due to poor judgement, sliding technique, current stationary base design, unorthodox joint and extremity position during ground impact and catching of cleats. The increasing prevalence of overtraining syndrome among athletes has been attributed to an unclear definition of an optimal training zone, poor communication between player and coach, and the limited ability of bone and connective tissue to quickly respond to match the demands of the sport. This has led routinely to arm, shoulder and lumbar instability, chronic nonsteroidal anti-inflammatory drug (NSAID) use and time loss injuries in 45% of pitching staff during a single season. Specific attention to a safer playing environment, coaching and player education, and sport-specific training and conditioning would reduce the risk, rate and severity of fast pitch traumas. Padding of walls, backstops, rails and dugout areas, as well as minimising use of indoor facilities, is suggested to decrease the number of collision

  18. LiTrack A Fast longitudinal phase space tracking code with graphical user interface

    CERN Document Server

    Emma, Paul

    2005-01-01

    Many linear accelerators, such as linac-based light sources and linear colliders, apply longitudinal phase space manipulations in their design, including electron bunch compression and wakefield-induced energy spread control. Several computer codes handle such issues, but most require detailed information on the transverse focusing lattice. In fact, in most linear accelerators, the transverse distributions do not significantly affect the longitudinal, and can be ignored initially. This allows the use of a fast 2D code to study longitudinal aspects without time-consuming considerations of the transverse focusing. LiTrack is based on a 15-year old code (same name) originally written by one of us (KB), which is now a MATLAB-based code with additional features, such as a graphical user interface and output plotting. The single-bunch tracking includes RF acceleration, bunch compression to 3rd order, geometric and resistive wakefields, aperture limits, synchrotron radiation, and flexible output plotting. The code w...

  19. Simultaneous determination of size and refractive index of red blood cells by light scattering measurements

    International Nuclear Information System (INIS)

    Ghosh, N.; Buddhiwant, P.; Uppal, A.; Majumder, S.K.; Patel, H.S.; Gupta, P.K.

    2006-01-01

    We present a fast and accurate approach for simultaneous determination of both the mean diameter and refractive index of a collection of red blood cells (RBCs). The approach uses the peak frequency of the power spectrum and the corresponding phase angle obtained by performing Fourier transform on the measured angular distribution of scattered light to determine these parameters. Results on the measurement of two important clinical parameters, the mean cell volume and mean cell hemoglobin concentration of a collection of RBCs, are presented

  20. Export of cyclic AMP by avian red cells and inhibition by prostaglandin A1

    International Nuclear Information System (INIS)

    Heasley, L.E.

    1985-01-01

    The mechanism by which PGA 1 inhibits cAMP export by avian red cells was studied, to provide details on the molecular mechanism of a prostaglandin action and on the process of cAMP export itself. The interaction of PGA 1 with pigeon red cells is a multi-step process of uptake, metabolism and secretion. [ 3 H]PGA rapidly enters red cells and is promptly metabolized (V/sub max/ ≥ 1 nmol/min/10 7 cells) to a compound (5) that remains in the aqueous layer after ethyl acetate extraction. Chromatographic analyses, amino acid content and fast atom bombardment mass spectrometry reveal that the polar metabolite is conjugated with glutathione (PGA 1 -GSH) at C-11 via a thioether bond and is largely (80%) reduced to the C-9 hydroxyl derivative

  1. [Quality management in a combined clinic - the quality management system according to DIN EN ISO 9001 of the The German Association of Spa Accommodation Resorts e. V. (VdKB)].

    Science.gov (United States)

    Eckert, H; Schulze, U

    2004-06-01

    The implementation of a quality system in health care organizations offers huge potentials for improvement and development. But the realization of such systems necessitates high investments, which small companies and family businesses often are unable to raise. The German Association of Spa Accommodation Resorts (VdKB) commissioned two consultants to develop a reasonably priced implementation concept of a DIN EN ISO 9001 quality system specially adjusted to small companies and family businesses in medical spa and rehabilitation services, which was successfully accredited in May 2003. This paper describes fundamental requirements in combine management systems, considers the pros and cons of management combines and demonstrates the practical realization of combine requirements on the example of the VdKB-combine system.

  2. Red is Romantic, but Only for Feminine Females: Sexual Dimorphism Moderates Red Effect on Sexual Attraction

    Directory of Open Access Journals (Sweden)

    Fangfang Wen

    2014-10-01

    Full Text Available Previous researchers have documented that the color red enhances one's sexual attraction to the opposite sex. The current study further examined the moderating role of sexual dimorphism in red effects. The results indicated that red enhanced men's sexual attraction to women with more feminine facial characteristics but had no effect on ratings of perceived general attractiveness. Red clothing also had a marginally significant effect on men's sexual attractiveness. In addition, regardless of sexual dimorphism cues, male participants rated women with red as warmer and more competent. The underlying mechanisms of the red effect, the limitations of the current study, and suggestions for future directions are discussed.

  3. Adsorption of procion red and congo red dyes using microalgae Spirulina sp

    Directory of Open Access Journals (Sweden)

    Risfidian Mohadi

    2017-10-01

    Full Text Available Adsorption of procion red and congo red dyes using microalgae Spirulina sp was conducted. Spirulina sp was obtained by cultivation and production in laboratory scale. Spirulina sp was used as adsorbent for adsorption of dyes. Adsorption process was studied by kinetic and thermodynamic in order to know the adsorption phenomena. The results showed that kinetically congo red is reactive than procion red on Spirulina sp. On the other hand, thermodynamically procion red was stable than congo red on Spirulina sp which was indicated by adsorption capacity, enthalpy, and entropy.

  4. The polarization of fast neutrons

    International Nuclear Information System (INIS)

    Talov, V.V.

    2000-01-01

    The present work is the review of polarization of fast neutrons and methods of polarization analysis. This also includes information about polarization of fast neutrons from first papers, which described polarization in the D(d,n) 3 He, 7 Li(p,n) 7 Be, and T(p,n) 3 He reactions. (authors)

  5. FastStats: Child Health

    Science.gov (United States)

    ... Women’s Health State and Territorial Data Reproductive Health Contraceptive Use Infertility Reproductive Health Notice Regarding FastStats Mobile ... table 6 [PDF – 2.7 MB] Related FastStats Adolescent Health ADHD Asthma Infant Health More data: reports ...

  6. Fast feedback in classroom practice

    NARCIS (Netherlands)

    Emmett, K.M.; Klaassen, K.; Eijkelhof, H.

    2009-01-01

    In this article we describe one application of the fast feedback method (see Berg 2003 Aust. Sci. Teach. J. 28–34) in secondary mechanics education. Two teachers tried out a particular sequence twice, in consecutive years, once with and once without the use of fast feedback. We found the method to

  7. Uranium and the fast reactor

    International Nuclear Information System (INIS)

    Price, T.

    1982-01-01

    The influence of uranium availability upon the future of the fast reactor is reviewed. The important issues considered are uranium reserves and resources, uranium market prices, fast reactor economics and the political availability of uranium to customers in other countries. (U.K.)

  8. Fasting and nonfasting lipid levels

    DEFF Research Database (Denmark)

    Langsted, Anne; Freiberg, Jacob J; Nordestgaard, Børge G

    2008-01-01

    Lipid profiles are usually measured after fasting. We tested the hypotheses that these levels change only minimally in response to normal food intake and that nonfasting levels predict cardiovascular events.......Lipid profiles are usually measured after fasting. We tested the hypotheses that these levels change only minimally in response to normal food intake and that nonfasting levels predict cardiovascular events....

  9. Oil Analysis by Fast DSC

    NARCIS (Netherlands)

    Wetten, I.A.; Herwaarden, A.W.; Splinter, R.; Ruth, van S.M.

    2014-01-01

    Thermal analysis of Olive and Sunflower Oil is done by Fast DSC to evaluate its potential to replace DSC for adulteration detection. DSC measurements take hours, Fast DSC minutes. Peak temperatures of the crystallisation peak in cooling for different Olive and Sunflower Oils are both comparable to

  10. The safety of fast reactors

    International Nuclear Information System (INIS)

    Justin, F.

    1976-01-01

    A response is made to the main questions that a man in the street may arise concerning fast breeder reactors, in particular: the advantages of this line, dangerous materials contained in fast breeder reactors, containment shells protecting the environment from radiations, main studies now in progress [fr

  11. Fast reactor programme

    International Nuclear Information System (INIS)

    Plakman, J.C.

    1981-06-01

    The accuracy requirements and the status of the evaluated fission-product cross sections for fast reactors are reviewed; the work on calculating the sensitivity of the sodium void effect to fission-product cross sections is described; some results of the intercomparison of adjusted data sets for capture cross sections of fission-products (RCN-2A and CARNAVAL-IV) are discussed; the applicability of the maximum-likelihood method for the analysis of resolved resonance parameters for a large class of fission-product nuclides is demonstrated; the neutron cross sections for corrosion product 64 Ni are evaluated. Some results of post-irradiation examination of a loss-of-cooling experiment are given; the progress in testing the equipment and instrumentation for transient-overpower experiments is reported. The proceedings in the thermochemical investigations on uranium compounds with some fission-products are described. The creep behaviour of a heat of DIN 1.4948 parent metal is investigated with respect to the changes in strain with different test temperatures. Sodium smoke aerosols have been produced and analysed with respect to their aerodynamic behaviour and morphology. The two-phase local boiling experiments have been analysed to find criteria for the occurrence of different boiling regimes with the objection to deduce general dryout correlations

  12. Fast ignition breakeven scaling

    International Nuclear Information System (INIS)

    Slutz, Stephen A.; Vesey, Roger Alan

    2005-01-01

    A series of numerical simulations have been performed to determine scaling laws for fast ignition break even of a hot spot formed by energetic particles created by a short pulse laser. Hot spot break even is defined to be when the fusion yield is equal to the total energy deposited in the hot spot through both the initial compression and the subsequent heating. In these simulations, only a small portion of a previously compressed mass of deuterium-tritium fuel is heated on a short time scale, i.e., the hot spot is tamped by the cold dense fuel which surrounds it. The hot spot tamping reduces the minimum energy required to obtain break even as compared to the situation where the entire fuel mass is heated, as was assumed in a previous study [S. A. Slutz, R. A. Vesey, I. Shoemaker, T. A. Mehlhorn, and K. Cochrane, Phys. Plasmas 7, 3483 (2004)]. The minimum energy required to obtain hot spot break even is given approximately by the scaling law E T = 7.5(ρ/100) -1.87 kJ for tamped hot spots, as compared to the previously reported scaling of E UT = 15.3(ρ/100) -1.5 kJ for untamped hotspots. The size of the compressed fuel mass and the focusability of the particles generated by the short pulse laser determines which scaling law to use for an experiment designed to achieve hot spot break even

  13. Fast liner proposal

    International Nuclear Information System (INIS)

    Sherwood, A.R.; Freeman, B.L.; Gerwin, R.A.; Jarboe, T.R.; Krakowski, R.A.; Malone, R.C.; Marshall, J.; Miller, R.L.; Suydam, B.

    1977-08-01

    This is a proposal to study, both theoretically and experimentally, the possibility of making a fusion reactor by magnetically imploding a cylindrical metallic shell on a prepared plasma. The approach is characterized by the following features: (1) the nonrotating liner would be driven by an axial current, (2) the plasma would also carry an axial current that provides an azimuthal magnetic field for thermal insulation in both the radial and longitudinal directions, (3) solid end plugs would be utilized to prevent axial loss of particles, and (4) liner speeds would be in the 10 6 cm/s range. The preliminary calculations indicate (1) that the energetics are favorable (energy inputs of about 10 MJ might produce a machine in the break-even regime), (2) that radiation and heat losses could be made tolerable, (3) that alpha-particle heating could be made very effective, and (4) that Taylor instabilities in a fast liner might be harmless because of the large viscosities at high pressures. A preliminary conceptual design of the sort of fusion reactor that might result from such an approach is discussed, as are some of the relevant reactor scaling arguments

  14. Fast reactor recharging device

    International Nuclear Information System (INIS)

    Artemiev, L.N.; Kurilkin, V.V.

    1979-01-01

    Disclosure is made of a device for recharging a fast-neutron reactor, intended for the transfer of fuel assemblies and rods of the control and safety system, having profiled heads to be gripped on the outside. The device comprises storage drums whose compartments for rods of the control and safety system are identical to compartments for fuel assemblies. In order to store and transport rods of the control and safety system from the storage drums to the recharging mechanism provision is made for sleeve-type holders. When placed in such a holder, the dimensions of a rod of the control and safety system are equal to those of a fuel assembly. To join a holder to a rod of the control and safety system, on the open end of each holder there is mounted a collet, whereas on the surface of each rod of the control and safety system, close to its head, there is provided an encircling groove to interact with the collet. The grip of the recharging mechanism is provided with a stop interacting with the collet in order to open the latter and withdraw the safety and control system rod from its holder

  15. The ATLAS Fast Tracker

    CERN Document Server

    Volpi, Guido; The ATLAS collaboration

    2015-01-01

    The use of tracking information at the trigger level in the LHC Run II period is crucial for the trigger an data acquisition (TDAQ) system. The tracking precision is in fact important to identify specific decay products of the Higgs boson or new phenomena, a well as to distinguish the contributions coming from many contemporary collisions that occur at every bunch crossing. However, the track reconstruction is among the most demanding tasks performed by the TDAQ computing farm; in fact, full reconstruction at full Level-1 trigger accept rate (100 KHz) is not possible. In order to overcome this limitation, the ATLAS experiment is planning the installation of a specific processor: the Fast Tracker (FTK), which is aimed at achieving this goal. The FTK is a pipeline of high performance electronic, based on custom and commercial devices, which is expected to reconstruct, with high resolution, the trajectories of charged tracks with a transverse momentum above 1 GeV, using the ATLAS inner tracker information. Patte...

  16. Fast breeder fuel cycle

    International Nuclear Information System (INIS)

    1978-07-01

    This contribution is prepared for the answer to the questionnaire of working group 5, subgroup B. B.1. is the short review of the fast breeder fuel cycles based on the reference large commercial Japanese LMFBR. The LMFBRs are devided into two types. FBR-A is the reactor to be used before 2000, and its burnup and breeding ratio are relatively low. The reference fuel cycle requirement is calculated based on the FBR-A. FBR-B is the one to be used after 2000, and its burnup and breeding ratio are relatively high. B.2. is basic FBR fuel reprocessing scheme emphasizing the differences with LWR reprocessing. This scheme is based on the conceptual design and research and development work on the small scale LMFBR reprocessing facility of Japan. The facility adopts a conventional PUREX process except head end portions. The report also describes the effects of technical modifications of conventional reprocessing flow sheets, and the problems to be solved before the adoption of these alternatives

  17. Fast Aerial Video Stitching

    Directory of Open Access Journals (Sweden)

    Jing Li

    2014-10-01

    Full Text Available The highly efficient and robust stitching of aerial video captured by unmanned aerial vehicles (UAVs is a challenging problem in the field of robot vision. Existing commercial image stitching systems have seen success with offline stitching tasks, but they cannot guarantee high-speed performance when dealing with online aerial video sequences. In this paper, we present a novel system which has an unique ability to stitch high-frame rate aerial video at a speed of 150 frames per second (FPS. In addition, rather than using a high-speed vision platform such as FPGA or CUDA, our system is running on a normal personal computer. To achieve this, after the careful comparison of the existing invariant features, we choose the FAST corner and binary descriptor for efficient feature extraction and representation, and present a spatial and temporal coherent filter to fuse the UAV motion information into the feature matching. The proposed filter can remove the majority of feature correspondence outliers and significantly increase the speed of robust feature matching by up to 20 times. To achieve a balance between robustness and efficiency, a dynamic key frame-based stitching framework is used to reduce the accumulation errors. Extensive experiments on challenging UAV datasets demonstrate that our approach can break through the speed limitation and generate an accurate stitching image for aerial video stitching tasks.

  18. Glucocorticoid-like activity of propylparaben, butylparaben, diethylhexyl phthalate and tetramethrin mixtures studied in the MDA-kb2 cell line.

    Science.gov (United States)

    Klopčič, Ivana; Kolšek, Katra; Dolenc, Marija Sollner

    2015-01-22

    Endocrine-disrupting compounds can interfere with the endocrine organs or hormone system and cause tumors, birth defects and developmental disorders in humans. The estrogen-like activity of compounds has been widely studied but little is known concerning their possible modulation of the glucocorticoid receptor. Steroidal (synthetic and natural) and non-steroidal endocrine-active compounds commonly occur as complex mixtures in human environments. Identification of such molecular species, which are responsible for modulating the glucocorticoid receptor are necessary to fully assess their risk. We have used the MDA-kb2 cell line, which expresses endogenous glucocorticoid receptor and a stably transfected luciferase reporter gene construct, to quantify the glucocorticoid-like activity of four compounds present in products in everyday use - propylparaben (PP), butylparaben (BP), diethylhexyl phthalate (DEHP) and tetramethrin (TM). We tested all possible combinations of these compounds at two concentrations (1 μM and 10 nM) and compared their glucocorticoid-like activity. At the concentration of 1 μM seven mixtures were identified to have glucocorticoid-like activity except: DEHP+TM, BP+TM, DEHP+PP+TM, BP+PP+TM. At the concentration of 10 nM only three mixtures have glucocorticoid modulatory activity: DEHP+PP, BP+PP, DEHP+BP+PP+TM. Identified glucocorticoid-like activities were between 1.25 and 1.51 fold at the concentration of 1 μM and between 1.23 and 1.44 fold at the concentration of 10 nM in comparison with the solvent control. Individually BP, PP, and DEHP had glucocorticoid-like activity of 1.60, 1.57 and 1.50 fold over the solvent control at the concentration of 1 μM. On the other hand PP and DEHP, at the concentration of 10nM, showed no glucocorticoid-like activity, while BP showed 1.44 fold. The assertion that individual glucocorticoid-like compounds do not produce harm because they are present at low, ineffective levels in humans may be irrelevant when we

  19. Antibacterial Compounds from Red Seaweeds (Rhodophyta)

    OpenAIRE

    Noer Kasanah; Triyanto Triyanto; Drajad Sarwo Seto; Windi Amelia; Alim Isnansetyo

    2015-01-01

    Seaweeds produce great variety of metabolites benefit for human. Red seaweeds (Rhodophyta) are well known as producer of phycocolloids such agar, agarose, carragenan and great variety of secondary metabolites. This review discusses the red algal secondary metabolites with antibacterial activity. The chemical constituents of red algae are steroid, terpenoid, acetogenin and dominated by halogenated compounds mainly brominated compounds. Novel compounds with intriguing skeleton are also reported...

  20. Radiosensitivity of red flour beetle tribolium castaneum

    International Nuclear Information System (INIS)

    Sattar, A.; Khattak, S.; Hamed, M.

    1992-07-01

    In this report radiosensitivity of red beetle has been discussed. Red flour beetle is the most injurious pest causing great losses to stored grain. Radiation is one of the best tools of insect control. Different radiation doses (50 to 200 krads) were employed for different age groups from 1 to 60 days. It is concluded from these results that 200 krad radiation dose caused 100% mortality in red beetle in all age group. (A.B.)

  1. Antibacterial Compounds from Red Seaweeds (Rhodophyta

    Directory of Open Access Journals (Sweden)

    Noer Kasanah

    2015-07-01

    Full Text Available Seaweeds produce great variety of metabolites benefit for human. Red seaweeds (Rhodophyta are well known as producer of phycocolloids such agar, agarose, carragenan and great variety of secondary metabolites. This review discusses the red algal secondary metabolites with antibacterial activity. The chemical constituents of red algae are steroid, terpenoid, acetogenin and dominated by halogenated compounds mainly brominated compounds. Novel compounds with intriguing skeleton are also reported such as bromophycolides and neurymenolides. In summary, red seaweeds are potential sources for antibacterial agents and can serve as lead in synthesis of new natural medicines.

  2. Infra Red 3D Computer Mouse

    DEFF Research Database (Denmark)

    Harbo, Anders La-Cour; Stoustrup, Jakob

    2000-01-01

    The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use of bandw......The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use...

  3. Rapid Determination of the Geographical Origin of Chinese Red Peppers (Zanthoxylum Bungeanum Maxim. Based on Sensory Characteristics and Chemometric Techniques

    Directory of Open Access Journals (Sweden)

    Xiangqian Yin

    2018-04-01

    Full Text Available In this paper, principal component analysis (PCA, linear discriminant analysis (LDAp, artificial neural networks (ANN, and support vector machine (SVM were applied to discriminate the geographical origin of Chinese red peppers (Zanthoxylum bungeanum Maxim.. The models based on color, smell and taste may discriminate quickly and effectively the geographical origin of Chinese red peppers from different regions, but the successful identification rates may vary with different kinds of parameters and chemometric methods. Among them, all models based on taste indexes showed an excellent ability to discriminate the geographical origin of Chinese red peppers with correct classifications of 100% for the training set and the 100% for test set. The present study provided a simple, efficient, inexpensive, practical and fast method to discriminate the geographical origin of Chinese red peppers from different regions, which was of great importance for both consumers and producers.

  4. Rapid Determination of the Geographical Origin of Chinese Red Peppers (Zanthoxylum Bungeanum Maxim.) Based on Sensory Characteristics and Chemometric Techniques.

    Science.gov (United States)

    Yin, Xiangqian; Xu, Xiaoxue; Zhang, Qiang; Xu, Jianguo

    2018-04-24

    In this paper, principal component analysis (PCA), linear discriminant analysis (LDAp, artificial neural networks (ANN), and support vector machine (SVM) were applied to discriminate the geographical origin of Chinese red peppers ( Zanthoxylum bungeanum Maxim.). The models based on color, smell and taste may discriminate quickly and effectively the geographical origin of Chinese red peppers from different regions, but the successful identification rates may vary with different kinds of parameters and chemometric methods. Among them, all models based on taste indexes showed an excellent ability to discriminate the geographical origin of Chinese red peppers with correct classifications of 100% for the training set and the 100% for test set. The present study provided a simple, efficient, inexpensive, practical and fast method to discriminate the geographical origin of Chinese red peppers from different regions, which was of great importance for both consumers and producers.

  5. Fast-prototyping of VLSI

    International Nuclear Information System (INIS)

    Saucier, G.; Read, E.

    1987-01-01

    Fast-prototyping will be a reality in the very near future if both straightforward design methods and fast manufacturing facilities are available. This book focuses, first, on the motivation for fast-prototyping. Economic aspects and market considerations are analysed by European and Japanese companies. In the second chapter, new design methods are identified, mainly for full custom circuits. Of course, silicon compilers play a key role and the introduction of artificial intelligence techniques sheds a new light on the subject. At present, fast-prototyping on gate arrays or on standard cells is the most conventional technique and the third chapter updates the state-of-the art in this area. The fourth chapter concentrates specifically on the e-beam direct-writing for submicron IC technologies. In the fifth chapter, a strategic point in fast-prototyping, namely the test problem is addressed. The design for testability and the interface to the test equipment are mandatory to fulfill the test requirement for fast-prototyping. Finally, the last chapter deals with the subject of education when many people complain about the lack of use of fast-prototyping in higher education for VLSI

  6. FAST MRI breast screening revisited

    International Nuclear Information System (INIS)

    Jain, Manish; Jain, Arushi; Hyzy, Marek D.; Werth, Graziella

    2017-01-01

    Screening for breast cancer in high-risk women takes about 40 minutes to acquire an MRI scan and is time-intensive to report. There is recent interest in the performance of an abbreviated MRI protocol (FAST) in the screening setting. FAST scans have a reported negative predictive value of 99.8%. This study evaluates the false positive rates (FPR) and recall rates for FAST scans as compared to full diagnostic studies (FD). A database of all screening breast MRI scans performed at our institution between 30 June 2013 and 1 July 2014 (n = 591) was created by one of the researchers, who did not subsequently analyse the MRI scans. The T1W and first post-contrast and subtracted images from each of these scans (FAST protocol) were assessed by experienced breast MRI radiologists, blinded to the final diagnosis. The findings were then compared with the FD result. The recall rates were 6.6% for FAST scans and 5.8% for FD scans. FPR rates were 4.7% and 3.9% respectively. There is no statistically significant difference in the recall rates or FPR of FAST scans in comparison with full diagnostic studies. Given the absence of statistically significant difference in the FPR and recall rates in comparison with FD, FAST scans can replace FD for screening of breast cancer.

  7. Fast food: unfriendly and unhealthy.

    Science.gov (United States)

    Stender, S; Dyerberg, J; Astrup, A

    2007-06-01

    Although nutrition experts might be able to navigate the menus of fast-food restaurant chains, and based on the nutritional information, compose apparently 'healthy' meals, there are still many reasons why frequent fast-food consumption at most chains is unhealthy and contributes to weight gain, obesity, type 2 diabetes and coronary artery disease. Fast food generally has a high-energy density, which, together with large portion sizes, induces over consumption of calories. In addition, we have found it to be a myth that the typical fast-food meal is the same worldwide. Chemical analyses of 74 samples of fast-food menus consisting of French fries and fried chicken (nuggets/hot wings) bought in McDonalds and KFC outlets in 35 countries in 2005-2006 showed that the total fat content of the same menu varies from 41 to 65 g at McDonalds and from 42 to 74 g at KFC. In addition, fast food from major chains in most countries still contains unacceptably high levels of industrially produced trans-fatty acids (IP-TFA). IP-TFA have powerful biological effects and may contribute to increased weight gain, abdominal obesity, type 2 diabetes and coronary artery disease. The food quality and portion size need to be improved before it is safe to eat frequently at most fast-food chains.

  8. Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

    Directory of Open Access Journals (Sweden)

    Mourad, Kacem

    2007-06-01

    Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

  9. Faktor-faktor yang Berhubungan Dengan Unmet Need KB Pasca-Salin IUD post-placenta di Kamar Rawat Pasca-bersalin RSUP DR. M. Djamil periode Januari-Maret 2013

    Directory of Open Access Journals (Sweden)

    Sari Handayani Utami

    2013-09-01

    Full Text Available AbstrakWanita pada periode post-partum memiliki angka unmet need terhadap kontrasepsi, padahal ini waktu yang tepat untuk mulai memakai kontrasepsi. Salah satu kontrasepsi pasca-salin terkini yang mulai disosialisasikan adalah IUD post-placenta. Namun demikian, masih belum banyak wanita pasangan usia subur yang menggunakan alat kontrasepsi ini bahkan mengetahuinya. Tujuan dari penelitian ini adalah untuk mengetahui faktor-faktor yang berhubungan dengan unmet need KB pasca-salin IUD post-placenta. Jenis penelitian survey dengan desain cross sectional study. Waktu pengambilan data dari 12 Januari sampai dengan 12 Maret 2013. Sampel adalah wanita pasangan usia subur yang melahirkan pervaginam dan dipilih secara accidental sampling. Penelitian dilakukan pada 88 orang responden dengan 50 orang bukan akseptor KB IUD post-placenta dan 38 orang akseptor KB IUD Post-placenta. Pengumpulan data dilakukan menggunakan kuesioner melalui wawancara terpimpin. Data dianalisis secara univariat dan bivariat. Hasil penelitian menunjukkan faktor yang memiliki hubungan signifikan dengan unmet need IUD post-placenta adalah faktor pengetahuan (p value = 0,001, sedangkan faktor lain yang tidak memiliki hubungan signifikan adalah faktor pendidikan (p value = 0,222, faktor status ekonomi (p value = 1,000, dan faktor konseling KB (p value = 0,583.Kata kunci: faktor yang berhubungan, unmet need, KB pasca-salin, IUD post-placentaAbstractThe women in post-partum period have unmet need rate to contraception, whereas it’s approriate time to start using contraception. One of recent post-partum contraception method is IUD post-placenta. But, only a few women of fertile age couple use this contraception even has known it. The purpose of this study was to determine the factors associated to unmet need of post-partum contraception IUD post-placenta. This survey study with cross sectional design study. The data was collected from January 12 until March 12 2013. The subject were

  10. Irradiation treatment of textile dyes: Apollofix-red

    International Nuclear Information System (INIS)

    Wojnarovits, L.; Palfi, T.; Takacs, E.

    2004-01-01

    The UV-VIS absorption spectra of azo dyes in aqueous solutions strongly overlap with the spectra of intermediates produced in reaction with the intermediates of water radiolysis. This overlap complicates the investigation of reaction mechanisms. The paper describes a method for the separation of the two spectra on the example of Apollofix-Red, a triazine and H-acid containing dye. The reactivity of water radiolysis intermediates (e aq - , OH, H, O 2 /HO 2 ) with the dye is also discussed. The most intensive decolouration was found in the reaction of e aq - and H which is due to the fast reaction of these intermediates with the -N=N-azo group of the unreacted molecule and their slow reaction with the transformed molecules. (author)

  11. Fast reactor physics - an overview

    International Nuclear Information System (INIS)

    Lee, S.M.

    2004-01-01

    An introduction to the basic features of fast neutron reactors is made, highlighting the differences from the more conventional thermal neutron reactors. A discussion of important feedback reactivity mechanisms is given. Then an overview is presented of the methods of fast reactor physics, which play an important role in the successful design and operation of fast reactors. The methods are based on three main elements, namely (i) nuclear data bases, (ii) numerical methods and computer codes, and (iii) critical experiments. These elements are reviewed and the present status and future trends are summarized. (author)

  12. [Fast food promotes weight gain].

    Science.gov (United States)

    Stender, Steen; Dyerberg, Jørn; Astrup, Arne V

    2007-05-07

    The total amounts of fat in a fast food menu consisting of French fries and fried Chicken Nuggets from McDonald's and KFC, respectively, bought in 35 different countries vary from 41 to 71 gram. In most countries the menu contained unacceptably high amounts of industrially-produced trans fat which contributes to an increased risk of ischaemic heart disease, weight gain, abdominal fat accumulation and type 2 diabetes. The quality of the ingredients in fast food ought to be better and the size of the portions smaller and less energy-dense so that frequent fast food meals do not increase the risk of obesity and diseases among customers.

  13. The acute stress response of red porgy, Pagrus pagrus, kept on a red or white background

    NARCIS (Netherlands)

    Salm, A.L. van der; Pavlidis, M; Flik, G.; Wendelaar Bonga, S.E.

    2005-01-01

    The skin colour of red porgy, Pagrus pagrus, can be modified by exposure to different background colours. Red and white background colours brighten the dark skin colour that develops under common culture conditions in red porgy. To assess whether skin colour is also modified by aquaculture related

  14. When red means go : non-normative effects of red under sensation seeking

    NARCIS (Netherlands)

    Mehta, R.; Demmers, J.; van Dolen, W.M.; Weinberg, C.B.

    Although previous research has identified red as the color of compliance, the current work proposes that this effect of red may not hold under high sensation-seeking propensity conditions. It is argued that the color red has the capability to induce arousal, which in turn has been shown to enhance a

  15. Control of poultry red mites

    DEFF Research Database (Denmark)

    Kilpinen, Ole; Steenberg, Tove

    2008-01-01

    The poultry red mite (PRM), Dermanyssus gallinae, is the most important ectoparasite in European egg production. The mites hide in cracks and crevices in the near vicinity of the resting places of the birds, coming out to feed mainly during the night. Under favourable conditions the population can...... grow rapidly, leading to serious problems. Large mite populations may cause anaemia or even death to the poultry, but also in lower numbers mites may be a nuisance to the birds causing decreased egg production and egg quality. Furthermore, they may have the potential of acting as reservoir......-pathogenic fungi and desiccant dust. The dust is diatomaceous earth (of natural origin), synthetic silica products or combinations of the two. The progress of the work with desiccant dusts will be reported. So far, 7 different products have been tested in the laboratory with regard to their efficacy, speed...

  16. Nitrogen depletion in field red giants

    DEFF Research Database (Denmark)

    Masseron, T.; Lagarde, N.; Miglio, A.

    2017-01-01

    , the behaviour of nitrogen data along the evolution confirms the existence of non-canonical extramixing on the red giant branch (RGB) for all low-mass stars in the field. But more surprisingly, the data indicate that nitrogen has been depleted between the RGB tip and the red clump. This may suggest that some...

  17. Mycobacterium bovis Infection of Red Fox, France.

    Science.gov (United States)

    Michelet, Lorraine; De Cruz, Krystel; Hénault, Sylvie; Tambosco, Jennifer; Richomme, Céline; Réveillaud, Édouard; Gares, Hélène; Moyen, Jean-Louis; Boschiroli, María Laura

    2018-06-01

    Mycobacterium bovis infection in wild red foxes was found in southern France, where livestock and other wildlife species are infected. Foxes frequently interact with cattle but have been underestimated as a reservoir of M. bovis. Our results suggest a possible role of the red fox in the epidemiology of bovine tuberculosis.

  18. Red blood cell alloimmunization after blood transfusion

    NARCIS (Netherlands)

    Schonewille, Henk

    2008-01-01

    Current pretransfusion policy requires the patients’ serum to be tested for the presence of irregular red blood cell antibodies. In case of an antibody, red blood cells lacking the corresponding antigen are transfused after an antiglobulin crossmatch. The aim of the studies in this thesis is

  19. Moving Forward with Computational Red Teaming

    Science.gov (United States)

    2012-07-01

    Red Teaming is used across both public and private sectors and is not the sole domain of the military. Red Team Consulting (2011) notes that “the use...open for review. Consider also the context of application. Oh (2009) explains how globalisation , the rise of emerging powers, environmental

  20. Seeing red to being red: conserved genetic mechanism for red cone oil droplets and co-option for red coloration in birds and turtles.

    Science.gov (United States)

    Twyman, Hanlu; Valenzuela, Nicole; Literman, Robert; Andersson, Staffan; Mundy, Nicholas I

    2016-08-17

    Avian ketocarotenoid pigments occur in both the red retinal oil droplets that contribute to colour vision and bright red coloration used in signalling. Turtles are the only other tetrapods with red retinal oil droplets, and some also display red carotenoid-based coloration. Recently, the CYP2J19 gene was strongly implicated in ketocarotenoid synthesis in birds. Here, we investigate CYP2J19 evolution in relation to colour vision and red coloration in reptiles using genomic and expression data. We show that turtles, but not crocodiles or lepidosaurs, possess a CYP2J19 orthologue, which arose via gene duplication before turtles and archosaurs split, and which is strongly and specifically expressed in the ketocarotenoid-containing retina and red integument. We infer that CYP2J19 initially functioned in colour vision in archelosaurs and conclude that red ketocarotenoid-based coloration evolved independently in birds and turtles via gene regulatory changes of CYP2J19 Our results suggest that red oil droplets contributed to colour vision in dinosaurs and pterosaurs. © 2016 The Author(s).

  1. Red Sea as a source for bioprospecting

    KAUST Repository

    Kodzius, Rimantas

    2015-01-01

    King-Abdullah University of Science and Technology (KAUST) is located on the shores of the Red Sea in Saudi Arabia. The Red Sea is well known for its unique environment, harboring various microbes capable of surviving in salty brines. We collected

  2. The Austrian x red pine hybrid

    Science.gov (United States)

    W. B. Critchfield

    1963-01-01

    The genetic improvement of red pine (Pinus resinosa Ait.) presents tree breeders with one of their most difficult problems. Not only is this valuable species remarkably uniform, but until 1955 it resisted all attempts to cross it with other pines. In that year red pine and Austrian pine (P. nigra var. austriaca [...

  3. Red Dirt Thinking on Aspiration and Success

    Science.gov (United States)

    Osborne, Sam; Guenther, John

    2013-01-01

    This article sets the scene for the series of five articles on "red dirt thinking". It first introduces the idea behind red dirt thinking as opposed to "blue sky thinking". Both accept that there are any number of creative and expansive solutions and possibilities to identified challenges--in this case, the challenge of…

  4. Human Red Cells With Paroxysmal Nocturnal Haemoglobinuria ...

    African Journals Online (AJOL)

    The purified cells were used as hosts for the culture of P.falciparum in vitro. Results show that GPI-linked molecules on the red cell surface are not required for the efficient entry of the parasites, and that the PNH red cells are competent to sustain the growth of P.falciparum. Nigerian Quarterly Journal of Hospital Medicine Vol ...

  5. La red sobre trabajo infantil peligroso (Red Tip The hazardous child labor network (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.In the world, approximately 351.7 millions children between 5 and 17 years old work. Of them, 170,5 millions (48.5% work at the hazardous child labor forms. A high percentage is in agriculture, others in mines, manufactures, brick makers, predominantly in informal economy. The 138 Convention of ILO and the 182 Convention, define as hazardous child labor activities that can affect the health, safety and morality of the children. Studies on the children at work point out their particular susceptibility to some occupational risks, increasing the danger for their normal development and growth. "They are not little adults". The occupational health

  6. 21 CFR 640.10 - Red Blood Cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Red Blood Cells. 640.10 Section 640.10 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Red Blood Cells § 640.10 Red Blood Cells. The proper name of this product shall be Red Blood Cells. The product is defined as red blood cells remaining...

  7. White dwarf-red dwarf binaries in the Galaxy

    NARCIS (Netherlands)

    Besselaar, E.J.M. van den

    2007-01-01

    This PhD thesis shows several studies on white dwarf - red dwarf binaries. White dwarfs are the end products of most stars and red dwarfs are normal hydrogen burning low-mass stars. White dwarf - red dwarf binaries are both blue (white dwarf) and red (red dwarf). Together with the fact that they are

  8. FastStats: Contraceptive Use

    Science.gov (United States)

    ... Growth (data are for 2011-2015) Related FastStats Infertility Reproductive Health More data Condom Use During Sexual Intercourse Among Females and Males 15-44 in the United States [PDF – 430 ...

  9. Fast global sequence alignment technique

    KAUST Repository

    Bonny, Mohamed Talal; Salama, Khaled N.

    2011-01-01

    fast alignment algorithm, called 'Alignment By Scanning' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the 'GAP' (which is heuristic) and the 'Needleman

  10. Allegheny County Fast Food Establishments

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The Allegheny County Health Department has generated this list of fast food restaurants by exporting all chain restaurants without an alcohol permit from the...

  11. FastStats: Mental Health

    Science.gov (United States)

    ... Women’s Health State and Territorial Data Reproductive Health Contraceptive Use Infertility Reproductive Health Notice Regarding FastStats Mobile ... Use of Selected Nonmedication Mental Health Services by Adolescent Boys and Girls With Serious Emotional or Behavioral ...

  12. Fast neutron spectrometry and dosimetry

    International Nuclear Information System (INIS)

    Blaize, S.; Ailloud, J.; Mariani, J.; Millot, J.P.

    1958-01-01

    We have studied fast neutron spectrometry and dosimetry through the recoil protons they produce in hydrogenated samples. In spectrometric, we used nuclear emulsions, in dosimetric, we used polyethylene coated with zinc sulphide and placed before a photomultiplier. (author) [fr

  13. The Fast Theater Model (FATHM)

    National Research Council Canada - National Science Library

    Brown, Gerald G; Washburn, Alan R

    2002-01-01

    The Fast Theater Model (FATHM) is an aggregated joint theater combat model that fuses Air Force Air-to-Ground attack sortie optimization with Ground-to-Ground deterministic Lanchester fire-exchange battles using attrition rates...

  14. The price of fast fashion

    Science.gov (United States)

    2018-01-01

    The fashion industry has changed rapidly in recent years with the increased prevalence of fast fashion, impacting the environment. Efforts to green this polluting industry require action from businesses and consumers.

  15. FastStats: Body Measurements

    Science.gov (United States)

    ... this? Submit What's this? Submit Button NCHS Home Body Measurements Recommend on Facebook Tweet Share Compartir Data ... 7 MB] Related FastStats Obesity/Overweight Related Links Body Mass Index table CDC Growth Charts National Health ...

  16. Fast generation of dendritic cells

    DEFF Research Database (Denmark)

    Kvistborg, P; Bøgh, Marie; Pedersen, A W

    2009-01-01

    we have developed fast DC protocol by comparing two different fast DC protocols with SDDC. DC were evaluated by FACS analysis, and the optimal profile was considered: CD14(low), CD80(high), CD83(high), CD86(high), CCR7(high), HLA class I and II(high). FACS profiles were used as the selection criteria...... together with yield and morphology. Two fast DC protocols fulfilled these criteria and were selected for functional analysis. Our results demonstrate that DC generated within 5days or 48h are comparable with SDDC both phenotypically and functionally. However, we found that 48h DC were more susceptible than...... SDDC to the IL-10 inducing stimulus of TLR ligands (R848 and LPS). Thus to determine the clinical relevance of fast DC protocols in cancer settings, small phase I trials should be conducted monitoring regulatory T cells carefully....

  17. Contraband detection with fast neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Buffler, Andy E-mail: abuffler@science.uct.ac.za

    2004-11-01

    Recent terror events and the increase in the trade of illicit drugs have fuelled the exploration of the use of fast neutrons as probes for the detection of hidden contraband, especially explosives, in packages ranging in size from small mail items to cargo containers. The various approaches using fast neutrons for contraband detection, presently under development, are reviewed. The role that a neutron system might play in the non-intrusive interrogation of airline luggage is discussed.

  18. Review of fast reactor activities

    International Nuclear Information System (INIS)

    1982-01-01

    A description of some highlights of the activities performed by the Commission of the European Communities in the field of fast reactors is given. They fall into two categories: coordinating and harmonizing activities and research activities. The former are essentially performed in the frame of the Fast Reactor Coordinating Committee (FRCC), the latter in the Commission's Joint Research Center and to some extent under contract in research centers of the Member States

  19. From red giants to planetary nebulae

    International Nuclear Information System (INIS)

    Kwok, S.

    1982-01-01

    The transition from red giants to planetary nebulae is studied by comparing the spectral characteristics of red giant envelopes and planetary nebulae. Observational and theoretical evidence both suggest that remnants of red giant envelopes may still be present in planetary nebula systems and should have significant effects on their formation. The dynamical effects of the interaction of stellar winds from central stars of planetary nebulae with the remnant red giant envelopes are evaluated and the mechanism found to be capable of producing the observed masses and momenta of planetary nebulae. The observed mass-radii relation of planetary nebulae may also be best explained by the interacting winds model. The possibility that red giant mass loss, and therefore the production of planetary nebulae, is different between Population I and II systems is also discussed

  20. Red algae and their use in papermaking.

    Science.gov (United States)

    Seo, Yung-Bum; Lee, Youn-Woo; Lee, Chun-Han; You, Hack-Chul

    2010-04-01

    Gelidialian red algae, that contain rhizoidal filaments, except the family Gelidiellaceae were processed to make bleached pulps, which can be used as raw materials for papermaking. Red algae consist of rhizoidal filaments, cortical cells usually reddish in color, and medullary cells filled with mucilaginous carbohydrates. Red algae pulp consists of mostly rhizoidal filaments. Red algae pulp of high brightness can be produced by extracting mucilaginous carbohydrates after heating the algae in an aqueous medium and subsequently treating the extracted with bleaching chemicals. In this study, we prepared paper samples from bleached pulps obtained from two red algae species (Gelidium amansii and Gelidium corneum) and compared their properties to those of bleached wood chemical pulps. Copyright 2009 Elsevier Ltd. All rights reserved.

  1. Identified Natural Hazards May Cause Adverse Impact on Sustainability of Desalination Plants in Red Sea

    Science.gov (United States)

    Aburizaiza, O. S.; Zaigham, N. A.; Nayyar, Z. A.; Mahar, G. A.; Siddique, A.; Eusufi, S. N.

    2011-12-01

    The Red Sea and its surrounding countries have harsh arid climatic conditions where fast growth of the socio-economic activities and rapid change of lifestyle have caused tremendous stress on water to the level of acute crisis. To meet the water demands, the Red Sea countries have adopted seawater desalination giving priority against their land-based resources. Saudi Arabia is the largest desalinated-water producers in the Red Sea and has practically no adequate backup plan in case of sudden unforeseen emergency. Out of about 3.64 million m3/day, Saudi Arabia is alone being desalinated about 3.29 m3/day seawater from Red Sea and more projects are in progress. Present integrated research study has identified some of natural and anthropogenic hazards, which may be major threats to the quality of the seawater as well as to the desalination plants themselves. Results of present study reveal that the submarine complex morphologic features may cause the isolation of Red Sea from any of the open sea, the increase in the seismicity trends, the active volcanism causing unique longitudinal as well as transverse deformations of the axial trough particularly in the southern part of the Red Sea, the consistently generating enormous hot-brine tectonic-factory all along the deeper parts of the Red Sea rifting trough and other related issues. Considering the identified odd conditions, the total dependence on seawater desalination may not be worthwhile for sustainable water management strategy and consequent socio-economic developments in future. It is recommended that the priority should also be given mainly in three main disciplines to meet the future water challenges - one, developing reliable backup water management; second, alternate options for the supplementary resources of water; and third, the development and immediate implementation of the water-use conservation strategy plan.

  2. Upgrading ATLAS Fast Calorimeter Simulation

    CERN Document Server

    Heath, Matthew Peter; The ATLAS collaboration

    2017-01-01

    Producing the very large samples of simulated events required by many physics and performance studies with the ATLAS detector using the full GEANT4 detector simulation is highly CPU intensive. Fast simulation tools are a useful way of reducing CPU requirements when detailed detector simulations are not needed. During the LHC Run-1, a fast calorimeter simulation (FastCaloSim) was successfully used in ATLAS. FastCaloSim provides a simulation of the particle energy response at the calorimeter read-out cell level, taking into account the detailed particle shower shapes and the correlations between the energy depositions in the various calorimeter layers. It is interfaced to the standard ATLAS digitization and reconstruction software, and it can be tuned to data more easily than Geant4. Now an improved version of FastCaloSim is in development, incorporating the experience with the version used during Run-1. The new FastCaloSim aims to overcome some limitations of the first version by improving the description of s...

  3. Direct Fast-Neutron Detection

    International Nuclear Information System (INIS)

    DC Stromswold; AJ Peurrung; RR Hansen; PL Reeder

    2000-01-01

    Direct fast-neutron detection is the detection of fast neutrons before they are moderated to thermal energy. We have investigated two approaches for using proton-recoil in plastic scintillators to detect fast neutrons and distinguish them from gamma-ray interactions. Both approaches use the difference in travel speed between neutrons and gamma rays as the basis for separating the types of events. In the first method, we examined the pulses generated during scattering in a plastic scintillator to see if they provide a means for distinguishing fast-neutron events from gamma-ray events. The slower speed of neutrons compared to gamma rays results in the production of broader pulses when neutrons scatter several times within a plastic scintillator. In contrast, gamma-ray interactions should produce narrow pulses, even if multiple scattering takes place, because the time between successive scattering is small. Experiments using a fast scintillator confirmed the presence of broader pulses from neutrons than from gamma rays. However, the difference in pulse widths between neutrons and gamma rays using the best commercially available scintillators was not sufficiently large to provide a practical means for distinguishing fast neutrons and gamma rays on a pulse-by-pulse basis. A faster scintillator is needed, and that scintillator might become available in the literature. Results of the pulse-width studies were presented in a previous report (peurrung et al. 1998), and they are only summarized here

  4. Fast Calorimeter Simulation in ATLAS

    CERN Document Server

    Schaarschmidt, Jana; The ATLAS collaboration

    2017-01-01

    Producing the very large samples of simulated events required by many physics and performance studies with the ATLAS detector using the full GEANT4 detector simulation is highly CPU intensive. Fast simulation tools are a useful way of reducing CPU requirements when detailed detector simulations are not needed. During the LHC Run-1, a fast calorimeter simulation (FastCaloSim) was successfully used in ATLAS. FastCaloSim provides a simulation of the particle energy response at the calorimeter read-out cell level, taking into account the detailed particle shower shapes and the correlations between the energy depositions in the various calorimeter layers. It is interfaced to the standard ATLAS digitization and reconstruction software, and it can be tuned to data more easily than GEANT4. It is 500 times faster than full simulation in the calorimeter system. Now an improved version of FastCaloSim is in development, incorporating the experience with the version used during Run-1. The new FastCaloSim makes use of mach...

  5. Red to green or fast to slow? Infants' visual working memory for "just salient differences".

    Science.gov (United States)

    Kaldy, Zsuzsa; Blaser, Erik

    2013-01-01

    In this study, 6-month-old infants' visual working memory for a static feature (color) and a dynamic feature (rotational motion) was compared. Comparing infants' use of different features can only be done properly if experimental manipulations to those features are equally salient (Kaldy & Blaser, 2009; Kaldy, Blaser, & Leslie, 2006). The interdimensional salience mapping method was used to find two objects that each were one Just Salient Difference from a common baseline object (N = 16). These calibrated stimuli were then used in a subsequent two-alternative forced-choice preferential looking memory test (N = 28). Results showed that infants noted the color change, but not the equally salient change in rotation speed. © 2013 The Authors. Child Development © 2013 Society for Research in Child Development, Inc.

  6. Adsorption of C.I. Reactive Red 228 and Congo Red dye from aqueous solution by amino-functionalized Fe3O4 particles: kinetics, equilibrium, and thermodynamics.

    Science.gov (United States)

    Yan, Ting-guo; Wang, Li-Juan

    2014-01-01

    A magnetic adsorbent was synthesized by γ-aminopropyltriethoxysilane (APTES) modification of Fe(3)O(4) particles using a two-step process. Scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), X-ray photoelectron spectroscopy (XPS), and vibration sample magnetometry were used to characterize the obtained magnetic adsorbent. EDS and XPS showed that APTES polymer was successfully introduced onto the as-prepared Fe(3)O(4)/APTES particle surfaces. The saturation magnetization of the magnetic adsorbent was around 65 emu g(-1), which indicated that the dye can be removed fast and efficiently from aqueous solution with an external magnetic field. The maximum adsorption capacities of Fe(3)O(4)/APTES for C.I. Reactive Red 228 (RR 228) and Congo Red (CR) were 51.4 and 118.8 mg g(-1), respectively. The adsorption of C.I. Reactive Red 228 (RR 228) and Congo Red (CR) on Fe(3)O(4)/APTES particles corresponded well to the Langmuir model and the Freundlich model, respectively. The adsorption processes for RR 228 and CR followed the pseudo-second-order model. The Boyd's film-diffusion model showed that film diffusion also played a major role in the studied adsorption processes for both dyes. Thermodynamic study indicated that both of the adsorption processes of the two dyes are spontaneous exothermic.

  7. Red and Green Fluorescence from Oral Biofilms.

    Science.gov (United States)

    Volgenant, Catherine M C; Hoogenkamp, Michel A; Krom, Bastiaan P; Janus, Marleen M; Ten Cate, Jacob M; de Soet, Johannes J; Crielaard, Wim; van der Veen, Monique H

    2016-01-01

    Red and green autofluorescence have been observed from dental plaque after excitation by blue light. It has been suggested that this red fluorescence is related to caries and the cariogenic potential of dental plaque. Recently, it was suggested that red fluorescence may be related to gingivitis. Little is known about green fluorescence from biofilms. Therefore, we assessed the dynamics of red and green fluorescence in real-time during biofilm formation. In addition, the fluorescence patterns of biofilm formed from saliva of eight different donors are described under simulated gingivitis and caries conditions. Biofilm formation was analysed for 12 hours under flow conditions in a microfluidic BioFlux flow system with high performance microscopy using a camera to allow live cell imaging. For fluorescence images dedicated excitation and emission filters were used. Both green and red fluorescence were linearly related with the total biomass of the biofilms. All biofilms displayed to some extent green and red fluorescence, with higher red and green fluorescence intensities from biofilms grown in the presence of serum (gingivitis simulation) as compared to the sucrose grown biofilms (cariogenic simulation). Remarkably, cocci with long chain lengths, presumably streptococci, were observed in the biofilms. Green and red fluorescence were not found homogeneously distributed within the biofilms: highly fluorescent spots (both green and red) were visible throughout the biomass. An increase in red fluorescence from the in vitro biofilms appeared to be related to the clinical inflammatory response of the respective saliva donors, which was previously assessed during an in vivo period of performing no-oral hygiene. The BioFlux model proved to be a reliable model to assess biofilm fluorescence. With this model, a prediction can be made whether a patient will be prone to the development of gingivitis or caries.

  8. Red and Green Fluorescence from Oral Biofilms.

    Directory of Open Access Journals (Sweden)

    Catherine M C Volgenant

    Full Text Available Red and green autofluorescence have been observed from dental plaque after excitation by blue light. It has been suggested that this red fluorescence is related to caries and the cariogenic potential of dental plaque. Recently, it was suggested that red fluorescence may be related to gingivitis. Little is known about green fluorescence from biofilms. Therefore, we assessed the dynamics of red and green fluorescence in real-time during biofilm formation. In addition, the fluorescence patterns of biofilm formed from saliva of eight different donors are described under simulated gingivitis and caries conditions. Biofilm formation was analysed for 12 hours under flow conditions in a microfluidic BioFlux flow system with high performance microscopy using a camera to allow live cell imaging. For fluorescence images dedicated excitation and emission filters were used. Both green and red fluorescence were linearly related with the total biomass of the biofilms. All biofilms displayed to some extent green and red fluorescence, with higher red and green fluorescence intensities from biofilms grown in the presence of serum (gingivitis simulation as compared to the sucrose grown biofilms (cariogenic simulation. Remarkably, cocci with long chain lengths, presumably streptococci, were observed in the biofilms. Green and red fluorescence were not found homogeneously distributed within the biofilms: highly fluorescent spots (both green and red were visible throughout the biomass. An increase in red fluorescence from the in vitro biofilms appeared to be related to the clinical inflammatory response of the respective saliva donors, which was previously assessed during an in vivo period of performing no-oral hygiene. The BioFlux model proved to be a reliable model to assess biofilm fluorescence. With this model, a prediction can be made whether a patient will be prone to the development of gingivitis or caries.

  9. Red Misfits in the Sloan Digital Sky Survey: properties of star-forming red galaxies

    Science.gov (United States)

    Evans, Fraser A.; Parker, Laura C.; Roberts, Ian D.

    2018-06-01

    We study Red Misfits, a population of red, star-forming galaxies in the local Universe. We classify galaxies based on inclination-corrected optical colours and specific star formation rates derived from the Sloan Digital Sky Survey Data Release 7. Although the majority of blue galaxies are star-forming and most red galaxies exhibit little to no ongoing star formation, a small but significant population of galaxies (˜11 per cent at all stellar masses) are classified as red in colour yet actively star-forming. We explore a number of properties of these galaxies and demonstrate that Red Misfits are not simply dusty or highly inclined blue cloud galaxies or quiescent red galaxies with poorly constrained star formation. The proportion of Red Misfits is nearly independent of environment, and this population exhibits both intermediate morphologies and an enhanced likelihood of hosting an active galactic nucleus. We conclude that Red Misfits are a transition population, gradually quenching on their way to the red sequence and this quenching is dominated by internal processes rather than environmentally driven processes. We discuss the connection between Red Misfits and other transition galaxy populations, namely S0s, red spirals, and green valley galaxies.

  10. Fast reactor database. 2006 update

    International Nuclear Information System (INIS)

    2006-12-01

    Liquid metal cooled fast reactors (LMFRs) have been under development for about 50 years. Ten experimental fast reactors and six prototype and commercial size fast reactor plants have been constructed and operated. In many cases, the overall experience with LMFRs has been rather good, with the reactors themselves and also the various components showing remarkable performances, well in accordance with the design expectations. The fast reactor system has also been shown to have very attractive safety characteristics, resulting to a large extent from the fact that the fast reactor is a low pressure system with large thermal inertia and negative power and temperature coefficients. In addition to the LMFRs that have been constructed and operated, more than ten advanced LMFR projects have been developed, and the latest designs are now close to achieving economic competitivity with other reactor types. In the current world economic climate, the introduction of a new nuclear energy system based on the LMFR may not be considered by utilities as a near future option when compared to other potential power plants. However, there is a strong agreement between experts in the nuclear energy field that, for sustainability reasons, long term development of nuclear power as a part of the world's future energy mix will require the fast reactor technology, and that, given the decline in fast reactor development projects, data retrieval and knowledge preservation efforts in this area are of particular importance. This publication contains detailed design data and main operational data on experimental, prototype, demonstration, and commercial size LMFRs. Each LMFR plant is characterized by about 500 parameters: physics, thermohydraulics, thermomechanics, by design and technical data, and by relevant sketches. The focus is on practical issues that are useful to engineers, scientists, managers, university students and professors with complete technical information of a total of 37 LMFR

  11. FAST: An advanced code system for fast reactor transient analysis

    International Nuclear Information System (INIS)

    Mikityuk, Konstantin; Pelloni, Sandro; Coddington, Paul; Bubelis, Evaldas; Chawla, Rakesh

    2005-01-01

    One of the main goals of the FAST project at PSI is to establish a unique analytical code capability for the core and safety analysis of advanced critical (and sub-critical) fast-spectrum systems for a wide range of different coolants. Both static and transient core physics, as well as the behaviour and safety of the power plant as a whole, are studied. The paper discusses the structure of the code system, including the organisation of the interfaces and data exchange. Examples of validation and application of the individual programs, as well as of the complete code system, are provided using studies carried out within the context of designs for experimental accelerator-driven, fast-spectrum systems

  12. Reaching for the red planet

    Science.gov (United States)

    David, L

    1996-05-01

    The distant shores of Mars were reached by numerous U.S. and Russian spacecraft throughout the 1960s to mid 1970s. Nearly 20 years have passed since those successful missions which orbited and landed on the Martian surface. Two Soviet probes headed for the planet in July, 1988, but later failed. In August 1993, the U.S. Mars Observer suddenly went silent just three days before it was to enter orbit around the planet and was never heard from again. In late 1996, there will be renewed activity on the launch pads with three probes departing for the red planet: 1) The U.S. Mars Global Surveyor will be launched in November on a Delta II rocket and will orbit the planet for global mapping purposes; 2) Russia's Mars '96 mission, scheduled to fly in November on a Proton launcher, consists of an orbiter, two small stations which will land on the Martian surface, and two penetrators that will plow into the terrain; and finally, 3) a U.S. Discovery-class spacecraft, the Mars Pathfinder, has a December launch date atop a Delta II booster. The mission features a lander and a microrover that will travel short distances over Martian territory. These missions usher in a new phase of Mars exploration, setting the stage for an unprecedented volley of spacecraft that will orbit around, land on, drive across, and perhaps fly at low altitudes over the planet.

  13. A red-letter day !

    CERN Multimedia

    2008-01-01

    Today is a red-letter day for the LHC and CERN as a beam of protons has travelled around the LHC ring for the very first time! The start of LHC operation marks the end of a long period in which you have given your all, and this first particle beam circulating in the accelerator now paves the way for discoveries that will open up a whole new field of knowledge. The history of the LHC began in 1984 with a debate on the possible objectives of a future accelerator, based on the state of our knowledge at that time. The CERN Council then approved the single-stage construction of the LHC in 1996, giving the go-ahead for the work that has now reached completion. For the past twelve years, physicists, engineers and technicians from CERN and its associated institutes have been engaged in constructing the three pillars of the LHC: the accelerator (including the upgrade of the existing accelerator chain), the four experiments, and the computing ...

  14. Red Shifts and Existing Speculations

    Science.gov (United States)

    Aisenberg, Sol

    2009-03-01

    There are many current flaws, mysteries, and errors in the standard model of the universe - all based upon speculative interpretation of many excellent and verified observations. The most serious cause of some errors is the speculation about the meaning of the redshifts observed in the 1930s by Hubble. He ascribed the redshifts as due to ``an apparent Doppler effect''. This led to speculation that the remote stars were receding, and the universe was expanding -- although without observational proof of the actual receding velocity of the stars. The age of the universe, based upon the Hubble constant is pure speculation because of lack of velocity demonstration. The belief in expansion, the big bang, and of inflation should be reexamined. Also, the redshift cannot always be used as a distance measure, particularly for photons from quasars containing massive black holes that can reduce photon energy through gravitational attraction. If the linear Hubble constant is extrapolated to the most remote super novae and beyond, it would eventually require that the corresponding photon energy go to zero or become negative -- according to Hubble linear relationship. This should require a reexamination of the meaning of the red shift and the speculative consequences and give a model with fewer mysteries.

  15. Red Blood Cell Storage Lesion

    Directory of Open Access Journals (Sweden)

    Daryl J. Kor

    2009-10-01

    Full Text Available The past two decades have witnessed increased scrutiny regarding efficacy and risk of the once unquestioned therapy of red blood cell (RBC transfusion. Simultaneously, a variety of changes have been identified within the RBC and storage media during RBC preservation that are correlated with reduced tissue oxygenation and transfusion-associated adverse effects. These alterations are collectively termed the storage lesion and include extensive biochemical, biomechanical, and immunologic changes involving cells of diverse origin. Time-dependent falls is 2,3-diphosphoglycerate, intracellular RBC adenosine triphosphate, and nitric oxide have been shown to impact RBC deformability and delivery of oxygen to the end-organ. The accumulation of biologic response modifiers such as soluble CD40 ligand (sCD40L, lysophosphatidylcholine (lyso-PC, and Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES have been associated with altered recipient immune function as well. This review will address the alterations occurring within the RBC and storage media during RBC preservation and will address the potential clinical consequence thereof.

  16. Decadal Stability of Red Sea Mangroves

    KAUST Repository

    Almahasheer, Hanan; Aljowair, Abdulaziz; Duarte, Carlos M.; Irigoien, Xabier

    2015-01-01

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  17. Uptake of carnitine by red blood cells

    International Nuclear Information System (INIS)

    Campa, M.; Borum, P.

    1986-01-01

    A significant amount of blood carnitine (70% of cord blood and 40% of blood from healthy adults) is partitioned into the red blood cell compartment of whole blood. Data indicate that the plasma compartment and the red blood cell compartment of whole blood represent different metabolic pools of carnitine. There are no data to indicate that red blood cells synthesize carnitine, but our understanding of the uptake of carnitine by red blood cells is negligible. Red blood cells were obtained from healthy adults, washed twice with normal saline, and used for uptake experiments. When the cells were incubated at 37 0 C in the presence of 14 C-carnitine, radioactivity was found both in the soluble cytosolic and membrane fractions of the cells following lysis. The uptake was dependent upon the time of incubation, temperature of incubation, and carnitine concentration in the incubation medium. Washed red blood cell membranes incubated with 14 C-carnitine showed specific binding of radioactivity. These data are consistent with the hypothesis that red blood cells have an uptake mechanism for L-carnitine

  18. Decadal Stability of Red Sea Mangroves

    KAUST Repository

    Almahasheer, Hanan

    2015-12-15

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  19. A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

    Directory of Open Access Journals (Sweden)

    Jamie A. O'Rourke

    2013-06-01

    Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.

  20. Preoperative fasting time in children.

    LENUS (Irish Health Repository)

    Adeel, S

    2012-02-01

    The aim of preoperative fasting is to prevent regurgitation and pulmonary aspiration while limiting potential problems of thirst, dehydration and hypoglycaemia. The American Society of Anaesthesiologists (ASA) has suggested guidelines for preoperative fasting for children undergoing elective surgery. We did a postal survey to determine the current practice regarding these guidelines amongst all specialist registrars in anaesthesia in Ireland. A questionnaire was sent to all specialist registrars in anaesthesia (90 in total), 60 (67%) were returned and analysed. The question asked was how long children should be kept fasting before elective surgery. The results of our survey suggest that most of the respondents are following the ASA guidelines for clear fluids and solids however there were differing opinion regarding the duration of fasting for formula milk and breast milk. In conclusion, we would recommend greater awareness and collaboration between anaesthetists, nurses and surgeons to ensure that fasting instructions are consistent with the ASA guidelines and that patient and their parents understand these directives as well.